Novel RNA molecules for cancer detection

Abstract

The present invention relates to a method for diagnosing cancer in a patient. Further, the present invention relates to a method for monitoring the course of cancer in a patient. Further, the present invention relates to a method for determining whether a patient responds to a therapeutic treatment for cancer. The present invention also relates to a method for determining the risk of recurrence of cancer in a patient. Further, the present invention relates to a method for detecting minimal residual disease in a patient having cancer. The present invention also relates to a kit for carrying out these methods.

Description

[Technical Field]

[0001] The present invention relates to methods for diagnosing cancer in a patient. Further, the present invention relates to methods for monitoring the progress of cancer in a patient. Further, the present invention relates to methods for determining whether a patient will respond to therapeutic treatment for cancer. The present invention also relates to methods for determining a patient's risk of cancer recurrence. Further, the present invention relates to methods for detecting minimal residual disease in patients with cancer. The present invention also relates to kits for carrying out these methods. [Background technology]

[0002] Cancer is the uncontrolled growth of abnormal cells somewhere in the body. Abnormal cells are called cancer cells, malignant cells, or tumor cells. Cancer cells may grow out of control and form a mass of cancerous cells.

[0003] The most common types of cancer in men are lung, prostate, colon and stomach cancer. In women, the most common types are breast, colon, lung and cervical cancer.

[0004] Lung cancer, or bronchogenic carcinoma, refers to tumors that arise in the lung parenchyma or bronchi. It is one of the leading causes of cancer-related deaths in Europe and the United States. Since 1987, lung cancer has been a more common cause of death in women than breast cancer. It is estimated that 225,000 new cases of lung cancer occur each year in the United States, and approximately 160,000 people die from the disease. Interestingly, lung cancer was a relatively rare disease in the early 20th century. Its dramatic increase in subsequent decades is primarily due to increased smoking in both men and women.

[0005] Historically, markers such as age, performance status, and stage have been used to risk stratify cancer patients and guide treatment decisions. While these parameters provide some useful information, there is a clear need for more sensitive markers. Molecular and genetic studies have identified several such markers that appear to play important roles in carcinogenesis and influence patient outcomes. However, their prognostic and predictive value for cancer treatment has so far been low.

[0006] The present inventors have identified 28S ribosomal RNA (rRNA) fragments that are upregulated in cancer patients compared to healthy controls. In particular, the inventors found that 28S rRNA fragments were significantly upregulated in lung cancer patients compared to healthy controls. Furthermore, in clinical trials involving lung cancer patients, the inventors demonstrated that 28S rRNA fragments were more highly expressed with increasing tumor stage. The inventors also found that 28S rRNA fragment levels returned to normal after lung cancer surgery. Therefore, these RNA molecules can be used as biomarkers for cancer diagnosis, monitoring, recurrence control, detection of microlesions, and determining surgical resection status. Summary of the Invention

[0007] In a first aspect, the present invention provides a method of diagnosing cancer in a patient, comprising: The present invention relates to a method comprising determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence set forth in SEQ ID NO:1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0008] In a second aspect, the present invention provides a method for monitoring the progress of cancer in a patient, comprising: determining a level of an RNA molecule in a blood sample from the patient, wherein the RNA The molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0009] In a third aspect, the present invention provides a method for determining whether a patient will respond to a therapeutic treatment for cancer, comprising: The present invention relates to a method comprising determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence set forth in SEQ ID NO:1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0010] In a fourth aspect, the present invention provides a method for determining a patient's risk of cancer recurrence, comprising: The present invention relates to a method comprising determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence set forth in SEQ ID NO:1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0011] In a fifth aspect, the present invention provides a method for detecting minimal residual disease in a patient having cancer, comprising: The present invention relates to a method comprising determining the level of an RNA molecule in a blood sample from a patient, wherein the RNA molecule comprises a nucleotide sequence set forth in SEQ ID NO:1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto.

[0012] In a sixth aspect, the present invention relates to the use of an RNA molecule for diagnosing cancer in a patient, monitoring the progress of cancer in a patient, determining whether a patient will respond to therapeutic treatment for cancer, determining a patient's risk of cancer recurrence, and / or detecting minimal residual disease (MRD) in a patient with cancer, wherein the RNA molecule comprises, is a fragment of, or has a sequence with at least 80% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 1.

[0013] In a seventh aspect, the present invention relates to a kit for diagnosing cancer in a patient, monitoring the course of cancer in a patient, determining whether a patient will respond to therapeutic treatment for cancer, determining the risk of recurrence of cancer in a patient, and / or detecting minimal residual disease in a patient with cancer, wherein the kit comprises means for determining the level of an RNA molecule in a blood sample from the patient, wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, is a fragment thereof, or has a sequence with at least 80% sequence identity thereto.

[0014] This summary of the invention does not necessarily describe all features of the invention, and other embodiments will become apparent from review of the following detailed description.

[0015] Detailed Description of the Invention definition Before describing the present invention in detail below, it is to be understood that this invention is not limited to the particular methodology, protocols, and reagents described herein, as these may vary. Also, it is to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0016] Preferably, the terms used herein are those defined in "A multilingual glossary of biotechnology terms: (IUPAC Recommendations)", Leuenberger, HGW, Nage l, B. and Kolbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland.

[0017] Several documents are cited throughout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, GenBank Accession Number sequence submissions, etc.), whether supra or infra, is incorporated herein by reference in its entirety. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such disclosure by virtue of prior invention. In the event of a conflict between a definition or teaching of such incorporated reference and a definition or teaching recited herein, the text of this specification shall control.

[0018] According to the present invention, the term "comprise" or variations such as "comprises" or "comprising" means the inclusion of a stated integer or group of integers, but not the exclusion of any other integer or group of integers. According to the present invention, the term "consisting essentially of" means the inclusion of a stated integer or group of integers, but excluding modifications or other integers that would materially affect or alter the stated integer. According to the present invention, the term "consisting of" or variations such as "consists of" means the inclusion of a stated integer or group of integers, and the exclusion of any other integer or group of integers.

[0019] As used in the context of describing the present invention (particularly in the context of the claims), the terms "a," "an," and "the" and similar references should be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0020] As used herein, the term "about" indicates a certain variation from the quantitative value that precedes it. In particular, the term "about" allows for a variation of ±5% from the quantitative value that precedes it, unless otherwise indicated or inferred. The use of the term "about" also includes the specific quantitative value itself, unless otherwise specified. For example, the expression "about 80°C" allows for a variation of ±4°C, and therefore refers to a range of 76°C to 84°C.

[0021] Nucleotide and amino acid sequence similarity, i.e., percentage sequence identity, can be determined by sequence alignment. Such alignment can be performed using several art-known algorithms, preferably the mathematical algorithm of Karlin and Altschul (Karlin & Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5877), hmmalign ((HMMER package) or the CLUSTALW algorithm (Thompson, JD, Higgins, DG & Gibson, TJ (1994) Nucleic Acids Res. 22, 4673-80) or the CLUSTALW2 algorithm (Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. (2007). Clustal W and Clustal X version 2.0. Bioinformatics, 23, 2947-2948).

[0022] The degree of sequence identity (sequence matching) can be determined using, for example, BLAST, BLAT, or Blas The calculation can be performed using tZ (or BlastX). A similar algorithm is incorporated into the BLASTN and BLASTP programs of Altschul et al. (1990) J. Mol. Biol. 215:403-410. BLAST protein searches are performed using the BLASTP program, available, for example, at the following website: http: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastp&BLAST_PROGRAMS=blastp&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome. The preferred algorithm parameters used are the default parameters set on the specified website: Expectation threshold=10, word size=3, maximum match within query range=0, matrix=BLOSUM62, gap cost=presence:11 extension:1, composition adjustment=conditional composition score matrix adjustment and database of non-redundant protein sequences (nr).

[0023] To obtain gapped alignments for comparison purposes, Gapped BLAST is utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402. When utilizing the BLAST and Gapped BLAST programs, the default parameters of the respective programs are used. Sequence matching analysis can be supplemented by established homology mapping techniques such as Shuffle-LAGAN (Brudno M., Bioinformatics 2003b, 19 Suppl 1:I54-I62) or Markov Random Fields.

[0024] When percentages of sequence identity are referred to in this application, these percentages are calculated with respect to the entire length of the indicated reference sequence unless otherwise specified. For example, a reference to "a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity with SEQ ID NO: XYZ" means that the percentage of sequence identity is calculated with respect to the entire length of SEQ ID NO: XYZ. Variants of the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 are specifically described herein. The variant has at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.

[0025] When the percentage of sequence identity between two sequences is calculated, unless otherwise indicated, these percentages can also be calculated with respect to the entire length of the longer of the two sequences. For example, the statement "a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: XYZ" means that the percentage of sequence identity is calculated with respect to the longer of the two sequences (e.g., the relationship between the nucleotide sequence set forth in SEQ ID NO: 1 and the nucleotide sequence set forth in SEQ ID NO: 2, which is one nucleotide longer than the nucleotide sequence set forth in SEQ ID NO: 1).

[0026] As used herein, the term "RNA molecule" refers to a polymeric molecule that is essential in a variety of biological roles in the coding, decoding, regulation, and expression of genes. RNA and deoxyribonucleic acid (DNA) are nucleic acids. Along with lipids, proteins, and carbohydrates, nucleic acids constitute one of the four major macromolecules essential to all known living organisms. Like DNA, RNA is assembled as a chain of nucleotides; however, unlike DNA, RNA is found in nature as a single strand folded upon itself rather than as a paired double strand. Cellular organisms use messenger RNA (mRNA) to transmit genetic information (using the nitrogenous bases guanine, uracil, adenine, and cytosine, represented by G, U, A, and C) that directs the synthesis of specific proteins. Some RNA molecules play active roles within cells by catalyzing biological reactions, controlling gene expression, or sensing and transmitting responses to cellular signals. One of these active processes is protein synthesis, a universal function in which RNA molecules direct the synthesis of proteins on ribosomes. During this process, transfer RNA (tRNA) molecules are used to deliver amino acids to the ribosome, where ribosomal RNA (rRNA) links the amino acids to form the encoded protein.

[0027] As used herein, the term "ribosomal ribonucleic acid (rRNA)" refers to a type of non-coding RNA that is a major component of ribosomes and is essential in all cells. rRNA is a ribozyme that drives protein synthesis in ribosomes. Ribosomal RNA is transcribed from ribosomal DNA (rDNA) and then combines with ribosomal proteins to form large and small ribosomal subunits. rRNA is the physical and mechanical component of the ribosome, processing transfer RNA (tRNA) and messenger RNA (mRNA) and translating the latter into proteins. Ribosomal RNA is the major form of RNA found in most cells, accounting for approximately 80% of intracellular RNA, even though it is not itself translated into proteins. Ribosomes are composed of approximately 60% rRNA and 40% ribosomal proteins by mass.

[0028] Mammalian cells have two mitochondrial (12S and 16S) rRNA molecules and four cytoplasmic rRNA molecules (28S, 5.8S, 18S, and 5S subunits). The 28S, 5.8S, and 18S rRNAs are encoded by a single transcription unit (45S) separated by two internal transcribed spacers. The first spacer corresponds to that found in bacteria and archaea, and the other spacer is inserted into the prokaryotic 23S rRNA. The 45S rDNA is organized into five clusters (each containing 30–40 repeats) on chromosomes 13, 14, 15, 21, and 22. These are transcribed by RNA polymerase I. The 5S subunit DNA is arranged in tandem (approximately 200–300 true 5S genes and numerous scattered pseudogenes), the largest of which is located on chromosome 1q41–42. The 5S rRNA is transcribed by RNA polymerase III. In most eukaryotes, the 18S rRNA is located within the small ribosomal subunit, and the large subunit contains three types of rRNA (5S, 5.8S, and 28S).

[0029] The present inventors have identified 28S ribosomal RNA (rRNA) fragments that are upregulated in cancer patients compared to healthy controls. In particular, the inventors found that 28S rRNA fragments were significantly upregulated in lung cancer patients compared to healthy controls. Furthermore, in clinical trials of lung cancer patients, the inventors demonstrated that 28S rRNA fragments were more highly expressed with increasing tumor stage. The inventors found that 28S rRNA fragment levels returned to normal after lung cancer surgery. Therefore, these RNA molecules can be used as biomarkers for cancer diagnosis, monitoring, recurrence control, detection of microlesions, and determining surgical resection status.

[0030] As used herein, the term "28S ribosomal RNA (rRNA)" refers to the structural ribosomal RNA (rRNA) for the large subunit (LSU) of the eukaryotic cytoplasmic ribosome. A) and therefore refers to one of the basic components of all eukaryotic cells. In mammals, it has the size of 28S, hence the name. The 28S rRNA described herein has the following nucleotide sequence: GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1). The variant of 28S rRNA described herein has the following nucleotide sequence: GCCGCCGGUGAAAUACCACUAC U (SEQ ID NO: 2). Thus, the nucleotide sequence set forth in SEQ ID NO: 2 is one nucleotide longer than the nucleotide sequence set forth in SEQ ID NO: 1. The levels of both nucleotide sequences can be determined by the methods of the present invention. This term covers RNA molecules that contain the nucleotide sequence set forth in SEQ ID NO: 2 as well as the nucleotide sequence set forth in SEQ ID NO: 1.

[0031] The term "cancer" as used herein refers to or describes a physiological condition in an individual that is typically characterized by unregulated cell proliferation. Examples of cancer include, but are not limited to, lung cancer, preferably non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC), breast cancer, cervical cancer, gastric cancer, bladder cancer, skin cancer, nasopharyngeal cancer, neuroendocrine cancer, colon cancer, urothelial cancer, liver cancer, ovarian cancer, esophageal cancer, pancreatic cancer, renal cancer, head and neck cancer, brain cancer, lymphatic cancer, blood cancer, squamous cell carcinoma, laryngeal cancer, retinal cancer, prostate cancer, uterine cancer, testicular cancer, bone cancer, tonsillar cancer, esophageal cancer, lymphoma, and leukemia. The term "cancer" as used herein also encompasses cancer metastasis.

[0032] Preferably, the cancer is selected from the group consisting of lung cancer, such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS), bladder cancer, colon cancer, esophageal cancer, gastric cancer, tonsillar cancer, and uterine cancer. More preferably, the cancer is lung cancer, for example, lung cancer at stage I, II, III, or IV. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC), for example, NSCLC at stage I, II, III, or IV, or small cell lung cancer (SCLS), for example, NSCLC at stage I, II, III, or IV. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC), for example, NSCLC at stage I, II, III, or IV.

[0033] As used herein, the term "pulmonary cancer" refers to a disease consisting of uncontrolled cell proliferation in lung tissue. This proliferation can lead to metastasis, which is invasion into adjacent tissues and invasion beyond the lung. The majority of primary lung cancers are lung cancers derived from epithelial cells. Lung cancer is the most common cause of cancer-related death in both men and women. The most common symptoms are shortness of breath, cough (including hemoptysis), and weight loss. The lung cancer can be stage I, II, III, or IV lung cancer. Preferably, the lung cancer is non-small cell lung cancer (NSCLC), e.g., stage I, II, III, or IV NSCLC, or small cell lung cancer (SCLC), e.g., stage I, II, III, or IV NSCLC. More preferably, the lung cancer is non-small cell lung cancer (NSCLC), e.g., stage I, II, III, or IV NSCLC.

[0034] Lung cancer can be staged as follows: Stage I means that the cancer is small. It has not spread to lymph nodes or other distant organs. Stage I belongs to the early stages of lung cancer. Stage I can be divided into stages IA and IB. Stage IA means the cancer is 3cm or smaller. Stage IB means the cancer is 3 to 4 centimeters in size. It may also have grown into structures such as the main airways of the lungs (main bronchi) or the membranes that cover the lungs (visceral pleura).

