Oligonucleotides for detecting black rot fungus of leek and detection method using the same
The development of oligonucleotides and primer sets targeting conserved regions of the G3PDH, HSP60, and CaM genes enables accurate and sensitive detection of both group A and group B strains of the black rot fungus, overcoming the limitations of existing PCR methods and soil disinfection challenges.
Patent Information
- Application Number
- JP2022025868
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-02-22
- Filing Date
- 2022-02-22
- Publication Date
- 2025-09-29
- Estimated Expiration
- 2042-02-22
AI Technical Summary
Existing PCR primer sets for detecting black rot fungus of onions are ineffective in detecting group A strains and provide false negatives, and soil disinfection methods are costly and labor-intensive, necessitating a more efficient and accurate detection method for early-stage infestation.
Development of oligonucleotides and primer sets targeting conserved regions of the G3PDH, HSP60, and CaM genes in Sclerotium cepivorum, capable of detecting both group A and group B strains, and employing LAMP method for sensitive and rapid detection.
The method allows for accurate and sensitive detection of both group A and group B strains of the black rot fungus, distinguishing it from related species, with improved sensitivity and ease of differentiation from false positives, even in the presence of soil-derived inhibitors.
Smart Images

Figure 0007745203000005 
Figure 0007745203000006 
Figure 0007745203000007
Abstract
Description
[Technical Field]
[0001] The present invention relates to the detection of pathogens of agricultural crops by PCR. [Background technology]
[0002] Welsh onions are cultivated throughout Japan. The main production areas are Saitama, Chiba, Ibaraki, and Gunma prefectures. White onions (long onions and deep-rooted onions) are typically cultivated as "autumn / winter onions" or "spring harvest onions" and shipped from autumn to spring. In recent years, the damage caused by black rot of onions has been increasing. This disease infects the roots from sclerotia of the pathogenic fungus remaining in the soil, then spreads to the stalk and leaf sheath (the edible part of the white onion), and then spreads to neighboring plants. Early onset of the disease causes root rot, resulting in stunted growth and tsubo wilting. Even if the onion survives until harvest, soil mulching (which involves burying the soil up to the bifurcation of the leaf blade to maintain a soft, white leaf sheath) can cause the leaf sheath and stalk to rot and brown. Soil disinfection to inactivate sclerotia in the soil is considered an effective method of controlling black rot of onions.
[0003] The causal agent of this disease is a filamentous fungus (Sclerotium cepivorum, the black rot fungus of leeks) that prefers low temperatures (soil temperatures below 20°C). Therefore, in the case of "autumn-winter leeks" cultivation, infection and disease progress in the soil during the autumn and winter when hilling is performed, making timely control extremely difficult. Furthermore, sclerotia remaining in the soil after harvest can become a source of infection for the next crop, resulting in rapid damage throughout the field within two to three years of the initial outbreak.
[0004] Traditionally, diagnosis and identification of black rot disease in onion involves visual inspection, whereby stunted or dead plants are removed from the field and the condition of the roots and symptoms (black discoloration, presence or absence of sclerotia) are observed. Subsequently, sclerotia formed on infected plants (mainly in the leaf sheaths) are cultured for 2 to 4 weeks, and a definitive diagnosis is made based on cultural characteristics (hyphal growth rate, color and shape of the mycelium) and the appearance of sclerotial formation on the medium. Haq et al. designed PCR primers to amplify the 5.8S rRNA gene and a portion of the nearby ITS region from Sclerotium cepivorum, the causative agent of black rot disease in onion, and provided this as a method for confirming the presence of this bacterium in onions at the early stage of infection (Non-Patent Document 1). Woodhall et al. developed real-time PCR primers targeting the ITS region to detect sclerotia from large amounts of soil (Non-Patent Document 2) and stated that this method is suitable for quantifying the level of Sclerotium cepivorum in soil samples. developed nested PCR primers for highly sensitive detection of domestic outbreak strains (Shizuoka Prefecture) (Non-Patent Document 3). Amselem et al. sequenced the genomes of one strain of Sclerotinia sclerotiorum, a closely related ascomycete fungus to the black rot fungus of leeks, and two strains of Botrytis cinerea, the cause of gray mold, and constructed a phylogenetic tree of five gene loci, including glyceraldehyde-3-phosphate (G3PDH) and heat shock protein 60 (HSP60) (Non-Patent Document 4).
[0005] Regarding the sclerotia of Sclerotium cepivorum, Morikawa et al. reported that there are two types of sclerotial formation on culture media (Non-Patent Document 5). Furthermore, the present inventors performed molecular phylogenetic analysis of HSP60, G3PDH, and calmodulin for Sclerotium cepivorum strains classified into two groups, A and B, based on morphological characteristics, and reported that the results of the molecular phylogenetic analysis were consistent with those of the morphologically classified groups, A and B (Non-Patent Document 6). [Prior art documents] [Non-patent literature]
[0006] [Non-Patent Document 1] Haq MA, Collin HA, Tomsett AB, Jones, MG (2003) Detection of Sclerotium cepivorum within onion plants using PCR primers. Physiological and Molecular Plant Pathology, 62(3), 185-189. [Non-patent document 2] Woodhall JW, Webb KM, Giltrap PM, Adams IP, Peters JC, Budge GE, Boonham N (2012) A new large scale soil DNA extraction procedure and real-time PCR assay for the detection of Sclerotium cepivorum in soil. European Journal of Plant Pathology, 134(3), 467-473. [Non-patent document 3] Iyozumi, H. and Kawabe, M. (2019) Detection of Sclerotium cepivorum Berkeley, the cause of black rot of onion, by nested PCR of the ribosomal DNA-ITS region. Kansai Society of Disease and Insect Research Bulletin, 61: 133-136 [Non-patent document 4] Amselem J et al (2011) Genomic Analysis of the Necrotrophic Fungal Pathogens Sclerotinia sclerotiorum and Botrytis cinerea. PLos Genetics, 7(8): e1002230. [Non-Patent Document 5] Morikawa, T., Teranaka, S., Okuda, S., & Natsuaki, T. (1987). Formation of sclerotia and microconidia of Sclerotium cepivorum on culture medium. Bulletin of the Phytopathological Society of Japan, 53(1), Abstracts of the Autumn Meeting of the Kanto Division, 118 [Non-patent document 6] Kataoka, Y., Miyata, S., Kim, Ok-kyung, H. Negishi, and K. Shinohara (2018) New mycelial compatibility groups and molecular phylogenetic analysis of black rot fungi of onion in Japan. Bulletin of the Phytopathological Society of Japan, 84(3), Abstracts of the Annual Meeting of the Phytopathological Society of Japan, 257 Summary of the Invention [Problem to be solved by the invention]
[0007] Inactivation of black rot sclerotinia sclerotia on onion by soil disinfection is difficult to achieve consistently in fields with moderate to high infestations, and soil disinfection treatment, which requires complete coverage, is costly and labor-intensive. For these reasons, a growing-season control system is being established in fields where the disease occurs, in which effective chemicals are irrigated or sprayed during the onion growth period (at planting or during soil mulching), making it possible to reduce damage. In order to utilize this control system more efficiently, it is important to accurately grasp the early stages of infestation.
