Genetic analysis method, genetic analysis device, and genetic analysis kit

Abstract

To provide a gene analysis method for quantifying a content ratio of a target gene sequence on the basis of fluorescent intensity in gene mutation detection by fragment analysis in capillary electrophoresis, in particular, for quantitatively determining a mutation ratio to a wild type which is required for cancer diagnosis, or a frequency of gene mutation, as well as a gene analysis apparatus and kits for gene analysis based on the gene analysis method.SOLUTION: The present invention provides a gene analysis method comprising: a step for performing a single-base extension reaction by using a single-base extension reaction primer for detecting a target base sequence, and a single-base extension reaction substrate having a fluorescent dye; a step for subjecting a reaction product of the single-base extension reaction to electrophoresis; and a step for measuring mobility of the electrophoresis and fluorescence intensity of the fluorescent dye to quantify a content ratio of a plurality of target base sequences on the basis of a magnitude of the fluorescence intensity, the gene analysis method being characterized in that a single-base extension reaction substrate having no fluorescent dye is mixed in the single-base extension reaction.SELECTED DRAWING: Figure 4

Description

[Technical Field]

[0001] The present invention relates to a genetic analysis method for quantitatively analyzing gene mutations using a single-base extension reaction, a genetic analysis device based on the method, and a genetic analysis kit. [Background technology]

[0002] The dideoxy method, developed by Sanger et al., is a method for determining DNA base sequences. The DNA to be analyzed is introduced into a vector, amplified, and denatured to create a single-stranded template DNA. A primer is then attached to this template DNA, allowing complementary strand synthesis to occur starting from the primer. In addition to four types of deoxynucleotide triphosphates, one specific dideoxynucleotide triphosphate (terminator) is added. Complementary strand synthesis terminates upon incorporation of this dideoxynucleotide triphosphate (ddNTP), yielding DNA fragments of various lengths terminating at specific bases. The above complementary strand synthesis reaction is carried out using dideoxynucleotide triphosphates corresponding to the four bases adenine (A), cytosine (C), guanine (G), and thymine (T), i.e., ddATP, ddCTP, ddGTP, and ddTTP, to obtain DNA fragments of various lengths with terminal bases A, C, G, and T, respectively. These DNA fragments are then separated by molecular weight, and the base species are read in order of molecular weight to determine the base sequence. Molecular weight separation is carried out by electrophoresis using polyacrylamide gel or capillary electrophoresis.

[0003] A DNA sequencer using capillary electrophoresis is a device that analyzes base sequences by electrophoresing DNA samples labeled with four fluorescent labels through a capillary. Capable of continuous automated analysis and capable of high-speed parallel analysis of multiple samples, it has significantly contributed to large-scale gene sequencing, such as the Human Genome Project, and remains the most robust method in widespread use today. The principle of determining the base sequence of a DNA sample involves electrophoretic separation of DNA strands and detection of fluorescently labeled ddNTPs at the separation sites. Bases are estimated from the resulting fluorescent signal intensity by majority vote at each peak coordinate position based on the signal intensity or the area of ​​the signal waveform. This allows accurate base sequence determination without considering differences in the fluorescence intensity of the four fluorescent labels corresponding to the terminal bases A, C, G, and T. Meanwhile, Patent Document 1 devised a method for determining A, C, G, and T by utilizing the differences in the fluorescence intensity characteristics of these four fluorescent labels.

[0004] In recent years, advances in cancer research have increased the importance of detecting tumor-derived gene mutations using genetic analysis techniques. In particular, medical diagnostic tests that detect tumor-derived gene mutations in blood are known as liquid biopsies, and they are expected to be useful for early cancer diagnosis, optimizing postoperative treatment options, and monitoring residual tumors. Next-generation sequencers (NGS) are now enabling large-scale, high-speed analysis to identify tumor-related gene mutations that could serve as biomarkers, making it easier to identify the gene mutations required for liquid biopsies. Therefore, in cancer diagnosis, for example, there is a growing trend to increase the versatility of this testing technique by measuring tumor-derived gene mutations identified based on comprehensive analysis using NGS using mutation detection technologies that offer advantages over NGS in terms of cost and detection sensitivity.

[0005] One example of a low-cost, highly sensitive technique for detecting genetic mutations is fragment analysis using capillary electrophoresis. As shown in Figure 1, selective primers with different molecular weights are designed to vary their electrophoretic mobility for each target gene sequence. A polymerase synthesis reaction is then performed to attach ddNTPs modified with four fluorescent dyes to the 3' end of the selective primer corresponding to the genetic mutation via a single-base extension reaction. Double-stranded DNA is converted into single strands by formamide treatment and heat denaturation, and genetic mutations are identified by fluorescent detection of the fluorescent dye at the 3' end. Using this method, for example, in Non-Patent Document 1, targeted tumor-derived gene sequences were selectively enriched using multiplex polymerase chain reaction (PCR), followed by the detection of 120 known genetic mutations in 13 cancer genes. However, because the upper limit of the migration length for separating selective primers by electrophoresis is approximately 120 bases, only a few types of primers can be simultaneously detected per run. Furthermore, the fluorescence intensity of each fluorescent dye used to identify genetic mutations varies. Regarding the number of simultaneous detections, the inventors have recently linked interstrand-crosslinked double-stranded DNA to selective primers, thereby stably extending the electrophoretic distance to 120 bp or more, thereby utilizing an electrophoretic region that could not be effectively utilized until now, and making it possible to increase the number of gene mutations that can be simultaneously detected. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Japanese Patent Application Publication No. 05-118991 [Non-patent literature]

