Polypeptides having 2-indolecarboxylic acid decarboxylation activity and uses thereof
Mutating PaHudA to improve its decarboxylation activity addresses the decomposition challenges in high-temperature synthesis, enabling efficient indole production from 2-indolecarboxylic acid at room temperature and pressure.
Patent Information
- Application Number
- JP2022212471
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2022-12-28
- Publication Date
- 2025-10-14
- Estimated Expiration
- 2042-12-28
AI Technical Summary
Existing methods for synthesizing indole carboxylic acid, such as 2-indolecarboxylic acid, involve high-temperature decarboxylation processes that lead to product decomposition and purification issues, necessitating the development of a more efficient and stable enzymatic decarboxylation process.
Mutating specific amino acid residues in the prenylated flavin decarboxylase PaHudA to enhance its decarboxylation activity towards 2-indolecarboxylic acid, enabling the production of indole at room temperature and pressure using a polypeptide with improved stability and efficiency.
The mutated polypeptide effectively catalyzes the decarboxylation of 2-indolecarboxylic acid to indole at room temperature and pressure, overcoming decomposition issues and enhancing production efficiency.
Smart Images

Figure 0007753182000001 
Figure 0007753182000002 
Figure 0007753182000003
Abstract
Description
[Technical Field]
[0001] The present invention relates to a polypeptide having 2-indolecarboxylic acid decarboxylation activity and uses thereof. [Background technology]
[0002] Indole is an organic compound with a condensed benzene ring and a pyrrole ring. It is found in natural jasmine essential oil at approximately 2.5% concentration, and synthetic indole is used in orange and jasmine fragrances and perfumes. Indole is also known as a raw material for indigo dye. Furthermore, indoles with substituents on the indole ring are important in pharmaceuticals, various chemical products, and as synthetic intermediates for these products.
[0003] Synthetic methods for synthesizing indoles, such as the Reissert method, the Fischer method, and the Rees-Moody method, have long been known. However, in the indole ring formation reaction using these time-honored methods, a method of synthesizing an indole carboxylic acid, such as 2-indolecarboxylic acid, followed by decarboxylation is adopted from the viewpoint of reactivity. For example, 2-indolecarboxylic acid is produced using phenylhydrazine and pyruvic acid, and then subjected to a decarboxylation reaction to synthesize indole. The decarboxylation reaction here is mainly carried out under heated conditions (200 to 300°C), which poses the problem of decomposition of the product and further decomposition during purification (Non-Patent Document 1).
[0004] Recently, prenylated flavin decarboxylases (prFMN-DCs), such as PaHudA, CbHmfF, and AnFDC1, have been discovered as enzyme catalysts capable of decarboxylating heteroaromatic carboxylic acids in a single step and reversibly at room temperature and pressure (Non-Patent Document 2). Among these, AnFDC1, a representative prFMN-DC, has been modified to exhibit specificity for various aromatic substrates, and mutants with decarboxylation activity toward 2-indole carboxylic acid have been identified (Non-Patent Document 3). [Prior art documents] [Non-patent literature]
[0005] [Non-Patent Document 1] U. Tilstam, Organic Process Research & Development 2012, 16, 1449. [Non-patent document 2] SE Payer et al., Advanced Synthesis & Catalysis 2019, 361, 2402. [Non-patent document 3] D. Leys et al., Nature Chemical Biology 2020, 16, 1255. Summary of the Invention [Problem to be solved by the invention]
[0006] The present invention relates to providing a polypeptide having decarboxylation activity for 2-indolecarboxylic acids and a method for using the same. [Means for solving the problem]
[0007] The present inventors have found that specific mutants of PaHudA, a prenylated flavin decarboxylase with decarboxylation activity toward pyrrole-2-carboxylic acid, have excellent decarboxylation activity toward 2-indolecarboxylic acid and are useful for producing indole acids.
[0008] The present invention relates to the following 1) to 7). 1) A polypeptide having indole-2-carboxylic acid decarboxylation activity, wherein the amino acid residue at position 322 in the amino acid sequence shown in SEQ ID NO: 2 is the following amino acid, or wherein the amino acid residue at the position corresponding to position 322 in the amino acid sequence shown in SEQ ID NO: 2 is the following amino acid in an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 2; Alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, leucine, methionine, asparagine, proline, glutamine, serine, threonine, valine, or tyrosine. 2) A method for producing a mutant polypeptide having indole-2-carboxylic acid decarboxylation activity, comprising substituting the amino acid residue at position 322 of the amino acid sequence shown in SEQ ID NO: 2 with the amino acid shown below, or substituting the amino acid residue at the position corresponding to position 322 of the amino acid sequence shown in SEQ ID NO: 2 with the amino acid shown below in an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2; Alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, leucine, methionine, asparagine, proline, glutamine, serine, threonine, valine, or tyrosine. 3) a method for imparting decarboxylation activity to indole-2-carboxylic acid, comprising substituting the amino acid residue at position 322 of the amino acid sequence shown in SEQ ID NO: 2 with the amino acid shown below, or substituting the amino acid residue at the position corresponding to position 322 of the amino acid sequence shown in SEQ ID NO: 2 with the amino acid shown below in an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 2; Alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, leucine, methionine, asparagine, proline, glutamine, serine, threonine, valine, or tyrosine. 4) A polynucleotide encoding the polypeptide of 1). 5) A vector or DNA fragment containing the polynucleotide of 4). 6) A transformed cell containing the vector or DNA fragment of 5). 7) The following general formula (1):
[0009] [ka] [In the formula, R 1 and R2 may be the same or different and represent a hydrogen atom, a hydroxy group, a halogen atom, an alkyl group having 1 to 3 carbon atoms, an alkoxy group having 1 to 3 carbon atoms, a carboxy group, or an amino group.
