Recombinant strains producing L-amino acids, methods for their construction and use

Abstract

Using Corynebacterium glutamicum YP97158 as the starting bacterium, mutant genes obtained by introducing site-specific mutations and / or enhancing expression in the NCgl1089 gene coding region, NCgl0761 gene coding region, and / or ptsS gene coding region, and recombinant strains containing these genes have high L-amino acid production ability, significantly improve L-amino acid production, and are highly stable.When used as an L-amino acid producing strain, these strains reduce production costs.

Description

[Technical Field]

[0001] This application claims priority from an earlier application bearing patent application number 2020107908681 filed with the State Intellectual Property Office of China on August 7, 2020, an earlier application bearing patent application number 2020111050353 filed with the State Intellectual Property Office of China on October 15, 2020, and an earlier application bearing patent application number 2020110930801 filed with the State Intellectual Property Office of China on October 13, 2020, the entire text of which is incorporated herein by reference.

[0002] The present invention relates to the technical fields of genetic engineering and microorganisms, and more particularly to a strain of the genus Corynebacterium with enhanced L-amino acid productivity, its construction method and use. [Background technology]

[0003] L-amino acids are industrially produced by fermentation using microorganisms such as bacteria capable of producing L-amino acids. Examples of such microorganisms that can be used include strains isolated from nature and mutant strains thereof.

[0004] Improvements in the production of L-amino acids by fermentation may relate to fermentation techniques, such as agitation and oxygen supply, the composition of the nutrient medium, such as sugar concentration during fermentation, processing of the fermented broth into a suitable form, such as drying and granulation of the fermented broth or ion exchange chromatography, or the inherent performance and properties of the relevant microorganisms themselves. Methods for improving the performance and properties of these microorganisms include mutagenesis, selection, and screening of mutants. The resulting strains are resistant to antimetabolites or auxotrophic for regulatory important metabolites and produce L-amino acids. Currently, there is also a need for the development of high-yield, more economical methods for producing L-amino acids. Summary of the Invention [Problem to be solved by the invention]

[0005] The present invention provides recombinant strains that produce L-amino acids, methods for their recombinant construction, and their use in the fermentative production of amino acids.

[0006] In the present invention, Corynebacterium glutamicum YP97158 is used as the starting bacterium, and mutant genes obtained by introducing site-specific mutations and / or improved expression into the NCgl1089 gene coding region, and / or the NCgl0761 gene coding region, and / or the ptsS gene coding region, and recombinant strains containing the genes have high L-amino acid production ability, significantly improve the L-amino acid production amount, have excellent strain stability, and reduce production costs as L-amino acid producing strains. [Means for solving the problem]

[0007] Therefore, the present invention provides the following technical solutions:

[0008] The present invention provides an L-amino acid-producing microorganism belonging to the genus Corynebacterium, which has improved expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO: 3, and / or SEQ ID NO: 35, and / or SEQ ID NO: 63. According to the present invention, the improved expression means enhanced expression of the polynucleotide, or a point mutation in the polynucleotide encoding the amino acid sequence, or a point mutation in the polynucleotide encoding the amino acid sequence with enhanced expression.

[0009] According to a first aspect of the present invention, The amino acid sequence of SEQ ID NO:3 is the protein encoded by the gene NCgl1089.

[0010] The polynucleotide may encode an amino acid sequence that is at least about 90%, at least about 92%, at least about 95%, at least about 97%, at least about 98%, or at least about 99% identical to the amino acid sequence of SEQ ID NO:3.

[0011] In one embodiment of the invention, the polynucleotide may comprise the nucleotide sequence of SEQ ID NO:1.

[0012] In one embodiment of the present invention, the polynucleotide encoding the amino acid sequence of SEQ ID NO:3 has a point mutation such that glutamic acid at position 170 of the amino acid sequence of SEQ ID NO:3 is replaced with a different amino acid.

[0013] According to the present invention, preferably glutamic acid at position 170 is substituted with lysine.

[0014] According to the present invention, the amino acid sequence of SEQ ID NO:3 in which glutamic acid (E) at position 170 is substituted with lysine (K) is shown in SEQ ID NO:4.

[0015] In one embodiment of the present invention, the polynucleotide sequence having a point mutation is a mutation at base 508 of the polynucleotide sequence shown in SEQ ID NO:1.

[0016] According to the present invention, the mutation comprises a mutation from guanine (G) to adenine (A) at base 508 of the polynucleotide sequence shown in SEQ ID NO:1.

[0017] In one embodiment of the invention, the polynucleotide sequence having a point mutation comprises the polynucleotide sequence shown in SEQ ID NO:2.

[0018] According to the present invention, the expression control sequence of the polynucleotide of the present invention may be modified. The expression control sequence controls the expression of the polynucleotide operably linked thereto. The control sequence may be, for example, a promoter, terminator, enhancer, silencer, etc.

[0019] In one embodiment of the present invention, the promoter is a promoter of a polynucleotide encoding the amino acid sequence of SEQ ID NO:3 (NCgl1089 gene).

[0020] The present invention also provides polynucleotide sequences, amino acid sequences encoded by the polynucleotide sequences, recombinant vectors containing the polynucleotide sequences, and recombinant strains containing the polynucleotide sequences.

[0021] According to the present invention, the polynucleotide sequence includes a polynucleotide encoding the amino acid sequence shown in SEQ ID NO:3, in which glutamic acid at position 170 has been replaced with a different amino acid.

[0022] According to the present invention, preferably glutamic acid at position 170 is substituted with lysine.

[0023] According to the present invention, the amino acid sequence of SEQ ID NO:3 in which glutamic acid (E) at position 170 is substituted with lysine (K) is shown in SEQ ID NO:4.

[0024] According to the present invention, preferably, the polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:3 comprises the polynucleotide sequence shown in SEQ ID NO:1.

[0025] In one embodiment of the present invention, the polynucleotide sequence is a mutation at base 508 of the polynucleotide sequence shown in SEQ ID NO:1.

[0026] According to the present invention, the mutation comprises a mutation from guanine (G) to adenine (A) at base 508 of the polynucleotide sequence shown in SEQ ID NO:1.

[0027] In one embodiment of the invention, the polynucleotide sequence comprises the polynucleotide sequence shown in SEQ ID NO:2.

[0028] According to the present invention, the amino acid sequence comprises the amino acid sequence shown in SEQ ID NO:4.

[0029] According to the present invention, the recombinant vector is constructed by introducing the polynucleotide sequence into a plasmid.

[0030] In one embodiment of the invention, the plasmid is the pK18mobsacB plasmid.

[0031] In another embodiment of the invention, the plasmid is the pXMJ19 plasmid.

[0032] Specifically, a recombinant vector may be constructed from the polynucleotide sequence and the plasmid using the NEBuider recombination system.

[0033] According to the present invention, said recombinant strain contains said polynucleotide sequence.

[0034] In one embodiment of the present invention, the starting strain of the recombinant strain is YP97158.

[0035] The present invention also provides methods for constructing recombinant Corynebacterium strains.

[0036] According to the present invention, the construction method comprises: The method includes modifying the polynucleotide sequence of wild-type NCgl1089 shown in SEQ ID NO:1 in a host strain to mutate the 508th base thereof, thereby obtaining a recombinant Corynebacterium strain containing a mutated NCgl1089-encoding gene.

[0037] According to the construction method of the present invention, the modification comprises at least one of the following methods: mutagenesis, PCR site-directed mutagenesis, and / or homologous recombination.

[0038] According to the construction method of the present invention, the mutation means that the 508th base in SEQ ID NO:1 is mutated from guanine (G) to adenine (A). Specifically, the polynucleotide sequence containing the mutated NCgl1089-encoding gene is shown in SEQ ID NO:2.

[0039] Furthermore, the construction method includes: (1) modifying the nucleotide sequence of the wild-type NCgl1089 gene shown in SEQ ID NO: 1 to mutate the 508th base thereof to obtain a mutated NCgl1089 gene polynucleotide sequence; (2) constructing a recombinant vector from the mutated polynucleotide sequence and the plasmid using the NEBuider recombination system; and (3) introducing the recombinant vector into a host strain to obtain a recombinant Corynebacterium strain containing the mutant NCgl1089-encoding gene.