[0007] [Non-Patent Document 1] Dias-Santagata, D. et al., EMBO Molecular Medicine Vol. 2, pp. 146-158 (2010) Summary of the Invention [Problem to be solved by the invention]

[0008] One example of a low-cost, highly sensitive cancer diagnostic technology using liquid biopsy is the detection of over 100 known gene mutations by fragment analysis using capillary electrophoresis. However, in the process of investigating the degree of expression of mutant forms compared to wild-type genes, which indicate normal conditions, the conventional gene mutation detection technology using single-base extension reaction described above has different signal intensities due to differences in fluorescence excitation efficiency between fluorescent dyes, making it impossible to quantitatively determine the wild-type:mutant ratio, which is important for detection sensitivity. [Means for solving the problem]

[0009] As a result of extensive research aimed at solving the above problems, we have found that by incorporating a fluorescent dye-free substrate into a single-base extension reaction using a primer for single-base extension reaction to detect a target gene sequence and a fluorescent dye-containing substrate for single-base extension reaction, the ratio of the target base sequence (e.g., wild-type and mutant) can be quantitatively determined from the magnitude of fluorescence intensity. The mixing ratio of the fluorescent dye-free substrate can be set depending on the excitation efficiency ratio, binding incorporation efficiency, etc. of the fluorescent dyes to be detected.

[0010] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: a step of performing a single base extension reaction using a single base extension reaction primer for detecting a target base sequence and a single base extension reaction substrate having a fluorescent dye; subjecting the reaction product of the single base extension reaction to electrophoresis; measuring the electrophoretic mobility and the fluorescence intensity of the fluorescent dye, and quantifying the content ratio of a plurality of target base sequences from the magnitude of the fluorescence intensity; A genetic analysis method comprising: a substrate for single-base extension reaction that does not have a fluorescent dye is mixed with the single-base extension reaction; The mixing ratio of the substrate not having the fluorescent dye to the substrate having the fluorescent dye is (a) when at least two types of fluorescent dyes are used, it is set according to the ratio of the excitation efficiencies of the fluorescent dyes to be detected, and / or (b) When at least two types of primers are used, the primers are set according to the efficiency of binding and incorporation of the substrate. The present invention relates to a method for gene analysis characterized by:

[0011] In another aspect, the present invention provides a method for producing a pharmaceutical composition comprising: a measurement unit that performs single-base extension reaction, electrophoresis, and measurement of fluorescence intensity; a data analysis unit including a measurement data storage unit that stores the measurement data obtained by the measurement unit and a data processing device; Control unit and A genetic analysis device comprising: The control unit analyzes the measurement data stored in the measurement data storage unit, and determines the amount of a substrate having a fluorescent dye and a fluorescent dye to be used in a single-base extension reaction. pigment The present invention relates to a genetic analysis device configured to determine a mixing ratio of a substrate having the above-mentioned structure with a substrate having no above-mentioned structure.

[0012] In yet another aspect, the present invention provides a method for producing a pharmaceutical composition comprising: a primer for single-base extension reaction for detecting a target base sequence; a substrate for a single base extension reaction having a fluorescent dye; and Substrates for single-base extension reactions without fluorescent dyes A genetic analysis kit comprising: The content ratio of the substrate not having the fluorescent dye to the substrate having the fluorescent dye is (a) when at least two types of fluorescent dyes are included, it is set according to the ratio of the excitation efficiencies of the fluorescent dyes to be detected, and / or (b) When at least two types of primers are used, the ratio is set according to the efficiency of binding and incorporation of the substrate into the primers used. The present invention relates to a gene analysis kit characterized by the above-mentioned. [Effects of the Invention]

[0013] According to the present invention, the content ratio of a target gene sequence can be quantitatively determined from the magnitude of fluorescence intensity, and the abundance ratio of a mutation relative to a wild type or the frequency of a gene mutation, which are particularly necessary for cancer diagnosis, can be quantified. Problems, configurations, and effects other than those described above will be made clear in the description of the following embodiments. [Brief explanation of the drawings]

[0014] [Figure 1] FIG. 1 is an explanatory diagram of a fragment analysis method using capillary electrophoresis. [Figure 2] FIG. 1 is an explanatory diagram showing that the relative fluorescence intensity differs when ddNTPs modified with different fluorescent dyes are used for each target tumor-derived gene sequence. [Figure 3] FIG. 1 is an explanatory diagram showing that the incorporation efficiency of fluorescent dye-modified ddNTPs varies depending on the target tumor-derived gene sequence. [Figure 4] FIG. 1 is an explanatory diagram showing an example of the solution of the present invention, which is devised so that when ddNTPs modified with different fluorescent dyes are used for each gene sequence derived from the target tumor, quantitativeness of the relative fluorescence intensity can be obtained by using ddNTPs that are not modified with fluorescent dyes. [Figure 5] The results show the template concentration and peak fluorescence intensity before and after using ddNTPs that are not modified with a fluorescent dye. [Figure 6] 1 is a flowchart showing an example of a processing procedure in a gene analysis device and a gene analysis kit for carrying out the present invention. [Figure 7] FIG. 2 is a block diagram showing an example of functions provided in the gene analysis device of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0015] Hereinafter, an example of an embodiment of the present invention will be described with reference to the drawings. As described above with reference to Figure 1, the present invention utilizes fragment analysis using capillary electrophoresis. Using the target gene sequence as a template, selective primers with different molecular weights are designed to vary their electrophoretic mobility for each sequence. A polymerase synthesis reaction is then performed to attach ddNTPs modified with four types of fluorescent dyes to the 3' end of the selective primer corresponding to the gene mutation via a single-base extension reaction. A typical fragment analysis process involves converting double-stranded DNA into single strands through formamide treatment and thermal denaturation, and identifying the gene mutation through fluorescent detection of the fluorescent dye at the 3' end. Using selective primers with different molecular weights, over 100 known gene mutations can be detected. In this process, not only can gene sequences of specific lengths be detected by primer design, but single-nucleotide polymorphisms, in which only a single base is mutated, can also be detected. Furthermore, insertions and deletions, which are types of gene mutations, can also be detected using the same principle. Therefore, the scope of application of the present invention is generally applicable to fragment analysis using fluorescent dye-modified ddNTPs.