[0035] Stage II still belongs to the early stage of lung cancer. Divided into stage IIA and stage IIB, part of the affected lung may have collapsed. Stage IIA means the cancer is 4-5cm in size but there are no cancer cells in any of the lymph nodes. Stage IIB means the cancer is up to 5 cm in size and has cancer cells in lymph nodes near the affected lung; or it is between 5 cm and 7 cm but no cancer cells are in any lymph nodes; or the cancer has not reached any lymph nodes and has spread to one or more areas of the chest wall (ribs, muscle, or skin), nerves near the lung (phrenic nerve), or membranes covering the heart (mediastinal pleura and parietal pericardium); or the cancer is smaller than 7 cm but there are multiple tumors in the same lobe of the lung.

[0036] Stage III is divided into stages IIIA, IIIB, and IIIC. It is also sometimes called locally advanced lung cancer. In Stage IIIA, the cancer is up to 5 cm in size and has spread to lymph nodes in the central chest on the same side as the tumor. Alternatively, the cancer is between 5 cm and 7 cm in size and there are multiple tumors in the same lobe of the lung. Alternatively, the cancer has spread to one or more areas just outside the lung, such as the chest wall (ribs, muscle, or skin), nerves near the lung (phrenic nerve), membranes covering the heart (mediastinal pleura and parietal pericardium), or the lung or lymph nodes near the lung. Alternatively, the cancer is larger than 7 cm. It has not spread to lymph nodes, but has spread to one or more of the following areas: the muscle below the lung (diaphragm), the central area of ​​the chest (mediastinum), the heart, major blood vessels, the trachea, nerves leading to the larynx, the esophagus, the vertebrae, or the area where the trachea branches (carina). Alternatively, the cancer is in multiple lobes of the same lung, and there may also be cancer cells in lymph nodes near the affected lung. Stage IIIB can mean a variety of things: the cancer is smaller than 5 cm and has spread to the chest on the opposite side of the affected lung, the neck, or above the collarbone; or the cancer is 5 cm to 7 cm and has spread to lymph nodes in the central chest; or the cancer is of any size and has spread to lymph nodes in the central chest and to one or more areas of the chest wall, the muscles under the lungs (diaphragm), or the membranes covering the heart (mediastinal pleura and parietal pericardium); or the cancer has spread to lymph nodes in the central chest; or the lung tumor is 7 cm or larger or has spread to major structures in the chest, such as the heart, trachea, esophagus, or major blood vessels. Stage IIIC means the cancer is between 5 cm and 7 cm in size or has spread to the nerves near the lung (phrenic nerve) or the membrane covering the heart (parietal pericardium) and one or more lymph nodes in the central chest on the opposite side of the affected lung, the upper part of the same lung, or above the collarbone. Alternatively, there are multiple tumors in different lobes of the same lung. Alternatively, Stage IIIC means the cancer is larger than 7 cm or has spread to the muscles below the lung (diaphragm), the central chest (mediastinum), the heart, major blood vessels, trachea, nerves leading to the larynx (recurrent laryngeal nerve), the food pipe (esophagus), vertebrae, or the area where the trachea branches (carina), and has spread to the central chest on the opposite side of the affected lung, the upper part of the same or opposite lung, or lymph nodes above the collarbone. Alternatively, there are tumors in multiple lobes of the lung.

[0037] Stage IV means that the lung cancer has metastasized. This can be described as advanced lung cancer. It is divided into stage IVA and stage IVB. Stage IVA means either: cancer is found in both lungs, cancer is in the lining of the lungs (pleura) or heart (pericardium), or there is fluid containing cancer cells around the lungs or heart. It may also mean that an area of ​​cancer has spread to lymph nodes outside the chest or to organs such as the liver or bones. Stage IVB means the cancer has spread to multiple areas in one or more organs.

[0038] The term "(therapeutic) treatment / therapy" as used herein relates to any treatment / therapy that improves the health status and / or prolongs (increases) the lifespan of a patient. The treatment may eliminate the disease in the patient, may prevent, inhibit, or delay the onset of the disease in the patient, may reduce the frequency or severity of the patient's symptoms, and / or may reduce recurrence in patients who currently or previously had the disease.

[0039] The term "cancer therapy" as used herein refers to any protocol, method, and / or agent that can be used in the prevention, management, treatment, and / or amelioration of cancer. In particular, the term "cancer therapy" as used herein means achieving one or more of the following: (i) tumor growth inhibition and / or tumor cell death, (ii) reduction in tumor markers, (iii) shrinkage of tumor lesions and metastases, (iv) reduction in tumor burden as evidenced by imaging (e.g., computed tomography (CT), magnetic resonance imaging (MRI), positron emission tomography (PET), etc.), and (v) reduction in tumor burden as evidenced by clinical assessment or self-report by the patient.

[0040] Specifically, cancer therapies include, but are not limited to, drug therapy, supportive therapy, and / or other therapies useful in the prevention, management, treatment, and / or amelioration of cancer known to those skilled in the art, such as medical professionals. More specifically, cancer therapies include, but are not limited to, surgery, chemotherapy, targeted therapy, immunotherapy, oncolytic virus therapy, vaccination therapy, radiation therapy, laser therapy, hyperthermia, and administration of drugs, or combinations thereof, such as, for example, a combination of chemotherapy and immunotherapy.

[0041] The drug administered to a patient in need thereof is preferably selected from the group consisting of immunomodulators, chemotherapeutics, immunotherapeutics, immunosuppressants, radiotherapeutics, oncolytic viruses, vaccines, and antibodies. Combinations of these drugs can also be administered, for example, a chemotherapeutic drug combined with an immunotherapeutic drug. The administration of a chemotherapeutic drug combined with an immunotherapeutic drug can be referred to as immunochemotherapy.

[0042] The term "chemotherapy" as used herein refers to a type of cancer treatment that uses one or more anti-cancer drugs, also known as chemotherapeutic agents, as part of a standardized chemotherapy regimen. Chemotherapy can be used with curative intent (preferably a combination of drugs) or to prolong life or relieve symptoms (palliative chemotherapy). Preferably, the chemotherapy is platinum doublet chemotherapy.

[0043] As used herein, the term "chemotherapeutic agent" refers to any agent that directly or indirectly inhibits the uncontrolled growth and proliferation of cancer cells. Chemotherapeutic agents include, but are not limited to, alkylating agents, antimetabolites, folinic acid, antifolates, mitotic inhibitors, anthracyclines, topoisomerase inhibitors, antibodies, signal transduction inhibitors, angiogenesis inhibitors, and / or histone deacetylase inhibitors. Preferably, the chemotherapeutic agent is a platinum doublet.

[0044] The term "radiation therapy" as used herein refers to a type of cancer treatment that uses ionizing radiation to control or kill cancerous / malignant cells. Ionizing radiation is usually delivered by a linear accelerator. Radiation therapy can treat some types of cancer when they are localized to one area of ​​the body. It may also be used as part of adjuvant therapy to prevent tumor recurrence after surgery to remove the primary malignant tumor. Radiation therapy works synergistically with chemotherapy and can be used before, during, or after chemotherapy in sensitive cancers.

[0045] The term "immunotherapy" refers to any treatment in which one or more components of the human or animal immune system are intentionally modulated to achieve, directly or indirectly, some therapeutic benefit, including systemic and / or local effects, and prophylactic and / or therapeutic effects. Immunotherapy can be administered systemically, locally, or both, by any route (e.g., oral, intravenous, transdermal, injection, inhalation, etc.). ) to a human or animal subject, either alone or in any combination. Immunotherapy can involve inducing, increasing, decreasing, stopping, preventing, blocking, or otherwise modulating cytokine production, and / or activating or inactivating cytokines or immune cells, and / or modulating immune cell levels, and / or delivering one or more therapeutic or diagnostic substances to specific locations or types of cells or tissues in the body, and / or destroying specific cells or tissues. Immunotherapy can be used to achieve a local effect, a systemic effect, or both. Immunotherapy can also be used to reduce or eliminate side effects that may be caused by other anti-cancer treatments.

[0046] Immunotherapies designed to induce or amplify immune responses are classified as activating immunotherapies, and those that reduce or suppress immune responses are classified as suppressing immunotherapies. Antitumor immunotherapies have broad potential, demonstrating durable and potent responses across a wide range of malignancies, making them suitable for the treatment of many different types of advanced cancers.

[0047] Immunotherapy involves the administration of an immunotherapeutic agent.

[0048] As used herein, the term "immunotherapeutic agent" refers to any drug, compound, or biological agent that indirectly or directly restores, enhances, stimulates, or increases the body's immune response to cancer cells and / or reduces the side effects of other anti-cancer treatments. Examples of common immunotherapeutic agents known in the art include, but are not limited to, checkpoint inhibitors, cytokines, cancer vaccines, antibodies such as monoclonal antibodies, and / or non-cytokine adjuvants. Alternatively, or in addition, immunotherapeutic treatment involves the administration of immune cells (e.g., T cells, NK cells, dendritic cells, B cells, etc.) to the patient. In particular, the immune cells are antigen-presenting cells and / or chimeric antigen receptor T cells.

[0049] As used herein, the term "immunochemotherapy" refers to the treatment and management of diseases such as cancer by combining immunotherapy with chemotherapy. Chemotherapy uses various drugs to kill or slow the growth of cancer cells, while immunotherapy uses treatments to stimulate or restore the immune system's ability to fight cancer. In particular, immunochemotherapy is a combination anti-cancer therapy to improve treatment response and outcome. Immunochemotherapy is the combination of the administration of immunotherapeutic agents with the administration of chemotherapeutic agents.

[0050] The term "oncolytic virotherapy" as used herein refers to a type of cancer treatment that uses oncolytic viruses. Oncolytic viruses are viruses that kill tumor cells directly or indirectly. Oncolytic viruses have different mechanisms of action, such as by infecting and lysing tumor cells, by triggering an immune response, or by introducing toxins and tumor suppressor genes into tumor cells. Oncolytic virotherapy is sometimes considered a type of immunotherapy.

[0051] The term "vaccination therapy" as used herein refers to a type of cancer treatment that uses vaccines. The vaccines work to strengthen the body's immune system to fight cancer. Doctors administer therapeutic vaccines to people who already have cancer. Vaccine therapy is sometimes considered a type of immunotherapy.

[0052] The term "laser therapy" as used herein refers to a type of cancer treatment that uses a powerful, narrow beam of light to remove or destroy cancer or abnormal cells that may turn into cancer. Tumor cells absorb different wavelengths (or colors) of light than normal cells. Therefore, by choosing the appropriate wavelength of the laser, tumor cells can be targeted. Laser therapy is a type of localized treatment, meaning that it treats specific parts of the body.

[0053] The term "hyperthermia" as used herein refers to a type of cancer treatment that uses heat to treat cancer. In particular, hyperthermia is a type of treatment in which body tissue is heated to temperatures as high as 45°C to help damage and kill cancer cells with little or no harm to normal tissue. Hyperthermia for treating cancer is also referred to as thermal therapy, thermal ablation, or thermotherapy.

[0054] As used herein, the term "response" refers to a change in a patient's condition that occurs as a result of or correlates with cancer treatment. In some embodiments, the response is or includes a beneficial response. In some embodiments, a beneficial response can include stabilization of the condition (e.g., prevention or delay of a deterioration that would be expected to occur or typically observed in the absence of treatment), improvement of one or more symptoms of the condition (e.g., a reduction in frequency and / or intensity), and / or improved likelihood of a cure for the condition, etc. In particular, the response is the response of a patient afflicted with cancer to cancer treatment.

[0055] Specifically, a cancer patient or (control) subject suffering from cancer being treated with a cancer therapy is considered to be "responsive," "has a response," "has a positive response," or "is responsive" to a cancer therapy if the individual shows evidence of an anti-cancer effect according to a set of objective criteria accepted in the art, or reasonable modifications thereof, including a clinically significant benefit such as prevention or reduction in severity of symptoms, or delay in cancer progression. It is understood that the foregoing terms can also be used in reference to cancer. In contrast, a cancer patient or (control) subject suffering from cancer who is being treated with a cancer therapy is considered to have a "non-response," "no response," "negative response," or be "non-responsive" to the cancer therapy if the treatment does not provide a clinically significant benefit, such as preventing or reducing the severity of symptoms or the rate of cancer progression.

[0056] As used herein, the term "diagnosing cancer" means determining whether a patient exhibits symptoms of or is afflicted with cancer.

[0057] As used herein, the term "monitoring the progress of a patient's cancer" means determining whether a patient has developed cancer over time, or determining the progression of a patient's cancer over time, for example, determining whether a patient's cancer gets worse, does not get worse / remains stable, or improves over time.

[0058] As used herein, the term "determining whether a patient will respond to a cancer therapeutic treatment" means evaluating whether a therapeutic approach is effective for a patient. A patient may be identified as a patient who responds to cancer therapy. In this case, the cancer therapeutic treatment is continued. Specifically, the dose of a drug administered during the cancer therapeutic treatment is adjusted (e.g., reduced), and / or the frequency of administration of the drug during the cancer therapeutic treatment is adjusted (e.g., reduced). A patient may also be identified as a patient who does not respond to cancer therapy. In this case, the administration scheme is changed, or the cancer therapeutic treatment is changed. Specifically, the dose of a drug administered during the cancer therapeutic treatment is adjusted, e.g., increased, and / or the frequency of administration of the drug during the cancer therapeutic treatment is adjusted, e.g., increased.

[0059] Preferably, the therapeutic treatment for cancer is selected from the group consisting of surgery, chemotherapy, targeted therapy, immunotherapy, oncolytic virus therapy, vaccination therapy, radiation therapy, laser therapy, hyperthermia, and administration of drugs, or a combination thereof, such as chemotherapy and immunotherapy (immunochemotherapy). More preferably, the drug is selected from the group consisting of immunomodulators, chemotherapeutics, immunotherapeutics, immunosuppressants, radiotherapeutics, oncolytic viruses, vaccines, and antibodies. is selected from the group.

[0060] As used herein, the term "determining a patient's risk of cancer recurrence" refers to detecting whether a patient who is in remission (i.e., has no symptoms or signs of the disease) is at risk of developing the disease again. Recurrence occurs when cancer reappears after treatment. This can occur weeks, months, or even years after the primary or initial cancer is treated. It is impossible to know for sure whether cancer will recur. The likelihood of recurrence varies depending on the type of primary cancer. Cancer recurs because small areas of cancer cells may remain in the body after treatment. Over time, these cells may multiply and grow large enough to cause symptoms or be detected by testing. The time and location of cancer recurrence vary depending on the type of cancer. Some cancers have predictable patterns of recurrence. Cancer can recur in the same part of the body as the primary cancer, called a local recurrence; nearby the location of the primary cancer, called a regional recurrence; or in another part of the body, called a distant recurrence. Recurrent cancers are named after the location of the primary cancer, even if they recur in other parts of the body. For example, if breast cancer recurs in the liver, it is still called breast cancer, not liver cancer. Doctors call this metastatic breast cancer. Metastatic means that the cancer has spread to other parts of the body.

[0061] As used herein, the term "minimal residual disease (MRD)" is the name given to the small number of cancer cells that remain in a patient during treatment or after treatment when the patient is in remission (no symptoms or signs of disease). This is a major cause of cancer recurrence. In cancer treatment, MRD testing has several important roles: determining whether treatment has eradicated the cancer or whether any traces remain, comparing the effectiveness of different treatments, monitoring a patient's remission status and detecting cancer recurrence, and selecting the treatment that best meets these needs.

[0062] Preferably, the cancer is lung cancer, for example, stage I, II, III, or IV lung cancer. More preferably, the lung cancer is non-small cell lung cancer (NSCLC), for example, stage I, II, III, or IV NSCLC, or small cell lung cancer (SCLS), for example, stage I, II, III, or IV SCLS. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC), for example, stage I, II, III, or IV NSCLC.

[0063] As used herein, the term "neoadjuvant therapy" refers to therapy administered prior to the planned primary treatment (usually surgery) for a neoplastic disease. Neoadjuvant therapy aims to reduce the size or extent of the cancer before using a definitive therapeutic intervention, thereby making the procedure easier and more likely to be successful, and reducing the impact of more extensive treatment techniques that would be required if the tumor size or extent had not decreased. Neoadjuvant therapy can include, for example, chemotherapy, radiation therapy, hyperthermia, immunotherapy, or hormonal therapy.