[0010] A method for producing a compound represented by the following general formula (2):
[0011] [ka] [In the formula, R 1 and R 2 indicates the same as above.]
[0012] A method for producing an indole represented by the formula: [Effects of the Invention]
[0013] Since the polypeptide of the present invention has excellent indole-2-carboxylic acid decarboxylation activity, it can be used to efficiently produce indoles from indole-2-carboxylic acids at room temperature and pressure. DETAILED DESCRIPTION OF THE INVENTION
[0014] Herein, the identity of an amino acid sequence or a nucleotide sequence is calculated by the Lipman-Pearson method (Science, 1985, 227:1435-1441). Specifically, it is calculated by performing analysis using the homology analysis (Search homology) program of the genetic information processing software GENETYX Ver. 12, with the unit size to compare (ktup) set to 2.
[0015] As used herein, a "corresponding position" on an amino acid sequence or a nucleotide sequence can be determined by aligning a target sequence with a reference sequence (e.g., the amino acid sequence set forth in SEQ ID NO: 2) to maximize homology. Alignment of amino acid sequences or nucleotide sequences can be performed using known algorithms, and the procedures are well known to those skilled in the art. For example, alignment can be performed using the Clustal W multiple alignment program (Thompson, J.D. et al., 1994, Nucleic Acids Res. 22:4673-4680) with default settings. Alternatively, Clustal W2 or Clustal omega, which are revised versions of Clustal W, can also be used. Clustal W, Clustal W2, and Clustal omega are available, for example, on the websites of the European Bioinformatics Institute (EBI [www.ebi.ac.uk / index.html]) and the DNA Data Bank of Japan (DDBJ [www.ddbj.nig.ac.jp / searches-j.html]), operated by the National Institute of Genetics. The position of the target sequence aligned to any position in the reference sequence by the above-mentioned alignment is considered to be the "position corresponding to" that position.
[0016] Those skilled in the art can further fine-tune the alignment of amino acid sequences obtained above to optimize it. Such optimal alignment is preferably determined taking into account the similarity of the amino acid sequences, the frequency of inserted gaps, and other factors. Here, the similarity of amino acid sequences refers to the percentage (%) of the number of positions at which identical or similar amino acid residues exist in both aligned amino acid sequences relative to the total number of amino acid residues in the two sequences. Similar amino acid residues refer to amino acid residues among the 20 amino acids that constitute proteins that have similar properties in terms of polarity and charge, resulting in so-called conservative substitutions. Groups of such similar amino acid residues are well known to those skilled in the art, and include, but are not limited to, arginine and lysine or glutamine; glutamic acid and aspartic acid or glutamine; serine and threonine or alanine; glutamine and asparagine or arginine; and leucine and isoleucine.
[0017] As used herein, the term "amino acid residue" refers to the 20 amino acid residues that make up proteins: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine (Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y), and valine (Val or V).
[0018] As used herein, the term "operably linked" between a gene and a regulatory region such as a promoter means that the gene and regulatory region are linked in such a way that the gene can be expressed under the control of the regulatory region. Procedures for "operably linking" a gene to a regulatory region are well known to those skilled in the art.
[0019] As used herein, "upstream" and "downstream" in relation to a gene refer to upstream and downstream in the transcription direction of the gene. For example, "a gene located downstream of a promoter" means that the gene is located on the 3' side of the promoter on the DNA sense strand, and "upstream" of a gene means the 5' region of the gene on the DNA sense strand.
[0020] As used herein, the term "native" when used with respect to a cellular function, property, or trait is used to indicate that the function, property, or trait is inherently present in the cell. In contrast, the term "exogenous" is used to indicate that the function, property, or trait is not inherently present in the cell but is introduced from outside. For example, an "exogenous" gene or polynucleotide is a gene or polynucleotide that is introduced into a cell from outside. An exogenous gene or polynucleotide may be derived from the same organism as the cell into which it is introduced, or from a different organism (i.e., a heterologous gene or polynucleotide).
[0021] <Polypeptides with indole-2-carboxylic acid decarboxylation activity> The polypeptide of the present invention having indole-2-carboxylic acid decarboxylation activity (referred to as "polypeptide of the present invention") is a polypeptide in which the amino acid residue at position 322 in the amino acid sequence shown in SEQ ID NO: 2, or the amino acid residue at the position corresponding to position 322 in the amino acid sequence shown in SEQ ID NO: 2 in an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2, is alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, leucine, methionine, asparagine, proline, glutamine, serine, threonine, valine, or tyrosine, and preferably alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, leucine, methionine, asparagine, serine, or threonine.
