Method for screening anticancer drugs and combination drugs of kinase inhibitors for the treatment of pancreatic cancer
Drosophila models replicating pancreatic cancer mutations help identify effective kinase inhibitor combinations for treating pancreatic cancer, addressing the drug resistance and model limitations in current therapies.
Patent Information
- Application Number
- JP2022503384
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-02-27
- Filing Date
- 2021-03-01
- Publication Date
- 2025-10-29
- Estimated Expiration
- 2041-03-01
AI Technical Summary
Pancreatic cancer is difficult to treat due to high drug resistance and lack of effective therapies, with existing animal models failing to replicate the four key gene mutations associated with the disease, hindering research progress.
Development of Drosophila models mimicking the four gene mutations of pancreatic cancer, specifically introducing mutant Ras85D, p53 suppression, Cyclin E overexpression, and Med gene deletion, and using these models to screen for effective combinations of kinase inhibitors.
The Drosophila models efficiently identify therapeutic agents and kinase inhibitor combinations that can treat pancreatic cancer, offering a cost-effective and innovative approach to drug discovery.
Smart Images

Figure 0007761939000001 
Figure 0007761939000002 
Figure 0007761939000003
Abstract
Description
[Technical Field]
[0001] The present invention relates to a method for screening anticancer agents for pancreatic cancer, a combination drug of at least two kinase inhibitors for the treatment of pancreatic cancer, and a kinase inhibitor for use in the combination drug. [Background technology]
[0002] Pancreatic cancer is one of the most difficult cancers to treat. It is currently the fourth leading cause of cancer death, but is predicted to become the second leading cause over the next decade, raising concerns that it could become a major social problem.
[0003] More than 90% of pancreatic cancer cases are pancreatic ductal carcinomas that develop in the pancreatic duct, and are characterized by the absence of noticeable symptoms even when they develop. This often leads to patients missing opportunities to seek medical attention, and by the time they do, cancer cells have already metastasized to other organs. Because metastasis carries a severely poor prognosis, the survival rate for pancreatic cancer patients is the lowest of all cancer types, and the development of prevention and treatment for pancreatic cancer has long been considered an extremely important issue.
[0004] However, pancreatic cancer is known to exhibit extremely high resistance to drug treatment, making the development of new drugs extremely difficult. The few approved drugs, such as the antimetabolite gemcitabine and the EGFR inhibitor erlotinib, have been criticized for their insufficient effectiveness and toxicity.
[0005] In pancreatic cancer, four types of gene mutations frequently occur: KRAS activation due to KRAS mutation, TP53 inactivation due to TP53 mutation, CDKN2A inactivation due to CDKN2A mutation, and SMAD4 inactivation due to SMAD4 mutation. It is known that pancreatic cancer patients with the poorest prognosis have all four of these gene mutations (Non-Patent Document 1). Therefore, research into animal models with these four gene mutations and therapies using them is of great significance in developing treatments for pancreatic cancer. However, to date, no animal model mimicking these four gene abnormalities has been created, presenting a major obstacle to research.
[0006] In recent years, interest has been growing in the use of Drosophila as a model animal. Drosophila has many beneficial characteristics as a model animal, including a high degree of genetic conservation between Drosophila and mammals (for example, more than 75% of abnormal genes in human diseases are also present in flies), internal structures (epithelial structures, major organs, etc.) that functionally correspond to those of mammals, a wealth of genetic analysis tools (siRNA knockdown strains and mutants of almost all genes are available), and extremely rapid and inexpensive rearing (the next generation can be produced in 10 days, and rearing costs are approximately 1 / 1000 of those of mice).
[0007] We have demonstrated that Drosophila melanogaster expressing a mutant form of RET (ptc>dRet M955T They have reported on the search for kinases involved in medullary thyroid cancer and the screening of anticancer drugs targeting these kinases using the model animal ptc>dRet (Patent Document 1, Non-Patent Documents 2-4). M955T is a Drosophila modified to express RET mutants in limited epithelial cells of the larval wing discs using the gal4-UAS system, a binary system that can force the expression of foreign genes in Drosophila, and the ptc promoter. The mutants develop tumor-like lesions and all individuals die before reaching adulthood.
[0008] Thus, the development of cancer treatments using Drosophila as a model animal is an effective method, but M955T Since is an animal model for medullary thyroid cancer, it is necessary to create a new animal model for pancreatic cancer in order to explore treatments for pancreatic cancer. [Prior art documents] [Patent documents]
[0009] [Patent Document 1] Special Table 2019-528279 [Non-patent literature]
[0010] [Non-Patent Document 1] Qian et al., JAMA Oncol. 2018; 4(3): e173420. [Non-patent document 2] Sonoshita et al., Curr. Top. Dev. Biol. 2017; 121:287-309. [Non-patent document 3] Sonoshita et al., Nat. Chem. Biol. 2018; 14(3): 291-298. [Non-patent document 4] Ung, Sonoshita et al., PLoS Comput. Biol. 2019; 15(4): e1006878. DISCLOSURE OF THE INVENTION [Problem to be solved by the invention]
[0011] Of the four mutated genes identified in human pancreatic cancer, the CDKN2A gene does not exist in Drosophila. Therefore, a Drosophila model of pancreatic cancer cannot be created by simply reproducing the genetic mutations observed in human pancreatic cancer, as is the case with Drosophila models of medullary thyroid cancer. The present invention aims to create Drosophila that can serve as an animal model for pancreatic cancer, to develop a method for exploring new therapeutic approaches for pancreatic cancer using the Drosophila model, and to provide pharmaceuticals for use in treating pancreatic cancer. [Means for solving the problem]
[0012] The present inventors created Drosophila strains with characteristics corresponding to four types of gene mutations associated with human pancreatic cancer, and through screening using these strains, discovered that a combination of multiple kinase inhibitors is effective in treating pancreatic cancer, leading to the completion of the following invention.