[0064] The term "adjuvant therapy" as used herein refers to therapy administered in addition to primary or initial treatment to maximize its effectiveness. Due to the surgery and complex treatment regimens used in cancer treatment, this term has come to be used primarily to describe adjuvant cancer therapy. An example of such adjuvant therapy is additional treatment, usually administered after surgery, when all detectable disease has been removed but there remains a statistical risk of recurrence due to the presence of undetected disease. If known disease remains after surgery, subsequent treatment is not technically adjuvant therapy. For example, patients with minimal residual disease (MRD) preferably undergo such adjuvant therapy. Adjuvant therapy includes, for example, chemotherapy, radiation therapy, hyperthermia, immunotherapy, or hormonal therapy. It can be seen.

[0065] As used herein, the term "remission" means that treatment has reduced or eliminated the symptoms and / or signs of a disease, such as cancer. Remission may last for months, years, or the rest of a patient's life. In the case of cancer, remission can be complete or partial. Cancer is considered to be in complete remission if there is no evidence of cancer in physical exams, blood tests, or imaging tests. For example, if a patient has lung cancer in complete remission, the patient's symptoms improve and a computed tomography (CT) scan shows that the cancer has disappeared. Complete remission does not mean that the cancer is gone forever; cancer can recur. Furthermore, cancer is considered to be in partial remission if imaging and blood tests show that the tumor is at least 50% smaller than before treatment and / or tumor cells are no longer growing. A patient is considered cured of cancer if they are free of signs and symptoms of cancer for at least five years after treatment ends.

[0066] The term "recurrence" as used herein means the return of symptoms and / or signs of a disease, such as cancer. In other words, if a disease, such as cancer, is discovered after treatment and after a period in which the disease, such as cancer, was not detected, it is referred to as a recurrence of the disease, such as cancer recurrence. In the case of cancer, local recurrence means that the cancer is in the same place or very close to the original cancer. In the case of cancer, regional recurrence means that the tumor has grown in lymph nodes or tissues near the original cancer. In the case of cancer, distant recurrence means that the cancer has metastasized to organs or tissues distant from the original cancer.

[0067] As used herein, the term "progression" means that the symptoms and / or signs of a disease, such as cancer, get worse or increase over time. In the case of cancer, the cancer spreads (further) in the body. To indicate the progression of cancer, cancers are usually assigned to various stages, with the lowest stage representing early and small cancer / tumor forms, and the higher stages classifying advanced and / or metastatic cancers. Most cancers are classified into one of four stages, 1 to 4.

[0068] The term "stable disease" as used herein refers to a disease, such as cancer, that is neither decreasing nor increasing in degree or severity. Furthermore, the term "stable disease" as used herein refers to a disease, such as cancer, that is neither worsening nor improving over time. In a stable patient, the patient's condition remains constant. "Stable" preferably means no more than 10% or 20% (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20%) change over time. Small changes over time may be fluctuations within the precision of the measurement. The precision of the measurement depends on the measurement method used. More preferably, the level remains constant over time.

[0069] The term "patient" as used herein refers to any subject for whom it is desired to know whether or not they have cancer. In particular, the term "patient" as used herein refers to a subject suspected of having cancer. A patient can be diagnosed with cancer, i.e., with the disease, or can be diagnosed without cancer, i.e., healthy. The term "patient" as used herein also refers to a subject with cancer, i.e., who is diseased. A patient can be monitored to determine whether the cancer further progresses over time. In particular, a patient can be monitored in the form of longitudinal monitoring. Thus, the progress of cancer (particularly after or during treatment) can be observed in the patient. A patient can also be re-examined for cancer and diagnosed as to whether or not cancer has developed over time.

[0070] The term "patient" as used herein further refers to a subject suffering from cancer for whom it is desired to know whether they will respond to cancer treatment. In this case, the cancer therapeutic treatment is continued. Specifically, the dose of the drug administered during the cancer therapeutic treatment is adjusted, e.g., decreased, and / or the frequency of administration of the drug during the cancer therapeutic treatment is adjusted, e.g., decreased. The patient may also be identified as a patient not responding to cancer treatment. In this case, the administration scheme is changed or the cancer therapeutic treatment is changed. Specifically, the dose of the drug administered during the cancer therapeutic treatment is adjusted, e.g., increased, and / or the frequency of administration of the drug during the cancer therapeutic treatment is adjusted, e.g., increased. Furthermore, as used herein, the term "patient" refers to any subject for whom it is desired to know whether the subject (in remission) is at risk of becoming ill again or experiencing a recurrence. A patient can be identified as a patient at risk of recurrence. Furthermore, as used herein, the term "patient" refers to any subject for whom it is desired to know whether cancer treatment has eradicated the cancer or whether any traces remain. A patient (in remission) can be identified as a patient who still has a small number of cancer cells after treatment. Such patients have minimal residual disease (MRD). Patients with minimal residual disease (MRD) are preferably assigned to or eligible for adjuvant therapy. It should be noted that patients who are healthy, i.e., diagnosed as cancer-free, may have another disease or condition that has not been tested for / is unknown. The patient may also be a cancer patient in remission with stable or progressing cancer. The patient can be any mammal, including both humans and other mammals (e.g., animals such as rabbits, mice, rats, or monkeys). Human individuals are particularly preferred.

[0071] The term "(control) subject" as used herein refers to a subject known not to have cancer (negative control), i.e., a healthy subject. The term "(control) subject" as used herein also refers to a subject with cancer (positive control), i.e., a diseased subject. The (control) subject may have developed an advanced form of cancer, for example, a cancer of a higher grade or stage. The term "(control) subject" as used herein further refers to a subject known to be a responder to a therapeutic treatment for cancer or a non-responder to a therapeutic treatment for cancer. In addition, the term "(control) subject" as used herein further refers to a cancer patient who has been successfully treated.

[0072] It should be noted that (control) subjects known to be healthy, i.e., cancer-free, may be suffering from another untested / unknown disease or condition. The (control) subject may be any mammal, including both humans and other mammals (e.g., rabbits, mice, rats, or monkeys). Healthy human individuals are particularly preferred.

[0073] The term "blood sample" as used herein includes whole blood or blood fractions. Preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum. In particular, the blood fraction is selected from the group consisting of a blood cell fraction and plasma or serum. For example, the blood cell fraction includes red blood cells, white blood cells, and / or platelets. More preferably, the blood cell fraction is a white blood cell fraction or a mixture of red blood cells, white blood cells, and platelets.

[0074] Preferably, the blood sample has a volume of 0.01 to 20 ml, more preferably 0.1 to 10 ml, even more preferably 0.5 to 8 ml, and most preferably 1 to 5 ml.

[0075] The blood sample is provided by drawing blood from a patient or (control) subject. The amount of the antibody can be determined by the antibody itself, but can also be provided by using a previously isolated sample. For example, a blood sample can be taken from a patient or (control) subject by conventional blood collection techniques.

[0076] Blood samples can also be obtained from patients or (control) subjects before the start of therapeutic treatment, during therapeutic treatment, and / or after therapeutic treatment. When a blood sample is obtained from at least one (control) subject (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, or 1,000 (control) subjects), it is referred to as a "reference blood sample." Preferably, the reference blood sample is from the same source as the patient's blood sample to be tested, e.g., both are whole blood samples or blood cell fractions. It is more preferred that both are from the same species, e.g., human. It is also (alternatively or additionally) preferred that the measurements of the (control) subject's reference blood sample and the patient's blood sample to be tested are identical, e.g., both have the same volume. It is particularly preferred that the reference blood sample and the blood samples are from (control) subjects / patients of the same sex and similar age. Whole blood samples can be collected using blood collection tubes. For example, they can be collected in PAXgene Blood RNA tubes, Tempus Blood RNA tubes, EDTA tubes, Na-citrate tubes, heparin tubes, or ACD tubes (acid citrate dextrose). Alternatively, whole blood samples can be collected in blood collection tubes containing cell-free nucleic acid stabilizing chemical agents such as glutaraldehyde, formaldehyde, or similar (e.g., Streck cfRNA BCT tubes, Streck cfDNA BCT tubes), or in blood collection tubes containing cell-concentrating agents such as polyethylene glycol (PEG) (e.g., Norgen cfDNA / cfRNA storage tubes).

[0077] As used herein, blood samples, particularly whole blood samples, may also be used, for example, in the preparation of blood samples by Mitra. Blood can also be collected by blood spotting, such as by using a microsampling device. This technique requires smaller sample volumes, typically 45-60 μL or less for humans. For example, whole blood can be extracted from a patient by pricking their finger with a needle or lancet. Thus, the whole blood sample can be in the form of a blood drop. The blood drop is then placed on an absorbent probe, such as a hydrophilic polymer material like cellulose, that can absorb whole blood. Once sampling is complete, the blood spot is allowed to dry in the air before being transported to a laboratory for processing or mailed. Because blood is dry, it is not considered hazardous. Therefore, no special precautions need to be taken in handling or transportation. At the site of analysis, the desired components, such as the RNA molecules described herein, are extracted from the dried blood spot into the supernatant and then further analyzed. In this way, the level of the RNA molecule is determined. This technique is suitable for monitoring cancer patients at home (home care / home sampling-based) or for screening purposes.

[0078] In the methods described herein, the level of an RNA molecule is determined in a patient's blood sample. As used herein, the term "level" refers to the amount (e.g., measured in grams, moles, or ions) or concentration (e.g., absolute or relative concentration, e.g., reads per million (RPM) or NGS counts) of an RNA molecule. As used herein, the term "level" also includes scaled, normalized, or scaled and normalized amounts or values ​​(e.g., RPM). In particular, the level of an RNA molecule can be determined by sequencing, preferably next-generation sequencing (e.g., ABI SOLID, Illumina Genome Analyzer, Roche 454 GS FL, BGISEQ), nucleic acid hybridization (e.g., microarray or bead), nucleic acid amplification (e.g., PCR, RT-PCR, qRT-PCR, or high-throughput RT-PCR). R), polymerase extension, mass spectrometry, flow cytometry (e.g., LUMINEX), or any combination thereof. Specifically, the level of an RNA molecule is the expression level of said RNA molecule.

[0079] Those skilled in the art will understand that in many embodiments described herein, the determined RNA molecule level is compared to an appropriate RNA molecule "reference level." Specifically, the level of the RNA molecule is compared to the reference level of the RNA molecule. More specifically, the reference level of the RNA molecule is determined in a blood sample from a (control) subject. Even more specifically, the reference level is empirically determined by measuring multiple reference blood samples from subjects with cancer known to be responders or non-responders to cancer treatment, or by measuring multiple reference blood samples from subjects with cancer with a known good or bad survival prognosis. Typically, as will be understood by those skilled in the art, the reference level is determined under conditions equivalent to those utilized to determine or analyze the RNA molecule level in a patient's blood sample.

[0080] The reference level may be a cutoff or threshold level. Typically, the cutoff or threshold level can be determined experimentally, empirically, or theoretically. As will be appreciated by those skilled in the art, the cutoff or threshold level can also be arbitrarily selected based on existing experiments and / or clinical conditions. The cutoff or threshold level must be determined to obtain optimal sensitivity and specificity according to the function of the test and the benefit / risk balance (clinical consequences of false positives and false negatives). Typically, the optimal sensitivity and specificity (and threshold level) can be determined using a receiver operating characteristic (ROC) curve based on experimental data. For example, after determining the RNA molecule levels in the reference group, algorithmic analysis can be used for statistical processing of the measured RNA molecule levels in the tested sample, thereby obtaining a classification criterion with significance for sample classification. The full name of the ROC curve is a receiver operating characteristic curve, which is a receiver operating characteristic curve. It is also known as the ROC curve (Reception Operating Characteristic Curve). It is primarily used in clinical biomarker testing. The ROC curve is a comprehensive index that reflects the continuous variables of true positive rate (sensitivity) and false positive rate (1-specificity). The relationship between sensitivity and specificity was revealed using image synthesis. A series of different cutoff or threshold levels are set as continuous variables, and a series of sensitivity and specificity values ​​are calculated. The curve is then drawn using sensitivity as the vertical coordinate and specificity as the horizontal coordinate. The higher the area under the curve (AUC), the higher the accuracy of prediction / prognosis / diagnosis. On the ROC curve, the point closest to the top left of the coordinate diagram is the critical point with both high sensitivity and high specificity values. The AUC value of the ROC curve is between 1.0 and 0.5. If AUC>0.5, the prediction / prognosis / diagnosis result is better as the AUC approaches 1.

[0081] The term "classifier" as used herein refers to a prediction / prognosis model that allows for differentiation or characterization of a given sample by classifying the sample into a predetermined class based on specific characteristics of the sample. For example, the classification can predict with relatively high sensitivity and specificity if a blood sample from a patient with unknown response prognosis belongs to one of two given classes (each class represents a predicted estimated response). The output can be given as a probability of belonging to any class between 0 and 1. The classification can also predict with relatively high sensitivity and specificity if a blood sample from a patient with unknown survival prognosis belongs to one of two given classes (each class represents a predicted estimated survival). The output can be given as a probability of belonging to any class between 0 and 1. Specifically, the classifier allows for differentiation of responders to cancer therapy from non-responders to cancer therapy.

[0082] In the context of the present invention, the term "kit of parts" (or kit for short) is understood to be any combination of at least some of the components identified herein, combined into a functional unit, spatially coexistent, and which may include further components.

[0083] Embodiments of the present invention The present invention will now be further described. In the following text, different aspects of the present invention will be defined in more detail. Each aspect thus defined can be combined with any other aspect, unless expressly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous can be combined with any other feature or features indicated as being preferred or advantageous, unless expressly indicated to the contrary.

[0084] The present inventors have identified 28S ribosomal RNA (rRNA) fragments that are upregulated between cancer patients and healthy controls. In particular, the inventors found that 28S rRNA fragments were significantly upregulated in lung cancer patients compared with healthy controls. Additionally, in clinical trials involving lung cancer patients, the inventors demonstrated that 28S rRNA fragments were more highly expressed with increasing tumor stage. The inventors found that 28S rRNA fragment levels returned to normal after lung cancer surgery. Therefore, these RNA molecules can be used as biomarkers for cancer diagnosis, monitoring, recurrence control, detection of microlesions, and determining surgical resection status.

[0085] Thus, in a first aspect, the present invention provides an (in vitro) method of diagnosing cancer in a patient (suspected of having cancer), comprising: determining the level of an RNA molecule in a blood sample from a patient (suspected of having cancer), wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, or is a fragment thereof, or has a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto. Regarding the method.

[0086] in particular, (i) the nucleotide sequence set forth in SEQ ID NO: 1; (ii) a nucleotide sequence which is a fragment of the nucleotide sequence according to (i), preferably a fragment which is 1 to 12, more preferably 1 to 8, and most preferably 1 to 5 or 1 to 3, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides shorter than the nucleotide sequence according to (i); or (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity to the nucleotide sequence set forth in (i) or the nucleotide sequence fragment set forth in (ii); The level of an RNA molecule comprising the gene is determined in the blood sample.

[0087] In one embodiment, the level of the RNA molecule is compared to a reference level of the RNA molecule. Thus, in one particular embodiment, the present invention provides a method for diagnosing cancer in a patient ( An in vitro method comprising: (i) determining the level of an RNA molecule in a blood sample from the patient; and (ii) comparing the level of the RNA molecule to a reference level of said RNA molecule; wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, or is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto. Regarding the method.

[0088] The above comparison makes it possible to diagnose cancer in a patient, particularly in a patient suspected of having cancer. The patient may be diagnosed as having cancer, i.e., as being sick, or may be diagnosed as not having cancer, i.e., as being healthy.

[0089] The reference level can be any level that allows determining whether a patient has cancer or not.It can be obtained from a (control) subject (i.e., a subject different from the tested patient, such as a healthy subject and / or a subject known to have cancer), or from the same patient.In the latter case, the patient can be re-examined for cancer, for example, in the form of longitudinal monitoring.It can be determined that the patient currently has cancer or has not yet had cancer.

[0090] In particular, the reference level is a level of an RNA molecule that is empirically determined by measuring a number of reference blood samples from healthy subjects and / or subjects with / known to have cancer.

[0091] for example, the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from healthy subjects; and / or The reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from subjects with / known to have cancer.