[0016] Figure 2 is an explanatory diagram showing the difference in relative fluorescence intensity when ddNTPs modified with different fluorescent dyes are used for each target tumor-derived gene sequence. For the target tumor-derived gene sequence #1, designated 101, ddNTP 103 modified with fluorescent dye #1 is added to the 3'-end of gene sequence #1-selective primer 102 via a polymerase synthesis reaction in accordance with the principle of Figure 1. Similarly, for the target tumor-derived gene sequence #2, designated 201, ddNTP 203 modified with fluorescent dye #2 is added to the 3'-end of gene sequence #2-selective primer 202 via a single-base extension reaction. In this case, if the fluorescence excitation efficiency of fluorescent dye #2 is lower than that of fluorescent dye #1, the relative fluorescence intensity 204 derived from fluorescent dye #2 will be smaller than the relative fluorescence intensity 104 derived from fluorescent dye #1. Although the fluorescence excitation efficiency depends on the reagent environment during measurement (e.g., mixture, temperature, pH, etc.), the electrophoresis conditions of the measurement device (e.g., injection voltage, injection speed, electrophoresis voltage, temperature, etc.), and the excitation wavelength, if measurements are performed in advance taking into account the measurement conditions, it is possible to prepare data in advance on the extent to which the relative fluorescence intensity differs.

[0017] FIG. 3 is an explanatory diagram showing that the incorporation efficiency of fluorescent dye-modified ddNTPs differs for each target tumor-derived gene sequence (each primer). For the target tumor-derived gene sequence #1, designated 101, ddNTP 103 modified with fluorescent dye #1 is added to the 3'-end of gene sequence #1-selective primer 102 by a single-base extension reaction. Similarly, for the target tumor-derived gene sequence #3, designated 301, ddNTP 303 modified with fluorescent dye #1 is added to the 3'-end of gene sequence #3-selective primer 302 by a single-base extension reaction. When gene sequence #1 is in a state 401 where the incorporation efficiency of fluorescent-labeled ddNTPs is high and gene sequence #3 is in a state 402 where the incorporation efficiency of fluorescent-labeled ddNTPs is low, the relative fluorescence intensity 404 derived from fluorescent dye #1 in the state where the incorporation efficiency of fluorescent-labeled ddNTPs is low is smaller than the relative fluorescence intensity 403 derived from fluorescent dye #1 in the state where the incorporation efficiency of fluorescent-labeled ddNTPs is high for gene sequence #1. Regardless of whether the ddNTP is fluorescently labeled or not, the incorporation efficiency of the ddNTP depends on the combination with the selective primer and the reagent environment during measurement (e.g., mixture, temperature, pH, etc.). However, if measurements are performed in advance taking into account the measurement conditions, data on the degree of difference in the incorporation efficiency of the ddNTP can be prepared in advance.

[0018] Figure 4 is an explanatory diagram showing an example of the solution of the present invention, which is devised to achieve quantitative relative fluorescence intensity using unmodified ddNTPs when ddNTPs modified with different fluorescent dyes are used for each target tumor-derived gene sequence. For the target tumor-derived gene sequence #1, designated 101, ddNTP103 modified with fluorescent dye #1 is added to the 3'-end of gene sequence #1-selective primer 102 via a polymerase synthesis reaction in accordance with the principle of Figure 1. Similarly, for the target tumor-derived gene sequence #2, designated 201, ddNTP203 modified with fluorescent dye #2 is added to the 3'-end of gene sequence #2-selective primer 202 via a single-base extension reaction. In this case, for example, if the fluorescence excitation efficiency of fluorescent dye #2 is lower than that of fluorescent dye #1, adding ddNTP501 unmodified with fluorescent dye #1 to the reagent for the single-base extension reaction will result in a lower relative fluorescence intensity than when fluorescent dye #2 is not added. This allows the relative fluorescence intensity 502 derived from fluorescent dye #1, which indicates the abundance of gene sequence #1, to be corrected to the same value as the relative fluorescence intensity 503 derived from fluorescent dye #2, which indicates the abundance of gene sequence #2, when using ddNTPs not modified with fluorescent dye #1. In other words, quantitativeness can be ensured for the abundance ratio between gene sequence #1 and gene sequence #2. This makes it possible to clarify the extent to which mutants are expressed compared to the wild-type gene, which indicates a normal state. This can be adjusted not only when the fluorescence excitation efficiency differs but also when the ddNTP incorporation efficiency differs, allowing the wild-type:mutant ratio to be quantitatively determined.