[0013] (1) a) to d) below: a) Expression of mutant Ras85D in which the 12th glycine in the amino acid sequence of SEQ ID NO: 1 is replaced with aspartic acid, valine, or cysteine; b) deletion or suppression of the p53 gene; c) overexpression of the Cyclin E gene, and d) Med gene deletion or suppression of expression a step of measuring the survival rate of the Drosophila that have ingested the test substance; and a step of selecting the test substance as a candidate substance for an anticancer drug when the survival rate of the Drosophila that have ingested the test substance is higher than the survival rate of Drosophila that have not ingested the test substance. (2) The method according to (1), wherein the mutant Ras85D is a protein in which the 12th glycine in the amino acid sequence of SEQ ID NO: 1 is replaced with aspartic acid, the expression of the p53 gene is suppressed by introducing a nucleic acid that suppresses the expression of the p53 gene, the overexpression of Cyclin E is suppressed by introducing a nucleic acid that encodes Cyclin E, and the expression of the Med gene is suppressed by introducing a nucleic acid that suppresses the expression of the Med gene. (3) The method described in (1), wherein the Drosophila is a Drosophila into which a nucleic acid encoding a mutant Ras85D in which the 12th glycine in the amino acid sequence of SEQ ID NO: 1 is replaced with aspartic acid, a knockdown nucleic acid for the p53 gene, a nucleic acid encoding the Cyclin E gene, and a knockdown nucleic acid for the Med gene have been introduced. (4) a') to d') below): a') a nucleic acid having a nucleotide sequence downstream of a UAS sequence encoding a mutant Ras85D in which the 12th glycine in the amino acid sequence of SEQ ID NO: 1 is replaced with aspartic acid; b') a nucleic acid having a nucleotide sequence encoding an shRNA against the p53 gene downstream of a UAS sequence; c') a nucleic acid having a nucleotide sequence encoding a Cyclin E gene downstream of a UAS sequence, and d') A nucleic acid having a base sequence encoding shRNA for the Med gene downstream of the UAS sequence a step of raising eggs laid by mating a Drosophila having a gene introduced therein with a Drosophila having a gene introduced thereinto, on a diet containing the test substance; a step of measuring the survival rate of the Drosophila raised on the diet containing the test substance; and a step of selecting the test substance as a candidate substance for an anticancer drug when the survival rate of the Drosophila raised on the diet containing the test substance is higher than the survival rate of the Drosophila raised on a diet not containing the test substance. (5) The method according to any one of (1) to (4), wherein the survival rate of Drosophila that do not ingest the test substance or Drosophila that are reared on a diet that does not contain the test substance is controlled by adjusting the rearing temperature of the Drosophila. (6) a) to d) below: a) Expression of mutant Ras85D in which the 12th glycine in the amino acid sequence of SEQ ID NO: 1 is replaced with aspartic acid, valine, or cysteine; b) deletion or suppression of the p53 gene; c) overexpression of the Cyclin E gene, and d) Med gene deletion or suppression of expression A fruit fly with the following characteristics. (7) a') to d') below): a') a nucleic acid having a nucleotide sequence downstream of a UAS sequence encoding a mutant Ras85D in which the 12th glycine in the amino acid sequence of SEQ ID NO: 1 is replaced with aspartic acid; b') a nucleic acid having a nucleotide sequence encoding an shRNA against the p53 gene downstream of a UAS sequence; c') a nucleic acid having a nucleotide sequence encoding a Cyclin E gene downstream of a UAS sequence, and d') A nucleic acid having a base sequence encoding shRNA for the Med gene downstream of the UAS sequence The Drosophila described in (6) above, into which the vector is introduced. (8) A combination drug of at least two kinase inhibitors selected from the group consisting of a MEK inhibitor, a FRK inhibitor, a WEE inhibitor, an AURK inhibitor, and a ROCK inhibitor for the treatment of pancreatic cancer. (9) A combination drug of a MEK inhibitor and at least one kinase inhibitor selected from the group consisting of an FRK inhibitor, a WEE inhibitor, an AURK inhibitor, and a ROCK inhibitor for the treatment of pancreatic cancer. (10) The combination drug according to (8) or (9), wherein the MEK inhibitor is trametinib. (11) The combination drug according to any one of (8) to (10), wherein the FRK inhibitor is AD80, the WEE inhibitor is adavosertib, and the AURK inhibitor is alisertib or BI-831266. (12) A kinase inhibitor selected from the group consisting of an FRK inhibitor, a WEE inhibitor, an AURK inhibitor, and a ROCK inhibitor for combination with a MEK inhibitor in the treatment of pancreatic cancer. (13) The kinase inhibitor according to (12), wherein the MEK inhibitor is trametinib. (14) The kinase inhibitor according to (12) or (13), wherein the FRK inhibitor is AD80, the WEE inhibitor is adavosertib, and the AURK inhibitor is alisertib or BI-831266. (15) A MEK inhibitor for use in combination with at least one kinase inhibitor selected from the group consisting of an FRK inhibitor, a WEE inhibitor, an AURK inhibitor, and a ROCK inhibitor in the treatment of pancreatic cancer. (16) The MEK inhibitor according to (15), which is trametinib. (17) The MEK inhibitor according to (15) or (16), wherein the FRK inhibitor is AD80, the WEE inhibitor is adavosertib, and the AURK inhibitor is alisertib or BI-831266. [Effects of the Invention]
[0014] According to the present invention, Drosophila having characteristics corresponding to four types of gene mutations associated with human pancreatic cancer can be produced, and by using these Drosophila as a pancreatic cancer model animal, substances that may have therapeutic effects against pancreatic cancer can be efficiently and inexpensively discovered. Furthermore, a combination of two or more specific kinase inhibitors can be provided as a therapeutic drug for pancreatic cancer. [Brief explanation of the drawings]
[0015] [Figure 1]These are images of the wing primordia of larvae observed under a fluorescence microscope: a control fly (ptc>GFP), a Drosophila fly expressing a mutant Ras85D frequently found in pancreatic cancer cells (1-hit fly), and a Drosophila fly mimicking four gene mutations frequently found in pancreatic cancer cells (4-hit fly). [Figure 2] FIG. 1 shows an outline of the protocol for generating kinase heterozygous mutant 4-hit flies by introducing heterozygous mutations in kinase genes into 4-hit flies. [Figure 3] 1 is a graph showing the survival rate of 4-hit flies carrying heterozygous mutations in MEK, FRK, WEE, ROCK, or AURK. [Figure 4] This graph shows the survival rate of 4-hit flies (non-GFP) when treated with the MEK inhibitor (trametinib), FRK inhibitor (AD80), WEE inhibitor (MK-1775), ROCK inhibitor (Y-27632), and AURK inhibitor (BI-831266) alone, or in combination with one of the other four kinase inhibitors. *p < 0.01. [Figure 5] This graph shows the relative cell number of human pancreatic cancer cells (MIAPaCa-2 cells) cultured in the presence of a combination of an MEK inhibitor (trametinib) as a first compound and an FRK inhibitor (AD80), a WEE inhibitor (MK-1775), or an AURK inhibitor (alisertib, BI-831266) as a second compound. *: Significantly reduced compared to the absence of the second compound (0 nM) (p < 0.05). #: Significantly reduced compared to the absence of trametinib (0 nM) (p < 0.05). [Figure 6] 1 is a graph showing the survival rate of 4-hit flies (non-GFP) reared at 22 to 29°C. [Figure 7A]This graph shows the change in tumor volume over time in tumor-bearing mice orally administered the MEK inhibitor (trametinib) and the AURK inhibitor (BI-831266), either alone or in combination. *p < 0.05, **p < 0.01 (Mann-Whitney U test on day 21 of administration). NS, not significant. Error bars indicate the standard deviation of 8 mice. [Figure 7B] This is a waterfall plot showing the percent change in tumor volume on day 21 compared to the tumor volume at the start of administration in tumor-bearing mice orally administered the MEK inhibitor (trametinib) and the AURK inhibitor (BI-831266), either alone or in combination. Each bar represents the percent change in tumor volume for one mouse. DETAILED DESCRIPTION OF THE INVENTION
[0016] Drosophila mimics human pancreatic cancer The first aspect of the present invention is the following a) to d): a) Expression of mutant Ras85D in which glycine at position 12 of the amino acid sequence of SEQ ID NO: 1 is replaced with aspartic acid, valine, or cysteine; b) deletion or suppression of the p53 gene; c) overexpression of the Cyclin E gene, and d) Med gene deletion or suppression of expression The present invention relates to a Drosophila having the characteristics of
[0017] The Ras85D protein is a Drosophila orthologue of human KRAS, and its amino acid sequence (SEQ ID NO: 1) has been registered in NCBI under accession number NP_476699.1, and the nucleotide sequence encoding it has been registered in NCBI under accession number NM_057351.5.