[0040] According to the construction method of the present invention, step (1) is the construction of a point-mutated NCgl1089 gene. Based on the genome sequence of Corynebacterium glutamicum, two pairs of primers, P1 and P2 and P3 and P4, which amplify the NCgl1089 gene fragment, are synthesized, and point mutations are introduced into the wild-type NCgl1089 gene SEQ ID NO: 1 by PCR site-directed mutagenesis to obtain the point-mutated NCgl1089 gene nucleotide sequence SEQ ID NO: 2, which is then used to construct the NCgl1089 gene. G508A This includes:

[0041] In one embodiment of the present invention, the Corynebacterium glutamicum genome may be derived from the ATCC13032 strain, and its genome sequence may be obtained from the NCBI website.

[0042] In one embodiment of the present invention, in step (1), the primers are as follows: P1:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCGCGTGGGATCCACGCCAG 3'(SEQ ID NO:5) P2:5'CAATGAGGGCTTTCGCCACCTCGCGGGC 3'(SEQ ID NO:6) P3:5'GCCCGCGAGGTGGCGAAAGCCCTCATTG 3'(SEQ ID NO:7) P4:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCATGCGTTGGCGATCTTC 3'(SEQ ID NO:8).

[0043] In one embodiment of the present invention, the PCR amplification is carried out with denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, and extension at 72° C. for 40 s (30 cycles).

[0044] In one embodiment of the present invention, the overlap PCR amplification is carried out with denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, and extension at 72° C. for 90 s (30 cycles).

[0045] According to the construction method of the present invention, the step (2) is the construction of a recombinant plasmid, and the NCgl1089 after separation and purification is G508A The pK18mobsacB and pK18mobsacB plasmids were assembled using the NEBuider recombination system to create the recombinant plasmid pK18-NCgl1089. G508A This includes obtaining

[0046] According to the construction method of the present invention, the step (3) is the construction of a recombinant strain, and the recombinant plasmid pK18-NCgl1089 G508A into a host strain to obtain a recombinant strain.

[0047] In one embodiment of the present invention, the transformation in step (3) is electrotransformation.

[0048] In one embodiment of the invention, the host strain is YP97158.

[0049] In one embodiment of the invention, said recombination is achieved by homologous recombination.

[0050] The fourth aspect of the invention also provides a method for constructing a recombinant Corynebacterium strain.

[0051] According to the present invention, the construction method comprises: Upstream and downstream homology arm fragments of the NCgl1089 gene, the NCgl1089 gene coding region, and NCgl1089 G508A The gene coding region and promoter region sequence of the gene are amplified and inserted into the genome of the host strain by homologous recombination. G508A By introducing a gene, NCgl1089 or NCgl1089 G508A This includes overexpressing the gene.

[0052] In one embodiment of the present invention, the primers for amplifying the upstream homology arm fragment are as follows: P7:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAATGCGTTCTGGACTGAGG 3'(SEQ ID NO:11) P8:5'CATGAGTATA AAATCACTGT CGTGCACCGAG AACAGATG 3'(SEQ ID NO:12).

[0053] In one embodiment of the present invention, the primers for amplifying the downstream homology arm fragment are as follows: P13:5'CGTGCCCACAGAAGAGGTGAGAT GGCGCAATTA AATCAAG 3'(SEQ ID NO:17) P14:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCTATGACACCTTCAACGGA TC 3'(SEQ ID NO:18).

[0054] In one embodiment of the present invention, the primers for amplifying the promoter region sequence of the gene are as follows: P9:5'CATCTGTTCT CGGTGCACGACAGTGATT TTATACTCAT G 3'(SEQ ID NO:13) P10:5'GACGTTTCCA GATGCTCATCACCGAACCC GCTGCACTGT 3'(SEQ ID NO:14).

[0055] In one embodiment of the present invention, the NCgl1089 gene coding region or NCgl1089 G508A The primers for amplifying the gene coding region are as follows: P11:5'ACAGTGCAGC GGGTTCGGTGATGAGCATCT GGAAACGTC 3'(SEQ ID NO:15) P12:5'CTTGATTTAATTGCGCCATCTCACCTCTTC TGTGGGCACG 3'(SEQ ID NO:16).

[0056] In one embodiment of the present invention, the NCgl1089 gene promoter fragment obtained by amplification using the aforementioned P9 / P12 as primers and NCgl1089 or NCgl1089 G508A was used as a template to amplify NCgl1089 or NCgl1089 G508A Get the fragment.

[0057] In one embodiment of the present invention, the above-mentioned P7 / P14 is used as a primer to amplify an upstream homologous fragment, a downstream homologous fragment, and NCgl1089 or NCgl1089, which comprises its own promoter. G508A These three fragments are mixed and amplified as a template to obtain integrated homologous arm fragments.

[0058] In one embodiment of the present invention, the PCR system used contains 5 μL of 10× Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+The total volume was 50 μL, with 4 μL of 25 mM ATP, 2 μL of each primer (10 pM), and 0.25 μL of ExTaq (5 U / μL). PCR amplification was performed with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 90 s, followed by over-extension at 72°C for 10 min.

[0059] In one embodiment of the present invention, the NEBuider recombination system is used to assemble the shuttle plasmid PK18mobsacB and the integration homology arm fragment to obtain an integration plasmid.

[0060] In one embodiment of the present invention, the integrating plasmid is transfected into a host strain and NCgl1089 or NCgl1089 is integrated into the genome of the host strain by homologous recombination. G508A Introducing a gene.

[0061] In one embodiment of the invention, the host strain is YP97158.

[0062] In one embodiment of the invention, the host strain is a strain comprising the polynucleotide sequence shown in SEQ ID NO:2.

[0063] The present invention also provides methods for constructing recombinant Corynebacterium strains.

[0064] According to the present invention, the construction method comprises: NCgl1089 or NCgl1089 G508A The gene coding region and promoter region sequences are amplified to construct an overexpression plasmid vector, and the vector is introduced into a host strain to express NCgl1089 or NCgl1089 in the strain. G508A This includes overexpressing the gene.

[0065] In one embodiment of the present invention, the primers for amplifying the NCgl1089 promoter fragment are as follows: P19:5'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGACAGTGATTTTATACTCATG 3'(SEQ ID NO:23) P20:5'GACGTTTCCA GATGCTCATCACCGAACCC GCTGCACTGT 3'(SEQ ID NO:24).

[0066] In one embodiment of the present invention, the obtained NCgl1089 or NCgl1089 G508A The primers for amplifying the gene fragment are as follows: P21:5'ACAGTGCAGC GGGTTCGGTGATGAGCATCT GGAAACGTC 3'(SEQ ID NO:25) P22:5'ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACTCACCTCTTCTGTGGGCACG 3'(SEQ ID NO:26).

[0067] In one embodiment of the present invention, the NCgl1089 gene promoter fragment and NCgl1089 or NCgl1089 obtained by amplification using the aforementioned P19 / P22 as primers are G508A Using this as a template, overlapping PCR amplification was performed to obtain NCgl1089 or NCgl1089 G508A Get the fragment.

[0068] In one embodiment of the present invention, the PCR system contains 5 μL of 10× Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ The PCR mixture consisted of 4 μL of 25 mM ATP, 2 μL of each primer (10 pM), and 0.25 μL of ExTaq (5 U / μL) in a total volume of 50 μL. The PCR amplification was performed with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 90 s, followed by over-extension at 72°C for 10 min.

[0069] In one embodiment of the present invention, the NEBuider recombination system was used to synthesize the shuttle plasmid pXMJ19 and NCgl1089 or NCgl1089 with its own promoter. G508A The fragments are assembled to obtain the overexpression plasmid.

[0070] In one embodiment of the invention, the host strain is YP97158.

[0071] In one embodiment of the invention, the host strain is a strain having the polynucleotide sequence shown in SEQ ID NO:2.

[0072] The recombinant strain obtained in the present invention may be used alone for the fermentative production of L-lysine, or may be mixed with other bacteria that produce L-lysine and fermented to produce L-lysine.

