Engineered oncolytic adenoviruses
The Ad5-3del-A20T-IL21 mutant addresses the limitations of existing adenovirus mutants by enhancing tumor selectivity and immune stimulation through targeted gene deletions and insertions, achieving improved cancer treatment efficacy.
Patent Information
- Application Number
- JP2022560928
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-04-07
- Filing Date
- 2021-04-07
- Publication Date
- 2025-10-22
- Estimated Expiration
- 2041-04-07
AI Technical Summary
Existing adenovirus mutants for cancer treatment, such as Onyx-015 and H101, demonstrate reduced efficacy due to essential gene functions contributing to toxicity and limited tumor targeting, and CAR-based virotherapy is not suitable for efficient tumor targeting.
A novel mutant Ad5-3del-A20T-IL21 is developed, incorporating deletions and modifications in the E1ACR2, E1B19K, and E3gp19K genes, along with the insertion of the A20FMDV2 peptide and IL21 gene, to enhance tumor selectivity and immune stimulation.
The Ad5-3del-A20T-IL21 mutant achieves high efficacy in cancer cell lines with improved tumor targeting and reduced toxicity, guiding further optimization for systemic administration.
Smart Images

Figure 0007758355000001 
Figure 0007758355000002 
Figure 0007758355000003
Abstract
Description
[Technical Field]
[0001] A modified Ad5 virus capable of expressing a cytokine is provided, and the modified Ad5 virus is capable of expressing A20. Also provided are vectors and cells containing the modified Ad5 virus. The modified viruses of the present application can be used in cancer treatment. [Background technology]
[0002] Adenoviruses are engineered as oncolytic viruses that specifically target tumors while minimizing toxicity to normal cells. Clinical trials using various adenovirus mutants have demonstrated safety in tens of thousands of patients. However, most adenovirus mutants evaluated in previous clinical trials were designed to target p53 activity, which is frequently dysfunctional in human tumors. The first clinical application of this type of adenovirus was dl1520 (Onyx-015; ΔE1B55K and ΔE3B). A similar adenovirus mutant, H101, has been approved for anticancer treatment in China (Shanghai Sunway Biotech Co., Ltd., China). Although these mutants demonstrated tumor selectivity, their efficacy was only demonstrated in combination with chemotherapy. Subsequently, essential functions of the deleted E1B55K and E3B genes (e.g., late viral RNA transport and host immune defense, respectively) were found to contribute to the reduced efficacy of these viruses.
[0003] The ability of adenoviruses to evade host immune surveillance is crucial for their persistence. Four immunoregulatory proteins encoded in the E3 region of human Ads have been previously reported. One of these, gp19K (also known as E3 / 19K), binds to the heavy chain of major histocompatibility complex (MHC) class I antigens and inhibits their transport to the cell surface. Therefore, E3gp19K is involved in evading the recognition and elimination of infected cells by cytotoxic T lymphocytes (CTLs), a part of the host immune system.
[0004] Human adenoviruses (HAdV / Ad), particularly species C type 5 (HAdV-C5 / Ad5), have been developed as therapeutic agents for virotherapy. The mechanisms of Ad5 cellular uptake and tropism have been clearly understood in vitro. Viral uptake occurs via binding of the Ad5 fiber protein to the coxsackievirus and adenovirus receptor (CAR). However, CAR is ubiquitous throughout human tissues, including erythrocytes and various tumor cells, and loss of CAR expression in tumors has been documented in numerous reports. Therefore, CAR-based virotherapy may not be suitable for efficient tumor targeting, and evaluation of alternative receptor tropism is necessary.
[0005] Here, we report the generation of a novel mutant, Ad5-3del-A20T-IL21, which incorporates the A20FMDV2 peptide, ablates CAR binding, and expresses IL21 for optimal replication selectivity, cancer targeting, and immune stimulation. Ad5-3del-A20T-IL21 retained all viral functions necessary for proliferation in various cancer cell lines and demonstrated high efficacy. These findings are expected to guide further optimization of oncolytic adenoviruses for systemic administration to improve therapeutic outcomes in cancer patients. DISCLOSURE OF THE INVENTION [Problem to be solved by the invention]
[0006] This application realizes the combination of three viral genes carrying the immune regulatory gene IL21, as well as the modification and deletion of the fiber region. [Means for solving the problem]
[0007] In a first embodiment of the present application, a linearized donor cassette is used to generate recombinant adenovirus, thereby avoiding the tedious selection of a cloning vector carrying the donor cassette.
[0008] A second embodiment of the present application involves filling the gaps left after removing the antibiotic resistance genes with a polylinker of nucleotides (in this case, using the restriction enzyme SwaI), thereby allowing for multi-gene modification.
[0009] A third embodiment of the present application involves using the techniques described in the first and second embodiments to generate a backbone adenovirus with deletions of three genes: E1ACR2, E1B19k, and E3gp19K.
[0010] A fourth embodiment of the present application involves the production of an armed recombinant adenovirus in which the human IL-21 gene is inserted into E3gp19K.
[0011] The fifth embodiment of the present application involves producing a recombinant adenovirus based on the virus produced by the fourth embodiment, which has a Y477A mutation, a TAYT deletion, and an RGD peptide A20FMDV2 inserted into the adenovirus fiber.
[0012] Furthermore, the fifth embodiment, A20FMDV2, is precisely 20 peptides.
[0013] In the sixth embodiment of the present application, the virus produced by the fifth embodiment does not have any extra peptides attached.
[0014] In a seventh embodiment of the present application, a virus produced by any embodiment of the present application is used to treat cancers that express αvβ6 integrin, including, but not limited to, pancreatic cancer, head and neck cancer, and ovarian cancer.
[0015] In an eighth embodiment of the present application, a virus produced by any of the embodiments of the present application is used to treat cancer by intravenous injection.
[0016] Furthermore, in any embodiment of the present invention, the virus is an adenovirus.
[0017] In a ninth embodiment of the present application, a PI3Kδ inhibitor is provided in combination with intravenous injection of the modified virus prepared in claim 5 to improve the antitumor efficacy of the modified virus.
[0018] A ninth embodiment of the present application provides for the use of a modified virus produced according to any of the embodiments of the present application in combination with a checkpoint inhibitor to improve the anti-tumor efficacy of the modified virus.
[0019] Features of the present embodiment:
[0020] 1. This product realizes the combination of three viral genes, including the immune regulatory gene IL21, and the modification and deletion of the fiber region.
[0021] 2. A mutant virus with deleted E1ACR2 gene selectively replicates in tumor cells, sparing normal cells.
[0022] The E1ACR2 region binds to and inactivates pRb, releasing E2F and inducing S phase of the cell cycle. However, the function of the E1ACR2 region is redundant in proliferating normal cells and tumor cells with disrupted cell cycle regulation (mainly alterations in pRb and p16).
[0023] 3. Deletion of the E1B19k gene.
[0024] The ΔE1B19K mutant demonstrated an increased in vivo therapeutic index and reduced hepatotoxicity while maintaining antitumor activity. The anti-apoptotic E1B19K protein promotes viral replication and spread by inhibiting Bax-Bak oligomerization and mitochondrial pore formation, similar to the intracellular Bcl-2 homolog. In contrast to the E1B55K protein, which primarily inhibits p53-dependent pathways, E1B19K inhibits death receptor- and intrinsically induced apoptosis through both p53-dependent and p53-independent mechanisms. Adenovirus mutants lacking both the E1B19K gene and the E1ACR2 region, while leaving the E3 region intact, demonstrated improved efficacy and selectivity both as single agents and in combination with standard chemotherapy.
[0025] 4. Deletion of E3gp19k.
[0026] Adenovirus E3-gp19K is a transmembrane glycoprotein localized in the endoplasmic reticulum (ER). It forms a complex with major histocompatibility complex (MHC) class I antigens, retains them in the ER, and inhibits cytolysis by cytotoxic T lymphocytes (CTLs). The ER luminal domain of gp19K, consisting of residues 1-107, is known to be sufficient for binding to class I antigens. The transmembrane domain and cytoplasmic ER retention domain are located at residues 108-127 and 128-142, respectively.
[0027] 5. Mutation Y477A and deletion of TAYT in the fibrous region.
[0028] The Ad5 mutant, characterized by a series of fibril mutations (Y477A and TAYT deletion) that appear to impair binding to factor IX (FIX) and C4b-binding protein (C4BP), exhibits significantly reduced liver transplantation and toxicity, as well as low-level cytokine induction after intravenous administration.
[0029] 6. A20
[0030] The αvβ6 integrin is highly expressed in many solid tumors but not in normal cells. We engineered an adenovirus mutant expressing the 20-amino acid peptide A20FMDV2 derived from foot-and-mouth disease virus (FMDV), which selectively binds to αvβ6 via the Arg-Gly-Asp (RGD) domain.
[0031] 7. The virus carries the interleukin 21 (IL-21) gene
[0032] Like interleukin-12, interleukin-21 also activates NK cells and killer T cells. IL-21 plays a role later than IL-12 in the immune activation process, and the two interleukins synergistically activate immune cells. Therapeutic genes are inserted into E3gp19k.
[0033] In one aspect, the present application provides a modified virus Ad5, wherein the modified virus Ad5 is capable of expressing a cytokine, and the modified virus Ad5 is capable of expressing A20.
[0034] In some embodiments, the cytokine is of human origin.
[0035] In some embodiments, the cytokine comprises an interleukin, a tumor necrosis factor, an interferon, a chemokine, a lymphokine, and / or a growth factor.
[0036] In some embodiments, the cytokines comprise IL12, IL2, IL15 and / or IL8.
[0037] In some embodiments, the cytokine comprises IL-21.