[0018] Mutations at codon 12 of exon 2 of the human KRAS gene are known to be cancer-inducing mutations that result in KRAS activation and are frequently observed in pancreatic cancer cells. Mutant Ras85D is a Ras85D mutant that incorporates a mutation equivalent to the cancer-inducing mutation in human KRAS, specifically, a substitution of aspartic acid, valine, or cysteine for the 12th glycine in the amino acid sequence shown in SEQ ID NO: 1, and functions as activated KRAS. Forced expression of a gene encoding mutant Ras85D in Drosophila may enable the mimicking of the conditions caused by activated human KRAS in Drosophila.
[0019] Drosophila p53 is an ortholog of human TP53, and its encoding sequence has been deposited in NCBI under accession number NM_206545.2. In humans, reduced p53 function due to TP53 gene mutations is known to promote the development and progression of cancer, and p53 mutations are frequently observed in pancreatic cancer cells. Suppression of functional expression of the p53 gene in Drosophila, for example, deletion or suppression of p53 expression, is thought to mimic in Drosophila a condition similar to that caused by inactivated human p53.
[0020] Cyclin-dependent kinase inhibitor 2A (CDKN2A), also known as p16, is a protein involved in cell cycle regulation. CDKN2A inactivation due to mutations in the CDKN2A gene is known to be associated with the development of various cancers and is frequently observed in pancreatic cancer cells. Because Drosophila does not have an ortholog of human CDKN2A, the present invention uses overexpression of Drosophila cyclin E instead of CDKN2A gene mutations. Cyclin E is a factor that regulates the progression of the G1 phase and transition to the S phase of the cell cycle and is known to bind to and activate cyclin-dependent kinase 2 (CDK2). It has been reported that overexpression of cyclin E in Drosophila functionally substitutes for CDKN2A inactivation and mimics a condition similar to that caused by CDKN2A inactivation in Drosophila (Datar et al. EMBO J. 19:4543, 2000). The nucleotide sequence encoding Drosophila Cyclin E has been deposited in NCBI under the accession number NP_476959.1.
[0021] Med (Mothers against decapentaplegic) is the Drosophila ortholog of human SMAD4, and its encoding sequence has been deposited in NCBI under accession number NM_079871.4. In humans, SMAD4 is involved in TGF-β signaling, which negatively regulates cell proliferation. SMAD4 inactivation due to mutations in the SMAD4 gene has been implicated in cancer development and is frequently observed in pancreatic cancer cells. Suppression of functional expression of the Med gene in Drosophila, for example, deletion or silencing of the Med gene, is thought to mimic in Drosophila a condition similar to that caused by inactivated human SMAD4.
[0022] In the present invention, introduction of mutations into genes, deletion of genes and suppression of expression can be carried out using molecular biological techniques commonly used in the art.
[0023] In a preferred embodiment, the Drosophila is a mutant Ras85D in which the 12th glycine is replaced by aspartic acid (Ras G12D and (iii) a Drosophila in which p53 gene expression is suppressed by introducing a nucleic acid that suppresses p53 gene expression, Cyclin E overexpression is suppressed by introducing a nucleic acid that encodes Cyclin E, and Med gene expression is suppressed by introducing a nucleic acid that suppresses Med gene expression.
[0024] Nucleic acids that can be used in the present invention to suppress gene expression include knockdown nucleic acids such as antisense nucleic acids and siRNAs (antisense nucleic acids, siRNAs, their precursors, shRNAs, shDNAs encoding shRNAs, etc.). Knockdown nucleic acids can be appropriately designed based on the base sequence of the target gene so that they are specific to the target gene and have low off-target effects. In a more preferred embodiment, Drosophila is a plant that expresses Ras G12D The Drosophila melanogaster is a fruit fly into which a nucleic acid encoding the p53 gene, a nucleic acid encoding the Cyclin E gene, and a nucleic acid encoding the Med gene have been introduced. These four nucleic acids may all be configured to be under the control of a single regulatory sequence, or each may be configured to be under a different regulatory sequence.
[0025] The four nucleic acids are preferably integrated into the Drosophila genome with a regulatory system that allows for control of the timing and level of their expression. To achieve this, the gal4-UAS system is typically used. The gal4-UAS system is a binary system that induces forced gene expression by combining the yeast transcription activator gal4 with its target sequence, the upstream activating sequence (UAS). For example, Drosophila harboring a construct incorporating the four nucleic acids downstream of the UAS can be crossed with Drosophila expressing the gal4 protein (a gal4 driver strain). The resulting F1 Drosophila express the four nucleic acids in a manner that is consistent with the expression pattern of the gal4 protein. Because the transcriptional activity of the gal4 protein changes depending on the temperature in the gal4-UAS system, the activity of the gal4 protein can be controlled by adjusting the rearing temperature of the Drosophila. This allows the expression levels of the four nucleic acids to be controlled by adjusting the rearing temperature of the Drosophila. Furthermore, the degree of expression of the above four nucleic acids in this F1 Drosophila may vary depending on the cell type or tissue in which the promoter / enhancer region controlling gal4 expression is active and the strength of the promoter / enhancer region's activity at those sites. Therefore, the expression levels of the above four nucleic acids can also be controlled by appropriately designing the promoter / enhancer region controlling gal4 expression in the gal4 driver line, which is the parent for generating the F1, and all of these are within the capabilities of those skilled in the art.
[0026] There are no particular limitations on the location in the Drosophila genome where the four nucleic acids are integrated, but integration into the second or third chromosome, which is an autosome, is preferred.
[0027] In a further preferred embodiment, the Drosophila is selected from the group consisting of the following a') to d'): a') a nucleic acid having a nucleotide sequence downstream of a UAS sequence encoding a mutant Ras85D in which the 12th glycine in the amino acid sequence of SEQ ID NO: 1 is replaced with aspartic acid; b') a nucleic acid having a nucleotide sequence encoding an shRNA against the p53 gene downstream of a UAS sequence; c') a nucleic acid having a nucleotide sequence encoding a Cyclin E gene downstream of a UAS sequence, and d') A nucleic acid having a base sequence encoding shRNA for the Med gene downstream of the UAS sequence This is a Drosophila into which the gene has been introduced.