[0008] Furthermore, it was not clear whether PCR primer sets designed to detect black rot sclerotinia sclerotioides of onion could detect all strains occurring in various regions. According to the inventors' studies, existing primer sets (Non-Patent Documents 1 and 2 cited above) can detect group B of black rot sclerotinia sclerotioides of onion, but gave false negative results for group A. A method that can detect both groups A and B is desired. [Means for solving the problem]
[0009] The present invention provides the following: [1] Any one selected from the group consisting of a glyceraldehyde-3-phosphate dehydrogenase (G3PDH) gene region, a heat shock protein 60 (HSP60) gene region, and a calmodulin (CaM) gene region of a plant pathogenic fungus, conserved in both group A and group B strains of Sclerotium cepivorum, and An oligonucleotide of 15-30 bases in length capable of binding to a region that exhibits polymorphism in Botrytis cinerea, Botrytis squamosa, Dumontinia tuberosa, Macrophomina phaseolina, Sclerotinia homoeocarpa, Sclerotinia kitajimana, Sclerotinia minor, Sclerotinia nivalis, Sclerotinia sclerotiorum, Sclerotinia trifoliorum, Sclerotium fumigatum, and Sclerotium rolfsii. [2] The oligonucleotide of 1, Conserved in the sequences of SEQ ID NOs: 25-30, and an oligonucleotide capable of binding to a region in which a polymorphism is found in the sequences of SEQ ID NOs: 5-24, or a complementary region thereof; Conserved in the sequences of SEQ ID NOs: 51-56, and an oligonucleotide capable of associating with a polymorphic region in a sequence of SEQ ID NO: 31-50, or a complementary region thereof; or Conserved in the sequences of SEQ ID NOs: 77-82, and An oligonucleotide capable of binding to a region in which a polymorphism is found in the sequences of SEQ ID NOs: 57-76, or a complementary region thereof. [3] A primer set capable of amplifying any one selected from the group consisting of a glyceraldehyde-3-phosphate dehydrogenase (G3PDH) gene region, a heat shock protein 60 (HSP60) gene region, and a calmodulin (CaM) gene region of a plant pathogenic fungus, conserved in both group A and group B strains of Sclerotium cepivorum, and A primer set consisting of nucleotides each 15-30 bases long that can associate with regions that exhibit polymorphism in Botrytis cinerea, Botrytis squamosa, Dumontinia tuberosa, Macrophomina phaseolina, Sclerotinia homoeocarpa, Sclerotinia kitajimana, Sclerotinia minor, Sclerotinia nivalis, Sclerotinia sclerotiorum, Sclerotinia trifoliorum, Sclerotium fumigatum, and Sclerotium rolfsii. [4] The primer set according to 3, A region of the G3PDH gene that can be amplified and is conserved in the sequences of SEQ ID NOs: 25-30; and A primer set capable of associating with a region in which a polymorphism is found in the sequences of SEQ ID NOs: 5-24 or a complementary region thereof; A region of the HSP60 gene that can be amplified and is conserved in the sequences of SEQ ID NOs: 51-56; and A primer set capable of associating with a region in which a polymorphism is found in the sequence of SEQ ID NO: 31-50, or a complementary region thereof; or capable of amplifying a region of the CaM gene, conserved in the sequences of SEQ ID NOs: 77-82; and A primer set capable of associating with a region in which a polymorphism is found in the sequences of SEQ ID NOs: 57-76, or a complementary region thereof. [5] The primer set according to 3 or 4, It is capable of amplifying the G3PDH gene region, one primer is capable of binding to a region comprising positions 79 and 82 of the sequence of SEQ ID NO: 27, or a complementary region thereof; A primer set, wherein the other primer is capable of binding to a region including positions 329, 335 and 338 of the sequence of SEQ ID NO: 27, or a complementary region thereof. [6] A primer set described in any one of 3 to 5, wherein one primer is an oligonucleotide consisting of the sequence of SEQ ID NO: 1 or its complementary sequence, and the other primer is an oligonucleotide consisting of the sequence of SEQ ID NO: 2 or its complementary sequence. [7] A primer set according to any one of items 3 to 6, for diagnosing black rot of onion. [8] extracting DNA from the sample; performing PCR using the extracted DNA as a template and the primer set according to any one of claims 3 to 7; A step of detecting the PCR amplification product and determining that the pathogen is present in the sample when an amplification product is detected. [9] The method according to 8, wherein the sample is soil, or a plant body or part thereof.
[10] The method according to 8 or 9, further comprising the step of cleaving the PCR amplification product with a restriction enzyme.
[11] The method described in 10, wherein the primer set described in any one of 3 to 7 is used and the restriction enzyme is MspI.
[0010]
[12] The oligonucleotide according to 1 or 2, or the primer set according to any one of 3 to 7, used in the LAMP method.
[13] A kit for diagnosing black rot disease on onion, comprising the oligonucleotide described in 1 or 2, or the primer set described in any one of 3 to 7.
[14] A LAMP primer set for diagnosing black rot disease on onion, comprising the following oligonucleotides (e)-(j): (e) FIP, an oligonucleotide consisting of the sequence of SEQ ID NO: 83 or its complementary sequence (f) BIP, an oligonucleotide consisting of the sequence of SEQ ID NO: 84 or its complementary sequence (g) an F3 primer, which is an oligonucleotide consisting of the sequence of SEQ ID NO: 85 or its complementary sequence; (h) B3 primer, which is an oligonucleotide consisting of the sequence of SEQ ID NO: 86 or its complementary sequence. (i) LF, an oligonucleotide consisting of the sequence of SEQ ID NO: 87 or its complementary sequence (j) LB, an oligonucleotide consisting of the sequence of SEQ ID NO: 88 or its complementary sequence [Effects of the Invention]
[0011] According to the present invention, group A and group B strains of the black rot fungus of Welsh onion can be detected. According to the present invention, it is possible to specifically detect the black rot fungus of Welsh onion, distinguishing it from other closely related species. According to the present invention, highly sensitive detection of black rot fungus of leek can be performed. According to the present invention, the onion black rot fungus can be detected in a plant body or a part thereof. According to the present invention, group A and group B strains of the black rot fungus of Welsh onion can be detected separately. According to the present invention, PCR can be used to specifically and sensitively detect all Sc strains occurring in Japan, enabling rapid and highly accurate detection and diagnosis of black rot fungus of onion in onion production fields.