[0038] In some embodiments, the gene encoding the cytokine is integrated into the genome of the modified virus Ad5.
[0039] In some embodiments, A20 is derived from foot and mouth disease virus (FMDV).
[0040] In some embodiments, the gene encoding A20 has the nucleic acid sequence set forth in SEQ ID NO:4.
[0041] In some embodiments, the gene encoding A20 is integrated into the genome of the modified virus Ad5.
[0042] In some embodiments, the gene encoding A20 is integrated into the HI-loop of the modified virus Ad5.
[0043] In some embodiments, the integration uses methods of gene editing and / or genetic recombination.
[0044] In some embodiments, the modified virus Ad5 has at least one modification in the fiber region.
[0045] In some embodiments, the modification in the fiber region comprises the amino acid substitution Y477A.
[0046] In some embodiments, the modification in the fiber region comprises a deletion of amino acids TATY at residues 489-492.
[0047] In some embodiments, the expression and / or activity of the E1ACR2 gene is downregulated in the modified Ad5 virus compared to the wild-type Ad5 virus.
[0048] In some embodiments, the expression and / or activity of the E1B19K gene is downregulated in the modified Ad5 virus compared to the wild-type Ad5 virus.
[0049] In some embodiments, the expression and / or activity of the E3gp19K gene is downregulated in the modified Ad5 virus compared to the wild-type Ad5 virus.
[0050] In some embodiments, the expression and / or activity of the E1ACR2 gene, the E1B19K gene, and the E3gp19K gene are downregulated in the modified Ad5 virus compared to the wild-type Ad5 virus.
[0051] In some embodiments, downregulation uses methods of gene editing and / or genetic recombination.
[0052] In some embodiments, the gene editing uses antisense RNA, siRNA, shRNA and / or CRISPR / Cas systems.
[0053] In some embodiments, at least a portion of the gene encoding the E1ACR2 gene, at least a portion of the E1B19K gene, and at least a portion of the E3gp19K gene are deleted.
[0054] In some embodiments, the gene encoding the cytokine is integrated at the site of the E1ACR2 gene, the E1B19K gene, or the E3gp19K gene.
[0055] In some embodiments, the modified Ad5 virus is capable of expressing a gene and / or ligand that targets T cells, a gene and / or ligand that targets tumor cells, and a therapeutic gene.
[0056] In some embodiments, the therapeutic gene is selected from the group consisting of genes encoding immune co-stimulatory pathway activating molecules, genes encoding checkpoint inhibitors, genes encoding cytotoxic, tumor suppressor genes, and anti-angiogenic genes.
[0057] In some embodiments, the immune costimulatory pathway activating molecule is selected from the group consisting of CD40 ligand (CD40L), ICOS ligand, GITR ligand, 4-1BB ligand, OX40 ligand, TL1A, CD30 ligand, CD27, and Flt3 ligand or a variant thereof.
[0058] In some embodiments, the checkpoint inhibitor is selected from the group consisting of a PD-1 inhibitor, a PD-L1 inhibitor, and a CTLA-4 inhibitor.
[0059] In some embodiments, the tumor suppressor gene comprises the HIC1 gene.
[0060] In another aspect, the present application provides an isolated nucleic acid molecule encoding the modified virus Ad5 of the present application.
[0061] In another aspect, the present application provides a vector comprising the modified virus Ad5 of the present application and / or the isolated nucleic acid molecule of the present application.
[0062] In another aspect, the present application provides a cell comprising the modified virus Ad5 of the present application, the isolated nucleic acid molecule of the present application, and / or the vector of the present application.
[0063] In another aspect, the present application provides a pharmaceutical composition comprising the modified virus Ad 5 of the present application and a pharmaceutically acceptable adjuvant.
[0064] In another aspect, the present application provides a method for treating a disease and / or disorder, the method comprising administering to a subject in need thereof a modified Ad5 virus of the present application, an isolated nucleic acid molecule of the present application, a vector of the present application, a cell of the present application, and / or a pharmaceutical composition of the present application.
[0065] In some embodiments, the method comprises administering to a subject in need thereof the modified virus Ad5 of the present application in combination with at least one agent, wherein the agent is selected from the group consisting of an anti-cancer agent, an agonist, an antagonist, a chemotherapeutic agent, and a radiation agent.
[0066] In some embodiments, the disease comprises a tumor.
[0067] In some embodiments, the disease comprises a tumor expressing αvβ6 integrin.
[0068] In some embodiments, the disease comprises pancreatic cancer, head and neck cancer, and / or ovarian cancer. [Effects of the Invention]
[0069] Further aspects and advantages of the present application will become readily apparent to those skilled in the art from the following detailed description. Only exemplary embodiments of the present application are shown and described herein. As will be understood, the present application is capable of other and different embodiments, and its several details are capable of modification in various obvious respects, all without departing from the disclosure. Accordingly, the drawings and description should be regarded as illustrative in nature, and not restrictive. [Brief explanation of the drawings]
[0070] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are employed, and the accompanying drawings (also referred to herein as "FIG" and "FIG.").
[0071] [Figure 1] Figure 1 shows a schematic diagram of this product. [Figure 2]Figures 2A-C show shuttle cassettes for Ad5 modification. A: Shuttle cassette for deleting E3gp19k. The left arm targets the left side of the E3gp19k gene, and the right arm targets the right side of E3gp19k. Chloramphenicol and its promoter are located between the left and right arms. The shuttle cassette is cloned into the EcoRV site of the pUC57 vector. B: Shuttle cassette for deleting E3gp19k. The left arm targets the left side of the E3gp19k gene, and the right arm targets the right side of E3gp19k. Human IL-21 (hIL-21) uses the E3gp19k promoter, and chloramphenicol and its promoter are located between the left and right arms. The shuttle cassette is cloned into the EcoRV site of the pUC57 vector. C: Shuttle cassette for mutation Y477A, TAYT deletion, and A20 insertion. The shuttle cassette is cloned into the EcoRV site of the pUC57 vector. [Figure 3] Figure 3 shows a diagram of the deletion of E3gp19k. 1) E3gp19k was deleted by homologous recombination between the shuttle cassette in the vector and the backbone viral genome. The resulting recombinants were selected and cultured on LB plates under chloramphenicol. Colonies were picked, grown, and the plasmids were extracted and sequenced to confirm the deletion of E3gp19k. 2) Chloramphenicol was excised from the confirmed E3gp19k-deleted recombinant plasmids using SwaI. 3) Religation yielded the desired recombinant plasmid, which was then used to generate modified adenovirus. [Figure 4]Figure 4 shows a diagram of hIL-21 with E3gp19k replaced. 1) The E3gp19k gene was replaced with hIL-21 via homologous recombination by integrating the shuttle cassette in the vector with the backbone viral genome. The resulting recombinants were selected and cultured on LB plates under chloramphenicol. Colonies were picked, grown, and the plasmids were extracted and sequenced to confirm the deletion of E3gp19k. 2) The confirmed recombinant plasmid with hIL-21 inserted in place of E3gp19k was excised with SwaI and 3) religated to obtain the desired recombinant plasmid, which was then used to generate modified adenovirus. [Figure 5] Figure 5 shows the generation of the Y477A mutation, the TAYT deletion, and the A20 insertion in an adenovirus carrying three deleted genes. 1) The Y477A mutation, the TAYT deletion, and the A20 insertion were achieved by combining the shuttle cassette and the backbone viral genome within the vector via homologous recombination. The resulting recombinants were selected and grown on LB plates under chloramphenicol. Colonies were picked, expanded, and the plasmids were extracted and sequenced to confirm the Y477A mutation, the TAYT deletion, and the A20 insertion. 2) The confirmed recombinant plasmids were excised using SwaI and 3) religated to obtain the desired recombinant plasmids, which were then used to generate modified adenoviruses. [Figure 6]Figure 6 shows the generation of the Y477A mutation, TAYT deletion, and A20 insertion in the hIL-21-armed adenovirus. 1) The Y477A mutation, TAYT deletion, and A20 insertion were achieved by combining the shuttle cassette and backbone viral genome within the vector via homologous recombination. The resulting recombinants were selected and grown on LB plates under chloramphenicol. Colonies were picked, expanded, and the plasmids extracted and sequenced to confirm the Y477A mutation, TAYT deletion, and A20 insertion. 2) The confirmed recombinant plasmids were excised using SwaI and 3) religated to obtain the desired recombinant plasmids, which were then used to generate modified adenoviruses. [Figure 7] FIG. 7 shows the sequence of the cassette for deleting E3gp19k. [Figure 8] FIG. 8 shows the sequence of the cassette for replacing E3gp19k and inserting human IL-21 into the E3gp19k region. [Figure 9] FIG. 9 shows the sequence of the cassette for the Y477A mutation, the deletion of TAYT, and the insertion of RDG peptide A20 into the fiber region. [Figure 10] Figure 10 shows the sequencing results of the E3gp19k deletion in the control virus construct pAd-c. E3gp19k was deleted between ATGA (28372) and TTTACT (29212), as shown in the alignment in the top panel. After removing the chloroform using the SwAI restriction enzyme, the sequence CCCATCATTTGAAGCTTCAAATTACGGG was inserted between ATGA (28372) and TTTACT (29212), followed by filling in with a linker sequence. [Figure 11] The modifications of the control virus construct pAd-c are shown in Figure 11. Sequencing results indicated a Y477A mutation and a deletion of TAYT. [Figure 12]Figure 12 shows the modification of the control viral construct Ad-c in the fiber region by the insertion of the RGD sequence A20. The sequence of A20 is: AACGCAGTACCTAACTTGA GGAGATCTACAGTGTTGCACAGTCGACGTACT [Figure 13] FIG. 13 shows the sequencing results of chloroform removal using SwAI restriction enzyme on the control virus construct Ad-c. [Figure 14] Figure 14 shows that human IL-21 was inserted into the E3gp19K region of the viral construct pAd-IL21, where human IL-21 was inserted between ATGA and ATAAT in the adenoviral genome. [Figure 15] Figure 15 shows the sequencing results of chloroform removal using the SwAI restriction enzyme in the virus Ad-IL21. ATAAT is an extra sequence left in the viral genome. [Figure 16] Figure 16 shows the modifications of the viral construct pAd-IL 21. Sequencing results indicated a Y477A mutation and a deletion of TAYT. [Figure 17] FIG. 17 shows the modification of the viral construct pAd-IL21 in the fiber region by the insertion of the RGD sequence A20. [Figure 18] Figure 18 shows the sequencing results of chloroform excision using SwAI restriction enzyme on the viral construct pAd-IL21. ATTTAAAT is the extra sequence left in the viral genome. [Figure 19] The expression of human IL-21 by the modified adenovirus is shown in Figure 19. The cell culture medium was collected from 293T cells infected with the modified adenovirus, and the human IL-21 in the cell culture medium was measured by ELISA. [Figure 20] FIG. 20 shows that the modified virus Ad5 of the present application can specifically target and kill tumor cells. DETAILED DESCRIPTION OF THE INVENTION
[0072] While various embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions may occur to those skilled in the art without departing from the invention. It is understood that various alternatives to the embodiments of the invention described herein may be used.