[0022] The polypeptide is a mutant polypeptide having indole-2-carboxylic acid decarboxylation activity, in which the amino acid residue at position 322 of a reference polypeptide, i.e., a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, is substituted with alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, leucine, methionine, asparagine, proline, glutamine, serine, threonine, valine, or tyrosine, preferably alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, leucine, methionine, asparagine, serine, or threonine, or in which the amino acid residue at position 322 of a polypeptide consisting of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 is substituted with alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, leucine, methionine, asparagine, serine, or threonine.
[0023] In the present invention, "indole-2-carboxylic acid decarboxylation activity" means the activity of catalyzing the decarboxylation reaction of indole-2-carboxylic acid. As shown in the Examples below, indole-2-carboxylic acid decarboxylation activity can be determined by contacting indole-2-carboxylic acid with the polypeptide of the present invention or a microorganism that produces the polypeptide, and measuring the amount of indole produced by HPLC or the like.
[0024] Such polypeptides of the present invention can be produced by substituting the amino acid residue at position 322 of the amino acid sequence shown in SEQ ID NO: 2, or the amino acid residue at the position corresponding to position 322 of the amino acid sequence shown in SEQ ID NO: 2 in an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2, with alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, leucine, methionine, asparagine, proline, glutamine, serine, threonine, valine, or tyrosine, preferably alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, leucine, methionine, asparagine, serine, or threonine. Here, a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity thereto is the "parent" polypeptide of the polypeptide of the present invention. The parent polypeptide refers to a reference polypeptide in which predetermined mutations are made to amino acid residues to result in a polypeptide of the present invention.
[0025] The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 is known as PaHudA (NCBI Reference Sequence: WP_003115722.1), a type of prenylated flavin decarboxylase (prFMN-DC). PaHudA is a prenylated flavin decarboxylase derived from Pseudomonas aeruginosa, which contains prenylated flavin mononucleotide (prFMN) in the active center and has catalytic activity to promote the decarboxylation of pyrrole-2-carboxylic acid.
[0026] Therefore, examples of polypeptides that are parent polypeptides of the polypeptides of the present invention and have an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 2 include polypeptides that have an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 2, more preferably 95% identical to the amino acid sequence shown in SEQ ID NO: 2, more preferably 96% identical to the amino acid sequence shown in SEQ ID NO: 2, even more preferably 97% identical to the amino acid sequence shown in SEQ ID NO: 2, and have pyrrole-2-carboxylic acid decarboxylation activity.
[0027] <Polynucleotide encoding the polypeptide of the present invention> In the present invention, various mutagenesis techniques known in the art can be used to mutate amino acid residues in a parent polypeptide. For example, a polynucleotide encoding the polypeptide of the present invention can be obtained by mutating a nucleotide sequence encoding an amino acid residue to be mutated in a polynucleotide encoding the amino acid sequence of the parent polypeptide (hereinafter also referred to as a parent gene) to a nucleotide sequence encoding the mutated amino acid residue.
[0028] Introduction of the desired mutation into a parent gene can basically be carried out using various site-directed mutagenesis methods well known to those skilled in the art. Site-directed mutagenesis can be carried out by any method, such as inverse PCR or annealing. Commercially available site-directed mutagenesis kits (e.g., Agilent Technologies' QuikChange II Site-Directed Mutagenesis Kit or QuikChange Multi Site-Directed Mutagenesis Kit) can also be used.
[0029] Site-directed mutagenesis of a parent gene is most commonly performed using a mutagenesis primer containing the nucleotide mutation to be introduced. The mutagenesis primer is designed to anneal to a region of the parent gene containing a nucleotide sequence encoding the amino acid residue to be mutated, and to contain a nucleotide sequence containing a nucleotide sequence (codon) encoding the mutated amino acid residue in place of the nucleotide sequence (codon) encoding the amino acid residue to be mutated. Those skilled in the art can appropriately recognize and select the nucleotide sequences (codons) encoding the pre- and post-mutation amino acid residues based on standard textbooks. Alternatively, site-directed mutagenesis can be performed using two complementary primers containing the nucleotide mutation to be introduced, each amplifying DNA fragments upstream and downstream of the mutation site, and then joining the resulting fragments together using splicing by overlap extension (SOE)-PCR (Gene, 1989, 77(1): pp. 61-68).
[0030] Template DNA containing the parent gene can be prepared from the PaHudA-producing microorganism by standard methods, either by extracting genomic DNA or by synthesizing cDNA by reverse transcription of extracted RNA. Alternatively, a corresponding nucleotide sequence can be chemically synthesized based on the amino acid sequence of the parent polypeptide and used as template DNA. The DNA sequence encoding PaHudA, a polypeptide with pyrrole-2-carboxylic acid decarboxylation activity, is shown in SEQ ID NO: 1.