[0012] The method for detecting group A and group B strains of black rot fungus of onion according to the present invention employs the LAMP method using loop primers, and has the following advantages. -Detection results can be confirmed visually by turbidity or fluorescence. -Lower detection limit compared to conventional PCR. Even when diseased tissue with soil attached is used as a sample, detection is possible without being inhibited by soil-derived substances. -It is easy to distinguish whether it is a false positive or not. [Brief explanation of the drawings]
[0013] [Figure 1]Phylogenetic analysis of strains occurring in Japan. A molecular phylogenetic tree is shown using multiple regions of the genome (Hsp60 gene, G3PDH gene, Cal gene). Sclerotium cepivorum (Sc), the pathogen of black rot of onion, occurring in Japan, is broadly divided into two groups. The characteristics of groups A and B differ in the mycelium colony on artificial media, mycelial compatibility, and sclerotium size. [Figure 2] Alignment of the base sequences of the G3PDH gene region. The underlined region indicates the Sc-specific region (including potential regions). The box indicates the TaqMan sequence. [Figure 3] Alignment of the base sequences of the HSP60 gene region. The underlined regions are specific to Sc (including potential regions). [Figure 4] Alignment of the base sequences of the CaM gene region. The underlined regions are specific to Sc (including potential regions). The boxed regions are specific to group A. [Figure 5] Detection of Sc using previously reported primers. Conventional PCR was performed using the primers of Haq et al. (2003) and total DNA as a template for Sc strains and Sc-related species. Top: PCR was performed on domestic Sc isolates of groups A and B, but group A strains could not be detected. No PCR amplification products were detected in Sc-related species. [Figure 6] Detection of Sc using previously reported primers. Quantitative PCR was performed using the primers described by Woodhall et al. (2012) on total DNA of Sc strains and related species. Sc group B strains were detected, but not group A strains. [Figure 7] Detection of Sc using the primer set of the present example. PCR was newly performed using the total DNA of Sc strains (groups A and B) and related species (strains stored in gene banks) as templates. No related species were detected, but Sc group A and B strains were detected. [Figure 8] The sensitivity of Sc-specific detection using the primer set ScG3F / ScG3R. Total DNA (approximately 10 ng / μl) extracted from sclerotia (10 seeds) of Sc strains (groups A and B) by the CTAB method was detectable even when diluted to 1 / 100. [Figure 9]Specific detection of Sc using the primer set ScG3F / ScG3R. Quantitative PCR was performed using the total DNA of Sc strains (groups A and B) and related species as templates. Two Sc strains (groups A and B) were detected at a cycle value (Ct value) of approximately 23. [Figure 10] Detection was performed using a primer set designed based on Hsp60. PCR was performed using total DNA from Sc strains (groups A and B) and related species as templates. Two Sc strains (groups A and B) were detected. Amplification was also observed in samples from Dumontinia tuberosa and Sclerotinia minor. [Figure 11] Distinguishing between two Sc groups by restriction enzyme digestion after PCR. After PCR was performed using the primer set ScG3F / ScG3R, restriction enzyme (MspI) digestion allowed differentiation of group A and group B strains by agarose gel electrophoresis. [Figure 12] Detection from plants: Sampling of diseased plants. The severity of black rot disease on leek was classified into three stages (mild, medium, and severe), and sampling was carried out according to the distance from the roots, which are the site of pathogen invasion. [Figure 13] Detection from plants: Example of PCR detection. Total DNA (plant + pathogen) was extracted from diseased plants and detected using the ScG3F / ScG3R primer set. Differences in detection efficiency depending on the DNA extraction method were also compared. Top: Extraction by the CTAB method, bottom: Extraction using the Qiagen DNeasy Plant mini kit. [Figure 14] Sequence of a new LAMP primer set for Sc-specific detection (G3PDH). The sequences of the primer set ScG3F / ScG3R were used for F3 and B3 in the LAMP primer design. The primer positions for the FIP and BIP sequences were designed to reveal single-base polymorphisms with closely related species. [Figure 15] Sample preparation of Sc-infected welsh onion plants (DNA sample preparation for Sc detection) [Figure 16] Specific detection of Sclerotium cepivorum (Sc) by loop-mediated isothermal amplification (LAMP) using sclerotial DNA from Sc and related species [Figure 17]Specific detection of Sc by cPCR in Sc-infected onion plants. Conventional PCR (cPCR, regular PCR) allows accurate detection by washing the sample with water, but detection sensitivity decreases when soil is present due to the presence of inhibitors. Medium 1-3: Another sample with moderate symptoms; Light 1-3: Another sample with mild symptoms; None: Healthy onion with no symptoms (negative control); sai02: Sclerotial DNA of the sai02 strain (positive control) [Figure 18] Specific detection of Sc from Sc-infected leek plants: Comparison of cPCR and LAMP. Conventional PCR (cPCR, regular PCR) and LAMP yielded nearly identical results, with LAMP showing higher detection sensitivity for some sample DNA. DETAILED DESCRIPTION OF THE INVENTION
[0014] [Oligonucleotides, primers, probes] The present invention relates to oligonucleotides for PCR that can detect plant pathogenic fungi. The oligonucleotides for PCR include primers, primer sets, and probes. The oligonucleotides, primers, and probes of the present invention are particularly suitable for detecting Sclerotium cepivorum, the fungus that causes black rot of onion.
[0015] The oligonucleotide of the present invention is capable of binding to any one selected from the group consisting of the glyceraldehyde-3-phosphate dehydrogenase (G3PDH) gene region, the heat shock protein 60 (HSP60) gene region, and the calmodulin (CaM) gene region of ascomycetes. The oligonucleotide of the present invention is also capable of binding to a region that is conserved in both group A and group B strains of Sclerotium cepivorum (Sc) and that exhibits polymorphism in closely related species of Sc.
[0016] In the present invention, unless otherwise specified, the term "related species of Sc" refers to any species selected from the group consisting of Botrytis cinerea, Botrytis squamosa, Dumontinia tuberosa, Macrophomina phaseolina, Sclerotinia homoeocarpa, Sclerotinia kitajimana, Sclerotinia minor, Sclerotinia nivalis, Sclerotinia sclerotiorum, Sclerotinia trifoliorum, Sclerotium fumigatum, and Sclerotium rolfsii.