[0028] The production of Drosophila having the characteristics a) to d) was carried out by the ptc>dRet gene described in Non-Patent Documents 2 to 4. M955T An example of a production protocol is outlined below in (i) to (iii), but the production method and Drosophila are not limited to the example below. (i) The Drosophila genome is modified using a Drosophila expression vector in which the base sequence encoding mutant Ras85D and the base sequence encoding shRNA against the p53 gene are recombined under the control of UAS, to produce transformed flies 1. (ii) The Drosophila genome is modified using a Drosophila expression vector in which the base sequence of the Cyclin E gene and the base sequence encoding the shRNA against the Med gene are recombined under the control of UAS to produce transformed flies 2. (iii) The transgenic fly 1 and 2 are crossed to produce the transgenic fly 3, which is then crossed with a gal4 driver strain to produce a model Drosophila having the characteristics of a) to d).
[0029] Drosophila with characteristics a) to d) develop tumor cells with abnormal cell proliferation and enhanced migration ability. These phenomena are thought to be the result of recapitulating the traits of human pancreatic cancer, so Drosophila with characteristics a) to d) can be used as a model for human pancreatic cancer. Furthermore, by crossing these Drosophila with heterozygous mutant Drosophila in which a mutation such as a deletion has been introduced into one allele of a given gene to reduce its function, and examining the traits and survival rate of the resulting F1, it is possible to search for genes that affect the human pancreatic cancer-like traits exhibited by Drosophila with characteristics a) to d).
[0030] Anticancer drug screening method In another aspect, the present invention provides a method for screening anticancer agents, comprising the steps of: allowing the above-mentioned human pancreatic cancer-mimicking Drosophila, i.e., Drosophila having the characteristics a) to d) above, to ingest a test substance; measuring the survival rate of the Drosophila that have ingested the test substance; and, if the survival rate of the Drosophila that have ingested the test substance is higher than the survival rate of Drosophila that have not ingested the test substance, selecting the test substance as a candidate substance for an anticancer agent.
[0031] The anticancer drug screening method includes a step of feeding the above-mentioned human pancreatic cancer mimic Drosophila, i.e., Drosophila having the above characteristics a) to d), a test substance. This step can typically be performed by feeding Drosophila having the characteristics a) to d) a diet containing the test substance. The diet can be prepared using methods and materials commonly used for preparing Drosophila diet, except that it contains an appropriate amount of the test substance. The amount of the test substance and the method of mixing it with other ingredients can be adjusted appropriately depending on the physical properties of the test substance, the expected effective concentration, etc. Furthermore, the period during which the Drosophila are fed the diet may be as long as the Drosophila are in their larval stage, i.e., the period from hatching from eggs to pupation. In this step, the Drosophila may be raised under conditions commonly used for raising Drosophila as laboratory animals, as long as the rearing temperature is adjusted as described below to achieve the desired survival rate and humidity is maintained to prevent the food from drying out.
[0032] One suitable example of this step is a step of placing Drosophila eggs having the above characteristics a) to d) on food containing the test substance and allowing the hatched larvae to ingest the test substance together with the food. Another suitable example is a step of placing Drosophila larvae having the above characteristics a) to d) on food containing the test substance and allowing the larvae to ingest the test substance together with the food.
[0033] The method for screening anticancer drugs includes the steps of measuring the survival rate of Drosophila that have ingested a test substance, and selecting the test substance as a candidate anticancer drug when the survival rate of the Drosophila that have ingested the test substance is higher than the survival rate of Drosophila that have not ingested the test substance. The survival rate can be calculated by dividing the number of individuals that have emerged from pupae by the total number of pupae.
[0034] In Drosophila having the above characteristics a) to d), abnormal cell proliferation and tumor cells with enhanced migration ability develop, resulting in a decreased survival rate. Furthermore, when the gal4-UAS system is used, raising the rearing temperature within the range of 16 to 29°C increases the probability that the fly larvae will die before emerging from the pupa. For example, in the case of Ser-gal4;UAS-Ras gene described in Examples 3 and 5, G12D ,UAS-p53 shRNA ,UAS-CycE,UAS-Med shRNA In the case of 4-hit flies (non-GFP), the survival rate is essentially 0% at temperatures above 25° C. Therefore, if the survival rate of Drosophila reared with the test substance is higher than that of Drosophila reared under the same conditions without the test substance, for example, if the survival rate of Drosophila reared without the test substance is 0% while the survival rate of Drosophila reared with the test substance is higher than 0%, the substance is presumed to have an effect of suppressing the expression of human pancreatic cancer-like traits exhibited by Drosophila having characteristics a) to d), and therefore the substance can be selected as a candidate anticancer drug for pancreatic cancer.
[0035] In Drosophila having the above characteristics a) to d) using the gal4-UAS system, the survival rate can be controlled by adjusting the rearing temperature to control the expression levels of the above four nucleic acids. For example, in the Ser-gal4;UAS-Ras gene described in Examples 3 and 5, G12D ,UAS-p53 shRNA ,UAS-CycE,UAS-Med shRNA The survival rate of 4-hit flies (non-GFP) is essentially 0% when reared at 25°C or higher, but can be increased to approximately 10-20% when reared at 22-24°C. Test substances selected by carrying out this screening method at rearing temperatures of 22-24°C are expected to have relatively mild anticancer effects compared to test substances selected by carrying out this screening method at rearing temperatures of 25°C or higher.
[0036] A preferred embodiment of the present screening method includes the following a') to d'): a') a nucleic acid having a nucleotide sequence downstream of a UAS sequence encoding a mutant Ras85D in which the 12th glycine in the amino acid sequence of SEQ ID NO: 1 is replaced with aspartic acid; b') a nucleic acid having a nucleotide sequence encoding an shRNA against the p53 gene downstream of a UAS sequence; c') a nucleic acid having a nucleotide sequence encoding a Cyclin E gene downstream of a UAS sequence, and d') A nucleic acid having a base sequence encoding shRNA for the Med gene downstream of the UAS sequence a step of raising eggs laid by mating a Drosophila into which a gene has been introduced with a Drosophila into which a gal4 gene has been introduced, on a diet containing the test substance; a step of measuring the survival rate of the Drosophila raised on the diet containing the test substance; and a step of selecting the test substance as a candidate substance for an anticancer drug when the survival rate of the Drosophila raised on the diet containing the test substance is higher than the survival rate of the Drosophila raised on a diet not containing the test substance.
[0037] Combination medicines Another aspect of the present invention relates to a combination drug of at least two kinase inhibitors selected from the group consisting of a MEK inhibitor, a FRK inhibitor, a WEE inhibitor, an AURK inhibitor, and a ROCK inhibitor for the treatment of pancreatic cancer.