[0073] The present invention also provides a method for producing L-lysine, which method comprises culturing a microorganism and obtaining L-lysine from the culture.

[0074] In a second aspect of the present invention, The present invention provides an L-amino acid-producing bacterium that has improved expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO: 35. The present invention also provides a method for producing an L-amino acid using the microorganism.

[0075] The amino acid sequence of SEQ ID NO:35 is the protein encoded by the gene NCgl0761.

[0076] The polynucleotide can encode an amino acid sequence having at least about 90%, at least about 92%, at least about 95%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO:35.

[0077] The bacterium has an enhanced ability to produce L-amino acids compared to an unmodified strain.

[0078] In one embodiment of the invention, the polynucleotide may comprise the nucleotide sequence of SEQ ID NO:33.

[0079] In one embodiment of the present invention, the point mutation in the polynucleotide encoding the amino acid sequence of SEQ ID NO:35 replaces the leucine at position 31 of the amino acid sequence of SEQ ID NO:35 with a different amino acid.

[0080] According to the present invention, preferably leucine at position 31 is substituted with arginine.

[0081] According to the present invention, the amino acid sequence of SEQ ID NO:35 in which leucine at position 31 is replaced with arginine is shown in SEQ ID NO:36.

[0082] In one embodiment of the present invention, the polynucleotide sequence having a point mutation is a mutation at base 92 of the polynucleotide sequence shown in SEQ ID NO:33.

[0083] According to the present invention, the mutation comprises a mutation from thymine (T) to guanine (G) at base 92 of the polynucleotide sequence shown in SEQ ID NO:33.

[0084] In one embodiment of the invention, the polynucleotide sequence having a point mutation comprises the polynucleotide sequence shown in SEQ ID NO:34.

[0085] According to the present invention, the expression control sequences of the polynucleotide may be modified. Expression control sequences control the expression of a polynucleotide operably linked thereto and may include, for example, promoters, terminators, enhancers, silencers, etc. The polynucleotide may have an altered start codon.

[0086] In one embodiment of the present invention, the promoter is a promoter of a polynucleotide encoding the amino acid sequence of SEQ ID NO:35 (NCgl0761 gene).

[0087] In one embodiment of the present invention, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum ATCC13869.

[0088] The present invention also provides polynucleotide sequences, amino acid sequences encoded by the polynucleotide sequences, recombinant vectors containing the polynucleotide sequences, and recombinant strains containing the polynucleotide sequences.

[0089] According to the present invention, the polynucleotide sequence includes a polynucleotide that encodes a polypeptide containing the amino acid sequence shown in SEQ ID NO:35, in which the leucine at position 31 is replaced with a different amino acid.

[0090] According to the present invention, preferably leucine at position 31 is substituted with arginine.

[0091] According to the present invention, the amino acid sequence of SEQ ID NO:35 in which leucine at position 31 is replaced with arginine is shown in SEQ ID NO:36.

[0092] According to the present invention, preferably, the polynucleotide sequence encoding the polypeptide containing the amino acid sequence shown in SEQ ID NO:35 contains the polynucleotide sequence shown in SEQ ID NO:33.

[0093] In one embodiment of the present invention, the polynucleotide sequence is a polynucleotide sequence represented by SEQ ID NO:33, with a mutation at base 92.

[0094] According to the present invention, the mutation comprises a mutation from thymine (T) to guanine (G) at base 92 of the polynucleotide sequence shown in SEQ ID NO:33.

[0095] In one embodiment of the invention, the polynucleotide sequence comprises the polynucleotide sequence shown in SEQ ID NO:34.

[0096] According to the present invention, the amino acid sequence comprises the amino acid sequence shown in SEQ ID NO:36.

[0097] According to the present invention, the recombinant vector is constructed by introducing the polynucleotide sequence into a plasmid.

[0098] In one embodiment of the invention, the plasmid is the pK18mobsacB plasmid.

[0099] In another embodiment of the invention, the plasmid is the pXMJ19 plasmid.

[0100] Specifically, the polynucleotide sequence and the plasmid may be constructed into a recombinant vector using the NEBuider recombination system.

[0101] According to the present invention, said recombinant strain contains said polynucleotide sequence.

[0102] In one embodiment of the present invention, the starting strain of the recombinant strain is YP97158.

[0103] In one embodiment of the present invention, the starting strain of the recombinant strain is ATCC 13869.

[0104] The present invention also provides methods for constructing recombinant strains that produce L-amino acids.

[0105] According to the present invention, the construction method comprises: The method includes modifying the polynucleotide sequence of wild-type NCgl0761 shown in SEQ ID NO:33 in a host strain to mutate its 92nd base, thereby obtaining a recombinant strain containing a mutated NCgl0761-encoding gene.

[0106] According to the construction method of the present invention, the modification comprises at least one of the following methods: mutagenesis, PCR site-directed mutagenesis, and / or homologous recombination.

[0107] According to the construction method of the present invention, the mutation means that the 92nd base of SEQ ID NO:33 is mutated from thymine (T) to guanine (G). Specifically, the polynucleotide sequence containing the mutated NCgl0761-encoding gene is shown in SEQ ID NO:34.

[0108] Furthermore, the construction method includes: (1) modifying the nucleotide sequence of the wild-type NCgl0761 gene represented by SEQ ID NO: 33 to mutate the 92nd base thereof to obtain a mutated NCgl0761 gene polynucleotide sequence; (2) ligating the mutated polynucleotide sequence into a plasmid to construct a recombinant vector; and (3) introducing the recombinant vector into a host strain to obtain the recombinant strain containing the mutated NCgl0761-encoding gene.

[0109] According to the construction method of the present invention, step (1) is the construction of a point-mutated NCgl0761 gene. Based on the genome sequence of the unmodified strain, two pairs of primers, P1 and P2 and P3 and P4, which amplify the NCgl0761 gene fragment, are synthesized, and point mutations are introduced into the wild-type NCgl0761 gene SEQ ID NO: 33 by PCR site-directed mutagenesis to obtain the point-mutated NCgl0761 gene nucleotide sequence SEQ ID NO: 34, which is then used to construct the NCgl0761 gene. L31R This includes:

[0110] In one embodiment of the present invention, the unmodified strain genome may be derived from strain ATCC13032 or ATCC13869, the genome sequence of which may be obtained from the NCBI website.

[0111] In one embodiment of the present invention, in step (1), the primers are as follows: P1:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG CTTGCAGCTAACCTATACCCC3'(SEQ ID NO:37) P2:5'GCTTTTCAATATAATCACGTCCATCTGAGCCATC3'(SEQ ID NO:38) P3:5'GATGGCTCAGATGGACGTGATTATATTGAAAAGC3'(SEQ ID NO:39) P4:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC CTCCCAAATAATTGCCGC3'(SEQ ID NO:40).

[0112] In one embodiment of the present invention, the PCR amplification is performed as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 40 s (30 cycles), and over-extension at 72°C for 10 min.

[0113] In one embodiment of the present invention, the overlap PCR amplification is performed as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 60 s (30 cycles), and over-extension at 72°C for 10 min.

[0114] According to the construction method of the present invention, the step (2) is the construction of a recombinant plasmid, and the NCgl0761 L31R and pK18mobsacB plasmids were assembled using the NEBuider recombination system to obtain recombinant plasmids.

[0115] According to the construction method of the present invention, the step (3) is the construction of a recombinant strain, which includes transforming the recombinant plasmid into a host strain to obtain a recombinant strain.

[0116] In one embodiment of the present invention, the transformation in step (3) is electrotransformation.

[0117] In one embodiment of the invention, the host strain is YP97158.

[0118] In one embodiment of the invention, the host strain is ATCC 13869.

[0119] In one embodiment of the invention, said recombination is achieved by homologous recombination.

[0120] The fourth aspect of the present invention also provides a method for constructing a recombinant strain that produces an L-amino acid.

[0121] According to the present invention, the construction method comprises: The upstream and downstream homologous arm fragments of the NCgl0761 gene, the coding region of the NCgl0761 gene and its promoter region sequence, or the NCgl0761 L31R The gene coding region and its promoter region sequence were amplified and inserted into the genome of the host strain by homologous recombination. L31R By introducing the gene, NCgl0761 and NCgl0761 L31R This includes overexpressing the gene.