[0017] Analysis of Sc based on sclerotial shape, cultural properties, hyphae, and molecular phylogeny is underway, and it can be roughly divided into Group A (which forms large sclerotia) and Group B (which forms small sclerotia) in terms of MCG (mycelial anastomosis group) and molecular phylogeny (Non-Patent Document 6 cited above). Clear differences in cultural properties are observed between Group A and Group B, so if they can be distinguished and detected, it is expected that analysis of their influence on disease onset will progress in the future.
[0018] The sequence listing shows the sequences of the G3PDH gene region of related species as SEQ ID NOs: 5-24, the sequence of the G3PDH gene region of Sc as SEQ ID NOs: 25-30, the sequence of the HSP60 gene region of related species as SEQ ID NOs: 31-50, the sequence of the HSP60 gene region of Sc as SEQ ID NOs: 51-56, the sequence of the CaM gene region of related species as SEQ ID NOs: 57-76, and the sequence of the CaM gene region of Sc as SEQ ID NOs: 77-82.
[0019] In a preferred embodiment, the oligonucleotides are primers, and the primers may be a paired primer set. In a particularly preferred embodiment, the primer set is capable of amplifying a region of the G3PDH gene, and is capable of associating with a region conserved in the sequences of SEQ ID NOs: 25-30 and polymorphic in the sequences of SEQ ID NOs: 5-24, or a complementary region thereof.
[0020] A more specific example of such a primer set is one capable of amplifying a G3PDH gene region, in which one primer can bind to a region including positions 79 and 82 of the sequence of SEQ ID NO: 27, or a complementary region thereof, and the other primer can bind to a region including positions 329, 335, and 338 of the sequence of SEQ ID NO: 27, or a complementary region thereof.
[0021] Specifically, one of the primers is any of the following oligonucleotides: (a) an oligonucleotide consisting of a continuous portion of the sequence of at least 15-30 bases, preferably 18-25 bases, including positions 79 and 82 of SEQ ID NO: 27, or a complementary sequence thereof; (b) An oligonucleotide having a sequence in which 1 to 3 bases are substituted in the sequence of the oligonucleotide (a).
[0022] The other primer is any one of the following oligonucleotides: (c) an oligonucleotide consisting of a continuous portion of the sequence of at least 15-30 bases, preferably 18-25 bases, including positions 329, 335, and 338 of SEQ ID NO: 27, or a complementary sequence thereof; (d) An oligonucleotide having a sequence in which 1 to 3 bases are substituted in the sequence of the oligonucleotide (c).
[0023] A more specific example of one primer is any of the following oligonucleotides: (a') an oligonucleotide consisting of the sequence of SEQ ID NO: 1 or its complementary sequence; (b') An oligonucleotide having a sequence in which 1 to 3 bases are substituted in the sequence of the oligonucleotide (a').
[0024] A more specific example of the other primer is any of the following oligonucleotides: (c') an oligonucleotide consisting of the sequence of SEQ ID NO: 1 or its complementary sequence; (d') An oligonucleotide having a sequence in which 1 to 3 bases are substituted in the sequence of the oligonucleotide (c').
[0025] In another preferred embodiment, the primer set is capable of amplifying an HSP60 gene region, and is capable of associating with a region that is conserved in the sequences of SEQ ID NOs: 51-56 and polymorphic in the sequences of SEQ ID NOs: 31-50, or a complementary region thereof.
[0026] In another preferred embodiment, the primer set is capable of amplifying a region of the CaM gene that is conserved in the sequences of SEQ ID NOs: 77-82 and polymorphic in the sequences of SEQ ID NOs: 57-76, or a complementary region thereof.
[0027] In general, primers for PCR are designed with four considerations in mind: Tm value, terminal stability of each primer region, GC content, and secondary structure. Furthermore, primers are designed so that their 3' ends are not complementary to each other to prevent the formation of primer dimers. The same applies to the primers of the present invention.
[0028] The distance between the primers can be designed so that the amplification product is 120-400 bases long, for example, 200-300 bases long.
[0029] Each primer can be independently 15-30 bases long, preferably 18-25 bases long, and when the primer is a BIP or FIP primer in the LAMP method described below, each primer can be independently 30-60 bases long, preferably 36-50 bases long.
[0030] In another preferred embodiment, the oligonucleotide is a probe for detecting a specific sequence in a PCR amplification product, and the probe is capable of associating with a region related to the G3PDH gene that is conserved in the sequences of SEQ ID NOs: 25-30 and polymorphic in the sequences of SEQ ID NOs: 5-24, or a complementary region thereof.
[0031] A more specific example of such a probe is one that can associate with a region including any one selected from the group consisting of positions 79, 82, 329, 335 and 338 of the sequence of SEQ ID NO:27, or a complementary region thereof.
[0032] In another preferred embodiment, the probe is capable of associating with a region related to the HSP60 gene region that is conserved in the sequences of SEQ ID NOs: 51-56 and polymorphic in the sequences of SEQ ID NOs: 31-50, or a complementary region thereof.
[0033] In another preferred embodiment, the probe is capable of associating with a region related to the CaM gene region that is conserved in the sequences of SEQ ID NOs: 77-82 and polymorphic in the sequences of SEQ ID NOs: 57-76, or a complementary region thereof.
[0034] The probe should be designed to associate with the target polymorphism approximately in the center, specifically in a region five bases above and five bases below the center of the nucleotide chain. The probe should be 15-30 bases long, preferably 18-25 bases, because this length is effective for specific association with the intended complementary sequence.
[0035] The probe may be modified with a fluorescent molecule, such as N-(3-Fluoranthyl)maleimide (FAM), fluorescein, dansyl, Cascade Yellow, fluorescamine, Oregon Green, pyrene, Texas Red, Pacific Blue, Marine Blue, Alexa, Lucifer Yellow, BODIPY, coumarin, PyMPO, TET, JOE, Cy3, Cy5, Cy5.5, Cy7, ROX, VIC, HEX, TAMRA, SYBR Green, or NBD. Methods for binding fluorescent molecules to oligonucleotides and detecting fluorescence are well known in the art.
[0036] The present invention also provides a kit for diagnosing black rot disease on onion, which includes a predetermined oligonucleotide and primer set. The kit may also include a container such as a microtube, a solution for extracting DNA from a sample, a diluent, a positive control, a manual, etc.
[0037] [Detection method] The present invention also provides a method for detecting pathogens using the above-mentioned primer set. The detection method of the present invention comprises the following steps: extracting DNA from the sample; performing PCR using the extracted DNA as a template and the above-mentioned primer set; A process for detecting PCR amplification products.