[0031] Mutation primers can be prepared by well-known oligonucleotide synthesis methods, such as the phosphoramidite method (Nucleic Acids Research, 1989, 17:7059-7071). Such primer synthesis can also be performed using, for example, a commercially available oligonucleotide synthesizer (such as that manufactured by ABI). A primer set containing the mutation primers can be used to perform site-specific mutagenesis as described above using a parent gene as template DNA to obtain a polynucleotide encoding the polypeptide of the present invention having the desired mutation.
[0032] The polynucleotide encoding the polypeptide of the present invention may comprise single-stranded or double-stranded DNA, cDNA, RNA, or other artificial nucleic acids. The DNA, cDNA, and RNA may be chemically synthesized. The polynucleotide may also comprise a nucleotide sequence of an untranslated region (UTR) in addition to an open reading frame (ORF). The polynucleotide may also be codon-optimized for the species of the transformant used to produce the mutant polypeptide of the present invention. Information on codons used by various organisms is available from the Codon Usage Database ([www.kazusa.or.jp / codon / ]).
[0033] <Vector or DNA fragment> The obtained polynucleotide encoding the polypeptide of the present invention can be incorporated into a vector. The vector containing the polynucleotide is an expression vector. Preferably, the vector is an expression vector that can introduce a polynucleotide encoding the polypeptide of the present invention into a host microorganism and express the polynucleotide in the host microorganism. Preferably, the vector contains a polynucleotide encoding the polypeptide of the present invention and a control region operably linked thereto. The vector may be a vector that is capable of autonomous replication and replication outside of a chromosome, such as a plasmid, or may be a vector that is integrated into a chromosome.
[0034] Specific examples of vectors include pBluescript II SK(-) (Stratagene), pUC vectors such as pUC18 / 19 and pUC118 / 119 (Takara Bio), pET vectors (Takara Bio), pGEX vectors (GE Healthcare), pCold vectors (Takara Bio), pHY300PLK (Takara Bio), pUB110 (Mckenzie, T. et al., 1986, Plasmid 15(2):93-103), pBR322 (Takara Bio), pRS403 (Stratagene), pMW218 / 219 (Nippon Gene), pRI vectors such as pRI909 / 910 (Takara Bio), pBI vectors (Clontech), IN3 vectors (Implanta Innovations), pPTR1 / 2 (Takara Bio), pDJB2 (DJBallance et al.), and the like. al., Gene, 36, 321-331, 1985), pAB4-1 (van Hartingsveldt W et al., Mol Gen Genet, 206, 71-75, 1987), pLeu4 (MIGRoncero et al., Gene, 84, 335-343, 1989), pPyr225 (CDSkory et al., Mol Genet Genomics, 268, 397-406, 2002), pFG1 (Gruber, F. et al., Curr Genet, 18, 447-451, 1990), and the like.
[0035] Alternatively, the polynucleotide encoding the polypeptide of the present invention may be constructed as a DNA fragment containing the polynucleotide. Examples of such DNA fragments include PCR-amplified DNA fragments and restriction enzyme-cleaved DNA fragments. Preferably, the DNA fragment may be an expression cassette containing the polynucleotide encoding the polypeptide of the present invention and a control region operably linked thereto.
[0036] The control region contained in the above-mentioned vector or DNA fragment is a sequence for expressing a polynucleotide encoding a polypeptide of the present invention in a host cell into which the vector or DNA fragment has been introduced, and examples thereof include expression regulatory regions such as promoters and terminators, and replication origins. The type of control region can be appropriately selected depending on the type of host microorganism into which the vector or DNA fragment is to be introduced. If necessary, the vector or DNA fragment may further contain a selection marker such as an antibiotic resistance gene or an amino acid synthesis-related gene (e.g., a drug resistance gene such as ampicillin, neomycin, kanamycin, or chloramphenicol). The vector or DNA fragment may contain a polynucleotide sequence encoding flavin mononucleotide prenyltransferase (EC 2.5.1.129). Flavin mononucleotide prenyltransferase is an enzyme that catalyzes the reaction of attaching a dimethylallyl moiety from dimethylallyl monophosphate (DMAP) to the flavin backbone of flavin mononucleotide (FMN) to synthesize prenylated flavin mononucleotide (prFMN), which constitutes the active center of prenylated flavin decarboxylase. Sufficient expression of this enzyme in bacteria can help ensure that the target prenylated flavin decarboxylase retains sufficient activity.
[0037] The polynucleotide encoding the polypeptide of the present invention can be ligated to the above-mentioned regulatory region or marker gene sequence by the SOE-PCR method described above. The procedure for introducing a gene sequence into a vector is well known in the art. The types of regulatory regions, such as promoter regions, terminators, and secretion signal regions, are not particularly limited, and commonly used promoters and secretion signal sequences can be appropriately selected and used depending on the host to be introduced.
[0038] Suitable examples of the regulatory region include strong regulatory regions that can enhance expression compared to the wild type, such as known high expression promoters such as the T7 promoter, lac promoter, tac promoter, and trp promoter, but are not particularly limited to these.
[0039] <Transformed cells> The transformed cell of the present invention can be obtained by introducing a vector containing a polynucleotide encoding the polypeptide of the present invention into a host, or by introducing a DNA fragment containing a polynucleotide encoding the polypeptide of the present invention into the genome of the host. Such transformed cells are cells into which a polynucleotide encoding a polypeptide of the present invention has been introduced so that it can be expressed, and can be said to be cells in which the expression of the polynucleotide has been enhanced, and therefore cells in which the expression of the polypeptide of the present invention has been enhanced.