[0092] Specifically, the reference level is an average reference level. It is determined by measuring the reference level of a control subject (e.g., a healthy subject or a subject with / known to have cancer) and calculating its "average" value (e.g., mean, median, or modal value). The reference blood sample is preferably derived from the same source (e.g., blood cells, serum, or plasma) as the blood sample isolated from the patient being tested. It is more preferable that the reference level is obtained from a control subject (e.g., a healthy subject or a subject with / known to have cancer) of the same gender (e.g., female or male) and / or similar age / life stage (e.g., adult or elderly) as the patient being tested. In particular, the reference level represents the average value of RNA molecules in a healthy population, and / or the reference level represents the average value of RNA molecules in a population of subjects with / known to have cancer. More particularly, the population of subjects with / known to have cancer includes subjects with all cancer stages, e.g., I, II, III, and IV (a mixed population, specifically, equally represented).

[0093] In one preferred embodiment The reference level is a level of the RNA molecule that is empirically determined by measuring a number of reference blood samples from healthy subjects, and wherein a level of the RNA molecule that exceeds the reference level indicates that the patient is afflicted with cancer; and / or The reference level is a level of an RNA molecule that has been empirically determined by measuring multiple reference blood samples from subjects who have / are known to have cancer, and wherein a level of the RNA molecule that is comparable to the reference level indicates that the patient is afflicted with cancer.

[0094] Preferably, the level of the RNA molecule is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, even more preferably at least 2.0-fold or 3.0-fold of the reference level. For example, the level of the RNA molecule is at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold of the reference level.

[0095] "Similar" in the above context preferably means that the level varies over time between 0 and <20%, in particular between 0 and <10%, for example, 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 19.9, 19.99, or 19.999%. In this context, "similar" can also mean that the detected level variation is within the precision of the measurement. The precision of the measurement depends on the measurement method used. The level may be constant over time.

[0096] Alternatively, the level of the RNA molecule is compared to a threshold indicative of cancer, where a level of the RNA molecule above this threshold indicates that the patient has cancer.

[0097] Examples of cancer include, but are not limited to, lung cancer, preferably non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC), breast cancer, cervical cancer, gastric cancer, bladder cancer, skin cancer, nasopharyngeal cancer, neuroendocrine cancer, colon cancer, urothelial cancer, liver cancer, ovarian cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, kidney cancer, head and neck cancer, brain tumor, lymphatic cancer, blood cancer, squamous cell carcinoma, laryngeal cancer, retinal cancer, prostate cancer, uterine cancer, testicular cancer, bone cancer, tonsil cancer, esophageal cancer, lymphoma, and leukemia.

[0098] Preferably, the cancer is selected from the group consisting of lung cancer, such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS), bladder cancer, colon cancer, esophageal cancer, gastric cancer, tonsillar cancer, and uterine cancer. More preferably, the cancer is lung cancer. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS). Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC).

[0099] Figure 2 clearly shows that the above RNA molecules are increased in patients suffering from lung cancer compared to healthy controls.

[0100] In a second aspect, the present invention relates to an (in vitro) method for monitoring the course of cancer in a patient (whether suffering from cancer or healthy), comprising: The analysis of RNA molecules in blood samples from patients (whether cancer-stricken or healthy) determining a level, wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto.

[0101] in particular, (i) the nucleotide sequence set forth in SEQ ID NO: 1; (ii) a nucleotide sequence which is a fragment of the nucleotide sequence according to (i), preferably a fragment which is 1 to 12, more preferably 1 to 8, and most preferably 1 to 5 or 1 to 3, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides shorter than the nucleotide sequence according to (i); or (iv) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity to the nucleotide sequence set forth in (i) or the nucleotide sequence fragment set forth in (ii); The level of an RNA molecule comprising the gene is determined in the blood sample.

[0102] In one embodiment, the level of the RNA molecule is compared to a reference level of the RNA molecule. Thus, in one particular embodiment, the present invention provides a method for detecting a gene that is a target of the present invention. (i) determining the level of an RNA molecule in a blood sample from the patient; and (ii) comparing the level of the RNA molecule to a reference level of said RNA molecule; an (in vitro) method for monitoring the progression of cancer in a patient, comprising: wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, or is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto.

[0103] The above comparison makes it possible to monitor / determine the progress of cancer in a patient suffering from cancer. It can be determined whether the patient's cancer is getting worse, not getting worse / stable, or improving. The above comparison can also be used to monitor / determine whether the patient has developed cancer.

[0104] The reference level can be any level that allows for monitoring or detecting cancer in a patient, and can be obtained from a (control) subject (i.e., a subject different from the patient being tested, such as a subject with / known to have cancer or a healthy subject).

[0105] In particular, the reference level is a level of an RNA molecule empirically determined by measuring multiple reference blood samples from healthy subjects and / or subjects with / known to have cancer (e.g., subjects with / known to have stage I, II, III, or IV cancer). Stages I and II are early stages of cancer. Stage III is a locally advanced cancer stage. Stage IV is an advanced cancer stage. For example, the reference level may be at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 150, or at least 2000, or at least 3000, or at least 4000, or at least 5000, or at least 1000, or at least 1500, or at least 2000, or at least 3000, or at least 4000, or at least 5000, or at least 10000, or at least 15000, or at least 20 ...20000, or at least 30000, or at least 10000, or at least 10000, or at least 10000, or at least 10000, or at least 10000, or at least 10000, or at least 10000, or at least 10000, or at least 10000, or at least 10000, or at least 10000, or at least 10000, or at least 10000, The reference level is determined from 0, at least 2000, at least 5000 reference samples, and / or the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from subjects with / known to have cancer (e.g., subjects with / known to have stage I, II, III, or IV cancer).

[0106] Specifically, the reference level is an average reference level. It is determined by measuring the reference level of a control subject (e.g., a healthy subject or a subject with / known to have cancer) and calculating its "average" value (e.g., mean, median, or modal value). The reference blood sample is preferably derived from the same source (e.g., blood cells, serum, or plasma) as the blood sample isolated from the patient being tested. It is more preferable that the reference level is obtained from a control subject (e.g., a healthy subject or a subject with / known to have cancer) of the same gender (e.g., female or male) and / or similar age / life stage (e.g., adult or elderly) as the patient being tested. In particular, the reference level represents the average value of RNA molecules in a healthy population, and / or the reference level represents the average value of RNA molecules in a population of subjects with / known to have cancer. More particularly, a population of subjects with / known to have cancer includes subjects with a particular cancer stage (e.g., I, II, III, or IV), or subjects with all cancer stages (e.g., I, II, III, and IV) (a mixed population, specifically represented equally).

[0107] In one preferred embodiment, (i) the reference level is a level of the RNA molecule empirically determined by measuring a number of reference blood samples from healthy subjects, and a level of the RNA molecule above the reference level indicates that the patient has developed cancer, or (ii) the reference level is a level of the RNA molecule empirically determined by measuring multiple reference blood samples from subjects who have / are known to have cancer at a particular stage (e.g., stage I, II, III, or IV), whereby the stage is comparable to or greater than the stage of the cancer in the patient being tested, and whereby a level of the RNA molecule above the reference level indicates that the patient's cancer is worsening or (iii) the reference level is a level of the RNA molecule empirically determined by measuring multiple reference blood samples from subjects who have / are known to have cancer at a particular stage (e.g., stage I, II, III, or IV), whereby the stage is similar to or lower than the stage of the cancer in the patient being tested, and a level of the RNA molecule lower than the reference level indicates that the patient's cancer is improving; or (iv) The reference level is a level of an RNA molecule empirically determined by measuring multiple reference blood samples from subjects who have / are known to have cancer at a particular stage (e.g., stage I, II, III, or IV), whereby the stage is the same as the stage of the cancer in the patient being tested, and whereby a level of the RNA molecule comparable to the reference level indicates that the patient is stable or that the patient's cancer is not progressing.

[0108] Preferably, the level of the RNA molecule is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, and even more preferably at least 2.0-fold or 3.0-fold above / below the reference level. For example, the level of the RNA molecule may be at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 2.0-fold, or at least 3.0-fold above / below the reference level. 0.5x, at least 1.6x, at least 1.7x, at least 1.8x, at least 1.9x, at least 2.0x, at least 2.1x, at least 2.2x, at least 2.3x, at least 2.4x, at least 2.5x, at least 2.6x, at least 2.7x, at least 2.8x, at least 2.9x, or at least 3.0x above / below.

[0109] "Similar" in the above context preferably means that the level varies over time between 0 and <20%, in particular between 0 and <10%, for example, 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 19.9, 19.99, or 19.999%. In this context, "similar" can also mean that the detected level variation is within the precision of the measurement, which depends on the measurement method used. Preferably, the level is constant over time.

[0110] As already mentioned above, the reference level can be any level that allows monitoring or detecting cancer in a patient. It can be obtained from a (control) subject (i.e., a subject different from the patient being tested, such as a subject known to have cancer or a healthy subject), or it can be obtained from the same individual.

[0111] Thus, in one alternative or additional embodiment, said monitoring comprises determining the level of RNA molecules in a blood sample obtained from the patient at an initial time point and in at least one further blood sample obtained from the (same) patient at a later time point, and comparing said levels determined at the different time points. Thus, in one particular embodiment, the present invention provides a method for determining the level of RNA molecules in a blood sample obtained from the patient at an initial time point and in at least one further blood sample obtained from the (same) patient at a later time point, and comparing said levels determined at the different time points. (i) determining the level of RNA molecules in a blood sample obtained from the patient at an initial time point and in at least one further blood sample obtained from the (same) patient at a later time point; and (ii) comparing said levels measured at different time points; an (in vitro) method for monitoring the progression of cancer in a patient, comprising: wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO:1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%) sequence identity thereto.

[0112] This procedure allows for monitoring cancer in patients (whether healthy or with cancer) over extended periods of time, such as months or years (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 months, 1, 2, 3, 4, or 5 years).

[0113] In one preferred embodiment, (i) increasing levels of the RNA molecule over time indicates that the patient has developed cancer or that the patient's cancer is getting worse; (ii) levels of the RNA molecule that do not change over time indicate that the patient is stable or that the patient's cancer is not progressing; or (iii) A decrease in the level of the RNA molecule over time indicates that the patient's cancer is improving. In another preferred embodiment, (i) the patient is initially healthy and increasing levels over time indicate that the patient has developed cancer, or (ii) the patient has cancer at the initial time and increasing levels over time indicate that the patient's cancer is getting worse; or (iii) the patient has cancer at the initial time point and the level does not change (significantly) over time, indicating that the patient's cancer is not progressing; or (iv) The patient has cancer at the initial time point and a decreasing level over time indicates that the patient's cancer is improving.

[0114] Preferably, the increase is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, and even more preferably at least 2.0-fold or 3.0-fold over time.

[0115] For example, the increase can be at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold over time.

[0116] Preferably, the decrease is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, and even more preferably at least 2.0-fold or 3.0-fold over time.

[0117] For example, the decrease can be at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold over time.

[0118] "Significant change" in the above context preferably means a change over time of more than 10% or 20% (e.g., 10, 20, 30, 40, or 50%). Small changes over time may be variations within the precision of the measurement. The precision of the measurement depends on the measurement method used. The level may be constant over time.

[0119] "Stable" in the above context preferably means no more than 10% or 20% (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20%) change over time. Small changes over time may be variations within the precision of the measurement, which depends on the measurement method used. Preferably, the level is constant over time.

[0120] The period of time between the first time point and the later time point(s) is preferably at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days (1 week), at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months (1 year), at least 24 months (2 years), at least 3 years, at least 4 years, at least 5 years, at least 6 years, at least 7 years, at least 8 years, at least 9 years, or at least 10 years, for example. , individuals can be checked periodically (e.g., once or twice a year). Patients can be (re)tested at 2, 3, 4, 5, 6, 7, 8, 9, or 10 time points (initial and additional time points).

[0121] Figure 1 clearly shows that the above RNA molecules are more highly expressed with increasing tumor stage in clinical trials of lung cancer patients.

[0122] In addition to monitoring a patient for cancer, the patient may also be monitored for therapeutic treatment of cancer, particularly where the patient is undergoing, is undergoing, or has undergone therapeutic treatment for cancer.

[0123] Preferably, the cancer therapeutic treatment is selected from the group consisting of surgery, chemotherapy, targeted therapy, immunotherapy, oncolytic virus therapy, vaccine therapy, radiation therapy, laser therapy, hyperthermia, and drug administration, or a combination thereof (e.g., chemotherapy and immunotherapy) (immunochemotherapy).

[0124] More preferably, the drug is selected from the group consisting of an immunomodulatory agent, a chemotherapeutic agent, an immunotherapeutic agent, an immunosuppressant, a radiotherapeutic agent, an oncolytic virus, a vaccine, and an antibody. The drug may also be a combination of drugs (e.g., a chemotherapeutic agent and an immunotherapeutic agent). The administration of a chemotherapeutic agent in combination with an immunotherapeutic agent may be referred to as immunochemotherapy.

[0125] The patient may receive therapeutic treatment (e.g., administration of a drug) during the entire monitoring process, or may receive therapeutic treatment before, at, or after an initial time point (e.g., administration of a drug) and be re-examined at a later time point. In particular, the initial time point may be before the start of therapeutic treatment, and the later time point may be during and / or after therapeutic treatment. If the therapeutic treatment involves administration of a drug and the patient responds to the treatment, drug administration may be continued, the drug dose may be reduced, or drug administration may be stopped. If the therapeutic treatment involves administration of a drug and the patient does not respond to the treatment, the drug dose may be increased, the drug may be changed, or the treatment mode may be changed (e.g., from drug administration to surgery, laser therapy, or thermotherapy).

[0126] Therapeutic treatment can reduce the increased levels of RNA molecules, thus improving the (overall) condition of patients with cancer.

[0127] In another preferred embodiment (i) the patient is undergoing, is undergoing, or has undergone treatment for cancer, and a decreasing level over time indicates that the patient is responding to the treatment; or (ii) the patient is undergoing, is undergoing, or has undergone therapeutic treatment for cancer, and stable or increasing levels over time indicate that the patient is not responding to the treatment.

[0128] Preferably, the increase is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, and even more preferably at least 2.0-fold or 3.0-fold over time. For example, the increase can be at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold over time.

[0129] Preferably, the decrease is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, and even more preferably at least 2.0-fold or 3.0-fold over time. For example, the decrease can be at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold over time.

[0130] "Stable" in the above context preferably means a change over time of no more than 10% or 20% (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20%). Small changes over time can vary within the precision of the measurement, which depends on the measurement method used. Preferably, the level is constant over time.

[0131] Examples of cancer include, but are not limited to, lung cancer, preferably non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC), breast cancer, cervical cancer, gastric cancer, bladder cancer, skin cancer, nasopharyngeal cancer, neuroendocrine cancer, colon cancer, urothelial cancer, liver cancer, ovarian cancer, esophageal cancer, pancreatic cancer, renal cancer, stomach cancer, esophageal cancer, kidney cancer, head and neck cancer, brain tumor, lymphatic cancer, blood cancer, squamous cell carcinoma, laryngeal cancer, retinal cancer, prostate cancer, uterine cancer, testicular cancer, bone cancer, tonsil cancer, esophageal cancer, lymphoma and leukemia.

[0132] Preferably, the cancer is selected from the group consisting of lung cancer, such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS), bladder cancer, colon cancer, esophageal cancer, gastric cancer, tonsillar cancer, and uterine cancer. More preferably, the cancer is lung cancer. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS). Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC).

[0133] The data in Figure 7 clearly demonstrate that the above RNA molecules make it possible to monitor the progression of a patient's cancer, especially under therapeutic treatment of cancer / anti-cancer therapy such as chemotherapy or immunochemotherapy. In Figure 7, the distribution of the above RNA molecules in lung cancer samples before and after the patient's anti-cancer treatment is shown. Clinical evaluation by an oncologist at a follow-up visit (after treatment) summarizes the disease progression (since the previous visit) as either remission (disease improvement), stable disease (no change), or progression (disease worsening). The levels of the above RNA molecules (i) significantly decrease during remission, indicating that the patient's cancer is improving; (ii) significantly increase during progression, indicating that the patient's cancer is worsening; and (iii) remain constant (no significant difference) during the stable disease period, reflecting this assessment by indicating that the patient's cancer is not progressing.