[0073] The term "Ad 5" herein generally refers to a type of human adenovirus (HAdV / Ad), also known as human adenovirus species C type 5 or HAdV-C5. HAdV-C5 is a pathogen that can cause respiratory symptoms of varying severity, including acute, mild, and asymptomatic (Echavarria, 2009, Edwards et al., 1985, Fox et al., 1969, Garnett et al., 2009). Ad5 is commonly used in gene transfer experiments because it can infect a wide variety of cells and harbor large genes integrated into its genome via homologous recombination.
[0074] The term "cytokine" as used herein generally refers to a general class of biological molecules that can affect cells of the immune system. Cytokines can consist of biological molecules that act locally or that circulate in the blood and can regulate or modulate an individual's immune response to cancer. For example, cytokines include interferon-α (IFN-α), interferon-β (IFN-β), and interferon-γ (IFN-γ), interleukins (e.g., IL-1 through IL-29, particularly IL-2, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, and IL-18), tumor necrosis factors (e.g., TNF-α and TNF-β), erythropoietin (EPO), MIP3a, monocyte chemoattractant protein (MCP)-1, intercellular adhesion molecules (ICAMs), macrophage colony-stimulating factor (M-CSF), granulocyte colony-stimulating factor (G-CSF), and granulocyte-macrophage colony-stimulating factor (GM-CSF).
[0075] The term "IL-21" as used herein generally refers to a pleiotropic cytokine that acts on a wide range of lymphoid, myeloid, and epithelial cells. IL-21 is thought to play an important role in the differentiation of B cells into plasma cells, the development of T follicular helper cells, and promote functional germinal centers and immunoglobulin production. For example, IL-21 inhibits the proliferation and proliferation of CD8 + IL-21 induces T cell functional programs, potentially leading to enhanced survival, antiviral, and antitumor activity. IL-21 regulates both innate and adaptive immune responses and may play an important role in the development of autoimmune and inflammatory diseases as well as antitumor activity. The Gene ID for human IL-21 may be 59067.
[0076] The term "A20" herein generally refers to the A20FMDV2 peptide. A20 may be derived from foot-and-mouth disease virus. A20 may have the amino acid sequence set forth in SEQ ID NO: 5 (NAVPNLRGDLQVLAQKVART). A20 can exhibit high selectivity and affinity for tumor-associated αvβ6 integrin.
[0077] The term "fiber region" herein generally refers to the fiber structure of adenovirus (Ad). Ad may have a capsid consisting of three major exposed structural proteins: the hexon, fiber, and penton base. The primary role of the fiber region may be to tether the viral capsid to the cell surface through interaction with cellular receptors. The fiber region may have the following components: an N-terminal tail, a central axis consisting of repeats, and a C-terminal globular knob domain. The first approximately 45 residues of the fiber may be highly conserved among different serotypes. Variations in the fiber region can be seen in Table 2, "Impact of Adenovirus Fiber Structure and Function on Gene Therapy Vector Development."
[0078] The term "E1ACR2 gene" herein generally refers to the Ad5 gene. Various E1ACR2-deleted mutants have shown high efficacy in preclinical studies (Cancer Res. 2002 Oct. 15; 62(20):5736-42). E1ACR2, encoded by the E1ACR2 gene, may be involved in the binding and inactivation of pRb, thereby releasing E2F for S-phase induction. Furthermore, E1ACR2 may enhance in vivo safety while promoting cell death in response to cytotoxic drug-induced apoptosis.
[0079] The term "E1B19K gene" herein generally refers to an Ad5 gene. E1B19K, encoded by the E1B19K gene, is thought to promote viral replication and spread by inhibiting Bax-Bak oligomerization and mitochondrial pore formation, similar to intracellular Bcl-2 homologs. Furthermore, ΔE1B19K-mutants may have an increased therapeutic index and reduced hepatotoxicity in vivo (Clin Cancer Res. 2010 Jan 15;16(2):541-553).
[0080] The term "E3gp19K gene" herein generally refers to the Ad5 gene. E3gp19K, encoded by the E3gp19K gene, is a transmembrane glycoprotein that is thought to prevent cell lysis by cytotoxic T lymphocytes (CTLs). Deletion of the E3gp19K gene promotes tumor antigen presentation and stimulates immune responses targeting both infected and non-infected cancer cells, potentially benefiting tumor-mediated immune checkpoint inhibition (Oncolytic Virother. 2016; 5:45-57).
[0081] The term "gene editing" as used herein generally refers to a type of genetic engineering that inserts, deletes, alters, or replaces DNA in the genome of an organism. As used herein, gene editing may be performed using enzymes, such as nucleases engineered to target specific DNA sequences, which introduce cuts into the DNA strand, allowing for the removal of existing DNA and the insertion of replacement DNA. Gene editing may also be performed using a CRISPR / Cas system.
[0082] As used herein, the term "genetic recombination" generally refers to the exchange of genetic material between chromosomes and / or between different regions of the same chromosome. Genetic recombination is thought to occur through homology; that is, homologous regions of chromosomes are aligned in preparation for the exchange, and a degree of sequence identity is required.
[0083] The term "αvβ6 integrin" as used herein generally refers to an epithelial-specific integrin that is a receptor for the extracellular matrix (ECM) proteins fibronectin, vitronectin, tenascin, and the latency-associated peptide (LAP) of TGF-β. αvβ6 integrin may actually promote cancer progression. αvβ6 integrin may be highly upregulated in squamous cell carcinomas (SCCs) of the breast, lung, oral cavity, and skin, as well as carcinomas of the colon, stomach, and endometrium.
[0084] Embodiments of the present application provide an array comprising at least one of the following:
[0085] The sequence set forth in SEQ ID NO:1;
[0086] The sequence set forth in SEQ ID NO:2;
[0087] The sequence set forth in SEQ ID NO:3;
[0088] The sequence set forth in SEQ ID NO:4;
[0089] deletion of part or all of E1ACR2;
[0090] Deletion of part or all of E1B19k;
[0091] Deletion of part or all of E3gp19k;
[0092] IL-21;
[0093] mutant Ad5 fiber protein;
[0094] Ligand for αvβ6 integrin;
[0095] a therapeutic gene or a variant thereof; or
[0096] Ligands or antibodies that target T cells.
[0097] In one embodiment of the present application, a virus is provided, comprising at least one of the following:
[0098] The sequence set forth in SEQ ID NO:1;
[0099] The sequence set forth in SEQ ID NO:2;
[0100] The sequence set forth in SEQ ID NO:3;
[0101] The sequence set forth in SEQ ID NO:4;
[0102] deletion of part or all of E1ACR2;
[0103] Deletion of part or all of E1B19k;
[0104] Deletion of part or all of E3gp19k;
[0105] IL-21;
[0106] mutant Ad5 fiber protein;
[0107] Ligand for αvβ6 integrin;
[0108] a therapeutic gene or a variant thereof; or
[0109] Ligands or antibodies that target T cells.
[0110] Embodiments of the present application provide an array comprising at least one of the following:
[0111] Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by IL-21;
[0112] Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by a mutant Ad5 fiber protein;
[0113] Part or all of E1ACR2, E1B19k, or E3gp19k is displaced by a ligand for αvβ6 integrin;
[0114] Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by the sequence set forth in SEQ ID NO:4;
[0115] Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by a ligand or antibody that targets T cells;
[0116] Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by a tumor-targeting gene; or
[0117] Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by a therapeutic gene or a modified version thereof.
[0118] In one embodiment of the present application, a virus is provided, comprising at least one of the following:
[0119] Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by IL-21;
[0120] Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by a mutant Ad5 fiber protein;
[0121] Part or all of E1ACR2, E1B19k, or E3gp19k is displaced by a ligand for αvβ6 integrin;
[0122] Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by the sequence set forth in SEQ ID NO:4;
[0123] Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by a ligand or antibody that targets T cells;
[0124] Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by a tumor-targeting gene;
[0125] Alternatively, part or all of E1ACR2, E1B19k, or E3gp19k is replaced by a therapeutic gene or a modified version thereof.
[0126] In the above embodiment of the present application, the Ad5 fiber protein can include a mutation at Y477A and a deletion of TAYT. The ligand for αvβ6 integrin can be a peptide that selectively binds to αvβ6 via the Arg-Gly-Asp (RGD)-domain.