[0122] In one embodiment of the present invention, the primers for amplifying the upstream homology arm fragment are as follows: P7:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG AATGCGTTCTGGACTGAGG 3'(SEQ ID NO:43) P8:5'CCATCCATACCCCACTACATGTGCACCGAGAACAGATG 3'(SEQ ID NO:44).

[0123] In one embodiment of the present invention, the primers for amplifying the downstream homology arm fragment are as follows: P11:5'CTGAGCCGGAAACCTCACCC AGAATCAGATGGCGCAATTAAATC 3'(SEQ ID NO:47) P12:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GCTATGACACCTTCAACGGATC 3'(SEQ ID NO:48).

[0124] In one embodiment of the present invention, the gene coding region and its promoter region sequence are amplified as follows: P9:5'CATCTGTTCTCGGTGCACATGTAGTGGGGTATGGATGG 3'(SEQ ID NO:45) P10:5'GATTTAATTGCGCCATCTGATTCTGGGTGAGGTTTCCGGCTCAG3' (SEQ ID NO:46).

[0125] In one embodiment of the present invention, the PCR system used contains 5 μL of 10× Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ The total volume was 50 μL, with 4 μL of 25 mM ATP, 2 μL of each primer (10 pM), and 0.25 μL of ExTaq (5 U / μL). PCR amplification was performed with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 60 s, followed by over-extension at 72°C for 10 min.

[0126] In one embodiment of the present invention, the shuttle plasmid PK18mobsacB, upper and lower homology arm fragments, gene coding region and promoter region fragment are assembled using the NEBuider recombination system to obtain an integration plasmid.

[0127] In one embodiment of the present invention, the integrating plasmid is transfected into a host strain and NCgl0761 or NCgl0761 is inserted into the genome of the host strain by homologous recombination. L31R Introducing a gene.

[0128] In one embodiment of the invention, the host strain is YP97158.

[0129] In one embodiment of the invention, the host strain is ATCC 13869.

[0130] In one embodiment of the invention, the host strain is a strain comprising the polynucleotide sequence shown in SEQ ID NO:2.

[0131] The present invention also provides methods for constructing recombinant strains that produce L-amino acids.

[0132] According to the present invention, the construction method comprises: NCgl0761 gene coding region and promoter region sequence, or NCgl0761 L31R The gene coding region and promoter region sequences were amplified to construct an overexpression plasmid vector, and the vector was introduced into a host strain to express NCgl0761 and NCgl0761 in the strain. L31R This includes overexpressing the gene.

[0133] In one embodiment of the present invention, the primers for amplifying the gene coding region and its promoter region sequence are as follows: P17:5' GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCC ATGTAGTGGGGTATGGATGG 3'(SEQ ID NO:53) P18:5' ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC GTGAGGTTTC CGGCTCAG 3'(SEQ ID NO:54).

[0134] In one embodiment of the present invention, the PCR system contains 5 μL of 10×Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+The PCR mixture consisted of 4 μL of 25 mM ATP, 2 μL of each primer (10 pM), and 0.25 μL of ExTaq (5 U / μL) in a total volume of 50 μL. The PCR amplification was performed with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 60 s, followed by over-extension at 72°C for 10 min.

[0135] In one embodiment of the present invention, the NEBuider recombination system was used to transfect the shuttle plasmid pXMJ19 with NCgl0761 or NCgl0761 with its own promoter. L31R The fragments are assembled to obtain the overexpression plasmid.

[0136] In one embodiment of the invention, the host strain is YP97158.

[0137] In one embodiment of the invention, the host strain is ATCC 13869.

[0138] In one embodiment of the invention, the host strain is a strain comprising the polynucleotide sequence shown in SEQ ID NO:34.

[0139] The recombinant strain obtained in the present invention may be used alone for the fermentative production of L-amino acids, or may be mixed with other bacteria that produce L-amino acids and fermented to produce L-amino acids.

[0140] The present invention also provides a method for producing an L-amino acid, which method comprises culturing the bacterium and obtaining the L-amino acid from the culture.

[0141] In a third aspect of the present invention, The present invention provides an L-amino acid-producing bacterium having improved expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO: 63. According to the present invention, the improved expression can be due to enhanced expression of the polynucleotide, or the polynucleotide encoding the amino acid sequence of SEQ ID NO: 63 having a point mutation, or the polynucleotide encoding the amino acid sequence of SEQ ID NO: 63 having a point mutation and enhanced expression.

[0142] The amino acid sequence of SEQ ID NO:63 is the protein encoded by the gene ptsS.

[0143] The bacterium has an enhanced ability to produce L-amino acids.

[0144] Bacteria capable of producing an L-amino acid are bacteria that can accumulate the target L-amino acid in a medium at an amount of preferably 0.5 g / L or more, more preferably 1.0 g / L or more.

[0145] The polynucleotide can encode an amino acid sequence having at least about 90%, at least about 92%, at least about 95%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO:3.

[0146] In some specific embodiments of the present invention, the vector used is the pK18mobsacB plasmid, the pXMJ19 plasmid.

[0147] In one particular embodiment of the invention, said polynucleotide encoding the amino acid sequence of SEQ ID NO:63 may comprise the nucleotide sequence of SEQ ID NO:61.

[0148] In one embodiment of the present invention, the improved expression means that the polynucleotide encoding the amino acid sequence of SEQ ID NO:63 has a point mutation, whereby methionine at position 162 of the amino acid sequence of SEQ ID NO:63 is replaced with a different amino acid.

[0149] According to the present invention, preferably methionine at position 162 is replaced with threonine.

[0150] According to the present invention, the amino acid sequence of SEQ ID NO:63 in which methionine at position 162 is replaced with threonine is shown in SEQ ID NO:64.

[0151] In one embodiment of the present invention, the polynucleotide sequence having a point mutation is a mutation at base 485 of the polynucleotide sequence shown in SEQ ID NO:61.

[0152] According to the present invention, the mutation comprises a mutation from thymine (T) to cytosine (C) at base 485 of the polynucleotide sequence shown in SEQ ID NO:61.

[0153] In one embodiment of the invention, the polynucleotide sequence having a point mutation comprises the polynucleotide sequence shown in SEQ ID NO:62.

[0154] According to the present invention, the polynucleotide sequence is operably linked to a regulatory sequence.

[0155] In one particular embodiment of the invention, the promoter is the promoter of the polynucleotide encoding the amino acid sequence of SEQ ID NO:63 (ptsS gene).

[0156] In one embodiment of the present invention, the microorganism belonging to the genus Corynebacterium is Corynebacterium glutamicum ATCC 13869. According to the present invention, the bacterium may have other improvements related to improved L-amino acid production.

[0157] The present invention also provides polynucleotide sequences, amino acid sequences encoded by the polynucleotide sequences, recombinant vectors containing the polynucleotide sequences, and recombinant strains containing the polynucleotide sequences.

[0158] According to the present invention, the polynucleotide sequence has improved expression, and the improvement comprises a point mutation in a polynucleotide encoding a polypeptide containing the amino acid sequence set forth in SEQ ID NO:63, whereby methionine at position 162 of the amino acid sequence is replaced with a different amino acid.

[0159] According to the present invention, preferably methionine at position 162 is replaced with threonine.

[0160] According to the present invention, the amino acid sequence of SEQ ID NO:63 in which methionine at position 162 is replaced with threonine is shown in SEQ ID NO:64.

[0161] According to the present invention, the polynucleotide sequence encoding the polypeptide containing the amino acid sequence shown in SEQ ID NO:63 contains the polynucleotide sequence shown in SEQ ID NO:61.

[0162] In one embodiment of the present invention, the mutated polynucleotide sequence according to the present invention is a polynucleotide sequence represented by SEQ ID NO:61, in which the 485th base has been mutated.

[0163] According to the present invention, the mutation comprises a mutation from thymine (T) to cytosine (C) at base 485 of the polynucleotide sequence shown in SEQ ID NO:61.