[0019] Thus, in one aspect, the present invention provides a method of genetic analysis, the method comprising: a step of performing a single base extension reaction using a single base extension reaction primer for detecting a target base sequence and a single base extension reaction substrate having a fluorescent dye; subjecting the reaction product of the single base extension reaction to electrophoresis; measuring the electrophoretic mobility and the fluorescence intensity of the fluorescent dye, and quantifying the content ratio of a plurality of target base sequences from the magnitude of the fluorescence intensity; Including, a substrate for single-base extension reaction that does not have a fluorescent dye is mixed with the single-base extension reaction; The mixing ratio of the substrate not having the fluorescent dye to the substrate having the fluorescent dye is (a) when at least two types of fluorescent dyes are used, it is set according to the ratio of the excitation efficiencies of the fluorescent dyes to be detected, and / or (b) When at least two types of primers are used, the primers are set according to the efficiency of binding and incorporation of the substrate into the primers used.

[0020] The present invention is based on a method for gene analysis that combines single-base extension reaction and electrophoresis, and such a method for gene analysis is well known in the art, for example, as described in Non-Patent Document 1.

[0021] The single-base extension reaction is carried out using a single-base extension reaction primer for detecting a target base sequence in the presence of a substrate (dideoxynucleotide triphosphate) bound to a fluorescent dye. In the present invention, however, in order to correct the ratio of fluorescence intensities due to differences in the excitation efficiency of the fluorescent dye and / or the efficiency of incorporation of the substrate into the primer, the single-base extension reaction is carried out by also including a substrate to which no fluorescent dye is bound in the reaction.

[0022] The test sample used in this method is not particularly limited as long as it is a sample for which a target base sequence is to be detected, and includes deoxyribonucleic acid (DNA), such as genomic DNA, cDNA, and ribonucleic acid (RNA), such as messenger RNA (mRNA), and fragments thereof. In the present invention, it is preferable to use, for example, cell-free DNA (cfDNA, DNA free in the blood) or circulating tumor DNA (ctDNA) as the test sample. Nucleic acid preparation from the sample can be performed by methods known in the art. Nucleic acid preparation kits are commercially available from many manufacturers, allowing for convenient purification of the target nucleic acid.

[0023] Furthermore, a primer for single-base extension reaction is prepared. The primer for single-base extension reaction may be either DNA or RNA, and is determined depending on the type of test sample and target base sequence, and the type of polymerase used in the single-base extension reaction. Preferably, the primer is DNA, and the single-base extension reaction is carried out using DNA or mRNA as the test sample template.

[0024] Primers are designed to have a sequence that specifically binds to a target nucleotide sequence, i.e., a sequence complementary to the target nucleotide sequence. Primer design techniques are well known in the art, and primers usable in the present invention are designed to satisfy conditions that enable specific annealing, for example, to have a length and base composition (melting temperature) that enable specific annealing. For example, the length that functions as a primer is preferably 10 bases or more, more preferably 15 to 50 bases, and even more preferably 15 to 30 bases, for example, approximately 20 bases. Furthermore, during design, it is preferable to confirm the GC content and melting temperature (Tm) of the primer. Known primer design software can be used to confirm the Tm. The designed primers can be chemically synthesized using known oligonucleotide synthesis techniques, but are usually synthesized using a commercially available chemical synthesizer.

[0025] The primer may have an interstrand-crosslinked double-stranded DNA tag. The present inventors previously developed a fragment analysis method using capillary electrophoresis, enabling the number of simultaneously detectable gene mutations to be expanded to tens to hundreds of types. Specifically, by linking an interstrand-crosslinked double-stranded DNA tag to a primer and using it, the electrophoretic distance can be stably extended to 120 bp or more by changing the length of the double-stranded DNA tag, thereby enabling an increase in the number of simultaneously detectable gene mutations. The double-stranded DNA tag has a length that can be distinguished by mobility and has at least one interstrand crosslink. In the present invention, "interstrand crosslink" means that one strand of a double-stranded DNA is crosslinked to the other strand at at least one location. The method for intramolecularly crosslinking such two strands is not particularly limited as long as it is a method known in the art. Preferably, the interstrand crosslinking is performed by photocrosslinking. The double-stranded DNA tag having an interstrand crosslink determines the migration distance (mobility) in electrophoresis. In other words, by linking double-stranded DNA tags of different lengths to primers, the migration distance during electrophoresis can be changed. Capillary electrophoresis can detect nucleic acids with chain lengths up to approximately 600 bases. Therefore, excluding the chain length of the primer that binds to the target base sequence (10 to 30 bases), the length of the double-stranded DNA tag can range from 1 to approximately 590 bases. The base sequence of the double-stranded DNA tag is not particularly limited, as long as it is a nucleic acid that has an interstrand crosslink. Furthermore, double-stranded DNA tags can be chemically synthesized using known oligonucleotide synthesis techniques, but are usually synthesized using a commercially available chemical synthesizer.

[0026] In the method of the present invention, a single-base extension reaction is carried out using the primers described above in the presence of a substrate having the above-mentioned fluorescent dye and a substrate not having the above-mentioned fluorescent dye. Single-base extension reactions are known in the art and are typically performed using a polymerase. The polymerase used is selected based on the type of template (test sample) and the type of primer used. For example, a DNA-dependent or RNA-dependent DNA polymerase is used for a single-base extension reaction using a DNA primer with DNA or RNA as a template, respectively.

[0027] The single-base extension reaction is widely known in the art, and for example, Non-Patent Document 1 describes a method for efficiently extending one base by a cycle reaction.