[0134] In a third aspect, the present invention relates to an (in vitro) method of determining whether a patient will respond to a therapeutic treatment for cancer, comprising determining the level of an RNA molecule in a blood sample from the patient, wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, is a fragment thereof, or has at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%) sequence identity thereto. Has.

[0135] in particular, (i) the nucleotide sequence set forth in SEQ ID NO: 1; (ii) a nucleotide sequence that is a fragment of the nucleotide sequence of (i), preferably a fragment that is 1 to 12, more preferably 1 to 8, and most preferably 1 to 5 or 1 to 3 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) nucleotides shorter than the nucleotide sequence of (i); or (v) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%) sequence identity to the nucleotide sequence set forth in (i) or the nucleotide sequence fragment set forth in (ii). The level of an RNA molecule comprising the gene is determined in a blood sample.

[0136] Preferably, the patient is one to whom the drug used in the therapeutic treatment and / or other forms of therapeutic treatment has been administered at least once (one, two, or three times). The drug may also be a drug combination of at least two different drugs (e.g., a combination of a chemotherapeutic agent and an immunotherapeutic agent). The administration of a chemotherapeutic agent in combination with an immunotherapeutic agent may be referred to as immunochemotherapy.

[0137] The mode of administration may be oral, nasal, rectal, parenteral, or topical. Parenteral administration includes subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal administration.

[0138] It is further preferred that the blood sample be isolated from the patient after at least the first (e.g., first, second, or third) administration of the drug and / or after at least the first (e.g., first, second, or third) administration of another form of therapeutic treatment (other than drug administration). It is particularly preferred that the blood sample be isolated from the patient two weeks to one day after at least the first (e.g., first, second, or third) administration of the drug and / or after at least the first (e.g., first, second, or third) administration of another form of therapeutic treatment (other than drug administration). It is even more particularly preferred that the blood sample be isolated from the patient one week to one day after at least the first (e.g., first, second, or third) administration of the drug and / or after at least the first (e.g., first, second, or third) administration of the other form of therapeutic treatment (other than drug administration). For example, a blood sample is isolated from a patient after (1, 2, 3, 4, 5, 6 days, 1, 2, 3 weeks) at least a first (e.g., first, second, or third) administration of the drug and / or at least a first (e.g., first, second, or third) administration of other forms of therapeutic treatment (other than administration of the drug).

[0139] In one embodiment, the level of the RNA molecule is compared to a reference level of the RNA molecule. Thus, in one particular embodiment, the present invention provides a method for detecting a gene that is a target of the present invention. (i) determining the level of an RNA molecule in a blood sample from the patient; and (II) comparing the level of the RNA molecule to a reference level of said RNA molecule. The present invention relates to an (in vitro) method for determining whether a patient will respond to a therapeutic treatment for cancer, comprising: wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1 or is a fragment thereof, or is at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% identical thereto (e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99%) of sequence identity.

[0140] The above comparison allows one to assess whether a treatment approach is effective for a patient.

[0141] The reference level can be any level that allows determining whether a therapeutic treatment is effective for a patient. It can be obtained from a (control) subject (i.e., a different subject from the patient being tested (e.g., a subject with / known to have cancer)) or from the same individual.

[0142] In one preferred embodiment, the reference level is a level of an RNA molecule that is empirically determined by measuring multiple reference blood samples from subjects who have / are known to have cancer.

[0143] For example, the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, or at least 5000 reference samples from subjects with / known to have cancer. Specifically, the reference level is an average reference level, determined by measuring the reference levels of subjects with / known to have cancer and calculating their "average" value (e.g., mean, median, or modal value). The reference blood sample is preferably from the same source (e.g., blood cells, serum, or plasma) as the blood sample isolated from the patient being tested. More preferably, the reference level is obtained from subjects with / known to have cancer of the same gender (e.g., female or male) and / or similar age / life stage (e.g., adult or elderly) as the patient being tested. In particular, the reference level represents the average value of RNA molecules in a population of subjects with / known to have cancer. More particularly, the population includes subjects at a particular cancer stage (e.g., I, II, III, or IV), or subjects at all cancer stages (e.g., I, II, III, and IV) (a mixed population, particularly equally represented).

[0144] In one further preferred embodiment a level of the RNA molecule lower than the reference level indicates that the patient will respond to treatment for said cancer; a level of the RNA molecule that is comparable to the reference level indicates that the patient will not respond to treatment for said cancer; or A level of the RNA molecule above the reference level indicates that the patient will not respond to treatment for said cancer.

[0145] Preferably, the level of the RNA molecule is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, and even more preferably at least 2.0-fold or 3.0-fold above / below the reference level. For example, the level of the RNA molecule is at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold above / below the reference level.

[0146] "Similar" in the above context preferably means that the level varies between 0 and <20%, in particular between 0 and <10%, for example 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 19.9, 19.99, or 19.999%. In this context, "similar" can also mean that the detected level variation is within the precision of the measurement, which depends on the measurement method used. Preferably, the level is constant over time.

[0147] In an alternative or additional preferred embodiment, the reference level is a level determined in a reference blood sample isolated from the (same) patient before administration of the drug and / or other forms of therapeutic treatment. The drug may also be a drug combination of at least two different drugs, for example, a combination of a chemotherapeutic agent and an immunotherapeutic agent. Administering a chemotherapeutic agent in combination with an immunotherapeutic agent may be referred to as immunochemotherapy. It is particularly preferred that the reference blood sample is isolated from the (same) patient for a period of time ranging from 1 day to immediately before administration of the drug and / or immediately before administration of other forms of therapeutic treatment (other than administration of the drug). It is even more particularly preferred that the reference blood sample is isolated from the (same) patient for a period of time ranging from 0.5 days to immediately before administration of the drug and / or immediately before administration of other forms of therapeutic treatment (other than administration of the drug). For example, the reference blood sample is isolated from the (same) patient immediately 10, 20, 30, 40, 50 minutes, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 hours, or 1 day before administration of the drug and / or other forms of therapeutic treatment (other than administration of the drug).

[0148] In one further preferred embodiment, a level of the RNA molecule lower than the reference level indicates that the patient will respond to treatment for said cancer; a level of the RNA molecule that is comparable to the reference level indicates that the patient will not respond to treatment for said cancer; or A level of the RNA molecule above the reference level indicates that the patient will not respond to treatment for said cancer.

[0149] Preferably, the level of the RNA molecule is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, and even more preferably at least 2.0-fold or 3.0-fold above / below the reference level. For example, the level of the RNA molecule is at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold above / below the reference level.

[0150] "Similar" in the above context preferably means that the level varies between 0 and <20%, in particular between 0 and <10%, for example 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 19.9, 19.99 or 19.999%. In this context, "similar" may also mean that the detected level variation is within the precision of the measurement. The precision of the measurement depends on the measurement method used. Preferably, Preferably, the levels are constant over time.

[0151] If the therapeutic treatment involves the administration of a drug and the patient responds to the treatment, the administration of the drug may be continued. In particular, the dose of the drug may be reduced and / or the interval between drug administrations may be extended. Alternatively, the administration of the drug may be stopped. If the therapeutic treatment involves the administration of a drug and the patient does not respond to the treatment, the dose of the drug may be increased, the interval between drug administrations may be shortened, and / or the drug may be changed. Alternatively, the treatment mode may be changed, for example, from the administration of a drug to surgery, radiation therapy, laser therapy, and thermotherapy.

[0152] If the therapeutic treatment includes other therapeutic treatments besides the administration of a drug, and the patient responds to the treatment, the therapeutic treatment may be continued, the number of treatments may be reduced, or the intensity of the therapeutic treatment may be reduced. If the therapeutic treatment includes other therapeutic treatments besides the administration of a drug, and the patient does not respond to the treatment, the number of treatments may be increased and / or the intensity of the therapeutic treatment may be increased. Alternatively, the treatment mode may be changed.

[0153] Preferably, the drug is selected from the group consisting of immunomodulators, chemotherapeutic agents, immunotherapeutic agents, immunosuppressants, radiotherapeutic agents, oncolytic viruses, vaccines, and antibodies. As mentioned above, the drug may also be a drug combination of at least two different drugs. Thus, the patient may be a patient who is being administered, has been administered, or has been administered at least once a chemotherapeutic agent and an immunotherapeutic agent.

[0154] More preferably, (i) the immunomodulatory agent is selected from the group consisting of checkpoint inhibitors, preferably checkpoint inhibitors targeting PD-1, PD-L1, PD-L2, CTLA-4 or endogenous checkpoint blockade; (ii) the chemotherapeutic agent is selected from the group consisting of alkylating agents, antimetabolites, folinic acid, antifolates, mitotic inhibitors, anthracyclines, topoisomerase inhibitors, signal transduction inhibitors, angiogenesis inhibitors, and histone deacetylase inhibitors; or (iii) the immunotherapeutic agent is selected from the group consisting of a cytokine, an antibody, an antigen-presenting cell, or a chimeric antigen receptor T cell. Preferably, the other form of therapeutic treatment is selected from the group consisting of surgery, radiation therapy, laser therapy, and thermotherapy.

[0155] Examples of cancer include, but are not limited to, lung cancer, preferably non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC), breast cancer, cervical cancer, gastric cancer, bladder cancer, skin cancer, nasopharyngeal cancer, neuroendocrine cancer, colon cancer, urothelial cancer, liver cancer, ovarian cancer, esophageal cancer, pancreatic cancer, renal cancer, stomach cancer, esophageal cancer, kidney cancer, head and neck cancer, brain tumor, lymphatic cancer, blood cancer, squamous cell carcinoma, laryngeal cancer, retinal cancer, prostate cancer, uterine cancer, testicular cancer, bone cancer, tonsil cancer, esophageal cancer, lymphoma, and leukemia. Preferably, the cancer is selected from the group consisting of lung cancer, such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS), bladder cancer, colon cancer, esophageal cancer, gastric cancer, tonsillar cancer, and uterine cancer. More preferably, the cancer is lung cancer. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS). Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC).

[0156] The data in Figure 7 clearly show that the above-mentioned RNA molecules make it possible to determine whether a patient will respond to a therapeutic treatment of cancer / anti-cancer therapy. Specifically, the therapeutic treatment of cancer / anti-cancer therapy is chemotherapy or immunochemotherapy. Figure 7 shows the distribution of the above-mentioned RNA molecules in lung cancer samples before and after the patient's anti-cancer treatment. Clinical evaluation by an oncologist at a follow-up visit (after treatment) can determine the progression of the disease (since the previous visit), whether it is in remission or not. The levels of the RNA molecules are summarized as either (improvement of disease), stable disease (no change), or progressive (worsening of disease). The levels of the RNA molecules are (i) reflected by a significant decrease during the remission period, indicating that the patient is responding to the cancer treatment, (ii) reflected by a significant increase during progression, indicating that the patient is not responding to the cancer treatment, and (iii) reflected by a constant (no significant difference) during the stable disease period, indicating that the patient is not responding to the cancer treatment.

[0157] In a fourth aspect, the present invention relates to an (in vitro) method of determining the risk for recurrence of cancer in a patient, comprising determining the level of an RNA molecule in a blood sample from the patient, wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%) sequence identity thereto.

[0158] in particular, (i) the nucleotide sequence set forth in SEQ ID NO: 1; (ii) a nucleotide sequence which is a fragment of the nucleotide sequence according to (i), preferably a fragment which is 1 to 12, more preferably 1 to 8, and most preferably 1 to 5 or 1 to 3, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides shorter than the nucleotide sequence according to (i); or (vi) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity to the nucleotide sequence set forth in (i) or the nucleotide sequence fragment set forth in (ii). The level of an RNA molecule comprising the gene is determined in the blood sample.

[0159] Preferably, the patient has undergone therapeutic treatment for cancer, and in particular the patient is in remission (i.e., has no symptoms or signs of the disease).

[0160] It is further preferred that the treatment comprises the administration of a drug for cancer and / or other forms of therapeutic treatment for cancer. The drug may also be a drug combination of at least two different drugs, for example, a combination of a chemotherapeutic agent and an immunotherapeutic agent. The administration of a chemotherapeutic agent in combination with an immunotherapeutic agent may be referred to as immunochemotherapy. The mode of administration may be oral, nasal, rectal, parenteral, or topical. Parenteral administration includes subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal administration.

[0161] It is also preferred that the blood sample is isolated after a therapeutic treatment for cancer.

[0162] In one embodiment, the level of the RNA molecule is compared to a reference level of the RNA molecule. Thus, in one particular embodiment, the present invention provides a method for detecting a gene that is a target of the present invention. (i) determining the level of an RNA molecule in a blood sample from the patient (isolated after a therapeutic treatment for cancer); and (ii) comparing the level of the RNA molecule to a reference level of said RNA molecule; an (in vitro) method for determining a patient's risk of cancer recurrence, comprising: wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1 or a fragment thereof. or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto.

[0163] The above comparison allows an assessment of whether a patient who is in remission (i.e., has no symptoms or signs of the disease) is at risk of developing the disease again. Recurrence occurs when cancer returns after treatment. This can happen weeks, months, or even years after the primary or initial cancer was treated. It is impossible to know for sure whether cancer will recur. The likelihood of recurrence depends on the type of primary cancer. Cancer recurs because small areas of cancer cells may remain in the body after treatment. Over time, these cells can multiply and grow enough to cause symptoms or be detected by tests.

[0164] The reference level can be any level that allows one to determine whether a patient in remission (i.e., no symptoms or signs of disease) is at risk of becoming ill again. It can be obtained from a (control) subject (i.e., a healthy subject, or a subject different from the patient being tested, such as a successfully treated cancer patient).

[0165] In one preferred embodiment, the reference level is a level of an RNA molecule empirically determined by measuring a large number of reference blood samples from healthy subjects and / or successfully treated cancer patients. For example, the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, or at least 5000 reference samples from healthy subjects.

[0166] For example, the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, or at least 5000 reference samples from successfully treated cancer patients. Specifically, the reference level is an average reference level. This is determined by measuring the reference levels of control subjects (e.g., healthy subjects or successfully treated cancer patients) and calculating their "average" value (e.g., mean, median, or modal value). The reference blood sample is preferably derived from the same source (e.g., blood cells, serum, or plasma) as the blood sample isolated from the patient being tested. It is more preferred that the reference level be obtained from a control subject (e.g., a healthy subject or a successfully treated cancer patient) of the same gender (e.g., female or male) and / or similar age / life stage (e.g., adult or elderly) as the patient being tested. In particular, the reference level represents the average value of the RNA molecule in a healthy population, and / or the reference level represents the average value of the RNA molecule in a population of successfully treated cancer patients. More particularly, the population of successfully treated cancer patients includes subjects with a particular cancer stage (e.g., I, II, III, or IV) or subjects with all cancer stages (e.g., I, II, III, and IV) (a mixed population, particularly represented equally).

[0167] In another preferred embodiment, a level of the RNA molecule above the reference level indicates the patient's risk for cancer recurrence.

[0168] Preferably, the level of the RNA molecule is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, and even more preferably at least 2.0-fold or 3.0-fold above the baseline level. For example, the level of the RNA molecule is at least 0.6-fold, at least 0.7-fold above the baseline level. , at least 0.8 times, at least 0.9 times, at least 1.0 times, at least 1.1 times, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times, at least 1.8 times, at least 1.9 times, at least 2.0 times, at least 2.1 times, at least 2.2 times, at least 2.3 times, at least 2.4 times, at least 2.5 times, at least 2.6 times, at least 2.7 times, at least 2.8 times, at least 2.9 times, or at least 3.0 times.

[0169] In an alternative or additional preferred embodiment, the reference level represents the minimum level of the RNA molecule that can be achieved / achieved in a patient by therapeutic treatment of cancer. In another preferred embodiment, a level of the RNA molecule that exceeds the reference level indicates the patient's risk of cancer recurrence. Preferably, the level of the RNA molecule is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, and even more preferably at least 2.0-fold or 3.0-fold the reference level. For example, the level of the RNA molecule is at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold the reference level.