[0164] In one embodiment of the invention, the mutated polynucleotide sequence comprises the polynucleotide sequence shown in SEQ ID NO:62.

[0165] According to the present invention, the amino acid sequence after the substitution comprises the amino acid sequence shown in SEQ ID NO:64.

[0166] According to the present invention, the recombinant vector is constructed by introducing the polynucleotide sequence into a plasmid.

[0167] In one embodiment of the invention, the plasmid is the pK18mobsacB plasmid.

[0168] In another embodiment of the invention, the plasmid is the pXMJ19 plasmid.

[0169] Specifically, a recombinant vector may be constructed from the polynucleotide sequence and the plasmid using the NEBuider recombination system.

[0170] According to the present invention, said recombinant strain contains said polynucleotide sequence.

[0171] In one embodiment of the present invention, the starting strain of the recombinant strain is YP97158.

[0172] In one embodiment of the present invention, the starting strain of the recombinant strain is ATCC 13869.

[0173] The present invention also provides methods for constructing recombinant strains that produce L-amino acids.

[0174] According to the present invention, the construction method comprises: The method includes modifying the polynucleotide sequence of wild-type ptsS, represented by SEQ ID NO:61, in a host strain to mutate its 485th base, thereby obtaining a recombinant strain containing a mutated ptsS-encoding gene.

[0175] According to the construction method of the present invention, the modification comprises at least one of the following methods: mutagenesis, PCR site-directed mutagenesis, and / or homologous recombination.

[0176] According to the construction method of the present invention, the mutation means that the 485th base of SEQ ID NO:61 is mutated from thymine (T) to cytosine (C). Specifically, the polynucleotide sequence containing the mutated ptsS-encoding gene is shown in SEQ ID NO:62.

[0177] Furthermore, the construction method includes: (1) modifying the nucleotide sequence of the wild-type ptsS gene represented by SEQ ID NO: 61 to mutate the 485th base thereof to obtain a mutated ptsS gene polynucleotide sequence; (2) ligating the mutated polynucleotide sequence with a plasmid to construct a recombinant vector; and (3) introducing the recombinant vector into a host strain to obtain the recombinant strain containing the mutated ptsS coding gene.

[0178] According to the construction method of the present invention, step (1) is the construction of a point-mutated ptsS gene, which is performed by synthesizing two pairs of primers, P1 and P2 and P3 and P4, for amplifying a ptsS gene fragment based on the genome sequence of an unmodified strain, and introducing a point mutation into the wild-type ptsS gene SEQ ID NO: 61 by PCR site-directed mutagenesis to obtain the nucleotide sequence of the point-mutated ptsS gene SEQ ID NO: 62, which is then used to construct the ptsS gene. T485C This includes:

[0179] In one embodiment of the present invention, the unmodified strain genome may be derived from the ATCC13032 strain, the genome sequence of which may be obtained from the NCBI website.

[0180] In one embodiment of the present invention, in step (1), the primers are as follows: P1:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GACACCTGAAG CACCTGC 3'(SEQ ID NO:65) P2:5'GAGATGATCAACCTCACGGCATCTGCGC 3'(SEQ ID NO:66) P3:5'GCGCAGATGCCGTGAGGTTGATCATCTC 3'(SEQ ID NO:67) P4:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GATGGACAGGTTTCATTCGC3'(SEQ ID NO:68).

[0181] In one embodiment of the present invention, the PCR amplification is performed as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 40 s (30 cycles), and over-extension at 72°C for 10 min.

[0182] In one embodiment of the present invention, the overlap PCR amplification is performed as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 90 s (30 cycles), and over-extension at 72°C for 10 min.

[0183] According to the construction method of the present invention, the step (2) is the construction of a recombinant plasmid, and the ptsS M162T and pK18mobsacB plasmids were assembled using the NEBuider recombination system to obtain recombinant plasmids.

[0184] According to the construction method of the present invention, the step (3) is the construction of a recombinant strain, which includes transforming the recombinant plasmid into a host strain to obtain a recombinant strain.

[0185] In one embodiment of the present invention, the transformation in step (3) is electrotransformation.

[0186] In one embodiment of the invention, the host strain is YP97158.

[0187] In one embodiment of the invention, said recombination is achieved by homologous recombination.

[0188] The present invention also provides methods for constructing recombinant strains that produce L-amino acids.

[0189] According to the present invention, the construction method comprises: Upstream and downstream homologous arm fragments of the ptsS gene, the ptsS gene coding region and its promoter region sequence, or PtsS or PtsS M162T The gene coding region and its promoter region sequence are amplified and inserted into the genome of the host strain by homologous recombination. M162T By introducing a gene, PtsS or PtsS M162T This includes overexpressing the gene.

[0190] In one embodiment of the present invention, the primers for amplifying the upstream homology arm fragment are as follows: P7:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG AATGCGTTCTGGACTGAGG 3'(SEQ ID NO:71) P8:5'GTGACTCTACGCATCTTTGACAGTGCACCG AGAACAGATG 3'(SEQ ID NO:72).

[0191] In one embodiment of the present invention, the primers for amplifying the downstream homology arm fragment are as follows: P11:5'CACCACCACGATCCACAGACCCAGAATCAGATGGCGCAATTAAAT CAAG 3'(SEQ ID NO:75) P12:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GCTATGACACCTTCAACGGATC 3'(SEQ ID NO:76).

[0192] In one embodiment of the present invention, the primers for amplifying the gene coding region and its promoter region sequence are as follows: P9:5'CATCTGTTCTCGGTGCACTGTCAAAGATGCGTA GAGTCAC 3'(SEQ ID NO:73) P10:5'CTTGATTTAATTGCGCCATCTGATTCTGGGTCTGTGGATCGTGG TGGTG 3' (SEQ ID NO:74).

[0193] In one embodiment of the present invention, the P7-P12 primers are used to amplify the upstream homologous fragment, the downstream homologous fragment, and the PtsS or PtsS gene containing its own promoter. M162T These three fragments are mixed and amplified as a template to obtain integrated homologous arm fragments.

[0194] In one embodiment of the present invention, the PCR system used contains 5 μL of 10× Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ The total volume was 50 μL, with 4 μL of 25 mM ATP, 2 μL of each primer (10 pM), and 0.25 μL of ExTaq (5 U / μL). PCR amplification was performed with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 60 s, followed by over-extension at 72°C for 10 min.

[0195] In one embodiment of the present invention, the shuttle plasmid PK18mobsacB, upper and lower homology arm fragments, gene coding region and promoter region fragment are assembled using the NEBuider recombination system to obtain an integration plasmid.

[0196] In one embodiment of the present invention, the integrating plasmid is transfected into a host strain and PtsS or PtsS is integrated into the genome of the host strain by homologous recombination. M162T Introducing a gene.

[0197] In one embodiment of the invention, the host strain is YP97158. In one embodiment of the invention, the host strain is a strain comprising the polynucleotide sequence set forth in SEQ ID NO:62.

[0198] The present invention also provides methods for constructing recombinant strains that produce L-amino acids.

[0199] According to the present invention, the construction method comprises: PtsS gene coding region and promoter region sequence, or PtsS M162TThe gene coding region and promoter region sequences are amplified to construct an overexpression plasmid vector, and the vector is introduced into a host strain to express PtsS and PtsS in the strain. M162T The method further comprises the step of overexpressing the gene.

[0200] In one embodiment of the present invention, the primers for amplifying the gene coding region and its promoter region sequence are as follows: P17:5' GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCC TGTCA AAGATG CGTAGAGTCAC 3'(SEQ ID NO:81) P18:5' ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC GTCTGTGGATCGTGGTGGTG3'(SEQ ID NO:82).

[0201] In one embodiment of the present invention, the PCR system contains 5 μL of 10×Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ The PCR mixture consisted of 4 μL of 25 mM ATP, 2 μL of each primer (10 pM), and 0.25 μL of ExTaq (5 U / μL) in a total volume of 50 μL. The PCR amplification was performed with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 60 s, followed by over-extension at 72°C for 10 min.

[0202] In one embodiment of the present invention, the NEBuider recombination system was used to transfect the shuttle plasmid pXMJ19 with PtsS or PtsS with its own promoter. M162T The fragments are assembled to obtain the overexpression plasmid.