[0038] The present invention also provides a method for detecting pathogens using the above-mentioned probe. The detection method of the present invention comprises the following steps: extracting DNA from the sample; performing PCR using the extracted DNA as a template and an appropriate primer set; A step of detecting the PCR amplification product using the above-mentioned probe.
[0039] Furthermore, when an amplification product is detected, the detection method of the present invention can determine that a pathogen, more specifically, Sclerotium cepivorum (Sc), the fungus causing black rot of onion, is present in the sample.
[0040] Examples of plants in which Sc can be detected by the detection method of the present invention include plants of the genus Allium. Examples of Allium plants include green onion (Allium fistulosum L.), onion (A. cepa L.), leek (A. porrum L.), garlic (A. sativum L.), shallot (A. chinensis G. Don), wild onion (A. victorialis L.), Chinese chive (A. tuberosum Rottl.), Japanese chive (A. monanthum Maxim.), Chinese chive (A. togashii Hara), Japanese leek (A. virgunculae F. Maek. et Kitam.), mountain shallot (A. splendens Willden.), wild shallot (A. macrostemon Bunge), mountain shallot (A. thunbergii G. Don), and chives (A. schoenoprasum L.). The detection method of the present invention is suitable for detecting Sc in green onions, onions, garlic, leeks, shallots, and chives, and is particularly suitable for detecting Sc in green onions.
[0041] When the analytical method of the present invention is applied to leeks, there are no particular limitations on the variety, line, or crop type of the leeks to be analyzed. According to the present invention, analysis can be suitably carried out on white leeks (also called long leeks or deep-rooted leeks) that are susceptible to widespread damage caused by black rot of leeks and that are produced using the crop types of "autumn / winter leeks" and "spring harvest leeks." Examples of welsh onion varieties to which the analytical method of the present invention can be applied include TA-4, MSN-TAM-1, Suzuwarabe, MSS-TA-4, TAM-3, Koiwarabe, Yumewarabe, TAM-1, MSK-TA-2, TA-2, welsh onion intermediate parent No. 1, Fuyuwarabe, Hikawa, Nagaetsu, Iwai, late-season Shiobara, Benizome, Motoharu late-season, Big Fellow, Futoko, Harukawa Okuta, Daikokuho, Frost-resistant, Furuno Midori, Yoshiharu, Nishikizo, Shuntou, Harumi, Kiyomidori, Natsufujin, Satsukihime, Yawaragi, T Nakajima Shironaga, Saga Yutaka, BL Manganbo, Ashi Nagabijin, Shonan Ippon, Hitachi Benikko, Tom One, Etchu Natsu Komachi, Etchu Fuyu Komachi, Natsu Genki, YSG1, NR Shizuku 1, Tokyo Komachi, Early-season Kaminari, Akita Harukko, YSG2, Hyogo These include N-1, Natsu Moeka, Ryusho, Ryu Hikari 1, Ryu Hikari 2, Ryuuki, and Ryumi.
[0042] The sample to be detected can be fungal bodies (sclerotia), soil, or a plant body or part thereof. Examples of plant body parts include roots and stem discs to which Sc sclerotia are attached.
[0043] An extraction solution is used to extract DNA from a sample. The extraction solution can be prepared as a buffer containing a surfactant. The base buffer is selected from Tris buffer, phosphate buffer, Tricine buffer, HEPES buffer, MOPS buffer, carbonate buffer, citrate buffer, borate buffer, MES buffer, and PIPES buffer. It contains 100-700 mM, preferably 500 mM, NaCl, and has a pH of 6-10, preferably 7.4. Known surfactants can be used, including nonionic surfactants such as Triton X-100, NP-40, and Tween; zwitterionic surfactants such as 7BzO, SB3-10, SB3-14, CHAPS, and amidosulfobetaine-14 (ASB14); and ionic surfactants such as cetyltrimethylammonium bromide (CTAB) and sodium dodecyl sulfate (SDS). Zwitterionic surfactants and ionic surfactants are preferred, with ionic surfactants being even more preferred. Preferably, SDS or CTAB is used, more preferably CTAB. The concentration of the surfactant in the extraction solution is 0.5-1.5% by weight, preferably 1% by weight.
[0044] The extraction liquid can be added in a ratio of 0.1 to 30 ml, preferably 0.5 to 10 ml, more preferably 0.75 to 3 ml per 1 g of sample.
[0045] Extraction can be performed by known techniques, in which an extracting solution is added to the pulverized sample and the mixture is heated (e.g., at 60°C) for a few minutes to an hour, preferably 5 to 20 minutes. If necessary, the extraction process may be repeated multiple times, preferably twice.
[0046] The detection method of the present invention may further include a step of cleaving the PCR amplification product with a restriction enzyme. A preferred example of the restriction enzyme is MspI, as this allows for the distinction between group A and group B strains of Sc. MspI is a restriction enzyme derived from the MspI gene isolated from bacteria of the genus Moraxella, and recognizes and cleaves the following sequence:
[0047] [ka]
[0048] Other restriction enzymes with the same activity can be used, such as HpaII.
[0049] [Detection method using LAMP] The detection method of the present invention can be carried out as a LAMP (Loop-Mediated Isothermal Amplification) method. LAMP is a method of amplification using a strand displacement reaction with four primers that combine six regions selected from the sequence of a target gene. LAMP primers are designed using six regions, namely, F3 region, F2 region, F1 region, B1 region, B2 region, and B3 region, from the 5' end, in the region to be amplified (sometimes referred to as the "template (nucleotide, DNA)"). The regions complementary to these six regions are called F3c region, F2c region, F1c region, B1c region, B2c region, and B3c region, respectively. The basic LAMP method uses four primers, more specifically, two inner primers, namely, FIP and BIP, and two outer primers, namely, F3 primer and B3 primer.
[0050] In detail, FIP is designed to have an F2 region at its 3'-end, which is a sequence complementary to the F2c region, and a sequence identical to the F1c region at its 5'-end, F3 Primer is designed to have an F3 region at its 3'-end, which is a sequence complementary to the F3c region, BIP is designed to have a B2 region at its 3'-end, which is a sequence complementary to the B2c region, and a sequence identical to the B1c region at its 5'-end, and B3 Primer is designed to have a B3 region at its B3c region. When designing primers for the LAMP method for detection of the present invention, it is advisable to design any one of FIP, BIP, F3 primer, and B3 primer to associate with the position of the polymorphism.