[0127] In the above embodiment of the present application, the virus may be an adenovirus, in particular adenovirus type 5.
[0128] In the above embodiments of the present application, the sequence may further comprise a therapeutic gene, including an immunomodulatory factor, an immune co-stimulatory pathway activating molecule, a checkpoint inhibitor, a cytotoxic gene, a tumor suppressor gene, an anti-angiogenic gene, etc.
[0129] The immune regulator gene may include a cytokine gene, for example: IL12, IL21, IL2, IL15, IL8 or a modified version of any of these.
[0130] The immune costimulatory pathway activating molecule may comprise a gene encoding CD40 ligand (CD40L), ICOS ligand, GITR ligand, 4-1BB ligand, OX40 ligand, TL1A, CD30 ligand, CD27, or Flt3 ligand, or a variant of any of these.
[0131] The checkpoint inhibitor may comprise a PD-1 inhibitor, a PD-L1 inhibitor, a CTLA-4 inhibitor, or a variant of any of these.
[0132] The tumor suppressor gene may include HIC1, etc., or a variant of any of these.
[0133] The genes used in this application are available from the NCBI genebank.
[0134] In one embodiment of the present application, there is provided an expression vector or host cell comprising any of the above sequences.
[0135] Treatment strategies
[0136] Embodiments of the present invention provide a virus for use in a method of treating the human or animal body, comprising at least one of:
[0137] Used alone as monotherapy; or
[0138] It is used in combination with one or more medicines.
[0139] The pharmaceutical agent of the present embodiment may be a known anticancer agent, inhibitor, agonist, antagonist, chemotherapeutic agent, or radioactive agent, particularly a PI3Kδ inhibitor or immune checkpoint inhibitor.
[0140] In one embodiment of the present application, there is provided a virus for use in the manufacture of a medicament for treating the human or animal body.
[0141] In one embodiment of the present application, a virus is provided for use in inducing cancer cell death, modulating the biological activity of cancer cells, modulating the immune response, enhancing T cell proliferation and / or cytotoxicity.
[0142] In one embodiment of the present application, a virus is provided for use in the manufacture of a medicament for inhibiting the growth of, inducing the death of, and / or modulating the biological activity of cancer cells.
[0143] The biological activity of cancer cells includes inhibiting cancer cell replication, inhibiting cancer cell division, inhibiting cancer cell DNA repair, inhibiting cancer cell migration, or promoting cancer death.
[0144] In an embodiment of the present application, a product is provided that includes a virus in a sterile vial, ampoule, or syringe.
[0145] In one embodiment of the present application, there is provided a pharmaceutical composition comprising a virus according to an embodiment of the present application.
[0146] In one embodiment of the present application, the pharmaceutical composition further comprises an anti-cancer agent and / or an antibody.
[0147] In one embodiment of the present application, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier, diluent, and / or excipient.
[0148] The pharmaceutical compositions of the present invention can be manufactured by processes well known in the art, for example, by conventional mixing, dissolving, granulating, dragee-making, filling, emulsifying, encapsulating, entrapping, or lyophilizing processes.
[0149] Thus, pharmaceutical compositions for use in accordance with the present invention can be formulated in a conventional manner using one or more physiologically acceptable carriers, including excipients and auxiliaries, which facilitate processing of the active ingredient into a pharmaceutically usable preparation. The appropriate formulation will depend on the chosen route of administration.
[0150] Suitable routes of administration include, for example, oral, rectal, transmucosal, particularly nasal, intestinal or parenteral delivery, and may include intramuscular, subcutaneous and intramedullary injection, as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, intraperitoneal, intranasal or intraocular injection.
[0151] In one embodiment of the present application, there is provided a method for treating a disease, comprising administering an effective amount of a sequence, expression vector, host cell, virus, pharmaceutical composition, or medicament.
[0152] Exemplary diseases include cancer, proliferative diseases, autoimmune diseases, and the like.
[0153] In one aspect, the present application provides a modified virus Ad5, wherein the modified virus Ad5 is capable of expressing a cytokine, and the modified virus Ad5 is capable of expressing A20.
[0154] In the present application, it has been found that the modified Ad5 virus of the present application may have an improved ability to regulate the immune response activity of immune cells (e.g., T cells, NK cells) compared to the Ad5 virus of the present application that is unable to express the cytokines of the present application.
[0155] In the present application, it has been found that the modified Ad5 virus of the present application may have improved tumor cell targeting and / or tumor cell killing capabilities compared to the Ad5 virus incapable of expressing the A20 of the present application. For example, compared to the Ad5 virus capable of expressing a protein that targets an integrin other than the A20 of the present application, the modified Ad5 virus of the present application may have improved tumor cell targeting and / or tumor cell killing capabilities. For example, compared to the Ad5 virus capable of expressing a protein that targets another target in the tumor microenvironment, the modified Ad5 virus of the present application may have improved tumor cell targeting and / or tumor cell killing capabilities. In the present application, the tumor may constitute a cancer.
[0156] For example, the cytokine may be of human origin.
[0157] For example, cytokines may consist of interleukins, tumor necrosis factors, interferons, chemokines, lymphokines and / or growth factors.
[0158] For example, the cytokines may consist of IL12, IL2, IL15 and / or IL8.
[0159] For example, the cytokine may consist of IL-21.
[0160] The present application has revealed that the modified Ad5 virus of the present invention, which expresses IL-21, may be significantly less toxic to subjects administered with the Ad5 virus, compared with Ad5 viruses capable of expressing cytokines other than IL-21. For example, toxicity may be measured in vivo in an animal model. For example, the body weight of animals administered in the animal model may be used to describe the degree of toxicity.
[0161] For example, a gene encoding a cytokine may be incorporated into the genome of the modified virus Ad5.
[0162] For example, A20 may be derived from foot and mouth disease virus (FMDV).
[0163] For example, the gene encoding A20 may have the nucleic acid sequence set forth in SEQ ID NO: 4. For example, A20 may have the amino acid sequence set forth in SEQ ID NO: 5.
[0164] For example, a gene encoding A20 may be incorporated into the genome of the modified virus Ad5. In the present application, the gene encoding A20 may be incorporated into any part of the genome of the modified virus Ad5, as long as the endogenous promoter of the modified virus Ad5 can be used to express A20. For example, the gene encoding A20 may be incorporated into a site where an original gene (e.g., the E1ACR2 gene, the E1B19K gene, or the E3gp19K gene) is deleted.
[0165] For example, a gene encoding A20 may be inserted into the HI-loop of the modified virus Ad5.
[0166] For example, the integration may use methods of gene editing and / or genetic recombination.
[0167] For example, the modified virus Ad5 may have at least one modification in the fiber region.
[0168] For example, a modification in the fiber region may include the amino acid substitution Y477A.
[0169] For example, the modification in the fiber region may consist of a deletion of amino acids TATY at residues 489-492.
[0170] In the present application, the modification in the fiber region may consist of the amino acid substitution Y477A and the deletion of amino acids TATY at residues 489 to 492. For example, TATY at amino acid residues 489 to 492 may refer to amino acid residues 489 to 492 from the N-terminus of the fiber region.
[0171] For example, the expression and / or activity of the E1ACR2 gene may be down-regulated in the modified Ad5 virus compared to the wild-type Ad5 virus.
[0172] For example, the expression and / or activity of the E1B19K gene may be down-regulated in the modified Ad5 virus compared to the wild-type Ad5 virus.
[0173] For example, the expression and / or activity of the E3gp19K gene may be down-regulated in the modified Ad5 virus compared to the wild-type Ad5 virus.
[0174] For example, the expression and / or activity of the E1ACR2 gene, E1B19K gene, and E3gp19K gene may be downregulated in the modified Ad5 virus compared to the wild-type Ad5 virus. For example, the expression levels of the E1ACR2 gene, E1B19K gene, and E3gp19K gene may be significantly or almost undetectably downregulated in the modified Ad5 virus. For example, the expression levels of E1ACR2, E1B19K, and E3gp19K may be significantly or almost undetectably downregulated in the modified Ad5 virus. For example, the activity and / or function of E1ACR2, E1B19K, and E3gp19K may be significantly or almost undetectably downregulated in the modified Ad5 virus.
[0175] For example, downregulation may use methods of gene editing and / or genetic recombination.
[0176] For example, gene editing may use antisense RNA, siRNA, shRNA and / or a CRISPR / Cas system. For example, gene editing may use a CRISPR / Cas9 system.
[0177] For example, at least a portion of the gene encoding the E1ACR2 gene, at least a portion of the E1B19K gene, and at least a portion of the E3gp19K gene may be deleted.
[0178] For example, a gene encoding a cytokine may be integrated into the site of the E1ACR2 gene, the E1B19K gene, or the E3gp19K gene.
[0179] For example, in the modified virus Ad5, the E1ACR2 gene, the E1B19K gene, and the E3gp19K gene may be deleted, and a gene encoding a cytokine and a gene encoding A20 may be inserted.
[0180] For example, in the modified virus Ad5, the E1ACR2 gene, the E1B19K gene, and the E3gp19K gene may be deleted, and a gene encoding IL-21 (eg, human IL-21) and a gene encoding A20 may be inserted.
[0181] For example, the E1ACR2 gene, E1B19K gene, and E3gp19K gene may be deleted from the modified Ad5 virus, and a gene encoding IL-21 (e.g., human IL-21) and a gene encoding A20 may be inserted. The modification in the fiber region may consist of the amino acid substitution Y477A and deletion of amino acid residues 489 to 492 of TAYT. For example, the modified Ad5 virus may be designated KMAd1.
[0182] For example, a gene encoding IL-21 may be integrated into the original site of the E3gp19K gene.