[0203] In one embodiment of the invention, the host strain is YP97158.

[0204] In one embodiment of the invention, the host strain is ATCC 13869.

[0205] In one embodiment of the invention, the host strain is a strain comprising the polynucleotide sequence shown in SEQ ID NO:62.

[0206] The recombinant strain obtained in the present invention may be used alone for the fermentative production of L-amino acids, or may be mixed with other bacteria that produce L-amino acids and fermented to produce L-amino acids.

[0207] The present invention also provides a method for producing an L-amino acid, which comprises culturing the bacterium and obtaining the L-amino acid from the culture.

[0208] The present invention will be described in detail below.

[0209] The term "bacterium capable of producing an L-amino acid" refers to a bacterium that has the ability to produce and accumulate a target L-amino acid in a medium and / or bacterial cells to such an extent that the L-amino acid can be collected when the bacterium is cultured in the medium. A bacterium capable of producing an L-amino acid is a bacterium that can accumulate a target L-amino acid in a medium and / or bacterial cells in a larger amount than that obtained with an unmodified strain.

[0210] The term "unmodified strain" refers to a control strain that has not been modified to have a particular characteristic, i.e., examples of unmodified strains include wild-type strains and parental strains.

[0211] The bacterium capable of producing an L-amino acid may be a bacterium that can accumulate the target L-amino acid in a medium at an amount of preferably 0.5 g / L or more, more preferably 1.0 g / L or more.

[0212] Examples of L-amino acids include basic amino acids such as L-lysine, L-ornithine, L-arginine, L-histidine, and L-citrulline; aliphatic amino acids such as L-isoleucine, L-alanine, L-valine, L-leucine, and glycine; hydroxymonoaminocarboxylic acid amino acids such as L-threonine and L-serine; cyclic amino acids such as L-proline; aromatic amino acids such as L-phenylalanine, L-tyrosine, and L-tryptophan; sulfur-containing amino acids such as L-cysteine, L-cystine, and L-methionine; acidic amino acids such as L-glutamic acid and L-aspartic acid; and amino acids having an amide group in the side chain, such as L-glutamine and L-asparagine.

[0213] Specific examples of L-amino acids include L-glutamic acid, L-lysine, L-threonine, L-arginine, L-histidine, L-isoleucine, L-valine, L-leucine, L-phenylalanine, L-tyrosine, L-tryptophan, and L-cysteine.

[0214] More specific examples of L-amino acids include L-glutamic acid, L-lysine, L-threonine, and L-tryptophan. More specific examples of L-amino acids include L-glutamic acid and L-lysine.

[0215] In the present invention, unless otherwise specified, the term "amino acid" refers to an L-amino acid. In the present invention, unless otherwise specified, the term "L-amino acid" refers to an L-amino acid in free form, a salt thereof, or a mixture thereof.

[0216] The term "homology" refers to the percentage identity between two polynucleotide or two polypeptide modules. Sequence homology between one module and another may be measured by methods known in the art. For example, such sequence homology may be measured by the BLAST algorithm.

[0217] In the present invention, enhancing the expression of the polynucleotide means introducing a mutation into the polynucleotide sequence by substituting or mutating an expression regulatory sequence, increasing the copy number of the polynucleotide inserted via a chromosome or introduced via a vector, or a combination thereof.

[0218] According to the present invention, the mutation means that the base / nucleotide at the site has been changed, and the mutation method may be at least one method selected from mutagenesis, PCR site-directed mutagenesis, and / or homologous recombination, etc. In the present invention, PCR site-directed mutagenesis and / or homologous recombination are preferably used.

[0219] The present invention allows for modification of the expression control sequence of a polynucleotide. The expression control sequence controls the expression of a polynucleotide operably linked thereto and may include, for example, a promoter, terminator, enhancer, silencer, etc. The polynucleotide may have an altered start codon. The copy number may be increased by integrating the polynucleotide into a specific site in a chromosome. In this specification, the specific site may include, for example, a transposon site or an intergenic site. Alternatively, the copy number may be increased by incorporating the polynucleotide into an expression vector and introducing the expression vector into a host cell.

[0220] In one embodiment of the present invention, the copy number is increased by integrating the polynucleotide or a polynucleotide with a point mutation into a specific site in the chromosome of the microorganism.

[0221] In one embodiment of the present invention, a polynucleotide having a promoter sequence or a polynucleotide having a promoter sequence and a point mutation is integrated into a specific site in the chromosome of a microorganism to overexpress the nucleic acid sequence.

[0222] In one embodiment of the present invention, the copy number is increased by incorporating the polynucleotide or the polynucleotide having the point mutation into an expression vector and introducing the expression vector into a host cell.

[0223] In one embodiment of the present invention, a polynucleotide having a promoter sequence or a polynucleotide having a promoter sequence and a point mutation is incorporated into an expression vector, and the expression vector is introduced into a host cell, thereby overexpressing the nucleic acid sequence.

[0224] The term "operably linked" refers to a functional linkage between a regulatory sequence and a polynucleotide sequence, whereby the regulatory sequence controls the transcription and / or translation of the polynucleotide sequence. The regulatory sequence may be a strong promoter that can increase the expression level of the polynucleotide. The regulatory sequence may be a promoter derived from a microorganism belonging to the genus Corynebacterium or a promoter derived from another microorganism. For example, the promoter may be a trc promoter, a gap promoter, a tac promoter, a T7 promoter, a lac promoter, a trp promoter, an araBAD promoter, or a cj7 promoter.

[0225] The term "vector" refers to a polynucleotide construct containing a gene regulatory sequence and a gene sequence, which allows expression of a target gene in a suitable host cell. Alternatively, a vector may refer to a polynucleotide construct containing a sequence that can be used for homologous recombination, thereby allowing insertion of a target gene into a specific site in the host's genome, which can then be introduced into the host cell to alter the regulatory sequence of an endogenous gene in the genome of the host cell or to express the target gene. In this regard, the vector used in the present invention may further contain a selectable marker to confirm the introduction of the vector into the host cell or the insertion of the vector into the host cell's chromosome. The selectable marker may include a marker that confers a selectable phenotype, such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of a surface protein. In an environment treated with such a selection agent, only cells expressing the selectable marker will survive or display a different phenotypic trait, making it possible to select transformed cells.

[0226] In some specific embodiments of the present invention, the vector used is the pK18mobsacB plasmid, the pXMJ19 plasmid.

[0227] The term "transformation" refers to the introduction of a polynucleotide into a host cell, whereby the polynucleotide becomes an extragenomic element or is inserted into the genome of the host cell and can replicate. Methods for transforming vectors used in the present invention may include methods for introducing nucleic acids into cells. Alternatively, electric pulse methods may be performed depending on the host cell, as disclosed in the related art.

[0228] In the present invention, the microorganism belonging to the genus Corynebacterium may be Corynebacterium glutamicum, Brevibacterium flavum, Brevibacterium lactofermentum, Corynebacterium ammoniagenes, or Corynebacterium pekinense.

[0229] In one embodiment of the present invention, the microorganism belonging to the genus Corynebacterium, with deposit number CGMCC No. 12856, deposit date August 16, 2016, depository institution Center of Ordinary Microorganisms, China Microbial Species Depositary, No. 3, Hall 1, Beichen West Road, Chaoyang District, Beijing, telephone number 010-64807355, is Corynebacterium glutamicum YP97158, which is described in Chinese patent application CN106367432A (filing date September 1, 2016, publication date February 1, 2017).

[0230] In the present invention, the bacterium may be, for example, a bacterium encoding glutamate dehydrogenase, aconitate hydratase, citrate synthase, methylcitrate synthase, pyruvate carboxylase, pyruvate dehydrogenase, pyruvate kinase, phosphoenolpyruvate synthase, phosphoglycerate mutase, phosphoglycerate kinase, glyceraldehyde-3-phosphate dehydrogenase, phosphotriose isomerase, fructose bisphosphate aldolase, glucose phosphate isomerase, 6-phosphogluconate dehydrogenase, 2-keto- Other improvements related to improving L-amino acid production may be included, such as increasing or decreasing the activity of enzymes such as 3-deoxy-6-phosphogluconate aldolase, glucose dehydrogenase, glucokinase, aspartate kinase III, aspartate semialdehyde dehydrogenase, homoserine kinase, threonine synthase, dihydrodipicolinate synthase, dihydrodipicolinate reductase, m-diaminopimelate dehydrogenase, and diaminopimelate decarboxylase, or gene expression, or replacing the gene with an exogenous gene.