[0040] As the host cell, any of fungi, yeast, actinomycetes, Escherichia coli, Bacillus subtilis, etc. may be used, but Escherichia coli, yeast, and actinomycetes are preferred, and more preferred are a group of microorganisms defined as coryneform bacteria among Escherichia coli and actinomycetes (Bergey's Manual of Determinative Bacteriology, Vol. 8, 599 (1974)). Specific examples of coryneform bacteria include bacteria of the genus Corynebacterium, Brevibacterium, Arthrobacter, Mycobacterium, Rhodococcus, Streptomyces, and Micrococcus. Among these, preferred are bacteria of the genus Corynebacterium (e.g., Corynebacterium glutamicum, Corynebacterium efficiens, Corynebacterium ammoniagenes, Corynebacterium halotolerance, Corynebacterium alkanolyticum, Corynebacterium crenatum, Corynebacterium crudilactis, Corynebacterium callunae, etc.), and more preferred is Corynebacterium glutamicum.
[0041] Furthermore, the transformed cell of the present invention or its host cell may be a cell that harbors a gene encoding flavin mononucleotide prenyltransferase and expresses flavin mononucleotide prenyltransferase, or a cell in which expression of flavin mononucleotide prenyltransferase has been previously enhanced.
[0042] Methods that can be used to introduce a vector or DNA fragment into a host include, for example, electroporation, transformation, transfection, conjugation, protoplast method, particle gun method, and Agrobacterium method.
[0043] Furthermore, methods for introducing a polynucleotide into the genome of a host include, but are not limited to, a double-crossover method using a DNA fragment containing the polynucleotide. The DNA fragment may be introduced downstream of the promoter sequence of a gene that is highly expressed in the host cell described above. Alternatively, a fragment in which the DNA fragment and the above-mentioned control region are operably linked may be prepared in advance, and the linked fragment may be introduced into the genome of the host. Furthermore, the DNA fragment may be linked in advance to a marker (such as a drug resistance gene or an auxotrophy-complementing gene) for selecting cells into which the polynucleotide of the present invention has been appropriately introduced.
[0044] Transformed cells into which a vector or DNA fragment of interest has been introduced can be selected using a selection marker. For example, if the selection marker is an antibiotic resistance gene, transformed cells into which a vector or DNA fragment of interest has been introduced can be selected by culturing the cells in a medium supplemented with the antibiotic. Furthermore, if the selection marker is an amino acid synthesis-related gene, the gene can be introduced into a host microorganism that requires the amino acid, and then transformed cells into which a vector or DNA fragment of interest has been introduced can be selected using the presence or absence of the amino acid requirement as an indicator. Alternatively, introduction of a vector or DNA fragment of interest can be confirmed by examining the DNA sequence of the transformed cells using PCR or other methods.
[0045] When the transformed cells thus obtained are cultured in an appropriate medium, the polynucleotide introduced into the cells is expressed, producing the polypeptide of the present invention. That is, the transformed cells can become bacteria that produce a polypeptide having indole-2-carboxylic acid decarboxylation activity. As will be shown in the Examples below, when the transformed cells of the present invention are cultured in the presence of indole-2-carboxylic acid, indole production becomes possible, whereas no indole is produced at all when transformed cells producing the parent polypeptide are used. That is, in a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity thereto, a mutation in which the amino acid residue at or corresponding to position 322 of the amino acid sequence shown in SEQ ID NO: 2 is replaced with alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, leucine, methionine, asparagine, proline, glutamine, serine, threonine, valine, or tyrosine is useful for imparting decarboxylation activity to indole-2-carboxylic acid, and as shown below, the mutant polypeptide can be used to produce indoles from indole-2-carboxylic acids. Therefore, the transformed cells of the present invention are bacteria that produce polypeptides to which decarboxylation activity for indole-2-carboxylic acids has been imparted, and can be said to be useful indole-producing strains for producing indoles from indole-2-carboxylic acids.
[0046] <Production of indoles> The method for producing an indole compound of the present invention is a method for producing an indole compound by reacting a compound represented by the following general formula (1):
[0047] [ka]
[0048] [In the formula, R 1 and R 2 may be the same or different and represent a hydrogen atom, a hydroxy group, a halogen atom, an alkyl group having 1 to 3 carbon atoms, an alkoxy group having 1 to 3 carbon atoms, a carboxy group, or an amino group. By contacting an indole-2-carboxylic acid represented by the following general formula (2):
[0049] [ka]
[0050] [In the formula, R 1 and R 2 indicates the same as above.] The present invention relates to the production of indoles represented by the following formula:
[0051] In formula (1) or (2), R 1 , R 2 Examples of the halogen atom represented by the formula (I) include a fluorine atom, a chlorine atom, a bromine atom, and an iodine atom, and preferred are a fluorine atom, a chlorine atom, and a bromine atom. The alkyl group having 1 to 3 carbon atoms is preferably a methyl group or an ethyl group. The alkoxy group having 1 to 3 carbon atoms is preferably a methoxy group or an ethoxy group. R 1 and R 2 are preferably both hydrogen atoms.