[0038] MEK (MAPK (mitogen-activated protein kinase) / ERK (extracellular signal-regulated kinase) kinase) is a protein kinase that constitutes the MAPK cascade. The MAPK cascade forms a complex signaling network that controls a wide variety of cellular processes, including cell proliferation, growth, differentiation, and apoptosis. Because inhibiting MEK stops cell proliferation and induces apoptosis, MEK has attracted attention as a target molecule for anticancer drugs, and various MEK inhibitors have been reported.
[0039] Examples of MEK inhibitors used in the present invention include trametinib, cobimetinib, binimetinib, selumetinib, pimasertib, mirdametinib, refametinib, PD184352, PD98059, BIX02189, BIX02188, TAK-733, AZD8330, PD318088, myricetin, BI-847325, GDC-0623, Ro 5126766, PD198306, RO4987655, HI TOPK 032, and the like.
[0040] FRK (Fyn-related kinase, also known as RAK) is a nuclear non-receptor tyrosine kinase that belongs to the SRC subfamily and is known to be upregulated in breast and kidney cancer cells.
[0041] Examples of the FRK inhibitor used in the present invention include AD80, RAF709, and the like.
[0042] AURORA kinase (AURK) is a serine / threonine kinase that regulates cell division and is known to be involved in centrosome separation and bipolar spindle formation during cell division. There are three isoforms, AURK-A, AURK-B, and AURK-C, which share high homology in the C-terminal kinase domain. AURK is highly expressed in many cancer cells, making it a promising target molecule for anticancer drugs, and various AURK inhibitors have been reported.
[0043] Examples of AURK inhibitors used in the present invention include alisertib (AURK-A inhibitor), BI-831266 (AURK-B inhibitor), barasertib (AURK-B inhibitor), tozasertib (pan-AURK inhibitor with high AURK-A selectivity), danusertib (pan-AURK inhibitor), CCT137690 (pan-AURK inhibitor), CCT129202 (pan-AURK inhibitor with high AURK-A selectivity), CCT241736 (AURK-A, B inhibitor), SNS-314 (pan-AURK inhibitor), hesperadin (AURK-B inhibitor), MK-5108 (AURK-A inhibitor), MLN8054 (AURK-A inhibitor), ZM 447439 (AURK-A, B inhibitor), and PF03814735. (AURK-A, B inhibitor), AT9283 (AURK-A, B inhibitor), GSK1070916 (AURK-B, C inhibitor), PHA-680632 (pan-AURK inhibitor with high AURK-A selectivity), Reversine (pan-AURK inhibitor), CYC116 (AURK-A, B inhibitor), ENMD-2076 (AURK-A inhibitor), TAK-901 (AURK-A, B inhibitor), AMG 900 (pan-AURK inhibitor), MK-8745 (AURK-A inhibitor), JNJ-7706621 (AURK-A, B inhibitor), SCH-1473759 (AURK-A, B inhibitor), Ilorasertib (pan-AURK inhibitor with high AURK-B, C selectivity), TCS7010 (AURK-A inhibitor), LY3295668 (AURK-A inhibitor), BI-811283 (AURK-B inhibitor), Chiauranib (AURK-B inhibitor), NMI-900 (AURK-B, C inhibitor), etc.
[0044] WEE kinases are nuclear tyrosine kinases that negatively regulate cell division by phosphorylating and inactivating the CDK-1 / cyclin B complex. There are three types of WEE kinases: WEE1 (WEE1A), WEE2 (WEE1B), and Myt1 (PKMYT1). WEE1 plays an important role in the G2 / M checkpoint of mitosis, and cooperates with MYT1 to transition cells to G2-M arrest. Inhibition of WEE1 in cancer cells inactivates the G1 checkpoint, causing chromosomal instability and ultimately leading to mitotic catastrophe. Therefore, WEE kinases, especially WEE1, are attracting attention as targets for anticancer drugs.
[0045] Examples of WEE inhibitors used in the present invention include adavosertib (also known as MK-1775 or AZD1775), PD0166285, PD407824, and the like.
[0046] ROCK (Rho-associated protein kinase) is a serine / threonine kinase that regulates the cytoskeleton and exists in two isoforms: ROCK1 and ROCK2. ROCK is a downstream target of the small GTPase RhoA and phosphorylates numerous substrates, contributing to a variety of vital functions, including cell motility, cell polarity, cell adhesion, cell division, apoptosis, and transcriptional regulation. Therefore, ROCK is attracting attention as a target molecule for various drugs, including anticancer drugs, and various ROCK inhibitors have been reported.
[0047] Examples of ROCK inhibitors used in the present invention include Y-27632 (ROCK1 inhibitor), Fasudil (ROCK2 inhibitor), Azaindole 1 (pan-ROCK inhibitor), AT13148 (pan-ROCK inhibitor), Thiazovivin, Netarsudil, Ripasudil, Chroman 1, GSK429286A, RKI-1447, GSK269962A, Y-39983, KD025, SAR407899, BDP5290, SB-772077B, H-1152, LX7101, SR-3677, Y-33075, CMPD101, and SLx-2119.
[0048] The combined pharmaceutical of this embodiment is a pharmaceutical comprising a combination of at least two of the kinase inhibitors described above, i.e., at least two kinase inhibitors selected from the group consisting of MEK inhibitors, FRK inhibitors, WEE inhibitors, AURK inhibitors, and ROCK inhibitors. A "combination of at least two kinase inhibitors" includes a combination of two kinase inhibitors, a combination of three kinase inhibitors, a combination of four kinase inhibitors, and a combination of all five kinase inhibitors. This term does not include a combination of at least two kinase inhibitors of the same type, such as a combination of two or more kinase inhibitors classified as MEK inhibitors. Thus, for example, a "combination of two kinase inhibitors" refers to a combination of a MEK inhibitor and a FRK inhibitor, a MEK inhibitor and a WEE inhibitor, a MEK inhibitor and an AURK inhibitor, a MEK inhibitor and a ROCK inhibitor, a FRK inhibitor and a WEE inhibitor, a FRK inhibitor and an AURK inhibitor, a FRK inhibitor and a ROCK inhibitor, a WEE inhibitor and an AURK inhibitor, a WEE inhibitor and a ROCK inhibitor, and an AURK inhibitor and a ROCK inhibitor.
[0049] Furthermore, each inhibitor constituting the combination is not limited to one compound. For example, the combination of a MEK inhibitor and an FRK inhibitor is not limited to a combination of one MEK inhibitor and one FRK inhibitor, but includes a combination of one MEK inhibitor and two or more FRK inhibitors, a combination of two or more MEK inhibitors and one FRK inhibitor, and a combination of two or more MEK inhibitors and two or more FRK inhibitors.
[0050] The combination drug of this embodiment may include any combination consisting of two or more kinase inhibitors from the above five types of kinase inhibitors. In one embodiment, the combination is a combination of at least two kinase inhibitors selected from the group consisting of trametinib, an MEK inhibitor, AD80, an FRK inhibitor, adavosertib, a WEE inhibitor, and alisertib and BI-831266, which are AURK inhibitors. The combination may also be a combination of a MEK inhibitor and at least one kinase inhibitor selected from the other four types of kinase inhibitors. In another embodiment, the combination is a combination of trametinib, an MEK inhibitor, and at least one kinase inhibitor selected from the group consisting of AD80, an FRK inhibitor, adavosertib, a WEE inhibitor, and alisertib and BI-831266, which are AURK inhibitors.