[0231] Furthermore, the microorganism may have other improvements for improving L-lysine production, such as enhanced or reduced expression of genes involved in NADPH production (e.g., a gene encoding glucose dehydrogenase, a gene encoding gluconokinase, a gene encoding glyceraldehyde-3-phosphate dehydrogenase, a gene encoding glucose-6-phosphate dehydrogenase, or a gene encoding 6-phosphogluconate dehydrogenase) and / or other genes involved in the biosynthesis or secretion of L-lysine (e.g., a gene encoding aspartate aminotransferase, a gene encoding aspartate kinase, a gene encoding aspartate semialdehyde dehydrogenase, a gene encoding dihydrodipicolinate synthase, a gene encoding dihydrodipicolinate reductor, a gene encoding m-diaminopimelate dehydrogenase, a gene encoding diaminopimelate decarboxylase, lysE), or replacement of genes with foreign genes.

[0232] In the present invention, the mutation means that the base / nucleotide at the site has been changed, and the mutation method may be at least one method selected from mutagenesis, PCR site-directed mutagenesis, and / or homologous recombination, etc. In the present invention, PCR site-directed mutagenesis and / or homologous recombination are preferably used.

[0233] In the present invention, bacteria may be cultured in an appropriate medium under culture conditions known in the art. The medium may contain a carbon source, a nitrogen source, trace elements, or a combination thereof. The pH of the culture may be adjusted during the culture. Furthermore, during the culture, foam formation may be prevented, for example, by using an antifoaming agent to prevent foam formation. Furthermore, during the culture, gas may be injected into the culture. The gas may include any gas capable of maintaining an aerobic condition in the culture. During the culture, the temperature of the culture may be 20 to 45°C. The L-amino acid produced from the culture may be recovered by treating the culture with sulfuric acid, hydrochloric acid, or the like, followed by a combination of methods such as anion exchange chromatography, concentration, crystallization, and isoelectric precipitation.

[0234] [Effects of the invention] beneficial effects In this invention, Corynebacterium glutamicum YP97158 was used as the starting bacterium, and the NCgl1089 gene, NCgl0761 gene, and ptsS gene were weakened or knocked out in the background. As a result, it was found that the products of these gene codes affect the ability to produce L-amino acids. By introducing point mutations into the coding sequence, increasing the copy number of the gene, or overexpressing it, a recombinant strain was obtained. The resulting strain has obvious L-amino acid production ability and is advantageous for producing high-concentration L-amino acids. DETAILED DESCRIPTION OF THE INVENTION

[0235] The above and other features and advantages of the present invention will be further explained and illustrated by the following examples of the present invention, which are intended to exemplify the technical solutions of the present invention and are not intended to limit the scope of the present invention as defined by the claims and their equivalents.

[0236] Unless otherwise specified, all raw materials and reagents used in the following examples are commercially available or can be prepared by known methods, and all operations performed are known in the art or are performed according to the user's manuals of commercially available products.

[0237] In the following examples, the basal medium used to culture the above strains has the same composition, and in addition to the composition of this basal medium, sucrose, kanamycin, chloramphenicol, etc. are added as necessary, and the composition of the basal medium is as shown below.

[0238] TIFF0007768971000001.tif69170

[0239] In the following examples, the preparation and conditions of the SSCP electrophoresis PAGE are as follows: TIFF0007768971000002.tif85170

[0240] Example 1 (1) Transformation vector pK18-NCgl1089 containing the point-mutated NCgl1089 gene coding region G508A Construction According to the wild-type Corynebacterium glutamicum ATCC13032 genome sequence published by NCBI, two pairs of primers were designed and synthesized to amplify the NCgl1089 gene coding region sequence. Point mutations were then introduced into the NCgl1089 gene coding region (SEQ ID NO: 1) of strain YP97158 (deposit number: CGMCC No. 12856, date of deposit: August 16, 2016, depository: Center for Ordinary Microorganisms, China Microbial Species Depositary, No. 3, Beichen West Road, Chaoyang District, Beijing, Tel: 010-64807355, described in Chinese patent application CN106367432A, filed September 1, 2016, published February 1, 2017) by allelic replacement. The amino acid sequence corresponding to the encoded protein is shown in SEQ ID NO: 1. The nucleotide sequence of the NCgl1089 gene is SEQ ID NO:3, and the 508th G in the nucleotide sequence of the NCgl1089 gene is A (SEQ ID NO:2:NCgl1089 G508A ) in which glutamic acid at position 170 of the amino acid sequence corresponding to the encoded protein is changed to lysine (SEQ ID NO:4:NCgl1089E170K).

[0241] The primer designs are as follows (synthesized by Shanghai Invitrogen): P1:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCGCGTGGGATCCACGCCAG 3'(SEQ ID NO:5) P2:5'CAATGAGGGCTTTCGCCACCTCGCGGGC 3'(SEQ ID NO:6) P3:5'GCCCGCGAGGTGGCGAAAGCCCTCATTG 3'(SEQ ID NO:7) P4:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCATGCGTTGGCGATCTTC 3'(SEQ ID NO:8).

[0242] Construction method: PCR amplification was performed using Corynebacterium glutamicum ATCC13032 as a template and primers P1 and P2, and P3 and P4, respectively.

[0243] PCR system: 5 μL of 10x Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U / μL) 0.25 μL, total volume 50 μL.

[0244] The PCR amplification was performed with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 40 s, followed by over-extension at 72°C for 10 min, resulting in two DNA fragments (NCgl1089Up and NCgl1089Down) with sizes of 724 bp and 839 bp, respectively, containing the NCgl1089 gene coding region.

[0245] The two DNA fragments were separated and purified by agarose gel electrophoresis, and then a fragment approximately 1535 bp in length was amplified by overlap PCR using the two DNA fragments as templates and P1 and P4 as primers.

[0246] PCR system: 5 μL of 10x Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U / μL) 0.25 μL, total volume 50 μL.

[0247] The PCR amplification was carried out with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 90 s, followed by over-extension at 72°C for 10 min.

[0248] This DNA fragment (NCgl1089 G508A ) changes the guanine (G) at position 508 in the coding region of the YP97158 NCgl1089 gene to adenine (A), resulting in a change in the protein-encoding amino acid at position 170 from glutamic acid (E) to lysine (K).

[0249] The pK18mobsacB plasmid (purchased from Addgene) was digested with Xba I enzyme, and the linearized pK18mobsacB plasmid and NCgl1089 were separated by agarose gel electrophoresis. G508A The vector was isolated and purified, and then assembled using the NEBuider recombination system into the vector pK18-NCgl1089 G508A The plasmid contains a kanamycin resistance marker. Vector pK18-NCgl1089 G508A The vector pK18-NCgl1089, which contains the correct point mutation (GA), was identified by sequencing at a sequencing company. G508A was stored until use.

[0250] (2) Point-mutated NCgl1089 G508A Construction of genetically engineered strains containing Construction method: Allelic exchange plasmid pK18-NCgl1089 G508A The resulting clone was transformed by electric shock into the patented L-lysine-producing strain YP97158 (see WO2014121669A1 for construction methods; sequencing revealed that the wild-type NCgl1089 gene coding region was retained in the chromosome of the strain), and the cultured single colonies were identified using primer P1 and universal primer M13R. As a result, strains capable of amplifying a 1542 bp band were determined to be positive strains. The positive strains were cultured in a medium containing 15% sucrose, and single colonies cultured in a medium containing and not containing kanamycin were cultured, respectively. Strains that grew in a medium not containing kanamycin but not in a medium containing kanamycin were further identified by PCR using the following primers (synthesized by Shanghai Invitrogen): P5:5'GGTGATTGATGCATTATGCGC 3'(SEQ ID NO:9) P6:5'CCTAGCCTTTCACCTCTTCTGT 3'(SEQ ID NO:10).