[0052] Contact between the indole-2-carboxylic acids and the polypeptide of the present invention can be carried out by contacting (coexisting) the indole-2-carboxylic acids and the polypeptide in an aqueous medium and heating for a certain period of time while stirring or shaking. For example, the concentration of the indole-2-carboxylic acids may be 0.1 to 10 mM, preferably 1 to 5 mM, and the concentration of the polypeptide of the present invention may be 0.1 to 5 mg / ml, preferably 1 to 5 mg / ml, and the contact may be carried out at pH 5 to 9, 10°C to 40°C, for 6 to 72 hours, preferably 9 to 60 hours, and more preferably 12 to 48 hours.
[0053] Contact of the indole-2-carboxylic acid with the transformed cell of the present invention can be achieved by culturing the transformed cell in a medium supplemented with the indole-2-carboxylic acid. The medium for culturing the transformed cells may be either a natural medium or a synthetic medium, as long as it contains a carbon source, a nitrogen source, inorganic salts, etc. and allows efficient cultivation of the transformed cells of the present invention. Examples of carbon sources that can be used include sugars such as glucose, polyols such as glycerin, alcohols such as ethanol, and organic acids such as pyruvic acid, succinic acid, and citric acid. Examples of nitrogen sources that can be used include peptone, meat extract, yeast extract, casein hydrolysate, alkaline extract of soybean meal, alkylamines such as methylamine, and ammonia or its salts. Other salts that can be used, such as phosphates, carbonates, sulfates, salts of magnesium, calcium, potassium, iron, manganese, and zinc, specific amino acids, specific vitamins, and antifoaming agents, may also be used as needed.
[0054] The culture can usually be carried out at 10° C. to 40° C. for 6 to 72 hours, preferably 9 to 60 hours, and more preferably 12 to 48 hours, with stirring or shaking as needed. During the culture, antibiotics such as ampicillin or kanamycin may be added to the medium as needed.
[0055] The method for recovering and purifying the indoles from the reaction system is not particularly limited, and can be carried out by combining well-known methods such as ion exchange resin method, precipitation method, crystallization method, recrystallization method, concentration method, and others. For example, in the case of production using transformed cells, indoles can be obtained by removing the bacterial cells by centrifugation or the like, removing ionic substances with a cation and anion exchange resin, and concentrating the mixture. The indoles accumulated in the culture may be used as they are without isolation.
[0056] The present invention also encompasses the following substances, manufacturing methods, uses, methods, etc. as exemplary embodiments, but the present invention is not limited to these embodiments. <1> A polypeptide having indole-2-carboxylic acid decarboxylation activity, wherein the amino acid residue at position 322 in the amino acid sequence shown in SEQ ID NO: 2 is the following amino acid, or the amino acid residue at the position corresponding to position 322 in the amino acid sequence shown in SEQ ID NO: 2 is the following amino acid in an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2; Alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, leucine, methionine, asparagine, proline, glutamine, serine, threonine, valine or tyrosine, preferably alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, leucine, methionine, asparagine, serine or threonine. <2> A method for producing a mutant polypeptide having indole-2-carboxylic acid decarboxylation activity, comprising substituting the amino acid residue at position 322 of the amino acid sequence shown in SEQ ID NO: 2 with the amino acid shown below, or substituting the amino acid residue at a position corresponding to position 322 of the amino acid sequence shown in SEQ ID NO: 2 with the amino acid shown below in an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2; Alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, leucine, methionine, asparagine, proline, glutamine, serine, threonine, valine or tyrosine, preferably alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, leucine, methionine, asparagine, serine or threonine. <3> A method for imparting decarboxylation activity to indole-2-carboxylic acid, comprising substituting the amino acid residue at position 322 of the amino acid sequence shown in SEQ ID NO: 2 with the amino acid shown below, or substituting the amino acid residue at the position corresponding to position 322 of the amino acid sequence shown in SEQ ID NO: 2 with the amino acid shown below in an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 2; Alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, leucine, methionine, asparagine, proline, glutamine, serine, threonine, valine or tyrosine, preferably alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, leucine, methionine, asparagine, serine or threonine. <4> <1> A polynucleotide encoding a polypeptide of the present invention. <5> <4> A vector or DNA fragment comprising the polynucleotide of <6> further comprising a polynucleotide sequence encoding a flavin mononucleotide prenyltransferase, <5> A vector or DNA fragment of <7> <5> or <6> A transformed cell containing the vector or DNA fragment. <8> The transformed cell or its host further comprises a gene encoding flavin mononucleotide prenyltransferase. <7> Transformed cells. <9> the cell is Escherichia coli, yeast or coryneform bacteria; <7> or <8> Transformed cells. <10> The following general formula (1):
[0057] [ka] [In the formula, R 1 and R 2 may be the same or different and represent a hydrogen atom, a hydroxy group, a halogen atom, an alkyl group having 1 to 3 carbon atoms, an alkoxy group having 1 to 3 carbon atoms, a carboxy group, or an amino group.