[0183] In the present application, the modified Ad5 virus may be capable of expressing a foreign gene and / or foreign protein, for example, a gene and / or ligand targeting T cells, a gene and / or ligand targeting tumor cells, and a therapeutic gene.
[0184] For example, the therapeutic gene may be selected from the group consisting of genes encoding immune co-stimulatory pathway activating molecules, genes encoding checkpoint inhibitors, genes encoding cytotoxic, tumor suppressor genes, and anti-angiogenic genes.
[0185] For example, the immune co-stimulatory pathway activating molecule may be selected from the group consisting of CD40 ligand (CD40L), ICOS ligand, GITR ligand, 4-1BB ligand, OX40 ligand, TL1A, CD30 ligand, CD27, and Flt3 ligand or a variant thereof.
[0186] For example, the checkpoint inhibitor may be selected from the group consisting of a PD-1 inhibitor, a PD-L1 inhibitor, and a CTLA-4 inhibitor.
[0187] For example, the tumor suppressor gene may include the HIC1 gene.
[0188] In another aspect, the present application provides an isolated nucleic acid molecule encoding the modified virus Ad5 of the present application.
[0189] Isolated nucleic acids or isolated nucleic acids may be synthesized using recombinant techniques well known in the art. For example, isolated nucleic acids can be synthesized using an automated DNA synthesizer. Standard recombinant DNA and molecular cloning techniques include: Sambrook, J., Fritsch, E. F., and Maniatis, T., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, (1989) (Maniatis) and by T. J. Silhavy, M. L. Bennen, and L. W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, pub. by Greene Publishing Assoc. and Wiley-Interscience (1987). Briefly, nucleic acids of interest can be prepared from genomic DNA fragments, cDNA, and RNA, all of which can be extracted directly from cells or recombinantly produced by various amplification processes, including, but not limited to, PCR and RT-PCR.
[0190] In another aspect, the present application provides a vector comprising the modified virus Ad5 of the present application and / or the isolated nucleic acid molecule of the present application.
[0191] Expression vectors may or may not be suitable for use in a particular type of host cell. For example, an expression vector can be introduced into a host organism to monitor the viability of the host organism and the expression of any genes / polynucleotides contained in the vector. An expression vector may contain one or more selectable marker genes that, upon expression, confer one or more phenotypic traits useful for selecting or otherwise identifying host cells carrying the expression vector.
[0192] In another aspect, the present application provides a cell comprising the modified virus Ad5 of the present application, the isolated nucleic acid molecule of the present application, and / or the vector of the present application.
[0193] The cell may be a eukaryotic or prokaryotic cell.
[0194] In another aspect, the present application provides a pharmaceutical composition, which may comprise the modified virus Ad5 of the present application and a pharmaceutically acceptable adjuvant.
[0195] In another aspect, the present application provides a kit comprising the modified virus Ad5 of the present application.
[0196] The pharmaceutical composition may be, for example, in a form suitable for administration. The pharmaceutical composition of the present application may contain a therapeutically effective amount of the modified virus Ad5 of the present application.
[0197] In the present application, pharmaceutical acceptance adjuvants may include anti-foaming agents, defoamers, buffers, polymers, antioxidants, preservatives, chelating agents, viscosity modifiers, tonics, flavors, colorants, odorants, opacifying agents, suspending agents, binders, fillers, plasticizers, lubricants, and / or mixtures thereof.
[0198] In another aspect, the present application provides a method for treating a disease and / or disorder, the method comprising administering to a subject in need thereof a modified Ad5 virus of the present application, an isolated nucleic acid molecule of the present application, a vector of the present application, a cell of the present application, and / or a pharmaceutical composition of the present application.
[0199] In another aspect, the present application provides the modified virus Ad5 of the present application, the isolated nucleic acid molecule of the present application, the vector of the present application, the cell of the present application, and / or the pharmaceutical composition of the present application for use in treating a disease and / or disorder.
[0200] In another aspect, the present application provides a modified virus Ad5 of the present application, an isolated nucleic acid molecule of the present application, a vector of the present application, a cell of the present application, and / or a pharmaceutical composition of the present application in the preparation of a medicament, wherein the medicament is for treating a disease and / or disorder.
[0201] For example, the method may include administering to a subject in need thereof the modified virus Ad5 of the present application in combination with at least one agent, which may be selected from the group consisting of an anti-cancer agent, an agonist, an antagonist, a chemotherapeutic agent, and a radioactive agent.
[0202] For example, the disease may involve a tumor.
[0203] For example, the disease may involve a tumor that expresses αvβ6 integrin.
[0204] For example, the disease may include pancreatic cancer, head and neck cancer, and / or ovarian cancer.
[0205] While preferred embodiments of the present disclosure have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions may occur to those skilled in the art without departing from the scope of the present disclosure. It is understood that various alternatives to the embodiments of the present disclosure described herein may be used in practicing the present disclosure. The following claims define the scope of the disclosure, and it is intended that methods and structures within the scope of these claims and their equivalents be covered thereby.
[0206] Example The following examples are provided to provide those of skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent all or the only experiments performed. Efforts have been made to ensure accuracy of numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should be accounted for. Unless otherwise specified, parts are parts by weight, molecular weights are weight average molecular weights, temperatures are in degrees Celsius, and pressures are at or near atmospheric. Standard abbreviations may be used, such as bp, base pairs; kb, kilobase; pl, picoliter; s or sec, seconds; min, minutes; h or hr, hours; aa, amino acid; nt, nucleotide; im, intramuscular; ip, intraperitoneal; sc, subcutaneous, etc.
[0207] Product design and construction
[0208] 1. Using pAd2D as a backbone, further modified Ad5 viruses are generated.
[0209] The pAd2D plasmid has two modifications: an E1ACR2 deletion and an E1 B19k deletion.
[0210] 2. Deletion of E3Bgp19k in pAd2D plasmid
[0211] The cassette is designed as follows (see Figures 3 and 4 for schematic diagrams):
[0212] Left arm - promoter - chloramphenicol - right arm
[0213] 2. Integration of human interleukin-21 (hIL-21) and chloramphenicol into the E3B gp19k region
[0214] The cassette is designed as follows (see Figures 3 and 4 for schematic diagrams):
[0215] Left arm - hIL-21 promoter - chloramphenicol - right arm
[0216] 3. Y477A mutation and TAYT deletion in the fibrous region
[0217] The cassette is designed as follows (see Figure 5 for a schematic diagram):
[0218] Fiber region-promoter with Y477A mutation and TAYT deletion-chloramphenicol
[0219] 4. The structure of the resulting final product is shown in Figure 1:
[0220] Materials and Methods:
[0221] Cell lines: All tumor cell lines used were obtained from ATCC or provided by collaborators. All human cancer cell lines were genotyped by STR assay. The murine tumor cell lines used in this study were as follows: colon cancer cell line MC38 was derived from C57B / 6 mice.
[0222] The plasmid pAd2D, which lacks the backbone viral genes E1ACR2 and E1B19k, was provided by a collaborator.
[0223] Construction of pS-E3gp19K shuttle vector:
[0224] The pS-E3gp19K shuttle vector contains an E3gp19K left arm targeting the left side of the E3gp19K gene and an E3gp19K right arm targeting the right side of the E3gp19K gene. The chloramphenicol gene with its promoter is located between the left and right arms of the E3gp19K gene. The above sequences were spliced and synthesized in-house and cloned into the ECoRV site of the PUC57 vector (see Figure 2A).
[0225] Construction of pS-E3IL21 shuttle vector:
[0226] The pS-E3IL21 shuttle vector contains an E3gp19K left arm targeting the left side of the E3gp19K gene and an E3gp19K right arm targeting the right side of the E3gp19K gene. The chloramphenicol gene with its promoter is located between the left and right arms of E3gp19K. The human IL-21 gene is located under the E3gp19K promoter. The above sequences were spliced and synthesized in-house and cloned into the ECoRV site of the PUC57 vector (see Figure 2B).
[0227] Construction of pS-A20 shuttle vector:
[0228] The pS-A20 shuttle vector contains a gene with a Y477A mutation, a deletion of TAYT, and an insertion of A20. The entire sequence described above was spliced and synthesized in-house and cloned into the ECoRV site of the PUC57 vector (see Figure 2C).
[0229] Homologous recombination:
[0230] Electrocompetent E. coli BJ5183 cells were used for homologous recombination. Recombinant shuttle cassette fragments were purified from each PUC57-based construct using ECoRV restriction enzyme and agarose gel. pAd2D and the linearized shuttle cassette fragment were electroporated into 20 μL of electrocompetent BJ5183 cells using a Bio-Rad Gene Pulser electroporator in a 2.0 mm cuvette at 2,500 V, 200 Ω, and 25 μL of current. The cells were immediately transferred to 500 μL of LB-Broth and incubated at 37°C for 20 minutes. Next, 125 μL of the cell suspension was inoculated into four 10 cm Petri dishes containing L-agar supplemented with 25 μg / ml chloramphenicol. After 16–20 hours of incubation at 37°C, 10–25 colonies were typically obtained per dish. Small colonies (usually representing recombinants) were picked and grown in 2 ml of l-Broth containing 25 μg / ml chloramphenicol. Plasmids were extracted using a miniprep kit.
[0231] Recombinant Plasmid Propagation
[0232] 10 μg of the plasmid extracted from BJ5183 cells was transformed into Top10 chemically competent cells containing 25 μg / ml of chloramphenicol, and after culturing for 18 hours, the plasmid was extracted from the cells.
[0233] Obtaining recombinant plasmids without adding chloramphenicol
[0234] After chloramphenicol release from the recombinant plasmid using SwaI restriction enzyme, the large recombinant fragment was purified, religated, transformed into Top10 competent cells, and grown in LB-broth for 18 hours before plasmid extraction.