[0170] The above-mentioned "minimum level" may be a single value achievable / achieved in a patient by a therapeutic treatment for cancer, or may be an average value of multiple values ​​achievable / achieved in a patient during a therapeutic treatment for cancer.

[0171] As already mentioned above, the reference level can be any level that allows determining whether a patient in remission (i.e., no symptoms or signs of the disease) is at risk of developing the disease again. It can be obtained from a (control) subject (i.e., a healthy subject, or a subject different from the tested patient, such as a successfully treated cancer patient). It can also be obtained from the same individual.

[0172] Thus, in an alternative or additional embodiment, determining comprises determining the level of the RNA molecule in a blood sample obtained from the patient at an initial time point after therapeutic treatment for cancer, and in at least one further blood sample obtained from the (same) patient at a later time point, and comparing the levels determined at the different time points. Thus, in one particular embodiment, the present invention provides a method for determining the level of the RNA molecule in a blood sample obtained from the patient at an initial time point after therapeutic treatment for cancer, and in at least one further blood sample obtained from the (same) patient at a later time point, and comparing the levels determined at the different time points. (i) determining the level of an RNA molecule in a blood sample obtained from the patient at an initial time point after therapeutic treatment for cancer and in at least one further blood sample obtained from the (same) patient at a later time point; and (ii) comparing said levels measured at different time points; In a further aspect, the present invention relates to an (in vitro) method for determining a patient's risk for cancer recurrence, comprising: wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, or is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto.

[0173] The above comparison allows an assessment of whether a patient who is in remission (i.e., has no symptoms or signs of the disease) is at risk of developing the disease again. Recurrence occurs when cancer returns after treatment. This can happen weeks, months, or even years after the primary or initial cancer has been treated. It is impossible to know for sure whether cancer will recur. The likelihood of recurrence depends on the type of primary cancer. Cancer recurs because small areas of cancer cells can remain in the body after treatment. Over time, these cells can multiply and grow large enough to cause symptoms or be detected by tests.

[0174] In one preferred embodiment, increasing levels of the RNA molecule over time indicate the patient's risk for cancer recurrence. Preferably, the increase is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, and even more preferably at least 2.0-fold or 3.0-fold over time.

[0175] For example, the increase can be at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold over time.

[0176] The period between the initial time point and the subsequent time point is preferably at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days (1 week), at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months (1 year), at least 24 months (2 years), at least 3 years, at least 4 years, at least 5 years, at least 6 years, at least 7 years, at least 7 years, at least 8 years, at least 9 years, or at least 10 years. For example, individuals can be checked periodically, for example, once or twice a year. Patients can be (re)examined at 2, 3, 4, 5, 6, 7, 8, 9, or 10 time points (initial time point and additional time points).

[0177] Preferably, the drug is selected from the group consisting of immunomodulators, chemotherapeutic agents, immunotherapeutic agents, immunosuppressants, radiotherapeutic agents, oncolytic viruses, vaccines, and antibodies. As mentioned above, the drug may also be a drug combination of at least two different drugs. Thus, the patient may be a patient who is being administered, has been administered, or has been administered at least once a chemotherapeutic agent and an immunotherapeutic agent.

[0178] More preferably, (i) the immunomodulatory agent is selected from the group consisting of checkpoint inhibitors, preferably checkpoint inhibitors targeting PD-1, PD-L1, PD-L2, CTLA-4 or endogenous checkpoint blockade; (ii) the chemotherapeutic agent is selected from the group consisting of alkylating agents, antimetabolites, folinic acid, antifolates, mitotic inhibitors, anthracyclines, topoisomerase inhibitors, signal transduction inhibitors, angiogenesis inhibitors, and histone deacetylase inhibitors; or (iii) the immunotherapeutic agent is selected from the group consisting of a cytokine, an antibody, an antigen-presenting cell, or a chimeric antigen receptor T cell.

[0179] Preferably, the other form of therapeutic treatment is selected from the group consisting of surgery, radiation therapy, laser therapy, and thermotherapy.

[0180] Examples of cancer include, but are not limited to, lung cancer, preferably non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC), breast cancer, cervical cancer, gastric cancer, bladder cancer, skin cancer, nasopharyngeal cancer, neuroendocrine cancer, colon cancer, urothelial cancer, liver cancer, ovarian cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, kidney cancer, head and neck cancer, brain tumor, lymphatic cancer, blood cancer, squamous cell carcinoma, laryngeal cancer, retinal cancer, prostate cancer, uterine cancer, testicular cancer, bone cancer, tonsil cancer, esophageal cancer, lymphoma, and leukemia.

[0181] Preferably, the cancer is selected from the group consisting of lung cancer, such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS), bladder cancer, colon cancer, esophageal cancer, gastric cancer, tonsillar cancer, and uterine cancer. More preferably, the cancer is lung cancer. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS). Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC).

[0182] In a fifth aspect, the present invention provides a method for producing a pharmaceutical composition comprising: determining the level of the RNA molecule in a blood sample from the patient; A method for detecting minimal residual disease (MRD) in a patient with cancer (in vitro), comprising: wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% (e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%) sequence identity thereto.

[0183] in particular, (i) the nucleotide sequence set forth in SEQ ID NO: 1; (ii) a nucleotide sequence which is a fragment of the nucleotide sequence according to (i), preferably a fragment which is 1 to 12, more preferably 1 to 8, and most preferably 1 to 5 or 1 to 3, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides shorter than the nucleotide sequence according to (i); or (vii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity to the nucleotide sequence set forth in (i) or the nucleotide sequence fragment set forth in (ii). The level of an RNA molecule comprising the gene is determined in the blood sample.

[0184] Preferably, the patient is undergoing, is undergoing, or has undergone therapeutic treatment for cancer.

[0185] More preferably, the treatment includes or has included the administration of drugs for cancer and / or other forms of therapeutic treatment for cancer.

[0186] The drug may also be a drug combination of at least two different drugs, for example, a combination of a chemotherapeutic agent and an immunotherapeutic agent. The administration of a chemotherapeutic agent in combination with an immunotherapeutic agent may be referred to as immunochemotherapy.

[0187] The mode of administration may be oral, nasal, rectal, parenteral, or topical. Parenteral administration includes subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal administration.

[0188] It is also preferred that the blood sample is isolated during or after therapeutic treatment for cancer.

[0189] In one embodiment, the level of the RNA molecule is compared to a reference level of the RNA molecule. Thus, in one particular embodiment, the present invention provides a method for detecting a gene that is a target of the present invention. (i) determining the level of an RNA molecule in a blood sample from a patient (isolated during or after therapeutic treatment for cancer); and (ii) comparing the level of the RNA molecule to a reference level of said RNA molecule; A method for detecting minimal residual disease (MRD) in a patient with cancer (in vitro), comprising: wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, or is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto.

[0190] The above comparison can assess whether a patient has minimal cancer remaining. In particular, detecting minimal residual disease in a patient indicates the presence of a small number of cancer cells remaining in the patient during treatment or after treatment when the patient is in remission (no symptoms or signs of disease). This is a major cause of cancer recurrence. In cancer treatment, MRD testing has several important roles: determining whether treatment has eradicated the cancer or whether any traces remain, comparing the effectiveness of different treatments, monitoring the patient's remission status and detecting cancer recurrence, and selecting the treatment that best suits these needs.

[0191] The reference level can be any level that allows determining whether a patient has minimal residual disease or not, and can be obtained from a (control) subject (i.e., a healthy subject, or a subject different from the patient being tested, such as a successfully treated cancer patient).

[0192] In one preferred embodiment, the reference level is the level of an RNA molecule empirically determined by measuring a large number of reference blood samples from healthy subjects and / or successfully treated cancer patients. For example, the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, or at least 5000 reference samples from healthy subjects. For example, the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, or at least 5000 reference samples from successfully treated cancer patients.

[0193] Specifically, the reference level is an average reference level. This is determined by measuring the reference levels of control subjects (e.g., healthy subjects or successfully treated cancer patients) and calculating the "average" value (e.g., mean, median, or modal value). The reference blood sample is preferably derived from the same source (e.g., blood cells, serum, or plasma) as the blood sample isolated from the patient being tested. The reference level may be obtained from a control subject (e.g., healthy subject or successfully treated cancer patient) of the same sex (e.g., female or male) and / or similar age / life stage (e.g., adult or elderly) as the patient being tested. It is further preferred that the reference level represents the average value of the RNA molecule in a healthy population, and / or the reference level represents the average value of the RNA molecule in a population of successfully treated cancer patients. More particularly, the population of successfully treated cancer patients includes subjects with a particular cancer stage (e.g., I, II, III, or IV) or subjects with all cancer stages (e.g., I, II, III, and IV) (a mixed population, specifically represented equally).

[0194] In another preferred embodiment, a level of an RNA molecule above the reference level indicates that the patient is afflicted with minimal residual disease.

[0195] Preferably, patients suffering from minimal residual disease are assigned / eligible for adjuvant therapy. More preferably, patients assigned / eligible for adjuvant therapy are subsequently treated with said cancer therapy.

[0196] In an alternative or additional embodiment, the determining comprises determining the level of the RNA molecule in a blood sample obtained from the patient at an initial time point before therapeutic treatment for cancer, and in at least one further blood sample obtained from the (same) patient at a later time point after therapeutic treatment, and comparing the levels determined at the different time points. Thus, in one particular embodiment, the present invention provides a method for treating a pulmonary arthritis with a pulmonary arthritis virus (PAS) comprising: (i) determining the level of an RNA molecule in a blood sample obtained from the patient at an initial time point prior to therapeutic treatment for cancer, and in at least one further blood sample obtained from the (same) patient at a later time point after therapeutic treatment; and (ii) comparing said levels determined at different time points; a method for detecting minimal residual disease in a patient with cancer (in vitro), comprising: wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, or is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto.

[0197] In one preferred embodiment, levels of RNA molecules that are stable over time or that do not decrease over time to / below a threshold level (representing the minimum level of RNA molecules achievable by therapeutic treatment of cancer) indicate that the patient is afflicted with minimal residual disease. The threshold level preferably represents the minimum level of RNA molecules achievable by therapeutic treatment of cancer.

[0198] Preferably, patients suffering from minimal residual disease are assigned / eligible for adjuvant therapy. More preferably, patients assigned / eligible for adjuvant therapy are subsequently treated with said cancer therapy.

[0199] The period between the initial time point and the subsequent time point is preferably at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days (1 week), at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months (1 year), at least 24 months (2 years), at least 3 years, at least 4 years, at least 5 years, at least 6 years, at least 7 years, at least 8 years, at least 9 years, or at least 10 years. For example, individuals can be checked periodically, for example, once or twice a year. Patients can be (re)examined at 2, 3, 4, 5, 6, 7, 8, 9, or 10 time points (initial time point and additional time points).

[0200] Preferably, the drug is selected from the group consisting of immunomodulators, chemotherapeutic agents, immunotherapeutic agents, immunosuppressants, radiotherapeutic agents, oncolytic viruses, vaccines, and antibodies. As mentioned above, the drug may also be a drug combination of at least two different drugs. Thus, the patient may be a patient who is being administered, has been administered, or has been administered at least once a chemotherapeutic agent and an immunotherapeutic agent.

[0201] More preferably, (i) the immunomodulatory agent is selected from the group consisting of checkpoint inhibitors, preferably checkpoint inhibitors targeting PD-1, PD-L1, PD-L2, CTLA-4 or endogenous checkpoint blockade; (ii) the chemotherapeutic agent is selected from the group consisting of alkylating agents, antimetabolites, folinic acid, antifolates, mitotic inhibitors, anthracyclines, topoisomerase inhibitors, signal transduction inhibitors, angiogenesis inhibitors, and histone deacetylase inhibitors; or (iii) the immunotherapeutic agent is selected from the group consisting of a cytokine, an antibody, an antigen-presenting cell, or a chimeric antigen receptor T cell.

[0202] Preferably, the other form of therapeutic treatment is selected from the group consisting of surgery, radiation therapy, laser therapy, and thermotherapy.

[0203] Examples of cancer include, but are not limited to, lung cancer, preferably non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC), breast cancer, cervical cancer, gastric cancer, bladder cancer, skin cancer, nasopharyngeal cancer, neuroendocrine cancer, colon cancer, urothelial cancer, liver cancer, ovarian cancer, esophageal cancer, pancreatic cancer, renal cancer, stomach cancer, esophageal cancer, kidney cancer, head and neck cancer, brain tumor, lymphatic cancer, blood cancer, squamous cell carcinoma, laryngeal cancer, retinal cancer, prostate cancer, uterine cancer, testicular cancer, bone cancer, tonsil cancer, esophageal cancer, lymphoma, and leukemia.

[0204] Preferably, the cancer is selected from the group consisting of lung cancer, such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS), bladder cancer, colon cancer, esophageal cancer, gastric cancer, tonsillar cancer, and uterine cancer. More preferably, the cancer is lung cancer. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS). Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC).

[0205] Figure 6 shows the reduction of the above-mentioned RNA molecules after lung cancer surgery (by stage).Therefore, the above-mentioned RNA molecule levels are tumor-related.Therefore, determining the above-mentioned RNA molecule levels allows for the assessment of minimal residual disease in cancer patients, for example, after surgery, possibly as a treatment control.

[0206] In the methods of the first to fifth aspects, the patient is preferably a mammal, more preferably a human or rodent, even more preferably a human.

[0207] In the methods of the first to fifth aspects, the blood sample is preferably whole blood or a blood fraction. In particular, the blood fraction is selected from the group consisting of a blood cell fraction and plasma or serum. More preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum. The blood cell fraction may include red blood cells, white blood cells, and / or platelets. Even more preferably, the blood cell fraction is a white blood cell fraction, or the blood cell fraction is a mixture of red blood cells, white blood cells, and platelets.

[0208] In the methods of the first to fifth aspects, the level of RNA molecules is preferably determined by sequencing, preferably by next generation sequencing (e.g., ABI SOLID, Illumina The level of an RNA molecule may be determined by any of a variety of techniques, including Genome Analyzer, Roche 454 GS FL, BGISEQ), nucleic acid hybridization (e.g., microarray or beads), nucleic acid amplification (e.g., PCR, RT-PCR, qRT-PCR, or high-throughput RT-PCR), polymerase extension, mass spectrometry, flow cytometry (e.g., LUMINEX), or any combination thereof. Specifically, the level of an RNA molecule is the expression level of the RNA molecule.

[0209] In a sixth aspect, the present invention relates to the (in vitro) use of an RNA molecule for diagnosing cancer in a patient, monitoring the progress of cancer in a patient, determining whether a patient will respond to a therapeutic treatment for cancer, determining the risk of recurrence of cancer in a patient, and / or detecting minimal residual disease (MRD) in a patient with cancer, wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, or is a fragment thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto.

[0210] In the above mentioned use, the level of RNA molecules in a blood sample from a patient is determined / analyzed.

[0211] Preferably, the blood sample is whole blood or a blood fraction. In particular, the blood fraction is selected from the group consisting of a blood cell fraction and plasma or serum. More preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum. The blood cell fraction may include red blood cells, white blood cells, and / or platelets. Even more preferably, the blood cell fraction is a white blood cell fraction, or the blood cell fraction is a mixture of red blood cells, white blood cells, and platelets.

[0212] Examples of cancer include, but are not limited to, lung cancer, preferably non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS), breast cancer, cervical cancer, gastric cancer, bladder cancer, skin cancer, nasopharyngeal cancer, neuroendocrine cancer, colon cancer, urothelial cancer, liver cancer, ovarian cancer, esophageal cancer, pancreatic cancer, kidney cancer, head and neck cancer, brain tumor, lymphatic cancer, blood cancer, squamous cell carcinoma, laryngeal cancer, retinal cancer, prostate cancer, uterine cancer, testicular cancer, bone cancer, tonsil cancer, esophageal cancer, lymphoma, and leukemia. Preferably, the cancer is selected from the group consisting of lung cancer, for example, non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS), bladder cancer, colon cancer, esophageal cancer, gastric cancer, tonsil cancer, and uterine cancer. More preferably, the cancer is lung cancer. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC).Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC).

[0213] For other preferred embodiments, please refer to the first to fourth aspects of the invention.