[0051] Loop primers can be used in the LAMP method. Loop primers are usually designed to have a sequence complementary to the single-stranded portion of the loop at the 5' end of the dumbbell structure of the LAMP amplification product (between the B1 and B2 regions, or between the F1 and F2 regions). They are called loop primer B (LB) and loop primer F (LF), respectively. The use of loop primers can increase the number of origins of DNA synthesis. In amplification products that typically have six loops in the LAMP method, four loops are not utilized in the original method using four primers, but by using loop primers, all loops can be utilized. Loop primers LB and LF may also be used in the LAMP method for detection of the present invention.
[0052] In relation to the present invention, when referring to the F3 region, F2 region, F1 region, B1 region, B2 region, B3 region, FIP, F3 primer, BIP, B3 primer, loop primer B (LB), and loop primer F (LF) in relation to the LAMP method, they are used in the same sense as those in the general LAMP method (see below), unless otherwise specified.
[0053] [Table 1]
[0054] In general, the LAMP method is characterized by the fact that it does not require a denaturation reaction from single strands to double strands, and the reaction proceeds at a constant temperature of 60-65°C, eliminating the need for equipment such as a thermal cycler. Furthermore, the amplification rate is fast and the specificity is high.
[0055] In a particularly preferred embodiment, the LAMP method of the present invention uses the following primer sets (e)-(j): (e) FIP, an oligonucleotide consisting of the sequence of SEQ ID NO: 83 or its complementary sequence (f) BIP, an oligonucleotide consisting of the sequence of SEQ ID NO: 84 or its complementary sequence (g) an F3 primer, which is an oligonucleotide consisting of the sequence of SEQ ID NO: 85 or its complementary sequence; (h) B3 primer, which is an oligonucleotide consisting of the sequence of SEQ ID NO: 86 or its complementary sequence. (i) LF, an oligonucleotide consisting of the sequence of SEQ ID NO: 87 or its complementary sequence (j) LB, an oligonucleotide consisting of the sequence of SEQ ID NO: 88 or its complementary sequence
[0056] The LAMP method of the present invention may use an oligonucleotide probe. Furthermore, the primers and probes used in the LAMP method may be modified with a fluorescent molecule or a quencher molecule. Examples of fluorescent molecules are as described above. Examples of quencher molecules include non-fluorescent substances (known as dark quenchers), such as 4-dimethylaminoazobenzene-4'-carboxylic acid (Dabcyl), QSY-7, QSY-21, QSY-35, BHQ-0, BHQ-1, BHQ-2, BHQ-3, and Eclipse. Alternatively, fluorescent substances with absorption bands in the wavelength ranges emitted by the above-mentioned fluorescent molecules may be used as quencher molecules. Methods for attaching fluorescent molecules and quencher molecules to oligonucleotides and for detecting changes in fluorescence intensity are well known in the art. [Example]
[0057] Development of PCR primers for detecting I.Sc 1. Method [DNA extraction] Eight Sclerotium cepivorum (Sc) isolates isolated between 2015 and 2018 were cultured on PDA plates at 20°C in the dark, and approximately 10 sclerotia were collected. DNA from each strain was extracted using the CTAB method. In addition, 13 strains of closely related species of Sclerotinia (Botrytis cinerea MAFF 615004, Botrytis squamosa MAFF 241966, Dumontinia tuberosa MAFF 241471, Macrophomina phaseolina MAFF 238567, Sclerotinia homoeocarpa MAFF 235856, Sclerotinia kitajimana MAFF 410428, Sclerotinia minor MAFF 238173, Sclerotinia nivalis MAFF 241342, Sclerotinia sclerotiorum MAFF 306236, Sclerotinia trifoliorum MAFF 305210, Sclerotium fumigatum MAFF 237402) and 11 strains of Sclerotium rolfsii MAFF 242770 and Sclerotium DNA from each of the two strains (B. rolfsii var. delphinii MAFF 328254) was extracted using the CTAB method from a single sclerotium or mycelium cultured on a PDA plate. The extracted DNA concentration was measured using a Nanodrop (Thermo Fisher) and adjusted to 10-30 ng / μl. Each DNA sample was stored in a -25°C freezer until use.
[0058] [CTAB method] Extraction Buffer CTAB extraction solution (2% hexadecyltrimethylammonium bromide, 0.1M Tris-HCl pH 8.0, 20mM EDTA, 0.4M NaCl) Phenol-chloroform solution (v / v=1:1)
[0059] <method> 1. Place the sclerotia or mycelia of each strain into a 1.5 ml microtube and crush the cells using a pestle or a 2 mm stainless steel ball. 2. Add 500 μL of CTAB extraction solution and incubate at 60°C for 10 minutes. 3. Add 200 μL of phenol chloroform solution, mix well, and let stand for 10 minutes. 4. Centrifuge at 15,000 rpm for 10 minutes 5. Transfer 200 μL of the upper layer to a new tube, add 200 μL of isopropanol, and mix by inverting. 6. Centrifuge at 15,000 rpm for 10 minutes 7. Remove the supernatant and add 500 μL of 70% ethanol. 8. Centrifuge at 15,000 rpm for 10 minutes. 9. Remove the supernatant and dry the pellet 10. After drying, add 20 μL of TE Buffer and measure the concentration using a Nanodrop (Thermo Fisher) to adjust it to 10-30 ng / μl.
[0060] [Determination of base sequence] Conventional PCR was performed targeting the three regions reported by Andrews et al. (2012) (glyceraldehyde-3-phosphate dehydrogenase; G3PDH, heat shock protein 60; HSP60, and calmodulin; CaM). PCR of the G3PDH, HSP60, and CaM regions was performed using Takara EX taq. The reaction volume was 10x EX taq Buffer (Mg 2+The total volume was 25 μL, containing 10 mM ATP (Protein Plus), 0.25 mM dNTP Mixture, 0.2 μM each primer, and 0.2 U of EX taq. The reaction conditions were as described by Andrews et al. (2012). After a 2-minute denaturation at 95°C, the reaction was denatured at 95°C for 30 seconds, annealed at different temperatures for each primer (58°C for G3PDH, 53°C for HSP60, and 50°C for CaM), and then extended at 72°C for 1 minute for 35 cycles. The PCR products were electrophoresed on 1.5% agarose gel (Agarose LE, Analytical Grade) and analyzed using a 100-bp DNA Ladder (Nippon Genetics Co., Ltd.) as a size marker. The PCR products were purified using the FastGene Gel / PCR Extraction Kit (Nippon Genetics Co., Ltd.) to obtain purified products for sequencing. The purified products were subjected to a capillary sequencer to obtain each base sequence data, which was then subjected to a BLAST search at NCBI.