[0235] Confirmation of genetic modification
[0236] The gene modifications in the recombinant plasmids were confirmed by DNA sequencing using the respective primers: E3 sequencing primer: 5'-GGGTTTGGGTTATTCTCT-3' (SEQ ID NO: 6), fiber region sequencing primer: 5'-GACAGCACAGGTGCCATTACA-3' (SEQ ID NO: 7).
[0237] Adenovirus packaging
[0238] The adenovirus genome was excised from the plasmid using PacI restriction enzyme and purified from an agarose gel. 2 μg of linearized adenovirus genome was transfected into 293T cells in a 6-well plate using Effectene transfection reagent according to the manufacturer's instructions. The transfected 293T cells were placed in a cell culture incubator for 10 days until adenovirus appeared.
[0239] Viral amplification:
[0240] Once the desired recombinant virus was confirmed, 50 μl of the viral lysate was added to a T175 flask containing 293T cells and grown in approximately 30 ml of cell culture medium until 80-90% confluence. After 48 hours, the cells and medium were scraped and the "primary viral amplification product" was saved.
[0241] Large-scale virus production:
[0242] The primary viral amplification product from above was flash frozen, thawed, and diluted to the volume required for cell culture to infect 36 T175 flasks containing 293T cells (80-90% confluence). After 48 hours, infected 293T cells were scraped and harvested by repeated centrifugation at 2,000 rpm (4°C). The pellet was washed with PBS, resuspended in 12 ml of 10 mM Tris-HCl (pH 9) buffer, and stored at -80°C for later purification.
[0243] Adenovirus purification:
[0244] Concentrated virus, thawed at 37°C as described above, is frozen and thawed twice between liquid nitrogen and a 37°C water bath. The virus suspension is centrifuged at 6,000 rpm at room temperature for 10 minutes. The supernatant is transferred from the centrifuge tube to a 50 ml tube and immediately placed on CsCl for differential staining. After balancing, the tube is centrifuged at 25,000 rpm at 15°C for 2 hours. The virus should form a band during the CsCl step. Typically, three bands are visible: the highest band represents cellular debris, the middle band represents empty adenovirus particles, and the lowest band represents successfully encapsulated infectious particles. Place the ultracentrifuge tube in a clamp (preferably a blue clamp, which makes the virus bands easier to see) and place it over a beaker containing Vicryl® tubes. Next, use a 19G needle attached to a 10 ml syringe to puncture the tube just below the lowest band (approximately 1 cm below), being careful to puncture only on one side. The virus band is then carefully removed with minimal CsCl and transferred to a labeled 15 ml tube. Once all bands are pooled, layer them on top of 2.5 ml of 1.35 g / ml CsCl solution in a 1 / 2 x 2-inch centrifuge tube (Beckman small tube). Depending on the total pooled volume, this can be divided equally into two or three ultracentrifuge tubes. These tubes are balanced as before before being centrifuged at 40,000 rpm, 15°C, for 15 hours (overnight) in an Optima LE-80K ultracentrifuge combined with a Beckman SW55ti swing-out rotor. The virus band (which should be located in the center of the tube) is collected as before and transferred to a labeled 15 ml tube. It is then diluted to 12 ml with TSG (approximately a 2-3 fold dilution). If only a small amount of virus is present, dilute to 9 ml. Use a new needle and syringe for each tube spun. The virus and TSG mixture is injected into a Slide-A-Lyzer (pink dialysis cassette) using the included 18G needle (green tip) and 20ml syringe. The virus is transferred from the 12ml tube to a small beaker (because the syringe is too large). To inject the virus, excess air must be removed from the Slide-A-Lyzer, so the syringe is inserted into one of the remaining three injection ports.Each injection port can only be used once and must be marked as used. After carefully injecting all of the collected virus, remove the syringe and discard it in an autoclavable waste container. The transparent membrane surrounding the virus is semi-permeable, allowing the dialysis buffer to pass through the membrane while the virus cannot. This procedure ensures that the virus is in the appropriate storage buffer. Next, place the Slide-A-Lyzer in an appropriately sized float and transfer it to a 51-ml beaker containing 21 ml of dialysate (see diagram below). Place the beaker on a magnetic stirrer in a cool, dark place and allow the virus to dialyze for 24 hours. Invert the Slide-A-Lyzer, float-side up, into the buffer, ensuring that the buffer is stirred occasionally. After dialysis, transfer the Slide-A-Lyzer to a tissue culture hood, remove the virus with a syringe, and transfer it to a labeled 15 ml tube (orange cap). The whole virus is dispensed into 1 ml aliquots and the tubes are labeled with the virus name, date (used as the batch number), volume, and initials. Aliquots are stored in a -80°C freezer. Aliquots are used for virus validation (characterization) and particle counts (for TCID50).
[0245] Adenovirus titration
[0246] 1x10 293T cells per well in a 96-well plate 4 The purified virus was serially diluted by a factor of 10 to 10-12. To begin the titration, 20 μL of the 10-6 diluted virus was added to each well of a 96-well plate, and all wells in a 12-well row were titrated. The 10-12 dilution was the lowest dilution used for the titration.
[0247] Enzyme-linked immunosorbent assay
[0248] hIL-21 expression was detected by enzyme-linked immunosorbent assay ELISA according to the reagent manufacturer's instructions.
[0249] Determination of viral replication:
[0250] Depending on the growth rate, 2–4 × 10 cells were cultured in three wells of a 6-well plate containing cell culture medium. 5 The cells were seeded at 1000 cells / well and infected with 1 PFU / cell of virus the following day. 24, 48, and 72 hours after infection, the infected cells and their culture medium were harvested. Virus concentrations were then measured.
[0251] In vitro viral cytotoxicity assessment:
[0252] Depending on the growth rate, cells were grown in a 96-well plate at 1 x 10 3 pcs and 1 x 10 4 Cells were seeded at 1000 cells / well and infected with virus 16–18 hours later. Cell viability was measured by MTS assay 6 days after virus infection, and EC50 values (50% tumor cell deaths due to virus administration) were calculated as described previously. All assays were performed at least three times.
[0253] In vivo efficacy experiments to compare different adenoviruses:
[0254] 1~5×10 6 Subcutaneous tumors were formed in the dorsal region of 10 mice per treatment group by subcutaneous injection of 1 × 10 cancer cells, with a diameter of 0.4–0.5 cm. The mice were then regrouped based on tumor size and injected with 1 × 10 cells on days 1, 2, 3, 4, and 5. 8 PFU (immunodeficient mice) or PBS was administered. The tumor area was 1.69 cm 2 The tumor volume (volume = (length × width 2 × π) / 6) was measured twice a week until the mice were sacrificed at the time of reaching 100 μg / mL. The mice used were 4-5 week-old male BALB / c and C57BL / 6 strains.
[0255] statistical analysis
[0256] Comparative statistical analysis was performed using Graphpad Prism 5 unless otherwise noted. Two-way comparisons were performed using unpaired t-tests. For additional variables of two or more conditions, one or two separate ANOVAs were performed. Survival data were presented as Kaplan-Meier plots using log-rank analysis to plot whether the differences between groups were statistically significant.
[0257] Construction of Ad5 mutants with three deletion regions
[0258] A mutant lacking the E3B gp19k gene was constructed using the vector pAd2D, which contains the Ad5 genome deleted for E1ACR2 and E1B19k. The cassette, consisting of the left arm targeting the left side of the E1B19k gene, chloramphenicol, and the right arm targeting the E3B gp19k gene, was released from the PUC57 cloning vector using the restriction enzyme EcoRV and purified from an agarose gel. pAd2D and the linearized shuttle fragment were electroporated into 20 μl of electrocompetent E. coli BJ5183 cells using a Bio-Rad Gene Pulser electroporator in a 2.0 mm cuvette at 2,500 V, 200 Ω, and 25 μL. The cells were immediately transferred to 500 μl of LB-Broth and incubated at 37°C for 20 minutes. Next, 125 μl of the cell suspension was inoculated into four 10 cm Petri dishes containing L-agar supplemented with 25 μg / ml chloramphenicol. After 16–20 hours of incubation at 37°C, 10–25 colonies were typically obtained per dish. Small colonies (usually representing recombinants) were picked and grown in 2 ml of L-Broth containing 25 μg / ml chloramphenicol. 10 μg of plasmid extracted using a miniprep kit was transformed into Top10 chemically competent cells containing 25 μg / ml chloramphenicol. After 18 hours of incubation, the plasmid was extracted from the cells. After releasing chloramphenicol from the construct using SwaI restriction enzyme, the large recombinant fragment was purified, religated, and transformed into Top10 competent cells. After 18 hours of incubation in LB-broth, the plasmid was extracted. The deletion of the E3Bgp19k gene in the recombinant was confirmed by DNA sequencing.