[0028] When a target base sequence is present, the primer hybridizes to this target base sequence, and a nucleotide is incorporated as a substrate from the 3' end of the primer by a synthetic reaction of the polymerase. In this case, by using, for example, dideoxynucleotides (ddNTPs) as the nucleotides (substrates) to be incorporated, the synthetic reaction is completed with only one base extension.

[0029] In the present invention, substrates having a fluorescent dye and substrates not having a fluorescent dye are used as such substrates. The fluorescent dye is useful for easily detecting whether or not a substrate has been incorporated or for determining the type of incorporated base, and any fluorescent dye known in the art can be used. Examples of fluorescent dyes include, but are not limited to, fluorescein, fluorescein isothiocyanate (FITC), sulforhodamine (TR), tetramethylrhodamine (TRITC), carboxy-X-rhodamine (ROX), carboxytetramethylrhodamine (TAMRA), NED, 5-carboxyfluorescein (5-FAM), 6-carboxyfluorescein (6-FAM), 5'-hexachlorofluorescein CE-phosphoramidite (HEX), 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein (JOE), 5'-tetrachlorofluorescein CE-phosphoramidite (TET), rhodamine 110 (R110), rhodamine 6G (R6G), VIC (registered trademark), ATTO system, Alexa Fluor (registered trademark), Texas Instruments Incorporated (TIA), and the like. Examples of fluorescent dyes that do not cause a shift in electrophoretic size include dR110 (carboxy-dichloro rhodamine 110), dR6G (dihydro rhodamine 6G), dTAMRA (tetramethyl rhodamine), and dROX (carboxy-X-rhodamine). For example, when trying to determine the type of base, a combination of five fluorescent dyes that are excited and detected at different wavelengths can be used to distinguish between four types of bases and five types of reference bases (to detect and correct base length from a reference ladder DNA). There are no particular limitations on the type of fluorescent dye or the method of introduction, and various conventionally known methods can be used.

[0030] The mixing ratio of the substrate without fluorescent dye and the substrate with fluorescent dye is: (a) when at least two types of fluorescent dyes are used, it is set according to the ratio of the excitation efficiencies of the fluorescent dyes to be detected, and / or (b) When at least two types of primers are used, the primers are set according to the efficiency of binding and incorporation of the substrate into the primers used.

[0031] For example, as shown in Figure 2, when the fluorescent dye contains at least two types of fluorescent dyes (each with different fluorescence excitation efficiencies), the mixing ratio of the substrate with no fluorescent dye and the substrate with fluorescent dye is set according to the ratio of the excitation efficiencies of the fluorescent dyes to be detected. Specifically, for the same substrate as the substrate bound to the fluorescent dye with better fluorescence excitation efficiency, a substrate with no fluorescent dye bound to it is added and a single-base extension reaction is performed. pigment The mixing ratio of the substrate with the fluorescent dye may be based on previous measurement data, or the optimal mixing ratio may be determined by a preliminary experiment prior to actual gene analysis. Furthermore, for example, when four fluorescent dyes corresponding to four types of bases are used, it is possible to determine the mixing ratio of the substrate without the fluorescent dye and the substrate with the fluorescent dye for each of the four fluorescent dyes, and quantitatively analyze the genes that have incorporated each substrate by measuring the fluorescent signal intensities of the four fluorescent dyes.

[0032] For example, as shown in Figure 3, when the primers contain at least two types of primers (i.e., at least two types of primers for at least two types of target base sequences are included, with the efficiency of binding and incorporation of the substrate into the primers being different), the mixing ratio of the substrate without a fluorescent dye and the substrate with a fluorescent dye is set according to the efficiency of binding and incorporation of the substrate into the primer being used. Specifically, for the same substrate that binds to the primer with better efficiency of binding and incorporation of the substrate, a substrate without a fluorescent dye is added and a single-base extension reaction is carried out. pigment The mixing ratio of the substrate having the above formula (I) may be based on previous measurement data, or the optimal mixing ratio may be determined by a preliminary experiment prior to the actual genetic analysis.

[0033] Furthermore, when the primers include at least two types of primers and the fluorescent dyes include at least two types of fluorescent dyes, the mixing ratio of the substrate without the fluorescent dye and the substrate with the fluorescent dye is set according to the ratio of the excitation efficiencies of the fluorescent dyes to be detected and the binding and incorporation efficiency of the substrate to the primers used.

[0034] After the single-base extension reaction, the resulting reaction product is subjected to electrophoresis, preferably capillary electrophoresis (CE), for analysis. Electrophoresis, such as CE, is a technique for separating introduced components based on differences in mobility due to charge, size, shape, etc. Based on the mobility, the type of target base sequence (based on the type of primer) can be identified. Furthermore, based on the signal from the fluorescent dye, the presence or absence of the target base sequence or the type of specific base in the target base sequence (based on the type of substrate incorporated by the single-base extension reaction) can be determined.

[0035] In the present invention, as described above, a substrate containing a fluorescent dye and a substrate not containing a fluorescent dye are mixed and a single-base extension reaction is performed, whereby the content ratio of multiple target base sequences can be quantitatively determined from the magnitude of fluorescence intensity. Therefore, for example, the abundance ratio of mutant sequences relative to wild-type sequences, which is necessary for cancer diagnosis, or the frequency of genetic mutations can be quantified. In one embodiment, the multiple target base sequences to be analyzed include wild-type sequences and mutant sequences, and the target base sequences can be quantified when the content ratio of the mutant sequences relative to the wild-type sequences is in the range of 0.01% to 1%, for example, in the range of 0.01% to 0.1%. In this way, quantitative genetic analysis of the target base sequences can be performed.