[0061] [Primer design] Based on the report by Andrews et al. (2012), the nucleotide sequence information for each gene region of 13 Sc-related species (3 species of Botrytis, 4 species of Botryotinia, 4 species of Sclerotinia, and 2 species of Myriosclerotinia) was obtained from the DDBJ / EMBL / GenBank databases. The alignments were performed using the software Clustal W and compared using MEGA ver. 7. Based on the nucleotide sequence of each gene region, species-specific nucleotide sequence information was designed to be specific for either the upstream or downstream region, or both. Primers were designed: 3 primer sets for G3PDH, 10 primer sets for HSP60, and 4 primer sets for CaM.
[0062] In addition, Figure 2, 3, and 4 show the alignments of the nucleotide sequences of G3PDH, HSP60, and CaM derived from representative Sc group A and group B strains, and Sc-related species, respectively.
[0063] [Confirmation of Primer Specificity] PCR was performed on a total of 15 strains including 2 strains of S.cepivorum (MAFF239143 strain group A, Sai01 strain group B) and 13 strains of related species.
[0064] [PCR Reaction Conditions] Using Promega's Go taq Greenmaster mix, the test was conducted in a reaction system with a total volume of 25 μl according to the manual. The reaction cycle conditions were 30 cycles of 94°C for 15 seconds, 62°C for 15 seconds, and 72°C for 15 seconds after a preliminary reaction of 94°C for two minutes, using TaKaRa PCR Thermal Cycler Dice (registered trademark) TP600 or TP650. The PCR reaction products were electrophoresed using 1.5% agarose (Agarose, LE, Analytical Grade), and 100bp DNA Ladder (Nippon Genetics Co., Ltd.) was used as the Marker for judgment.
[0065] [Treatment of PCR Reaction Products] For the determination of bacterial groups using restriction enzyme treatment, MspI (Takara) was used and the cleavage enzyme treatment was performed according to Takara's manual. The restriction enzyme treatment reaction was incubated at 37°C for 15 minutes and then the enzyme was inactivated at 94°C for 10 minutes. The confirmation of the treated restriction enzyme treatment products was carried out in the same manner as the PCR reaction test.
[0066] [Quantitative PCR] Using Nippon Gene's GeneAce SYBR qPCR Mixα, this was carried out according to the manual. The reaction conditions were 45 cycles of 94°C for 15 seconds, 62°C for 15 seconds, and 72°C for 15 seconds after a preliminary reaction of 94°C for 10 minutes, using Takara's Tehermal Cycler Dice TP700.
[0067] [PCR Using Previously Reported Primers] PCR was performed using the Sc-specific primers (SCAF / ITS2SCR) from Haq et al. (2003) (Non-Patent Document 1) on 37 strains of Sc-related species and 71 strains of S. cepivorum. PCR reactions were performed in a 25-μl reaction system according to the Promega Go taq Greenmaster mix manual. PCR reaction conditions were as described by Haq et al. The PCR products were electrophoresed using 1.5% agarose (Agarose, LE, Analytical Grade), and the marker was read using a 100-bp DNA ladder (Nippon Genetics Co., Ltd.).
[0068] Quantitative PCR was performed on six Sc-related species using the Sc-specific primers (Z996-340F / Z996-450R:Z996-382T) from Woodhall et al. (2012). PCR reactions were performed according to the Nippon Gene GeneAce Probe qPCR Mix II manual, and the PCR reaction conditions were as described by Woodhall et al. (2012).
[0069] 2. Results [Detection using previously reported primers] The results are shown in Figures 5 and 6. Conventional PCR was performed using the primers from Haq et al. (2003) and the total DNA of Sc and related species as templates. Group B strains were detected, but not group A strains. No amplification products were obtained from 37 closely related species. Furthermore, PCR was performed using the primers from Woodhall et al. (2012) and the total DNA of Sc and related species as templates. Group B strains were detected, but not group A strains (Figure 6).
[0070] [Detection using ScG3F / ScG3R primer set] Using the designed primer sets and the total DNA of Sc strains (groups A and B) and related species as templates, we were able to perform PCR using one of the primer sets based on the GAPDH sequence to specifically detect Sc group A and B strains but not related species. The results are shown in Figure 7.
[0071] The sequences of the ScG3F primer and the ScG3R primer are shown below. ScG3F:5'-CAAGGGCGATATCAAGGTCCTT-3'(SEQ ID NO:1) ScG3R:5'-GGAGATGACATCTGCTTCACCA-3'(SEQ ID NO:2)
[0072] [Sensitivity of Sc-specific detection using the ScG3F / ScG3R primer set] PCR was performed using total DNA (approximately 10 ng / μl) extracted from sclerotia (10 seeds) of Sc strains (groups A and B) using the CTAB method described above, which was serially diluted to 1 / 100.
[0073] The results are shown in Figure 8. Amplification products were detected from diluted samples of both group A and group B strains.
[0074] [Quantitative PCR] The results of PCR using the ScG3F / ScG3R primer set are shown in Figure 9. Only two Sc strains (groups A and B) had cycle values (Ct values) of approximately 23, allowing them to be detected and distinguished from closely related Sc species.
[0075] [Design of PCR primers based on Hsp60] PCR was performed using PCR primers designed based on Hsp60 and the total DNA of Sc strains (groups A and B) and related species as templates. The results are shown in Figure 10. Two Sc strains (groups A and B) were detected. Other amplified DNA was also detected from Dumontinia tuberosa and Sclerotinia minor.
[0076] The primer sequences are shown below. F:5'- ACTGTTGGTGAACAGATGGTG -3'(SEQ ID NO:3) R:5'- GCGACTTGTGCGATTTCCTCGCTG -3'(SEQ ID NO:4)
[0077] [Discrimination of the two groups using the ScG3F / ScG3R primer set] The MAFF239143, Chi01, and Chi07 strains were used in group A, and the Sai01 and Shi01 strains were used in group B. PCR was performed using the ScG3F / ScG3R primer set, followed by treatment with a restriction enzyme (MspI) at 37°C for 15 or 60 minutes, followed by agarose gel electrophoresis. The results are shown in Figure 11. Group A and B could be distinguished by agarose gel electrophoresis of the enzyme-treated products. In Figure 11, the molecular weight markers are shown on the left side for a 15-minute reaction time and on the right side for a 60-minute reaction time, and both were detectable.
[0078] [Detection of pathogens from plants] Total DNA (plant + pathogen) was extracted from infected plants and detected using the ScG3F / ScG3R primer set. The detection efficiency of different DNA extraction methods was also compared.