[0214] In a seventh aspect, the present invention relates to a kit ((in vitro) use) for diagnosing cancer in a patient, monitoring the progress of cancer in a patient, determining whether a patient will respond to a therapeutic treatment for cancer, determining a patient's risk for cancer recurrence, and / or detecting minimal residual disease (MRD) in a patient with cancer, wherein the kit comprises means for determining the level of an RNA molecule in a blood sample from a patient; wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1 or is a fragment thereof or is at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, e.g. , having a sequence with at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity.

[0215] Specifically, the kit includes: (i) the nucleotide sequence set forth in SEQ ID NO: 1; (ii) a nucleotide sequence which is a fragment of the nucleotide sequence according to (i), preferably a fragment which is 1 to 12, more preferably 1 to 8, and most preferably 1 to 5 or 1 to 3, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides shorter than the nucleotide sequence according to (i); or (viii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity to the nucleotide sequence set forth in (i) or the nucleotide sequence fragment set forth in (ii); The method includes determining the level of an RNA molecule comprising:

[0216] More specifically, the kit comprises: means for performing next-generation sequencing (NGS); at least one polynucleotide (probe) for detecting said RNA molecule, at least one primer (e.g., a primer pair) for binding the RNA molecule, and / or at least one antibody capable of binding to a hybrid of said at least one polynucleotide (probe) and said RNA molecule; Includes.

[0217] The at least one polynucleotide (probe) may be part of a microarray / biochip or may be attached to a bead in a bead-based multiplex system. The at least one polynucleotide (primer, primer pair) may be part of an RT-PCR system, a PCR system, or a next-generation sequencing system. The means may further comprise a microarray, an RT-PCT system, a PCR system, a flow cytometer, a Luminex system, and / or a next-generation sequencing system.

[0218] In a preferred embodiment, the kit further comprises instructions on how to carry out the methods according to the first to fifth aspects of the invention.

[0219] In another preferred embodiment, the kit is useful for carrying out the methods according to the first to fifth aspects of the invention.

[0220] The kit may further comprise a container, and / or a data carrier.

[0221] The data carrier may be a non-electronic data carrier (e.g., an information leaflet, an information sheet, a graphical data carrier such as a bar code or an access code, or an electronic data carrier such as a floppy disk, a compact disk (CD), a digital versatile disk (DVD), a microchip or other semiconductor-based electronic data carrier). The access code may enable access to a database (e.g., an internet database, a centralized database, or a distributed database). The access code may also be used to generate an application that causes a computer to perform a task for a computer user. The data carrier may enable access to a mobile application software, or a mobile app, which is software designed to run on smartphones and other mobile devices. The data carrier may further comprise at least one criterion (e.g., a reference level or threshold level for the level of an RNA molecule determined herein). If the data carrier comprises an access code enabling access to a database, the at least one criterion (e.g., the reference level or threshold level) may be stored in this database. The data carrier may also comprise information or instructions on how to perform the methods according to the first to fifth aspects of the invention.

[0222] The kit may also include materials desirable from a commercial and user standpoint, including buffers, reagents and / or diluents for determining the above-mentioned levels.

[0223] Preferably, the blood sample is whole blood or a blood fraction. In particular, the blood fraction is selected from the group consisting of a blood cell fraction and plasma or serum. More preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum. The blood cell fraction may include red blood cells, white blood cells, and / or platelets. Even more preferably, the blood cell fraction is a white blood cell fraction, or the blood cell fraction is a mixture of red blood cells, white blood cells, and platelets.

[0224] Examples of cancer include, but are not limited to, lung cancer, preferably non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC), breast cancer, cervical cancer, gastric cancer, bladder cancer, skin cancer, nasopharyngeal cancer, neuroendocrine cancer, colon cancer, urothelial cancer, liver cancer, ovarian cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, kidney cancer, head and neck cancer, brain tumor, lymphatic cancer, blood cancer, squamous cell carcinoma, laryngeal cancer, retinal cancer, prostate cancer, uterine cancer, testicular cancer, bone cancer, tonsil cancer, esophageal cancer, lymphoma, and leukemia.

[0225] Preferably, the cancer is selected from the group consisting of lung cancer, such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS), bladder cancer, colon cancer, esophageal cancer, gastric cancer, tonsillar cancer, and uterine cancer. More preferably, the cancer is lung cancer. Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLS). Even more preferably, the lung cancer is non-small cell lung cancer (NSCLC).

[0226] Finally, it should be noted that in addition to or alternatively to the level of RNA molecules comprising the nucleotide sequence set forth in SEQ ID NO: 1, the level of RNA molecules comprising the nucleotide sequence set forth in SEQ ID NO: 2 may be determined in all aspects of the present invention. As mentioned above, the nucleotide sequence set forth in SEQ ID NO: 2 is a variant of the nucleotide sequence set forth in SEQ ID NO: 1. In particular, the nucleotide sequence set forth in SEQ ID NO: 2 is one nucleotide longer than the nucleotide sequence set forth in SEQ ID NO: 1.

[0227] In the first to seventh aspects of the present invention, the cancer is most preferably lung cancer. 1. A method of diagnosing lung cancer in a patient, comprising determining the level of an RNA molecule in a blood sample from the patient, A method wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto. 2. The method of item 1, wherein the level of the RNA molecule is compared to a reference level of the RNA molecule. 3. The method of item 2, wherein the reference level is a level of the RNA molecule empirically determined by measuring a number of reference blood samples from healthy subjects and / or subjects suffering from lung cancer. 4. The reference level is a level of the RNA molecule empirically determined by measuring a number of reference blood samples from healthy subjects, and a level of the RNA molecule above the reference level indicates that the patient is suffering from lung cancer; and / or 4. The method of item 3, wherein the reference level is a level of the RNA molecule empirically determined by measuring multiple reference blood samples from subjects with lung cancer, and a level of the RNA molecule comparable to the reference level indicates that the patient is affected with lung cancer. 5. A method for monitoring the progress of lung cancer in a patient, comprising determining the level of an RNA molecule in a blood sample from the patient, A method wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto. 6. The method of item 5, wherein the level of the RNA molecule is compared to a reference level of the RNA molecule. 7. The method of item 6, wherein the reference level is a level of the RNA molecule empirically determined by measuring multiple reference blood samples from healthy subjects or subjects with lung cancer. 8. The method of any one of items 5 to 7, wherein said monitoring comprises determining the level of the RNA molecule in a blood sample obtained from the patient at an initial time point and in at least one further blood sample obtained from the (same) patient at a later time point, and comparing said levels determined at the different time points. 9. The level of the RNA molecule is (i) If it increases over time, it indicates that the patient has developed lung cancer or that the patient's lung cancer is getting worse, or (ii) No change over time indicates that the patient is stable or that the patient's lung cancer is not progressing; or (iii) A decrease over time indicates that the patient's lung cancer is improving; The method described in item 8. 10. (i) The patient is initially healthy and increasing levels over time indicate that the patient has developed lung cancer, or (ii) the patient has lung cancer at the initial time point, and increasing levels over time indicate that the patient's lung cancer is getting worse; (iii) the patient has lung cancer at the initial time point, and the level does not change over time, indicating that the patient's lung cancer is not progressing; or (iv) the patient has lung cancer at the initial time point, and a decreasing level over time indicates that the patient's lung cancer is improving; The method described in item 9. 11. The method of any one of items 5 to 10, wherein the patient is undergoing, is undergoing, or has undergone therapeutic treatment for lung cancer. 12. The method of item 11, wherein the therapeutic treatment for lung cancer is selected from the group consisting of surgery, chemotherapy, targeted therapy, immunotherapy, oncolytic virus therapy, vaccination therapy, radiation therapy, laser therapy, hyperthermia, and drug administration, or a combination thereof. 13. (i) the patient is undergoing, is undergoing, or has undergone therapeutic treatment for lung cancer, and a decreasing level over time indicates that the patient is responding to the treatment, or (ii) the patient is undergoing, is undergoing, or has undergone therapeutic treatment for lung cancer, and an increasing level over time indicates that the patient is not responding to the treatment; Item 13. The method according to item 11 or 12. 14. A method for determining whether a patient will respond to therapeutic treatment for lung cancer, comprising: determining the level of the RNA molecule in a blood sample from the patient; wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1 or a fragment thereof. or has a sequence that has at least 80% sequence identity thereto. 15. The method according to item 14, wherein the patient is a patient to whom, has been or has been administered at least once a drug used in the therapeutic treatment and / or other form of therapeutic treatment. 16. The method according to item 15, wherein the blood sample is isolated from the patient at least after the first administration of the drug and / or other form of therapeutic treatment. 17. The method of any one of items 14 to 16, wherein the level of the RNA molecule is compared to a reference level of the RNA molecule. 18. The method of item 17, wherein the reference level is a level of the RNA molecule empirically determined by measuring multiple reference blood samples from subjects with lung cancer. 19. The method according to item 17 or 18, wherein the reference level is a level determined in a reference blood sample isolated from the (same) patient prior to administration of the drug and / or other form of therapeutic treatment. 20. The method of any one of items 17 to 19, wherein a level of the RNA molecule lower than the reference level indicates that the patient will respond to the treatment for lung cancer, a level of the RNA molecule at the same level as the reference level indicates that the patient will not respond to the treatment for lung cancer, or a level of the RNA molecule above the reference level indicates that the patient will not respond to the treatment for lung cancer. 21. The method of any one of items 15 to 20, wherein the drug is selected from the group consisting of immunomodulators, chemotherapeutic agents, immunotherapeutic agents, immunosuppressants, radiotherapeutic agents, oncolytic viruses, vaccines, and antibodies. 22. (i) the immunomodulatory agent is selected from the group consisting of checkpoint inhibitors, preferably checkpoint inhibitors targeting PD-1, PD-L1, PD-L2, CTLA-4 or endogenous checkpoint blockade; or (ii) the chemotherapeutic agent is selected from the group consisting of alkylating agents, antimetabolites, folinic acid, antifolates, mitotic inhibitors, anthracyclines, topoisomerase inhibitors, signal transduction inhibitors, angiogenesis inhibitors, and histone deacetylase inhibitors; or (iii) the immunotherapeutic agent is selected from the group consisting of a cytokine, an antibody, an antigen-presenting cell, or a chimeric antigen receptor T cell; The method described in item 21. 23. The method according to any one of items 15 to 22, wherein said other form of therapeutic treatment is selected from the group consisting of surgery, radiation therapy, laser therapy, and thermotherapy. 24. A method for determining the risk of recurrence of lung cancer in a patient, comprising determining the level of an RNA molecule in a blood sample from the patient, A method wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto. 25. The method of item 24, wherein the patient has undergone therapeutic treatment for lung cancer. 26. The method according to item 25, wherein the treatment comprises the administration of drugs for lung cancer and / or other forms of therapeutic treatment of lung cancer. 27. The method according to any one of items 24 to 26, wherein the blood sample is isolated after therapeutic treatment of lung cancer. 28. The method of any one of items 24 to 27, wherein the level of the RNA molecule is compared to a reference level of the RNA molecule. 29. The method of item 28, wherein the reference level is a level of the RNA molecule empirically determined by measuring a large number of reference blood samples from healthy subjects and / or successfully treated lung cancer patients. 30. The method of item 29, wherein a level of the RNA molecule above the reference level indicates the patient's risk for lung cancer recurrence. 31. The reference level is an RNA sequence achievable in patients with lung cancer by therapeutic treatment. 31. The method of any one of items 28 to 30, representing a minimum level of offspring. 32. The method of item 31, wherein a level of the RNA molecule above the reference level indicates the patient's risk for lung cancer recurrence. 33. The method of any one of items 24 to 32, wherein the determining step comprises determining the level of the RNA molecule in a blood sample obtained from the patient at an initial time point after therapeutic treatment for lung cancer and in at least one further blood sample obtained from the (same) patient at a later time point, and comparing the levels determined at the different time points. 34. The method of item 33, wherein the level of the RNA molecule increases over time and indicates the patient's risk of lung cancer recurrence. 35. The method of any one of items 26 to 34, wherein the drug is selected from the group consisting of immunomodulatory agents, chemotherapeutic agents, immunotherapeutic agents, immunosuppressive agents, radiotherapeutic agents, oncolytic viruses, vaccines, and antibodies. 36. (i) The immunomodulatory agent is selected from the group consisting of checkpoint inhibitors, preferably checkpoint inhibitors targeting PD-1, PD-L1, PD-L2, CTLA-4 or endogenous checkpoint blockade; or (ii) the chemotherapeutic agent is selected from the group consisting of alkylating agents, antimetabolites, folinic acid, antifolates, mitotic inhibitors, anthracyclines, topoisomerase inhibitors, signal transduction inhibitors, angiogenesis inhibitors, and histone deacetylase inhibitors; or (iii) the immunotherapeutic agent is selected from the group consisting of a cytokine, an antibody, an antigen-presenting cell, or a chimeric antigen receptor T cell; The method described in item 35. 37. The method according to any one of items 26 to 36, wherein said other form of therapeutic treatment is selected from the group consisting of surgery, radiation therapy, laser therapy, and thermotherapy. 38. A method for detecting minimal residual disease in a patient with lung cancer, comprising determining the level of an RNA molecule in a blood sample from the patient, A method wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto. 39. The method of item 38, wherein the patient is undergoing, is undergoing, or has undergone therapeutic treatment for lung cancer. 40. The method according to item 39, wherein the treatment includes or has included administration of a drug for lung cancer and / or other forms of therapeutic treatment of lung cancer. 41. The method of any one of items 38 to 40, wherein the level of the RNA molecule is compared to a reference level of the RNA molecule. 42. The method according to item 41, wherein the reference level is a level of the RNA molecule empirically determined by measuring a large number of reference blood samples from healthy subjects and / or successfully treated lung cancer patients. 43. The method of item 42, wherein a level of RNA molecules above the reference level indicates that the patient is suffering from minimal residual disease. 44. The method of item 43, wherein the patient suffering from minimal residual disease is assigned / eligible for adjuvant therapy. 45. The method of any one of items 38 to 44, wherein the determining step comprises determining the level of the RNA molecule in a blood sample obtained from the patient at an initial time point before therapeutic treatment for lung cancer, and in at least one further blood sample obtained from the (same) patient at a later time point after therapeutic treatment, and comparing the levels determined at the different time points. 46. ​​The method of item 45, wherein the level of RNA molecules that is stable over time or does not decrease over time to / below a threshold level (representing the minimum level of RNA molecules achievable by therapeutic treatment of lung cancer) indicates that the patient is suffering from minimal residual disease. 47. The patient with minimal residual disease is assigned to / qualified for adjuvant therapy Item 47. The method according to Item 46, wherein the 48. The method of any one of items 40 to 47, wherein the drug is selected from the group consisting of immunomodulatory agents, chemotherapeutic agents, immunotherapeutic agents, immunosuppressive agents, radiotherapeutic agents, oncolytic viruses, vaccines, and antibodies. 49. (i) The immunomodulatory agent is selected from the group consisting of checkpoint inhibitors, preferably checkpoint inhibitors targeting PD-1, PD-L1, PD-L2, CTLA-4 or endogenous checkpoint blockade; or (ii) the chemotherapeutic agent is selected from the group consisting of alkylating agents, antimetabolites, folinic acid, antifolates, mitotic inhibitors, anthracyclines, topoisomerase inhibitors, signal transduction inhibitors, angiogenesis inhibitors, and histone deacetylase inhibitors; or (iii) the immunotherapeutic agent is selected from the group consisting of a cytokine, an antibody, an antigen-presenting cell, or a chimeric antigen receptor T cell; The method described in item 48. 50. The method according to any one of items 40 to 49, wherein said other form of therapeutic treatment is selected from the group consisting of surgery, radiation therapy, laser therapy, and thermotherapy. 51. The method of any one of items 1 to 50, wherein the lung cancer is non-small cell lung cancer (NSCLC). 52. The method according to any one of items 1 to 51, wherein the patient is a mammal, preferably a human or a rodent. 53. The method of any one of items 1 to 52, wherein the level of the RNA molecule is determined by sequencing, preferably next generation sequencing, nucleic acid hybridization, nucleic acid amplification, polymerase extension, mass spectrometry, or any combination thereof. 54. The method according to any one of items 1 to 53, wherein the level of the RNA molecule is the expression level of the RNA molecule. 55. The method according to any one of items 1 to 54, wherein the blood sample is whole blood or a blood fraction. 56. The method according to item 55, wherein the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum. 57. The method of item 56, wherein the blood cell fraction is a white blood cell fraction or a mixture of red blood cells, white blood cells, and platelets. 58. Use of an RNA molecule for diagnosing lung cancer in a patient, monitoring the progress of lung cancer in a patient, determining whether a patient will respond to therapeutic treatment for lung cancer, determining the risk of recurrence of lung cancer in a patient, and / or detecting minimal residual disease in a patient with lung cancer, comprising: The RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto. 59. A kit for diagnosing lung cancer in a patient, monitoring the progress of lung cancer in a patient, determining whether a patient will respond to therapeutic treatment for lung cancer, determining the risk of recurrence of lung cancer in a patient, and / or detecting minimal residual disease in a patient with lung cancer, comprising: The kit comprises means for determining the level of an RNA molecule in a blood sample from a patient; wherein the RNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto. 60. The kit according to item 59, wherein the kit further comprises instructions on how to carry out the method according to any one of items 1 to 57. 61. The kit according to any one of items 59 or 60, wherein the kit is useful for carrying out the method according to any one of items 1 to 57.