[0036] The above-described gene analysis method according to the present invention can be carried out simply and quickly using a gene analysis device having the necessary configuration or a gene analysis kit including the necessary components.

[0037] Therefore, in another aspect, the present invention provides a genetic analysis device, the device comprising: a measurement unit that performs a single-base extension reaction, electrophoresis, and measurement of fluorescence intensity; a data analysis unit including a measurement data storage unit that stores the measurement data obtained by the measurement unit and a data processing device; Control unit and Equipped with The control unit analyzes the measurement data stored in the measurement data storage unit, and determines the amount of a substrate having a fluorescent dye and a fluorescent dye to be used in a single-base extension reaction. pigment The mixing ratio of the substrate with the substrate not having the above-mentioned characteristic is determined.

[0038] The control unit may further comprise a reference database for storing previous measurement data; In this case, the control unit compares the measurement data stored in the measurement data storage unit with previous measurement data stored in the reference database, and determines the substrate having a fluorescent dye and the fluorescent dye to be used in the single-base extension reaction. pigment The mixing ratio of the substrate with the substrate not having the above-mentioned characteristic is determined.

[0039] The genetic analysis device according to the present invention may further include an output display unit.

[0040] In yet another aspect, the present invention provides a kit for genetic analysis, the kit comprising: a primer for single-base extension reaction for detecting a target base sequence; a substrate for a single base extension reaction having a fluorescent dye; and Substrates for single-base extension reactions without fluorescent dyes Including, The content ratio of the substrate not having the fluorescent dye to the substrate having the fluorescent dye is (a) when at least two types of fluorescent dyes are included, it is set according to the ratio of the excitation efficiencies of the fluorescent dyes to be detected, and / or (b) When at least two types of primers are included, the ratio is set according to the efficiency of binding and incorporation of the substrate into the primers used.

[0041] In addition to the above components, the kit of the present invention may also include a buffer for constituting a reaction solution, enzymes (polymerase, reverse transcriptase, etc.), a standard sample for calibration, etc. By providing the primers and substrates used in the single-base extension reaction as a kit, genetic analysis can be performed more quickly and easily.

[0042] The present invention will be specifically described below by way of examples, but these examples are provided merely to illustrate the present invention and are not intended to limit or restrict the scope of the invention disclosed in this application.

[0043] <Example> The OncoSpan DNA Reference Standard (Horizon) was used as a standard sample containing cancer-related gene mutations, and the EGFR L858 gene, a type of cancer driver gene, was used as the target gene. The EGFR L858 mutation occurs at position 858 of leucine (L:C). U G) is arginine (R:C G The sequence is EGFR L858R, which is a single base substitution with L858Q (Q: glutamine, C). In order to verify the effectiveness of the present invention for four types of bases, a mutant type is used. A G), L858P (P: proline, C CG) were also evaluated. First, PCR for cloning was performed using the above-mentioned standard sample containing the EGFR L858 wild-type (EGFR L858WT) and mutant (L858R) genes as templates with primers L858 Forward (GCAGCATGTCAAGATCACAGATT: SEQ ID NO: 1) and L858 Reverse (CCTCCTTCTGCATGGTATTCTTTCT: SEQ ID NO: 2). The PCR product was transformed into Escherichia coli, cultured in LB medium, and amplified by colony-directed PCR. Sequence reactions were performed using the BigDye Terminator Sequencing Kit (Thermo Fisher Scientific). After purification, the sequence was confirmed using a SeqStudio genetic analyzer, and the plasmid was extracted. For cloning of mutants L858Q and L858P, site-directed mutagenesis PCR was performed using the wild-type plasmid with the PrimeSTAR Mutagenesis Basal Kit (Takara Bio Inc.) and the primers listed in the table below. [Table 1]

[0044] The extracted plasmid was used as a template (target tumor-derived gene sequence) and mixed with 0.2 μM of the EGFRL858 primer shown in the table below, 1 U of DNA polymerase, and four fluorescent dye-modified ddNTPs (R6G-ddATP, ROX-ddUTP, R110-ddGTP, TAMRA-ddCTP) (PerkinElmer). Single-base extension reactions were carried out in a thermal cycler under the following conditions: [96°C x 10 sec → 55°C x 5 sec → 60°C x 30 sec] x 25 cycles. The target template DNA concentrations were 0.1 fmol, 1 fmol, and 10 fmol. The concentrations of the fluorescent dye-modified substrates (ddNTPs) were initially all 0.1 μM. After incorporating the techniques of the present invention to improve quantitativeness (mixing ddNTPs that were not modified with fluorescent dyes), the concentration of ROX-ddUTP was adjusted to 4 μM, and 1 μM of ddATP that was not modified with the fluorescent dye R6G and 10 μM of ddGTP that was not modified with the fluorescent dye R110 were added. [Table 2]

[0045] After the single-base extension reaction, a dephosphorylation reaction (SAP) was performed to prevent interference from unreacted fluorescently labeled ddNTP substrates. 1 μL of SAP was added to 10 μL of the reaction product, and the mixture was incubated at 7°C for 1 hour, followed by incubation at 75°C for 15 minutes. This SAP-treated sample was mixed with a size marker and Hi-Di Formamide, and then heated at 95°C for 5 minutes. Fragment analysis was then performed using a CE sequencer DS3000 (Hitachi High-Tech).