[0259] Constructing Ad5 mutants with three deleted regions and armed with human IL-21
[0260] The E3B gp19k gene was replaced with human IL-21 using the vector pAd2D, which contains the Ad5 genome deleted for E1ACR2 and E1B19k. The cassette, consisting of the left arm targeting the left side of the E1B19k gene, chloramphenicol, and the right arm targeting the E3B gp19k gene, was released from the PUC57 cloning vector using the restriction enzyme EcoRV and purified from an agarose gel. pAd2D and the linearized shuttle fragment were electroporated into 20 μl of electrocompetent E. coli BJ5183 cells using a Bio-Rad Gene Pulser electroporator in a 2.0 mm cuvette at 2,500 V, 200 Ω, and 25 μL. The cells were immediately transferred to 500 μl of LB-Broth and incubated at 37°C for 20 minutes. Next, 125 μl of the cell suspension was inoculated into four 10 cm Petri dishes containing L-agar supplemented with 25 μg / ml chloramphenicol. After 16–20 hours of incubation at 37°C, 10–25 colonies were typically obtained per dish. Small colonies (usually representing recombinants) were picked and grown in 2 ml of L-Broth containing 25 μg / ml chloramphenicol. 10 μg of plasmid extracted using a miniprep kit was transformed into Top10 chemically competent cells containing 25 μg / ml chloramphenicol. After 18 hours of incubation, the plasmid was extracted from the cells. After releasing chloramphenicol from the construct using SwaI restriction enzyme, the large recombinant fragment was purified, religated, and transformed into Top10 competent cells. After 18 hours of incubation in LB-broth, the plasmid was extracted. The substitution of human IL-21 for the E3Bgp19k gene in the recombinant was confirmed by DNA sequencing.
[0261] The constructed Ad5 mutant, which is deleted for three regions and armed with human IL-21, Y477A, del TAYT, and Ad 5-3 del-A20T, can also be designated as KMAd1.
[0262] KMAd1 was deposited at the CCTCC on March 25, 2020, and designated CCTCC No. V202024. KMAd1 was maintained in host cells expressing αvβ6 integrin (e.g., human pancreatic cancer cell Suit-2). The human pancreatic cancer cell Suit-2 was cultured in DMEM cell culture medium containing 10% fetal bovine serum.
[0263] A recombinant vector carrying Y477A and delTAYTA20 was constructed using pAd2D, a vector in which E1ACR2, E1B19k, and E3B gp19k were replaced with human IL-21 in the Ad5 genome. The cassette, consisting of the left arm targeting the left side of the fiber gene, the Y477A mutation, the TAYT deletion, the A20 peptide, chloramphenicol, and the right side of the E3B gp19k gene, was released from the PUC57 cloning vector using the restriction enzyme EcoRV and purified from an agarose gel. pAd2D and the linearized shuttle fragment were electroporated into 20 μl of electrocompetent E. coli BJ5183 cells, and electroporation was performed using a Bio-Rad Gene Pulser electroporator in a 2.0 mm cuvette at 2,500 V, 200 Ω, and 25 μL. The cells were immediately transferred to 500 μl of LB-Broth and incubated at 37°C for 20 minutes. Next, 125 μl of the cell suspension was inoculated into four 10 cm Petri dishes containing L-agar supplemented with 25 μg / ml chloramphenicol. After 16–20 hours of incubation at 37°C, 10–25 colonies were typically obtained per dish. Small colonies (usually representing recombinants) were picked and grown in 2 ml of L-Broth containing 25 μg / ml chloramphenicol. 10 μg of plasmid extracted using a miniprep kit was transformed into Top10 chemically competent cells containing 25 μg / ml chloramphenicol. After 18 hours of incubation, the plasmid was extracted from the cells. After releasing chloramphenicol from the construct using SwaI restriction enzyme, the large recombinant fragment was purified, religated, and transformed into Top10 competent cells. After 18 hours of incubation in LB-broth, the plasmid was extracted. The substitution of human IL-21 for the E3Bgp19k gene in the recombinant was confirmed by DNA sequencing.
[0264] Example Example 1. Confirmation of E3gp19k deletion by DNA sequencing in the control viral construct pAd-c
[0265] FIG. 10 shows the deletion of E3gp19k in the control virus construct pAd-c, which was confirmed by DNA sequencing.
[0266] Example 2. Modification of the control viral construct pAd-c
[0267] Figure 11 shows the sequencing results showing the Y477A mutation, TAYT deletion in the control viral construct pAd-c. Figure 13 shows the sequencing results of chloroform removal using SwAI restriction enzyme in the control viral construct Ad-c.
[0268] Example 3 A viral construct pAd3d-hIL21 was prepared in which the human IL-21 gene was inserted into the E3gp19k region of the adenovirus genome.
[0269] The human IL-21 gene replacing the E3gp19 k region of the adenoviral genome is shown in Figure 14. Removal of chloroform from the viral construct pAd-IL21 left an extra sequence ATTTAAAT (Figure 18).
[0270] Example 4. Modification of the viral construct pAd3d-hIL21.
[0271] Sequencing confirmed the Y477A mutation, the TYAT deletion, and the A20 insertion (Figs. 16 and 17).
[0272] Removal of chloroform from the viral construct pAd-IL21 left an extra sequence ATAAT (FIG. 15).
[0273] Example 5. Expression of hIL-21 in modified adenoviruses.
[0274] Expression of hIL-21 in cell culture media from Ad-hIL-21 and Ad-hIL-21-A20 viruses was measured by ELISA (FIG. 19).
[0275] Example 6. Infection of αvβ6 integrin-negative or -positive tumor cells with control and A20 viruses.
[0276] Example 7 The modified virus Ad5 of the present application can specifically target and kill tumor cells
[0277] Several types of tumor cells were transformed with the modified virus Ad5 KMAd1 of the present invention, and tumor cells not administered with the virus served as controls.
[0278] After culturing for 3 days, the cells were stained with crystal violet, and the results are shown in Figure 20. The results demonstrated that the modified Ad5 virus of the present application can specifically bind to and / or kill αvβ6 integrin-positive tumor cells.
[0279] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. The present invention is not intended to be limited by the specific examples provided herein. While the present invention has been described with reference to the above specification, the description and illustration of the embodiments herein are not intended to be construed in a limiting sense. Numerous variations, changes, and substitutions may occur to those skilled in the art without departing from the invention. Furthermore, it is to be understood that all aspects of the present invention are not limited to the specific depictions, configurations, or relative proportions set forth herein, which depend upon a variety of conditions and variables. It is to be understood that various alternatives to the embodiments of the present invention described herein may be used in practicing the present invention. Accordingly, it is contemplated that the present invention also covers such alternatives, modifications, variations, or equivalents. The following claims define the scope of the invention, and it is intended that methods and structures within the scope of these claims and their equivalents be covered thereby. This specification includes, for example, the subject matter described in the following sections: Section 1. The modified Ad5 virus is capable of expressing a cytokine, and the modified Ad5 virus is capable of expressing A20. Section 2. Item 2. The modified virus Ad5 according to Item 1, wherein the cytokine is of human origin. Section 3. Item 3. The modified virus Ad5 according to any one of Items 1 and 2, wherein the cytokines consist of interleukins, tumor necrosis factors, interferons, chemokines, lymphokines and / or growth factors. Section 4. Item 4. The modified virus Ad5 according to any one of Items 1 to 3, wherein the cytokines consist of IL12, IL2, IL15, and / or IL8. Section 5. Item 5. The modified virus Ad5 according to any one of Items 1 to 4, wherein the cytokine comprises IL-21. Section 6. Item 6. The modified virus Ad5 according to any one of Items 1 to 5, wherein a gene encoding a cytokine is integrated into the genome of the modified virus Ad5. Section 7. Item 7. The modified virus Ad5 according to any one of Items 1 to 6, wherein A20 is derived from foot-and-mouth disease virus (FMDV). Section 8. Item 8. The modified virus Ad5 according to any one of Items 1 to 7, wherein the gene encoding A20 has the nucleic acid sequence set forth in SEQ ID NO:4. Section 9. Item 9. The modified virus Ad5 according to any one of Items 1 to 8, wherein a gene encoding A20 is incorporated into the genome of the modified virus Ad5. Section 10. Item 10. The modified virus Ad5 according to any one of Items 1 to 9, wherein a gene encoding A20 is incorporated into the HI loop of the modified virus Ad5. Section 11. Item 11. The modified virus Ad5 according to any one of Items 9 to 10, wherein the integration is performed using gene editing and / or gene recombination methods. Section 12. Item 12. The modified virus Ad5 according to any one of Items 1 to 11, wherein the modified virus Ad5 has at least one modification in the fiber region. Section 13. 13. The modified virus Ad5 of paragraph 12, wherein the modification in the fiber region comprises the amino acid substitution Y477A. Section 14. 14. The modified virus Ad5 of any one of paragraphs 12 to 13, wherein the modification in the fiber region comprises a deletion of amino acids TAYT at residues 489-492. Section 15. Item 15. The modified virus Ad5 according to any one of Items 1 to 14, wherein the expression and / or activity of the E1ACR2 gene is downregulated in the modified virus Ad5 compared to the wild-type virus Ad5. Section 16. Item 16. The modified virus Ad5 according to any one of Items 1 to 15, wherein the expression and / or activity of the E1B19K gene is downregulated in the modified virus Ad5 compared to that of the wild-type virus Ad5. Section 17. Item 17. The modified virus Ad5 according to any one of Items 1 to 16, wherein the expression and / or activity of the E3gp19K gene is downregulated in the modified virus Ad5 compared to that in the wild-type virus Ad5. Section 18. Item 18. The modified virus Ad5 according to any one of Items 1 to 17, wherein the expression and / or activity of the E1ACR2 gene, the E1B19K gene, and the E3gp19K gene are downregulated in the modified virus Ad5 compared to the wild-type virus Ad5. Section 19. Item 19. The modified virus Ad5 according to any one of Items 15 to 18, wherein the downregulation is achieved by gene editing and / or gene recombination. Section 20. 