[0228] Various modifications and variations of this invention will be apparent to those skilled in the art without departing from the scope of the invention. It should be understood that the invention as described in scope should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the relevant fields are intended to be covered by the present invention. [Brief explanation of the drawings]

[0229] The following figures are merely illustrative of the present invention and should not be construed in any way as limiting the scope of the invention as set forth by the appended claims.

[0230] [Figure 1] Figure 1 shows a box plot of log2(1+RPM) expression per tumor stage. The 28S ribosomal RNA (rRNA) fragment GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1) was more highly expressed with increasing tumor stage in a clinical trial of lung cancer patients. [Figure 2] Figure 2 shows histograms of log2(1+RPM) expression in the control and CaseLC groups, plotted as smoothed curves with Gaussian kernel density estimates. When all lung cancer patients (CaseLC) were grouped together, the histogram of log2-RPM expression showed a clear increase compared to the control group. [Figure 3] Figure 3 shows Cohen's d effect size (diagnosis) versus logistic regression model coefficients for features with non-zero model coefficients. [Figure 4] Figure 4 shows DESeq2 adjusted p-values ​​for log2 fold change (diagnosis) for features with non-zero model coefficients. [Figure 5] Figure 5 shows the performance of the binary classification (diagnostic) model on the retained test set. Performance is given as the area under the ROC curve (AUC). [Figure 6] Figure 6 shows the decrease in 28S ribosomal RNA (rRNA) fragments after surgery (by stage). [Figure 7]Figure 7 shows the distribution of 28S ribosomal RNA (rRNA) fragment GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1) expression in clinical lung cancer samples before and after anticancer treatment as a box plot. Clinical assessment by oncologists at follow-up visits (post-treatment) summarizes disease progression (since the previous visit) as either remission (disease improvement), stable disease (no change), or progressive disease (disease worsening). Expression of 28S ribosomal RNA (rRNA) fragments reflects this assessment in that it significantly decreases during remission, significantly increases during progressive disease, and remains constant (no significant difference) during stable disease periods. Statistical quantification of this difference was obtained by paired t-tests with a two-sided alternative hypothesis (change in expression between post-treatment and pre-treatment). P values ​​and Cohen's d signed effect sizes (sign indicating the direction of change) are shown for each test and sample size N. P values ​​are classified by significance (lower P values ​​indicate greater significance) using the following rules: ns (not significant): P > 0.05; *: P ≤ 0.05; **: P ≤ 0.01; ***: P ≤ 0.001; ****: P ≤ 0.0001. Results are given for (a) all treatment types combined, (b) only cases where chemotherapy was administered and may have been combined with other treatments, and (c) only cases where immunochemotherapy was administered and may have been combined with other treatments. [Example]

[0231] The following examples are for illustrative purposes only and are not intended to limit the above invention in any way.

[0232] The present inventors have been able to demonstrate that lung cancer can be diagnosed and monitored by measuring the levels of the 28S ribosomal RNA (rRNA) fragment GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1) in patient blood samples. The present inventors have also demonstrated that the level of the 28S ribosomal RNA (rRNA) fragment GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1) in patient blood samples can be used to diagnose and monitor lung cancer. It has been shown that determining the level of 28S ribosomal RNA (rRNA) fragment GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1) in blood samples can evaluate the success of anti-lung cancer treatment. Specifically, the present inventors have shown that determining the level of 28S ribosomal RNA (rRNA) fragment GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1) in blood samples can evaluate whether a patient is in remission after anti-lung cancer treatment, whether the patient is stable (no improvement or worsening of lung cancer), or whether the patient's lung cancer is further progressing (worsening of lung cancer).

[0233] 1. Experiment Materials and Methods A small RNA next-generation sequencing (NGS) dataset of 1,427 patients was used, excluding only patients with unclear diagnoses or low QC indices (based on in-house spike-in and total read counts). Of the 1.8M+ unique RNA sequences detected in this dataset, 18,312 sequences remained after removing those with a maximum log2(1+RPM) expression of less than 10. Here, RPM is the number of reads per million (Reads Per Million). Million).

[0234] These patients were first balanced for diagnosis (by undersampling the majority group) within each of the two clinics to avoid potential batch effects due to differences between clinics. Thus, the resulting balanced dataset had equal numbers for the control (non-tumor lung disease) and CaseLC (lung cancer) groups.

[0235] A uniformly sampled test set from 25% of patients was removed, while the remaining 75% of patients were used to train a logistic regression classification model. The training samples were further reduced to the 10,000 most variable sequences (features) within each NGS pooling group to reduce the influence of major batch variables. Additionally, any sequences detected in fewer than 20% of the training samples were removed. The remaining 9132 features were standard-scaled and used as input for an L1-penalized logistic regression model with a penalty of 20.

[0236] After fitting the model coefficients to discriminate between control and CaseLC samples, only 78 features remained with non-zero coefficients. These coefficients correlated somewhat with Cohen's d effect size (r = 0.59; see Figure 3). DESeq2 is a standard software tool for calculating significant differential expression in RNA-seq data. The adjusted p-values ​​and log2 fold changes between the control and CaseLC groups are shown in Figure 4.

[0237] result The strongest outlier in terms of Cohen's d, model coefficients, and adjusted p-values ​​from DESeq2 was the 28S ribosomal RNA (rRNA) fragment GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1).

[0238] In a clinical trial of lung cancer patients, using non-tumor lung disease patients as controls, this RNA molecule was found to be more highly expressed as the tumor stage increased (see Figure 1). When all lung cancer patients (CaseLC) were grouped together, the histogram of log2-RPM expression showed a clear increase compared to controls (see Figure 2).

[0239] Across the entire test set, the AUC was 0.67, thus much higher when compared to the AUC of 0.46 when the diagnostic labels were shuffled (not performing better than random guessing (see Figure 5)). The exact patient numbers (listed by stage) used for training and testing are , as shown in Table 1 below: [Table 1] Table 1: Number of patients used as controls or cases (split by tumor stage) per training and test set.

[0240] Figure 6: Further showing the decrease in 28S ribosomal RNA (rRNA) fragments after lung cancer surgery (by stage). Thus, 28S ribosomal RNA (rRNA) fragment levels are tumor-related. Determination of 28S ribosomal RNA (rRNA) fragment levels can also be used to determine minimal residual disease in patients with lung cancer (e.g., after surgery) as a suitable treatment control.

[0241] 2. Experiment Materials and Methods As described in Experiment 1 above, for a subset of lung cancer patients, follow-up visits involved blood sampling to monitor their response to various anti-cancer treatments deemed appropriate by their oncologist. These follow-up samples were processed in the same manner as baseline samples (see above). Multiple follow-ups were possible per patient.

[0242] Consecutive patient visits were paired regardless of the number of preceding visits. These paired visits were then classified as "progression," "stable disease," or "progression" according to the anthologist's assessment. RNA (SEQ ID NO: 1) expression was obtained for each patient visit as log2(1+RPM). Paired t-tests were performed for expression values ​​within each category with the two-sided alternative hypothesis "there is a significant difference in expression between the first and second visits in each visit pair." Cohen's d effect sizes and t-tests for paired samples were calculated using the pingouin statistical software package (https: / / pingouin-stats.org).

[0243] [Table 2] Table 2: Number of patients in consecutive visit pairs, including the first visit (baseline, BL) and numbered follow-up visits (F-). For example, "BL_F-01" is the interval between the pre-treatment visit (BL) and the first follow-up visit (F-01) where anti-cancer treatment was administered. The numbers indicate the order of the visits, but the duration between visits varies.

[0244] result We further evaluated the distribution of 28S ribosomal RNA (rRNA) fragment GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1) expression in clinical lung cancer samples before and after anticancer treatment. The results are shown as box plots in Figure 7. Clinical assessment by oncologists at follow-up visits (post-treatment) summarizes disease progression (since the previous visit) as either remission (disease improvement), stable disease (no change), or progressive disease (disease worsening). This assessment is reflected by the fact that 28S ribosomal RNA (rRNA) fragment expression significantly decreases during remission, significantly increases during progressive disease, and remains constant (no significant difference) during stable disease. Statistical quantification of this difference was obtained by paired t-tests with a two-sided alternative hypothesis (change in expression between post-treatment and pre-treatment). P values ​​and Cohen's d signed effect sizes (signs indicating the direction of change) are given for each test, as well as the sample size N. P values ​​are classified by significance (lower P values ​​indicate higher significance) using the following convention: ns (not significant): P > 0.05; * :P ≤ 0.05; ** :P ≤ 0.01; *** :P≤0.001; ****:P≦0.0001. Results are shown for (a) all treatment combinations, (b) chemotherapy only, potentially combined with other treatments, and (c) immunochemotherapy only, potentially combined with other treatments. In this regard, it should be noted that the box plot for all treatments combined includes data from patients after chemotherapy, radiation therapy, immunotherapy, immunochemotherapy, surgery, targeted therapy, or no treatment ("watch and wait" category).

Claims

1. A method for providing information for diagnosing lung cancer in a patient, comprising: (i) determining the expression level of the RNA molecule set forth in SEQ ID NO: 1 in a blood sample from a patient; and (ii) comparing the expression level of the RNA molecule to a reference expression level of the RNA molecule, where: the reference expression level is an expression level of the RNA molecule empirically determined by measuring a number of reference blood samples from healthy subjects, wherein an expression level of the RNA molecule above the reference expression level indicates that the patient is afflicted with lung cancer; or The reference expression level is an expression level of the RNA molecule empirically determined by measuring multiple reference blood samples from subjects suffering from lung cancer, and wherein an expression level of the RNA molecule that is comparable to the reference expression level indicates that the patient is suffering from lung cancer. method.

2. A method for providing information for monitoring the progress of lung cancer in a patient, comprising: (i) determining the expression level of the RNA molecule set forth in SEQ ID NO: 1 in a blood sample obtained from the patient at an initial time point and in at least one further blood sample obtained from the same patient at a later time point; and (ii) comparing the expression levels determined at different time points; where: (a) an increase over time indicates that the patient has developed lung cancer or that the patient's lung cancer is getting worse; (b) no change over time indicates that the patient is stable or that the patient's lung cancer is not progressing; or (c) a decrease over time indicates that the patient's lung cancer is improving.

3. (i) the patient is initially healthy, and the expression level increases over time, indicating that the patient has developed lung cancer; or (ii) the patient has lung cancer at an initial time point, and the expression level increases over time, indicating that the patient's lung cancer is worsening; (iii) the patient has cancer at an initial time point, and the expression level does not change over time, indicating that the patient has not progressed to lung cancer; or (iv) the patient has cancer at an initial time point, and a decrease in the expression level over time indicates that the patient's lung cancer is improving. The method of claim 2.

4. A method for providing information for determining whether a patient will respond to therapeutic treatment for lung cancer, comprising: (i) determining the expression level of the RNA molecule set forth in SEQ ID NO: 1 in a blood sample from the patient; and (ii) comparing the expression level of the RNA molecule to a reference expression level of the RNA molecule; wherein the patient is a patient to whom a drug used in the therapeutic treatment is administered at least once; wherein the baseline expression level is measured in a baseline blood sample isolated from the patient prior to administration of the drug; wherein said blood sample is isolated from the same patient after at least the first administration of said drug, wherein: an expression level of the RNA molecule lower than the reference expression level indicates that the patient will respond to treatment for the lung cancer; an expression level of the RNA molecule that is similar to the reference expression level indicates that the patient will not respond to treatment for the lung cancer; or an expression level of the RNA molecule higher than the reference expression level indicates that the patient will not respond to treatment for the lung cancer. method.

5. A method for providing information for determining a patient's risk of lung cancer recurrence, comprising: (i) determining the expression level of the RNA molecule set forth in SEQ ID NO: 1 in a blood sample obtained from the patient at an initial time point after therapeutic treatment for lung cancer and in at least one additional blood sample obtained from the same patient at a later time point; and (ii) comparing the expression levels determined at different time points; wherein the increasing expression level of the RNA molecule over time indicates the patient's risk for lung cancer recurrence. method.

6. A method for providing information for the detection of minimal residual disease in a patient suffering from lung cancer, comprising: (i) determining the expression level of the RNA molecule set forth in SEQ ID NO: 1 in a blood sample from the patient; and (ii) comparing the expression level of the RNA molecule to a reference expression level of the RNA molecule; where: the patient has undergone therapeutic treatment for lung cancer; The reference expression level is an expression level of the RNA molecule empirically determined by measuring multiple reference blood samples from healthy subjects or successfully treated lung cancer patients, and an expression level of the RNA molecule that exceeds the reference expression level indicates that the patient is suffering from minimal residual disease. method.

7. The method described in claim 6, wherein the therapeutic treatment for lung cancer is administration of a lung cancer therapeutic drug, and / or a treatment selected from the group consisting of surgery, radiation therapy, laser therapy, and thermotherapy.

8. 7. The method of claim 6, wherein the patient with minimal residual disease is assigned / eligible for adjuvant therapy.

9. 7. The method of claim 1, claim 2, claim 4, claim 5 or claim 6, wherein the lung cancer is non-small cell lung cancer (NSCLC).

10. 7. The method of claim 1, claim 2, claim 4, claim 5 or claim 6, wherein the expression level of the RNA molecule is determined by sequencing, nucleic acid hybridization, nucleic acid amplification, polymerase extension, mass spectrometry, or any combination thereof.

11. 7. The method of claim 1, claim 2, claim 4, claim 5 or claim 6, wherein the blood sample is whole blood or a blood fraction.

12. 12. The method of claim 11, wherein the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum.

13. 13. The method of claim 12, wherein the blood cell fraction is a white blood cell fraction or a mixture of red blood cells, white blood cells, and platelets.

14. Use of the RNA molecule set forth in SEQ ID NO: 1 to provide information for diagnosing lung cancer in a blood sample obtained from a patient, for monitoring the progress of lung cancer in a blood sample obtained from a patient, for determining whether a patient will respond to therapeutic treatment for lung cancer in a blood sample obtained from a patient, for determining the risk of recurrence of lung cancer in a blood sample obtained from a patient, and / or for detecting minimal residual disease in a blood sample obtained from a patient suffering from lung cancer.

15. 1. A kit for diagnosing lung cancer in a patient, monitoring the progress of lung cancer in a patient, determining whether a patient will respond to therapeutic treatment for lung cancer, determining a patient's risk of recurrence of lung cancer, and / or detecting minimal residual disease in a patient suffering from lung cancer, comprising: The kit comprises a means for determining the expression level of an RNA molecule set forth in SEQ ID NO: 1 in a blood sample from a patient, the means comprising: wherein the means comprises at least one polynucleotide probe for detecting the RNA molecule, at least one primer for binding the RNA molecule, and / or at least one antibody capable of binding to a hybrid between the at least one polynucleotide probe and the RNA molecule; kit.

Images