[0046] Figure 5 shows the relationship between template concentration and peak fluorescence intensity before and after using unmodified ddNTPs. The abundance of the target tumor-derived gene sequence is shown as relative fluorescence intensity for a known template concentration. The use of unmodified ddNTPs provides a linear relationship between abundance and fluorescence intensity, allowing quantitative determination of the abundance of the target gene sequence. For example, when wild-type EGFR L858WT is present at 10 fmol and mutant EGFR L858Q is present at 0.1 fmol, the use of unmodified ddNTPs provides quantitative relative fluorescence intensity, revealing the presence of wild-type:mutant at a ratio of 100:1 (1% sensitivity).

[0047] In the above examples, four fluorescent dyes were used: rhodamine 6G (R6G), x-rhodamine (ROX), rhodamine 110 (R110), and tetramethylrhodamine (TAMRA). However, the fluorescent dyes referred to in the present invention are not limited to these; any fluorescent dye commonly used to label nucleic acid probes may be used. In addition to rhodamine derivatives, other fluorescent dyes may be used, such as fluorescein or its derivatives, such as fluorescein isothiocyanate (FITC), Alexa 488, Alexa 532, cy3, cy5, and Texas Red. The fluorescent dye can be selected based on the excitation wavelength of the laser light installed in the capillary electrophoresis device used.

[0048] FIG. 6 is a flowchart showing an example of the processing procedure in a genetic analysis device and a genetic analysis kit for carrying out the present invention. The present invention makes it possible to quantitatively determine the content ratio of a target base sequence (e.g., wild-type and mutant) from the magnitude of fluorescence intensity. In this case, the measurement range of the fluorescence intensity of the analysis device is finite. Therefore, preprocessing to bring the fluorescence intensity within the detectable range of the analysis device can be performed on the device itself or in the analysis kit.

[0049] First, in step S701, a standard sample subjected to a single-base extension reaction is prepared. Next, in step S702, fragment analysis is performed by electrophoresis using the standard sample. Since any measuring device capable of fragment analysis by electrophoresis is sufficient, not only capillary electrophoresis devices but also microchannels such as MEMS (Micro-Electro-Mechanical Systems) can be used. Next, in step S703, a fluorescent signal at a predetermined detection position (base length) is acquired, and in step S704, the fluorescence excitation efficiency of each fluorescent dye is calculated. If a data storage unit is installed as part of the main mechanism of the analytical device, the calculation of this fluorescence excitation efficiency may be automated. Next, in step S705, a correction value is calculated to make the fluorescence intensity (signal) from each fluorescent dye linear with the template concentration. At this time, a reference database is compared to confirm that previously acquired or expected fluorescent signal characteristics (e.g., maximum value, half-width, peak detection position, etc.) have been obtained. In step S706, it is checked whether the fluorescent signal correction using the correction value falls within the detectable range of the analytical device. After confirming that the target base sequence (e.g., wild-type and mutant) is within the detectable range and that its content ratio can be detected within a range of, for example, 0.01% to 1%, a message indicating that measurement is possible is displayed in step S707, and the actual sample can be measured. At this time, the concentration of unmodified ddNTP to be added to the actual sample can also be displayed. However, if step S706 determines that the concentration is not within the detectable range, step S708 instructs the user to add unmodified ddNTP to the standard sample, and the process returns to step S701 to check whether the linearity of the template concentration and fluorescence intensity is achieved within the specified range. Furthermore, if a data set is prepared in advance for the analytical instrument, it can be used as an analytical kit and the above series of steps can be incorporated into the system.

[0050] FIG. 7 is a block diagram showing an example of the functions of the genetic analysis device of the present invention. The main components of the genetic analysis device are a measurement unit 801, a data analysis unit 802, a control unit 803, and an output display unit 804. In the measurement unit 801, a sample elongated by one base is placed in the sample placement unit, and the fluorescent signal of the sample flowing through the electrophoresis unit is measured over time using a fluorescence measurement unit using capillary electrophoresis. The data analysis unit 802 includes a measurement data storage unit for storing the measurement data obtained by the measurement unit 801, and a program for executing this data processing can be implemented by software. As shown in the flowchart in FIG. 6, the data processing includes acquiring fluorescent signals at predetermined detection positions (base lengths), calculating the fluorescence excitation efficiency of each fluorescent dye, and calculating correction values ​​to make the fluorescence intensity from each fluorescent dye linear with the template concentration. Reference data for gene sequences previously stored in the data analysis unit 802 can also be used. Furthermore, the reference data can be updated by transmitting and receiving information to and from an external network. All functional control of the measurement unit 801, data analysis unit 802, etc. can be realized by software, with a processor interpreting and executing programs stored in the memory of the control unit 803. Furthermore, some or all of the components, functional units, processing units, processing means, etc. can also be realized by hardware, for example, by designing them as integrated circuits. Information such as programs, files, and databases for each function can be stored in memory, a recording device such as a hard disk or solid-state drive (SSD), or a recording medium such as an IC card, SD card, or DVD. After data processing, a calculation is performed to determine whether the correction of the fluorescent signal using the correction value falls within the detectable range of the analytical device, and the results are output by the output display unit 804. The block diagram shown here is an example of a genetic analysis device as a whole system. The genetic analysis method of the present invention can be applied to any device that has the functions of the measurement unit 801, data analysis unit 802, control unit 803, and output display unit 804.