20. The modified virus Ad5 according to paragraph 19, wherein the gene editing is performed using antisense RNA, siRNA, shRNA and / or a CRISPR / Cas system. Section 21. 21. The modified virus Ad5 according to any one of Items 17 to 20, wherein at least a portion of the gene encoding the E1ACR2 gene, at least a portion of the E1B19K gene, and / or at least a portion of the E3gp19K gene has been deleted. Section 22. 22. The modified virus Ad5 according to any one of Items 17 to 21, wherein a gene encoding a cytokine has been integrated into the site of the E1ACR2 gene, the E1B19K gene, or the E3gp19K gene. Section 23. Item 23. The modified Ad5 virus according to any one of Items 1 to 22, wherein the modified Ad5 virus is capable of expressing a gene and / or a ligand that targets T cells, a gene and / or a ligand that targets tumor cells, and / or a therapeutic gene. Section 24. 24. The modified virus Ad5 of paragraph 23, wherein the therapeutic gene is selected from the group consisting of a gene encoding an immune co-stimulatory pathway activating molecule, a gene encoding a checkpoint inhibitor, a gene encoding a cytotoxic or tumor-suppressing gene, and an anti-angiogenic gene. Section 25. 25. The modified virus Ad5 according to paragraph 24, wherein the immune costimulatory pathway activating molecule is selected from the group consisting of CD40 ligand (CD40L), ICOS ligand, GITR ligand, 4-1BB ligand, OX40 ligand, TL1A, CD30 ligand, CD27, and Flt3 ligand or a variant thereof. Section 26. Item 26. The modified virus Ad5 according to any one of Items 24 to 25, wherein the checkpoint inhibitor is selected from the group consisting of a PD-1 inhibitor, a PD-L1 inhibitor, and a CTLA-4 inhibitor. Section 27. Item 27. The modified virus Ad5 according to any one of Items 24 to 26, wherein the tumor suppressor gene comprises the HIC1 gene. Section 28. Item 28. An isolated nucleic acid molecule encoding the modified virus Ad5 according to any one of Items 1 to 27. Section 29. A vector comprising the modified virus Ad5 according to any one of Items 1 to 27 and / or the isolated nucleic acid molecule according to Item 28. Section 30. A cell comprising the modified virus Ad5 of any one of Items 1 to 27, the isolated nucleic acid molecule of Items 28, and / or the vector of Items 29. A pharmaceutical composition comprising the modified virus Ad5 according to any one of Items 1 to 27 and a pharmaceutically acceptable adjuvant. Section 32. A method for treating a disease and / or disorder, comprising administering to a subject in need thereof the modified virus Ad5 described in any one of Items 1 to 27, the isolated nucleic acid molecule described in Item 28, the vector described in Item 29, the cell described in Item 30, and / or the pharmaceutical composition described in Item 31. Section 33. A method according to item 32, comprising administering to a subject in need thereof the modified virus Ad5 according to any one of items 1 to 27 in combination with at least one drug, wherein the drug is selected from the group consisting of an anticancer drug, an agonist, an antagonist, a chemotherapeutic agent, and a radioactive agent. Section 34. Item 34. The method according to any one of Items 32 to 33, wherein the disease comprises a tumor. Section 35. Item 35. The method according to any one of Items 32 to 34, wherein the disease comprises a tumor that expresses αvβ6 integrin. Section 36. Item 36. The method according to any one of Items 32 to 35, wherein the disease comprises pancreatic cancer, head and neck cancer, and / or ovarian cancer. Section 37. An array containing at least one of the following: The sequence set forth in SEQ ID NO:1; The sequence set forth in SEQ ID NO:2; The sequence set forth in SEQ ID NO:3; The sequence set forth in SEQ ID NO:4; deletion of part or all of E1ACR2; Deletion of part or all of E1B19k; Deletion of part or all of E3gp19k; IL-21; mutant Ad5 fiber protein; Ligand for αvβ6 integrin; a therapeutic gene or a variant thereof; or Ligands or antibodies that target T cells. Section 38. A virus containing at least one of the following: The sequence set forth in SEQ ID NO:1; The sequence set forth in SEQ ID NO:2; The sequence set forth in SEQ ID NO:3; The sequence set forth in SEQ ID NO:4; deletion of part or all of E1ACR2; Deletion of part or all of E1B19k; Deletion of part or all of E3gp19k; IL-21; mutant Ad5 fiber protein; Ligand for αvβ6 integrin; a therapeutic gene or a variant thereof; or Ligands or antibodies that target T cells. Section 39. An array containing at least one of the following: Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by IL-21; Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by a mutant Ad5 fiber protein; Part or all of E1ACR2, E1B19k, or E3gp19k is displaced by a ligand for αvβ6 integrin; Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by the sequence set forth in SEQ ID NO:4; Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by a ligand or antibody that targets T cells; Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by a tumor-targeting gene; or Alternatively, part or all of E1A CR2, E1B19k, or E3gp19k is replaced by a therapeutic gene or modification thereof. Section 40. A virus containing at least one of the following: Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by IL-21; Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by a mutant Ad5 fiber protein; Part or all of E1ACR2, E1B19k, or E3gp19k is displaced by a ligand for αvβ6 integrin; Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by the sequence set forth in SEQ ID NO:4; Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by a ligand or antibody that targets T cells; Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by a tumor-targeting gene; or Part or all of E1ACR2, E1B19k, or E3gp19k is replaced by a therapeutic gene or a modified version thereof.
Claims
1. A modified virus Ad5, the expression and / or activity of the E1ACR2 gene, the E1B19K gene, and / or the E3gp19K gene is down-regulated compared to wild-type virus Ad5; at least one modification in the fiber region, the modification in the fiber region comprising the amino acid substitution Y477A and the deletion of amino acids TAYT at residues 489-492; A modified virus Ad5 capable of expressing IL-21 and A20, wherein the A20 is derived from foot-and-mouth disease virus (FMDV).
2. The modified virus Ad5 described in claim 1, wherein IL-21 is of human origin.
3. The modified virus Ad5 described in claim 1, wherein a gene encoding IL-21 is incorporated into the genome of the modified virus Ad5.
4. The modified virus Ad5 of claim 1, wherein the gene encoding A20 has the nucleic acid sequence set forth in SEQ ID NO:
4.
5. The modified virus Ad5 of claim 1, wherein a gene encoding A20 is integrated into the genome of the modified virus Ad5.
6. The modified virus Ad5 of claim 1, wherein a gene encoding A20 is incorporated into the HI-loop of the modified virus Ad5.
7. A modified virus Ad5 described in any one of claims 5 to 6, wherein the gene encoding A20 is incorporated using gene editing and / or genetic recombination methods.
8. The modified virus Ad5 according to claim 1, wherein the expression and / or activity of the E1ACR2 gene, the E1B19K gene and the E3gp19K gene are downregulated in the modified virus Ad5 compared to the wild-type virus Ad5.
9. The modified virus Ad5 of claim 1, wherein the downregulation is achieved using gene editing and / or gene recombination methods.
10. The modified virus Ad5 of claim 9, wherein the gene editing uses antisense RNA, siRNA, shRNA and / or a CRISPR / Cas system.
11. The modified virus Ad5 according to claim 1, wherein at least a portion of the gene encoding the E1ACR2 gene, at least a portion of the E1B19K gene and / or at least a portion of the E3gp19K gene have been deleted.
12. The modified virus Ad5 described in claim 1, wherein a gene encoding IL-21 is integrated into the site of the E1ACR2 gene, the E1B19K gene, or the E3gp19K gene.
13. The modified Ad5 virus of claim 1, wherein the modified Ad5 virus is capable of expressing a gene and / or ligand that targets T cells, a gene and / or ligand that targets tumor cells, and / or a therapeutic gene.
14. The modified virus Ad5 of claim 13, wherein the therapeutic gene is selected from the group consisting of a gene encoding an immune co-stimulatory pathway activating molecule, a gene encoding a checkpoint inhibitor, a gene encoding a cytotoxic gene, a gene encoding a tumor suppressor gene, and an anti-angiogenic gene.
15. The modified virus Ad5 of claim 14, wherein the immune costimulatory pathway activating molecule is selected from the group consisting of CD40 ligand (CD40L), ICOS ligand, GITR ligand, 4-1BB ligand, OX40 ligand, TL1A, CD30 ligand, CD27, and Flt3 ligand or a variant thereof.
16. The modified virus Ad5 of claim 14, wherein the checkpoint inhibitor is selected from the group consisting of a PD-1 inhibitor, a PD-L1 inhibitor, and a CTLA-4 inhibitor.
17. The modified virus Ad5 of claim 14, wherein the tumor suppressor gene comprises the HIC1 gene.
18. An isolated nucleic acid molecule encoding the modified virus Ad5 of claim 1.
19. A vector comprising the modified virus Ad5 of claim 1 and / or the isolated nucleic acid molecule of claim 18.
20. A cell comprising the modified virus Ad5 of claim 1, the isolated nucleic acid molecule of claim 18, and / or the vector of claim 19.
21. A composition comprising the modified virus Ad5 of claim 1 and a pharmaceutically acceptable adjuvant.
22. A pharmaceutical composition for treating a disease and / or disorder comprising the modified virus Ad5 of claim 1, the isolated nucleic acid molecule of claim 18, the vector of claim 19, the cell of claim 20, and / or the composition of claim 21.
23. The pharmaceutical composition of claim 22, wherein the modified virus Ad5 of claim 1 is administered to a subject in need thereof in combination with at least one drug, the drug being selected from the group consisting of anticancer drugs, agonists, antagonists, chemotherapeutic drugs and radioactive drugs.
24. 23. The pharmaceutical composition of claim 22, wherein the disease comprises a tumor.
25. 23. The pharmaceutical composition of claim 22, wherein the disease comprises a tumor that expresses αvβ6 integrin.
26. 23. The pharmaceutical composition of claim 22, wherein the disease comprises pancreatic cancer, head and neck cancer, and / or ovarian cancer.
Citation Information
Patent Citations
Oncolytic adenoviruses and their applications in targeted therapy for human tumors.
JP2014509197A
Enhanced adoptive cell therapy
JP2016522805A
Modified adenoviruses
WO2019158914A1