[0058] Indole-2-carboxylic acids represented by the following formula: <1> or <7> ~ <9> A method for producing a transformant comprising contacting a transformed cell represented by any one of the following general formula (2):
[0059] [ka] [In the formula, R 1 and R 2indicates the same as above.]
[0060] A method for producing an indole represented by the formula: <11> R in general formulas (1) and (2) 1 and R 2 are both hydrogen atoms, <10> How to do it. <12> recovering the indoles. <10> or <11> How to do it. [Example]
[0061] The present invention will be described in more detail below based on examples, but the present invention is not limited to these examples.
[0062] Test Example 1: Production of indole (1) Construction of a plasmid containing a gene encoding decarboxylase In the following examples, PCR was performed using KOD One PCR Master Mix (Toyobo). After treating the PCR product with DpnI (Takara Bio), the DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio). The DNA fragments were ligated using the In-Fusion HD Cloning Kit (Takara Bio). The ligated DNA fragments were transformed into ECOS Competent E. coli JM109 (Nippon Gene). The cell suspension was plated on LBAmp agar medium (Difco LB Broth Lennox 20 g / L, ampicillin sodium 50 μg / mL, agar 1.5%) and allowed to stand overnight at 37°C. The resulting colonies were inoculated into 750 μL of TBAmp liquid medium (Difco Terrific Broth 47.6 g / L, ampicillin sodium 50 μg / mL) and cultured overnight at 37°C. Plasmids were prepared from the resulting cells using NucleoSpin Plasmid EasyPure (Takara Bio), and the DNA sequences of the resulting plasmids were analyzed by the Sanger method (Eurofins Genomics).
[0063] (a) Construction of a plasmid containing the gene encoding the wild-type enzyme A DNA fragment was amplified by PCR using primers PaHudA-ins-F (SEQ ID NO: 7, GAAGGAGATATACATATGAATCGGAGCGCGTTGGA) and PaHudA-ins-R (SEQ ID NO: 8, TGAATCAAACCTCCTTTAGGCGTCGCCAAAACCAT) with artificially synthesized DNA of the gene (SEQ ID NO: 1) encoding Pseudomonas aeruginosa decarboxylase (PaHudA) as a template. Furthermore, a DNA fragment was amplified by PCR using primers BsUbiX-ins-F (SEQ ID NO: 11, AGGAGGTTTGATTCATGAAAGCCGAATTCAAACGC) and BsUbiX-ins-R (SEQ ID NO: 12, GTGGTGGTGGTGGTGTTACGCTCCACCTTTCTGTT) with artificially synthesized DNA of the gene (SEQ ID NO: 5) encoding Bacillus subtilis flavin mononucleotide prenyltransferase (BsUbiX) as a template. These PCR products were ligated to a DNA fragment amplified by PCR using the pET21 vector as a template and primers pET-vec-F (SEQ ID NO: 13, CACCACCACCACCACCACTGAGATC) and pET-vec-R (SEQ ID NO: 14, ATGTATATCTCCTTCTTAAAGTTAAACAAAATTAT) to obtain the plasmid pET21a-PaHudA-BsUbiX. Similarly, a DNA fragment was amplified by PCR using the artificially synthesized DNA of the gene encoding Aspergillus niger decarboxylase (AnFDC1) (SEQ ID NO: 3) as a template and primers AnFDC1-ins-F (SEQ ID NO: 9, GAAGGAGATATACATATGTCAGCACAACCAGCGCA) and AnFDC1-ins-R (SEQ ID NO: 10, TGAATCAAACCTCCTTTAATTCGAGAACCCCATTT). In addition, a DNA fragment was amplified by PCR using artificially synthesized DNA of the gene encoding BsUbiX as a template and primers BsUbiX-ins-F (sequence number 11, AGGAGGTTTGATTCATGAAAGCCGAATTCAAACGC) and BsUbiX-ins-R (sequence number 12, GTGGTGGTGGTGGTGTTACGCTCCACCTTTCTGTT).These PCR products were ligated to a DNA fragment amplified by PCR using the pET21 vector as a template and primers pET-vec-F (sequence number 13, CACCACCACCACCACCACTGAGATC) and pET-vec-R (sequence number 14, ATGTATATCTCCTTCTTAAAGTTAAACAAAATTAT) to obtain the plasmid pET21a-AnFDC1-BsUbiX.
[0064] (b) Construction of a plasmid containing a gene encoding a mutant enzyme Plasmid pET21a-PaHudA(W322A)-BsUbiX was constructed by PCR using the plasmid pET21a-PaHudA-BsUbiX as a template and complementary primers PaHudA-W322A-F (SEQ ID NO: 15, ACGATTGCAGGAACTATGATCTCAGCC) and PaHudA-W322A-R (SEQ ID NO: 16, AGTTCCTGCAATCGTGTGGTTCTCTTC). Similarly, plasmids containing genes encoding each mutant enzyme were obtained by PCR using the primers listed in Table 1 under "Primers" instead of primers PaHudA-W322A-F and PaHudA-W322A-R.