[0079] Specifically, the severity of black rot disease on onion was classified into three stages (mild, moderate, and severe), and samples were collected according to the distance from the roots, the site of pathogen invasion (Figure 12). Total DNA was extracted from diseased plants using the CTAB method described above or the Qiagen DNeasy Plant mini kit, following the instructions provided with the kit. PCR was performed under the same conditions as described above.
[0080] The results are shown in Figure 13. When extracted using the CTAB method, the bacteria were detected in the stem disc where symptoms were "moderate," and in the roots, stem discs, and areas 10 cm away from the roots where symptoms were "severe."
[0081] II. Development of the LAMP method 1. Method [Primer set development] LAMP primers for the specific detection of Sc were designed using PrimerExplorer V5, a LAMP primer design support software from Eiken Chemical Co., Ltd. LAMP primer F3 utilized the sequence of primer ScG3F designed in I, but was two bases shorter than it in consideration of the Tm value. In addition, the polymorphic position in ScG3R was incorporated into BIP. The primer position of FIP was designed to reveal a single-base polymorphism compared to closely related species (see Figure 14).
[0082] The sequences of the designed LAMP primer set are shown in the table below.
[0083] [Table 2]
[0084] [Sample preparation] Samples were prepared from leek plants infected with Sc and with different degrees of disease (see Figure 15 and the table below), and total DNA was extracted from each sample (infected leek plants or sclerotia) using the CTAB method described in "I. Development of PCR primers for Sc detection."
[0085] [Table 3]
[0086] Specifically, samples were prepared from the welsh onion plants as follows. 1. Cut the diseased tissue of a diseased plant (approximately 1cm square: red frame) in half. 2. Total DNA was extracted from the "soil-attached" specimens using the CTAB method. 3. "Water washing" involved rinsing with tap water, wiping off the moisture thoroughly, and extracting total DNA.
[0087] [LAMP and cPCR methods] LAMP method: Reagents from a LAMP kit (Loopamp® DNA Amplification Reagent Kit D (Eiken Chemical Co., Ltd.) or Isothermal Master Mix (Nippon Gene Co., Ltd.)), total DNA (approximately 1 μl), and the designed primers were added to a 0.2 ml Eppendorf tube, and amplification reaction was carried out according to the manual provided with the kit. The apparatus used was a Takara Real time PCR48 (Takara Bio Inc.).
[0088] Conventional PCR (cPDR) method: This was performed according to the method described in "Development of PCR primers for detecting I.Sc."
[0089] 2. Results [Specific detection of Sc by LAMP using sclerotial DNA] The results are shown in Figure 16. DNA amplification was confirmed by the cloudiness of the reaction solution. Amplified products were detected by the LAMP method for both group A and group B strains.
[0090] [Specific detection of Sc by cPCR using plant tissues] The results are shown in Figure 17. In conventional PCR (cPCR, normal PCR), accurate detection is possible by washing the sample with water, but detection sensitivity decreases when soil is present due to the inclusion of inhibitors and other contaminants.
[0091] [Specific detection of Sc from plants: comparison of cPCR and LAMP methods] The results are shown in Figure 18. The results of conventional PCR (cPCR, normal PCR) and the LAMP method were almost identical, and the LAMP method had higher detection sensitivity for some sample DNA. [Industrial Applicability]
[0092] The present invention makes it possible to diagnose black rot disease of leeks at the initial stage of occurrence, and therefore can be used at leeks production sites, prefectural extension and guidance centers and public testing stations that receive consultations from production sites, and the seed and seedling industry.
[0093] According to the present invention, the density of sclerotia in soil can be measured to diagnose the degree of contamination, and therefore the present invention can also be used to diagnose soil pests.
[0094] The orthodox method for extracting DNA from plants, sclerotia, and fungi (CTAB method) has good detection sensitivity, and no special conditions are required for PCR, so it is thought that there are few technical limitations to its practical application. [Sequence List Free Text]
[0095] SEQ ID NO:1 ScG3F primer SEQ ID NO:2 ScG3R primer SEQ ID NO:3 primer SEQ ID NO:4 primer SEQ ID NOs:5-24 Related species G3PDH SEQ ID NOs:25-30 Sc G3PDH SEQ ID NOs:31-50 Related species HSP60 SEQ ID NOs:51-56 Sc HSP60 SEQ ID NOs:57-76 Related species CaM SEQ ID NOs:77-82 ScCaM SEQ ID NO:83 FIP SEQ ID NO:84 BIP SEQ ID NO:85 F3 primer SEQ ID NO:86 B3 primer SEQ ID NO:87 LF SEQ ID NO:88 LB
Claims
1. A primer set comprising: It is capable of amplifying the G3PDH gene region of plant pathogenic fungi, one primer is 15-30 bases long and is capable of binding to a complementary region of a region including positions 79 and 82 of the sequence of SEQ ID NO: 27; A primer set in which the other primer is 15-30 bases long and can bind to a region including positions 329, 335 and 338 of the sequence of SEQ ID NO:
27.
2. 2. The primer set according to claim 1, wherein one primer is an oligonucleotide consisting of the sequence of SEQ ID NO: 1, and the other primer is an oligonucleotide consisting of the sequence of SEQ ID NO:
2.
3. The primer set according to claim 1 or 2, for detecting Sclerotium cepivorum, a black rot fungus causing sclerotial disease on onion.
4. extracting DNA from the sample; A step of performing PCR using the extracted DNA as a template and the primer set according to any one of claims 1 to 3; A step of detecting the PCR amplification product and determining that the pathogen is present in the sample when an amplification product is detected.
5. The method according to claim 4, wherein the sample is soil, or a plant body or part thereof.
6. The method according to claim 4 or 5, further comprising the step of cleaving the PCR amplification product with a restriction enzyme.
7. The method according to claim 6, wherein the primer set according to any one of claims 1 to 3 is used and the restriction enzyme is MspI.
8. The primer set according to any one of claims 1 to 3, which is used in the LAMP method.
9. A kit for detecting Sclerotium cepivorum, a black rot fungus of onion, comprising the primer set described in any one of claims 1 to 3.
10. A LAMP primer set for detecting Sclerotium cepivorum, the fungus causing black rot on onion, comprising the following oligonucleotides (e)-(j): (e) FIP, an oligonucleotide consisting of the sequence of SEQ ID NO: 83 (f) BIP, an oligonucleotide consisting of the sequence of SEQ ID NO: 84 (g) F3 primer, an oligonucleotide consisting of the sequence of SEQ ID NO: 85 (h) B3 primer, an oligonucleotide consisting of the sequence of SEQ ID NO: 86 (i) LF, an oligonucleotide consisting of the sequence of SEQ ID NO: 87 (j) LB, an oligonucleotide consisting of the sequence of SEQ ID NO: 88