[0051] The two or more kinase inhibitors contained in the combined medicine are administered together or separately, simultaneously or sequentially to a subject who needs it, that is, who desires to treat pancreatic cancer.The combined medicine may be in the form of a preparation containing two or more kinase inhibitors together, or may be in the form of a combination of separate preparations of each kinase inhibitor.When the combined medicine is a combination of separate preparations, the order and timing of administration of each preparation are not particularly limited, and they may be administered simultaneously, or at different times or on different days.
[0052] The individual kinase inhibitors contemplated for use in the above pharmaceutical combinations are also another aspect of the present invention.
[0053] The above-mentioned combination medicine can be used for the treatment of pancreatic cancer. Here, the term "treatment" includes all types of medically acceptable therapeutic interventions aimed at curing or temporarily alleviating the disease. That is, treatment of pancreatic cancer includes medically acceptable interventions for various purposes, including delaying or stopping the progression of pancreatic cancer, regression or elimination of lesions, prevention of recurrence, etc.
[0054] The above-mentioned combination drug is administered to a subject suffering from pancreatic cancer, for example, a mammal such as a rodent including a mouse, rat, hamster, and guinea pig, a primate including a human, chimpanzee, and rhesus monkey, a livestock including a pig, cow, goat, horse, and sheep, or a pet including a dog and cat. The preferred subject is a human.
[0055] Pancreatic cancers to be treated include exocrine tumors, such as invasive ductal carcinoma, pancreatic acinar cell carcinoma, intraductal papillary mucinous tumor, and endocrine tumors, such as neuroendocrine tumors.
[0056] The amount of each kinase inhibitor in the combination drug can be as long as it can treat pancreatic cancer when combined with other kinase inhibitors that make up the combination, and is generally the same as or less than the amount when used alone.The combination drug containing the same amount of each kinase inhibitor as when used alone can exert a stronger effect on pancreatic cancer, and can treat pancreatic cancer in a shorter period of time, or in subjects who have not been able to confirm the effect when used alone.In addition, the combination drug containing the amount of each kinase inhibitor less than when used alone has the advantage that it can reduce the amount of each kinase inhibitor while maintaining the effect on pancreatic cancer.
[0057] The above-mentioned combination drugs and kinase inhibitors for the combination drugs can each be used in the form of a pharmaceutical composition containing pharmaceutically acceptable ingredients such as drugs other than kinase inhibitors, buffers, antioxidants, preservatives, proteins, hydrophilic polymers, amino acids, chelating agents, nonionic surfactants, excipients, stabilizers, carriers, etc. Pharmaceutically acceptable ingredients are well known to those skilled in the art, and can be appropriately selected and used by those skilled in the art within the scope of their ordinary capabilities, for example, from ingredients described in the 17th Edition of the Japanese Pharmacopoeia and other specifications, depending on the form of the formulation.
[0058] The pharmaceutical composition contains an effective amount of each kinase inhibitor. Here, the effective amount is an amount that can treat cancer when combined with other kinase inhibitors that constitute the combination, as described above. The effective amount is determined appropriately depending on the type and ratio of the individual kinase inhibitors to be combined, dosage, the age of the subject, the state of the disease, and other conditions.
[0059] The pharmaceutical composition may be in any dosage form, with preferred examples including oral preparations (tablets, capsules, powders, granules, fine granules, pills, suspensions, emulsions, liquids, syrups, etc.) and parenteral preparations (injections, drip infusions, enteral preparations, transdermal preparations, etc.). The route of administration of the pharmaceutical composition is not particularly limited, but in the case of parenteral preparations, examples include intravascular administration (preferably intravenous administration), intraperitoneal administration, intraintestinal administration, subcutaneous administration, and local administration to a target site. In a preferred embodiment, the pharmaceutical composition is administered orally or intravenously.
[0060] Cancer treatment methods In another aspect, the present invention provides a method for treating pancreatic cancer, comprising administering to a subject in need thereof a combination of effective amounts of at least two kinase inhibitors selected from the group consisting of a MEK inhibitor, a FRK inhibitor, a WEE inhibitor, an AURK inhibitor, and a ROCK inhibitor, together or separately, simultaneously or sequentially.
[0061] The present invention will be described in more detail by the following examples, but the present invention is not limited to these examples. [Example]
[0062] Example 1: Creation of a Drosophila model of human pancreatic cancer Drosophila - Genomic DNA was extracted from the Bloomington Drosophila Stock Center by standard methods. PCR was performed using this genomic DNA as a template and primer DNA designed to amplify the Ras85D gene, yielding a DNA fragment containing the base sequence of the Ras85D gene. Furthermore, primer DNA for site-specific mutagenesis was designed and synthesized to replace the codon encoding glycine at position 12 of the amino acid sequence of Ras85D with a codon encoding aspartic acid. PCR was performed using the DNA fragment as a template to identify the Ras85D mutant (Ras G12D This DNA fragment was inserted into the pWALIUM vector (Harvard Medical School), a Drosophila knockdown vector, and the resulting vector was pWALIUM.UAS-Ras G12D The vector was then transformed into Drosophila y 1 w 67c23 ;P{CaryP}attP2, and then the Ras G12D UAS-Ras with inserted DNA encoding G12D Flies were produced.
[0063] Also, Ras G12D A DNA fragment containing a p53 gene knockdown sequence (a sequence consisting of a sense strand TGCTGAAGCAATAACCACCGA (SEQ ID NO: 2), a hairpin loop TAGTTATATTCAAGCATA (SEQ ID NO: 6), and an antisense strand TCGGTGGTTATTGCTTCAGCA (SEQ ID NO: 3)) together with a DNA fragment encoding the above was inserted into a pWALIUM vector to form pWALIUM.UAS-Ras G12D ,UAS-p53 shRNAThe vector was then transformed into Drosophila y 1 w 67c23 Microinjection of P{CaryP}attP2 into the L region of chromosome 3 results in the expression of Ras G12D UAS-Ras containing DNA encoding the p53 gene and shRNA G12D ,UAS-p53 shRNA Flies were produced.
[0064] Furthermore, fruit flies - PCR was performed using the genomic DNA of the vector as a template and primers designed to amplify the Cyclin E (CycE) gene to obtain a DNA fragment containing the nucleotide sequence of the CycE gene. This DNA fragment was inserted into the pWALIUM vector together with a DNA fragment containing the Med gene knockdown sequence (a sequence consisting of the sense strand TTCAGTGCGATGAACATTGCT (SEQ ID NO: 4), the hairpin loop TAGTTATATTCAAGCATA (SEQ ID NO: 6), and the antisense strand AGCAATGTTCATCGCACTGAA (SEQ ID NO: 5)). shRNA The vector was constructed and microinjected into Drosophila PBac{yellow[+]-attP-9A}VK00027, and the DNA encoding the CycE gene and the shRNA targeting the Med gene were inserted into the R region of chromosome 3 by homologous recombination, resulting in the UAS-CycE,UAS-Med vector. shRNA Flies were produced.