[0065] [Table 1]
[0066] (2) Indole production ECOS competent cells BL21(DE3) (Nippon Gene) were transformed with each of the plasmids obtained above. The resulting transformed cells were plated on LBAmp agar medium and incubated overnight at 37°C. The resulting colonies were used as test strains. Similarly, colonies obtained by transformation with the pET21a vector were used as control strains. Each of the resulting strains was inoculated into 750 μL of TBAmpIC medium (per L: 60 g Overnight Express TB medium (Merck)), 10 mL glycerol, 50 μg sodium ampicillin, and 0.5 g indole-2-carboxylic acid) and cultured at 30°C for 40 hours. After incubation, 50 μL of the supernatant was mixed with 250 μL of 0.1% aqueous phosphoric acid solution. The insoluble matter was removed using an AcroPrep 96 filter plate (0.2 μm, WWPTFE membrane, Nippon Pall) and the mixture was subjected to high-performance liquid chromatography (HPLC). The HPLC was performed using a Chromaster (Hitachi High-Tech Science) system. The analytical column used was an L-column ODS (4.6 mm ID x 150 mm, Chemicals Evaluation and Research Institute, Japan). Gradient elution was performed using 0.1 M potassium dihydrogen phosphate in 0.1% phosphoric acid as eluent A and 70% methanol as eluent B at a flow rate of 1.0 mL / min and a column temperature of 40°C. Indole-2-carboxylic acid and indole were detected using a UV detector (detection wavelength 280 nm) and quantified using a concentration calibration curve. The indole productivity of the test strains was calculated according to the following formula (Equation 1):
[0067] (Number 1) Indole-producing ability of test strain = Amount of indole in the culture supernatant of the test strain (mol) / Amount of indole-2-carboxylic acid in the culture supernatant of the control strain (mol)
[0068] (2) Results As shown in Table 2, strains expressing enzymes in which the W322 position of PaHudA was substituted with alanine (A), cysteine (C), aspartic acid (D), glutamic acid (E), phenylalanine (F), glycine (G), isoleucine (I), leucine (L), methionine (M), asparagine (N), proline (P), glutamine (Q), serine (S), threonine (T), valine (V), or tyrosine (Y) showed higher indole production abilities than strains expressing enzymes in which the I327 position of AnFDC1 was substituted with serine (S).
[0069] [Table 2]
Claims
1. A polypeptide having indole-2-carboxylic acid decarboxylation activity, wherein the amino acid residue at position 322 in the amino acid sequence shown in SEQ ID NO: 2 is the following amino acid, or wherein the amino acid residue at the position corresponding to position 322 in the amino acid sequence shown in SEQ ID NO: 2 is the following amino acid in an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2; Alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, leucine, methionine, asparagine, proline, glutamine, serine, threonine, valine, or tyrosine.
2. A method for producing a mutant polypeptide having indole-2-carboxylic acid decarboxylation activity, comprising substituting the amino acid residue at position 322 of the amino acid sequence shown in SEQ ID NO: 2 with the amino acid shown below, or substituting the amino acid residue at a position corresponding to position 322 of the amino acid sequence shown in SEQ ID NO: 2 with the amino acid shown below in an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2; Alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, leucine, methionine, asparagine, proline, glutamine, serine, threonine, valine, or tyrosine.
3. A method for imparting decarboxylation activity to indole-2-carboxylic acid, comprising substituting the amino acid residue at position 322 of the amino acid sequence shown in SEQ ID NO: 2 with the amino acid shown below, or substituting the amino acid residue at a position corresponding to position 322 of the amino acid sequence shown in SEQ ID NO: 2 with the amino acid shown below in an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2; Alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, leucine, methionine, asparagine, proline, glutamine, serine, threonine, valine, or tyrosine.
4. A polynucleotide encoding the polypeptide of claim 1.
5. A vector or DNA fragment comprising the polynucleotide of claim 4.
6. 6. The vector or DNA fragment of claim 5, further comprising a polynucleotide sequence encoding a flavin mononucleotide prenyltransferase.
7. A transformed cell containing the vector or DNA fragment according to claim 5.
8. The transformed cell or its host is a flavin mononucleotide prenyltransferase The transformed cell of claim 7, further comprising a gene encoding an enzyme.
9. 9. The transformed cell according to claim 7 or 8, wherein the cell is Escherichia coli, yeast or coryneform bacteria.
10. The following general formula (1): 【Chemical 1】 [In the formula, R 1 and R 2 may be the same or different and represent a hydrogen atom, a hydroxy group, a halogen atom, an alkyl group having 1 to 3 carbon atoms, an alkoxy group having 1 to 3 carbon atoms, a carboxy group, or an amino group. A method for producing an indole-2-carboxylic acid represented by the following general formula (2): 【Chemistry 2】 [In the formula, R 1 and R 2 indicates the same as above.] A method for producing an indole represented by the formula:
11. R in general formulas (1) and (2) 1 and R 2 The method of claim 10 , wherein both are hydrogen atoms.
12. 11. The method of claim 10, further comprising recovering the indoles.
Citation Information
Patent Citations
Preparation of an indole
JP1995010837A
Method for producing indole derivative
JP2002017387A