[0051] The present invention is not limited to the above-described embodiments, but includes various modifications. For example, the above-described embodiments have been described in detail to clearly explain the present invention, and are not necessarily limited to those including all of the described configurations. Furthermore, it is possible to replace part of the configuration of one embodiment with the configuration of another embodiment, or to add the configuration of another embodiment to the configuration of one embodiment. Furthermore, it is possible to add, delete, or replace part of the configuration of each embodiment with other configurations. [Explanation of symbols]

[0052] 101:Targeted tumor-derived gene sequence #1 102: Gene sequence #1 selective primer 103: ddNTP modified with fluorescent dye #1 104: Relative fluorescence intensity derived from fluorescent dye #1 201:Targeted tumor-derived gene sequence #2 202: Gene sequence #2 selective primer 203: ddNTP modified with fluorescent dye #2 204: Relative fluorescence intensity derived from fluorescent dye #2 301:Targeted tumor-derived gene sequence #3 302: Gene sequence #3 selective primer 303: ddNTP modified with fluorescent dye #1 401: Gene sequence #1 with high incorporation efficiency of fluorescently labeled ddNTP 402: A state in which the incorporation efficiency of fluorescently labeled ddNTP is low in gene sequence #3 403: Relative fluorescence intensity derived from fluorescent dye #1 when the incorporation efficiency of fluorescently labeled ddNTP is high in gene sequence #1 404: Relative fluorescence intensity derived from fluorescent dye #1 when the incorporation efficiency of fluorescently labeled ddNTP is low in gene sequence #3 501: ddNTP not modified with fluorescent dye #1 502: Relative fluorescence intensity derived from fluorescent dye #1 indicating the abundance of gene sequence #1 when ddNTPs not modified with fluorescent dye #1 are used 503: Relative fluorescence intensity derived from fluorescent dye #2 indicating the abundance of gene sequence #2 601: Results showing the template concentration and peak fluorescence intensity before using ddNTPs not modified with fluorescent dye 602: Results showing the template concentration and peak fluorescence intensity after using ddNTPs that are not modified with fluorescent dyes. 801: Measurement section 802: Data Analysis Department 803: Control unit 804: Output display section [Sequence List Free Text]

[0053] SEQ ID NOs: 1 to 7: Artificial (synthetic oligonucleotides)

Claims

1. a step of performing a single base extension reaction using a single base extension reaction primer for detecting a target base sequence and a single base extension reaction substrate having a fluorescent dye; subjecting the reaction product of the single base extension reaction to electrophoresis; measuring the electrophoretic mobility and the fluorescence intensity of the fluorescent dye, and quantifying the content ratio of a plurality of target base sequences from the magnitude of the fluorescence intensity; A genetic analysis method comprising: a substrate for single-base extension reaction that does not have a fluorescent dye is mixed with the single-base extension reaction; The mixing ratio of the substrate not having the fluorescent dye to the substrate having the fluorescent dye is (a) when at least two kinds of fluorescent dyes are used, it is set according to the ratio of the excitation efficiencies of the fluorescent dyes to be detected, and / or (b) When at least two primers are used, the primers are set according to the efficiency of substrate incorporation into the primers used. A genetic analysis method characterized by:

2. the fluorescent dye comprises at least two fluorescent dyes; The method according to claim 1 , wherein the mixing ratio of the substrate not having the fluorescent dye and the substrate having the fluorescent dye is set according to the ratio of excitation efficiencies of the fluorescent dyes to be detected.

3. the primers include at least two primers, The method according to claim 1, wherein the mixing ratio of the substrate not having the fluorescent dye and the substrate having the fluorescent dye is set according to the efficiency of binding and incorporation of the substrate into the primer used.

4. the primers include at least two types of primers, and the fluorescent dyes include at least two types of fluorescent dyes; The method according to claim 1, wherein the mixing ratio of the substrate not having the fluorescent dye and the substrate having the fluorescent dye is set according to the ratio of the excitation efficiencies of the fluorescent dyes to be detected and the binding and incorporation efficiency of the substrate to the primer used.

5. the plurality of target base sequences include a wild-type sequence and a mutant-type sequence; The method of claim 1, wherein the content ratio of the mutant sequence to the wild-type sequence is quantified in the range of 0.01% to 1%.

6. The method of claim 1 , wherein the primer has an interstrand-bridged double-stranded DNA tag.

7. The method of claim 1, wherein the electrophoresis is capillary electrophoresis.

8. a measurement unit that performs single-base extension reaction, electrophoresis, and measurement of fluorescence intensity; a data analysis unit including a measurement data storage unit that stores the measurement data obtained by the measurement unit and a data processing device; Control unit and A genetic analysis device comprising: The control unit is configured to analyze the measurement data stored in the measurement data storage unit and determine a mixing ratio of a substrate having a fluorescent dye and a substrate not having a fluorescent dye to be used in a single-base extension reaction.

9. the control unit further comprises a reference database that stores previous measurement data; the control unit is configured to compare the measurement data stored in the measurement data storage unit with previous measurement data stored in the reference database, and determine a mixing ratio of a substrate having a fluorescent dye and a substrate not having a fluorescent dye to be used in a single-base extension reaction.

9. The apparatus of claim 8.

10. The apparatus of claim 8 further comprising an output display.

11. a primer for single-base extension reaction for detecting a target base sequence; a substrate for a single base extension reaction having a fluorescent dye; and Substrates for single-base extension reactions without fluorescent dyes A genetic analysis kit comprising: The content ratio of the substrate not having the fluorescent dye to the substrate having the fluorescent dye is (a) when at least two types of fluorescent dyes are included, it is set according to the ratio of the excitation efficiencies of the fluorescent dyes to be detected; and / or (b) When at least two types of primers are used, the primers are set according to the efficiency of substrate incorporation into the primers used. A genetic analysis kit comprising:

Images