[0065] Next, UAS-Ras G12D ,UAS-p53 shRNA Flies and UAS-CycE, UAS-Med shRNA Flies were mated at 25°C for 3 days and transfected with UAS-Ras G12D ,UAS-p53 shRNA ,UAS-CycE,UAS-Med shRNA Flies were produced.
[0066] UAS-Ras G12D Flies and UAS-Ras G12D ,UAS-p53shRNA ,UAS-CycE,UAS-Med shRNA Each fly was crossed with ptc-gal4, UAS-GFP flies (ptc>GFP flies, Bloomington Drosophila Stock Center) at 25°C for 3 days, and then transfected with ptc>GFP; UAS-Ras G12D Flies (referred to as 1-hit flies (ptc>GFP)) and ptc>GFP; UAS-Ras G12D ,UAS-p53 shRNA ,UAS-CycE,UAS-Med shRNA We generated flies (designated 4-hit flies (ptc>GFP)) in which transgene expression was induced in restricted epithelial cells of the wing disc under the control of the ptc promoter.
[0067] Figure 1 shows images of wing primordia from third-instar larvae of one-hit flies (ptc>GFP), four-hit flies (ptc>GFP), and control ptc>GFP flies observed under a fluorescence microscope. In the control, GFP expression was observed in a single layer of epithelial cells approximately 10 cells wide (second image from the left and center). In one-hit flies (ptc>GFP), GFP-expressing cells were observed over a wider area (second image from the right). This tendency was even more pronounced in four-hit flies (ptc>GFP) (first image from the right), and the appearance of tumor cells with enhanced migratory ability (indicated by arrowheads in the figure) that had detached from their original area was confirmed.
[0068] In addition, when crossbreeding to produce 1-hit (ptc>GFP) and 4-hit (ptc>GFP) flies, the mated parent flies were allowed to lay eggs on food for 2 days, yielding 20–50 eggs per vial. After rearing these for 25 days at 16°C, the survival rate was calculated by dividing the number of individuals that emerged by the total number of pupae. While the survival rate of control ptc>GFP flies was 100%, the survival rate of 1-hit (ptc>GFP) flies was 55%, and the survival rate of 4-hit (ptc>GFP) flies was 0%, i.e., they were lethal.
[0069] These results suggest that Ras G12DExpression of Ras enhances proliferation of wing disc epithelial cells. G12D In addition to the expression of 4-hit flies, knockdown of p53, increased expression of CycE, and knockdown of the Med gene further enhanced proliferation of wing disc epithelial cells and also enhanced their migration ability, indicating that 4-hit flies can be used as a Drosophila model for human pancreatic cancer.
[0070] Example 2: Search for kinase genes that affect the survival rate of 4-hit flies According to the method of Sonoshita et al. (Curr. Top. Dev. Biol., 2017, 121, 287-309), we performed crossbreeding as shown in Figure 2 to search for kinase genes that affect the survival rate of 4-hit flies. Specifically, we used the UAS-Ras gene produced in Example 1. G12D,UAS -p53 shRNA ,UAS-CycE,UAS-Med shRNA SM5 flies tubgal80 -TM6B balancer flies (Dr. Ross Cagan, Icahn School of Medicine at Mount Sinai, NY, USA) were crossed with UAS-Ras G12D ,UAS-p53 shRNA ,UAS-CycE,UAS-Med shRNA / SM5 tubgal80 These were then crossed with Ser>GFP flies (Bloomington Drosophila Stock Center) to generate Ser>GFP;UAS-Ras G12D ,UAS-p53 shRNA ,UAS-CycE,UAS-Med shRNA / SM5 tubgal80 -TM6B flies were generated.
[0071] In addition, 220 heterozygous mutant lines of kinases in the entire fly kinome were obtained from the Bloomington Drosophila Stock Center (USA). Each of these lines was incubated at 27°C for 3 days with Ser>GFP;UAS-Ras G12D ,UAS-p53 shRNA ,UAS-CycE,UAS-MedshRNA / SM5 tubgal80 The eggs of the kinase heterozygous 4-hit flies were obtained by crossing with the -TM6B flies. - Flies were transfected with Ser>GFP;UAS-Ras G12D ,UAS-p53 shRNA ,UAS-CycE,UAS-Med shRNA / SM5 tubgal80 The 4-hit kinase wild-type flies were mated with -TM6B flies to obtain eggs. These flies were reared at 27°C for 13 days, and the survival rate was calculated by dividing the number of individuals that emerged by the total number of pupae.
[0072] A comprehensive search of fly kinase genes revealed that heterozygous mutations in the RAS pathway factor MEK, the SRC family kinase FRK, the cell division regulators WEE and AURORA, and the cytoskeleton regulator ROCK suppressed the lethality of 4-hit flies (Fig. 3). The survival rates of these heterozygous mutant flies are shown in Fig. 3. This suggests that the use of MEK, FRK, WEE, AURK, and ROCK inhibitors may be effective in increasing the survival rate of 4-hit flies.
[0073] Example 3: Evaluation of the efficacy of kinase inhibitors on the survival rate of 4-hit flies Trametinib (MEK inhibitor), adavosertib (also known as MK-1775, a WEE1 inhibitor), AD80 (FRK inhibitor), Y-27632 (ROCK inhibitor), alisertib (AURKA inhibitor, all purchased from MedChem Express), and BI-831266 (AURKB inhibitor, donated by Boehringer Ingelheim) were dissolved in DMSO (SIGMA) and stored at -20°C.
[0074] Standard diet was prepared by dissolving agar (Wako), brewer's yeast (MPBio), yeast extract (Sigma-Aldrich), bacto casitone (BD), sucrose (Wako), glucose (Wako), MgCl2 (Wako), CaCl2 (Wako), propionic acid (Wako), and mold inhibitor (10% methyl-4-hydroxybenzoate in 95% ethanol; Wako) in ultrapure water. While incubating at 50°C, kinase inhibitors (trametinib alone or a combination of trametinib and other kinase inhibitors) dissolved in DMSO were added and mixed. The drug diet was then cooled to prepare the final concentrations of each compound in the diet: trametinib 1 μM, adavosertib 100 μM, AD80 50 μM, Y-27632 10 μM, and BI-831266 100 μM.
[0075] UAS-Ras produced in Example 1 G12D ,UAS-p53 shRNA ,UAS-CycE,UAS-Med shRNA After mating with Ser-gal4 flies (Bloomington Drosophila Stock Center), the parent flies were allowed to lay eggs on standard or drug diet for 2 days, and 20–50 Ser-gal4;UAS-Ras flies were cultured per vial. G12D ,UAS-p53 shRNA ,UAS-CycE,UAS-Med shRNA Eggs of 4-hit flies (non-GFP) were obtained and reared at 25°C for 13 days. The number of individuals that emerged was divided by the total number of pupae to calculate the survival rate of 4-hit flies (non-GFP) reared on each food.
[0076] Trametinib alone increased the survival rate of 4-hit flies (non-GFP) by 20%. In addition, other kinase inhibitors alone did not affect the survival rate of 4-hit flies (non-GFP), but when combined with trametinib, they improved survival rate more than trametinib alone, suggesting a synergistic effect between trametinib and other kinase inhibitors (Figure 4).
[0077] Example 4: Efficacy evaluation of kinase inhibitors using human pancreatic cancer cells Human pancreatic cancer cell line (MIAPaCa-2) was purchased from the RIKEN BioResource Research Center and cultured in Dulbecco's Modified Eagle's Medium (Nacalai Tesque) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin-streptomycin (Nacalai Tesque) at 37°C in the presence of 5% CO2.
[0078] Trametinib (DMSO only, 1 μM, 300 μM), adavosertib (300 μM, 1 mM), AD80 (30 μM, 3 mM), alisertib (30 μM, 1 mM), and BI-831266 (3 μM, 3 mM) were each prepared and diluted 100-fold with culture medium to prepare drug solutions.
[0079] MIAPaCa-2 cells were seeded at 1,000 cells / well in 100 μL of medium in a 96-well plate. After one day of culture, 10 μL of a drug solution containing trametinib alone or in combination with other kinase inhibitors was added to the cells in the 96-well plate (final DMSO concentration: 0.2%). Each combination was tested in five wells. After adding the drug solution, the cells were cultured at 37°C in the presence of 5% CO2 for 72 hours, and then cell viability was measured using the MTS assay (CellTiter96®, Promega). Viability was expressed as a percentage of the control (solvent only).
[0080] Trametinib alone reduced cell viability in a dose-dependent manner. When trametinib was combined with adavosertib, AD80, alisertib, or BI-831266, cell viability was reduced to a greater extent than with trametinib alone, suggesting a synergistic effect between trametinib and other kinase inhibitors (Figure 5).
[0081] Example 5 Evaluation of temperature dependence of lethality in 4-hit flies The 4-hit flies (non-GFP) produced in Example 3 were reared at temperatures of 22, 24, 25, 27, and 29°C. As the temperature increased, the survival rate decreased, and they died at temperatures above 25°C (Figure 6).
[0082] Example 6: Evaluation of the efficacy of kinase inhibitors using tumor-bearing mice BALB / c-nu / nu immunodeficient nude mice (6 weeks old, specific pathogen-free) were anesthetized and injected subcutaneously with 5 × 10 6 MIA PaCa-2 cells were transplanted. The tumor volume (longer diameter × shorter diameter × shorter diameter / 2) was measured and the mice were reared. 3 Once tumor volume reached 1000 mg / kg, the mice were divided into four groups (n=8). Each group was orally administered vehicle (5% DMSO), trametinib (1 mg / kg body weight / day), BI-831266 (10 mg / kg body weight / day), or trametinib (1 mg / kg body weight / day) and BI-831266 (10 mg / kg body weight / day), 5 days per week. Tumor volume was measured over time.
[0083] The trametinib and BI-831266 combination (T+B group) significantly suppressed mean tumor volume increase compared with the trametinib monotherapy (T group) and BI-831266 monotherapy (B group) (Figure 7A). Many mice in the combination therapy group achieved partial remission (≥30% tumor volume reduction) or complete remission (tumor disappearance). However, no partial or complete remissions were observed in the vehicle or trametinib monotherapy groups, and only one complete remission was observed in the BI-831266 group (Figure 7B). These results confirm that the combination of trametinib and BI-831266 exerted a synergistic inhibitory effect on human pancreatic cancer cells transplanted into mice, with minimal interindividual variability in this effect. [Sequence List Free Text]
[0084] SEQ ID NO: 1 Amino acid sequence of Ras85D SEQ ID NO: 2: DNA sequence encoding the sense strand of shRNA targeting the p53 gene SEQ ID NO: 3: DNA sequence encoding the antisense strand of shRNA targeting the p53 gene SEQ ID NO: 4: DNA sequence encoding the sense strand of shRNA targeting the Med gene SEQ ID NO: 5: DNA sequence encoding the antisense strand of shRNA targeting the Med gene SEQ ID NO: 6: DNA sequence encoding shRNA hairpin loop
Claims
1. A combination drug of trametinib and at least one kinase inhibitor selected from the group consisting of AD80, adavosertib, alisertib, BI-831266, and Y-27632 for the treatment of pancreatic cancer.
2. The combination pharmaceutical described in claim 1, wherein at least one kinase inhibitor is selected from the group consisting of AD80, adavosertib, alisertib and BI-831266.
3. The combination pharmaceutical described in claim 1, wherein at least one kinase inhibitor is selected from the group consisting of AD80, alisertib and BI-831266.
4. The combination pharmaceutical of claim 1, wherein at least one kinase inhibitor is BI-831266.
5. A therapeutic agent for pancreatic cancer, comprising at least one kinase inhibitor selected from the group consisting of AD80, adavosertib, alisertib, BI-831266 and Y-27632, for use in the treatment of pancreatic cancer, wherein the treatment includes administration of trametinib.
6. The therapeutic agent described in claim 5, wherein at least one kinase inhibitor is selected from the group consisting of AD80, adavosertib, alisertib and BI-831266.
7. The therapeutic agent described in claim 5, wherein at least one kinase inhibitor is selected from the group consisting of AD80, alisertib, and BI-831266.
8. The therapeutic agent described in claim 5, wherein at least one kinase inhibitor is BI-831266.
9. A therapeutic agent for pancreatic cancer containing trametinib for use in the treatment of pancreatic cancer, wherein the treatment comprises the administration of at least one kinase inhibitor selected from the group consisting of AD80, adavosertib, alisertib, BI-831266 and Y-27632.
10. The therapeutic agent described in claim 9, wherein at least one kinase inhibitor is selected from the group consisting of AD80, adavosertib, alisertib and BI-831266.
11. The therapeutic agent described in claim 9, wherein at least one kinase inhibitor is selected from the group consisting of AD80, alisertib, and BI-831266.
12. The therapeutic agent described in claim 9, wherein at least one kinase inhibitor is BI-831266.
Citation Information
Patent Citations
Substituted pyrazolo[3,4-D]pyrimidines and their uses
JP2014525464A
Combination of an Aurora kinase inhibitor and an anti-CD30 antibody
JP2016539156A
Agent for inhibiting invasive metastasis of pancreatic cancer cells
JP2019206516A
Kinase inhibitor compounds, compositions, and methods for treating cancer
JP2019528279A
Multispecific binding proteins that bind BCMA, NKG2D, and CD16 and methods of use
JP2021533169A