[0251] The PCR amplification product was denatured at high temperature, treated in an ice bath, and then subjected to sscp electrophoresis (plasmid pK18-NCgl1089 G508A The amplified fragment was used as a positive control, the YP97158 amplified fragment as a negative control, and water as a blank control. Because the fragment structures and electrophoretic positions differed, strains whose electrophoretic positions did not match those of the negative control fragments but did match those of the positive control fragments were strains in which allelic exchange had been successful. The target fragments from strains in which allelic exchange had been successful were further amplified by PCR using primers P5 and P6, ligated into the PMD19-T vector, and sequenced. Sequence alignment revealed that the sequence-verified strain, which showed mutations in the base sequence, was a successful allelic exchange strain and was designated YPL-4-017.

[0252] (3) NCgl1089 or NCgl1089 in the genome G508A Construction of genetically engineered strains with overexpressed genes According to the wild-type Corynebacterium glutamicum ATCC13032 genome sequence published by NCBI, the upstream and downstream homology arm fragments and the NCgl1089 gene coding region, NCgl1089 G508A Four pairs of primers were designed and synthesized to amplify the gene coding region and the gene promoter region sequence, and NCgl1089 or NCgl1089 were introduced into strain YP97158 by homologous recombination. G508A gene was introduced.

[0253] The primer designs are as follows (synthesized by Shanghai Invitrogen): P7:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAATGCGTTCTGGACTGAGG 3'(SEQ ID NO:11) P8:5'CATGAGTATA AAATCACTGT CGTGCACCGAG AACAGATG 3'(SEQ ID NO:12) P9:5'CATCTGTTCT CGGTGCACGACAGTGATT TTATACTCAT G 3'(SEQ ID NO:13) P10:5'GACGTTTCCA GATGCTCATCACCGAACCC GCTGCACTGT 3'(SEQ ID NO:14) P11:5'ACAGTGCAGC GGGTTCGGTGATGAGCATCT GGAAACGTC 3'(SEQ ID NO:15) P12:5'CTTGATTTAATTGCGCCATCTCACCTCTTC TGTGGGCACG 3'(SEQ ID NO:16) P13:5'CGTGCCCACAGAAGAGGTGAGAT GGCGCAATTA AATCAAG 3'(SEQ ID NO:17) P14:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCTATGACACCTTCAACGGA TC 3'(SEQ ID NO:18).

[0254] Construction method: Using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P7 / P8, P9 / P10, and P13 / P14, respectively, to obtain an 805 bp upstream homologous arm fragment, a 318 bp NCgl1089 gene promoter fragment, and a 628 bp downstream homologous arm fragment. Next, PCR amplification was performed using Corynebacterium glutamicum ATCC13032 and YPL-4-017 as templates, respectively, and primers P11 / P12 to obtain NCgl1089 or NCgl1089. G508A A gene fragment of 694 bp was obtained. Then, P9 / P12 was used as primers, and the NCgl1089 gene promoter fragment and NCgl1089 or NCgl1089 G508A NCgl1089 or NCgl1089 with its own promoter as a template. G508A A 972 bp fragment was obtained. Furthermore, P7 / P14 was used as a primer, and NCgl1089 or NCgl1089 with its own promoter was used. G508A A mixture of these three fragments was used as a template for amplification to obtain an integrated homology arm fragment.

[0255] After the PCR reaction, the amplified product was isolated by electrophoresis, and the required 2365 bp DNA fragment was isolated using a column DNA gel extraction kit (TIANGEN). This fragment was then reassembled with the shuttle plasmid PK18mobsacB, which had been digested with XbaI enzyme and isolated using the NEBuider recombination system, to form the integrated plasmids PK18mobsacB-NCgl1089 or PK18mobsacB-NCgl1089. G508A The plasmid contained a kanamycin resistance marker, and recombinants in which the plasmid had been integrated into the genome were obtained by kanamycin screening.

[0256] PCR system: 5 μL of 10x Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U / μL) 0.25 μL, total volume 50 μL.

[0257] The PCR amplification was carried out with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 90 s, followed by over-extension at 72°C for 10 min.

[0258] The two integrative plasmids were electrotransformed into the L-lysine-producing strain YP97158, and the resulting single colonies were identified by PCR using P15 / P16 primers. Those containing a 1332 bp fragment by PCR amplification were positive strains, while those lacking the fragment were primordial strains. The positive strains were screened on 15% sucrose medium and then cultured in media containing and without kanamycin. Strains that grew in media without kanamycin but not in media containing kanamycin were further identified by PCR using P17 / P18 primers. Those with an amplified fragment of 1187 bp were strains in which the gene had been integrated into the YP97158 genome and were designated YPL-4-018 (without point mutation) and YPL-4-019 (with point mutation), respectively. P15:5'TCCAAGGAAGATACACGCC 3'(SEQ ID NO:19) P16:5'CTGCGATTCC CAACGCATCT3'(SEQ ID NO:20) P17:5'GAGCAGCCAA AACATGCAGC3'(SEQ ID NO:21) P18:5'CGTTGGAATC TTGCGTTG 3'(SEQ ID NO:22).

[0259] (4) NCgl1089 or NCgl1089 in the plasmid G508A Construction of genetically engineered strains with overexpressed genes According to the wild-type Corynebacterium glutamicum ATCC13032 genome sequence published by NCBI, NCgl1089 or NCgl1089 G508A Two pairs of primers were designed and synthesized to amplify the gene coding region and promoter region sequences. The primer designs are as follows (synthesized by Shanghai Invitrogen): P19:5'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGACAGTGATTTTATACTCATG 3'(SEQ ID NO:23) P20:5'GACGTTTCCA GATGCTCATCACCGAACCC GCTGCACTGT 3'(SEQ ID NO:24) P21:5'ACAGTGCAGC GGGTTCGGTGATGAGCATCT GGAAACGTC 3'(SEQ ID NO:25) P22:5'ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACTCACCTCTTCTGTGGGCACG 3'(SEQ ID NO:26).

[0260] Construction method: Using YPL-4-018 as a template, a 378-bp NCgl1089 promoter fragment was obtained by PCR with primers P19 / P20. Then, using wild-type Corynebacterium glutamicum ATCC13032 and YPL-4-017 as templates, respectively, a 378-bp NCgl1089 or NCgl1089 promoter fragment was obtained by PCR with primers P21 / P22. G508A A 708-bp gene fragment was obtained. Furthermore, overlapping PCR was performed using the promoter and gene fragment as templates with primers P19 / P22 to obtain NCgl1089 or NCgl1089, which have their own promoters. G508A A 1066 bp gene fragment was obtained. The amplified product was recovered by electrophoresis, and the required 1066 bp DNA fragment was recovered using a column DNA gel extraction kit. This was then reassembled with the shuttle plasmid pXMJ19, which had been digested with EcoRI enzyme and recovered, using the NEBuider recombination system to generate the overexpression plasmid pXMJ19-NCgl1089 or pXMJ19-NCgl1089. G508A The plasmid contains a chloramphenicol resistance marker, allowing the transformation of the plasmid into strains to be screened using chloramphenicol.

[0261] PCR system: 5 μL of 10x Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U / μL) 0.25 μL, total volume 50 μL.

[0262] The PCR amplification was carried out with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 90 s, and over-extension at 72°C for 10 min.

[0263] pXMJ19-NCgl1089 or pXMJ19-NCgl1089 G508AEach of these was electrically transformed into the proprietary strain YP97158, an L-lysine-producing bacterium, and the cultured single colonies were identified by PCR using M13(-48) and P22 primers. Strains containing a 1104 bp fragment by PCR amplification were identified as the transformed strains and were designated YPL-4-020 (without point mutation) or YPL-4-021 (with point mutation), respectively.

[0264] (5) Construction of a genetically engineered strain lacking the NCgl1089 gene in the genome Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers were synthesized to amplify fragments at both ends of the NCgl1089 gene coding region, forming upstream and downstream homologous arm fragments. The primer designs are as follows (synthesized by Shanghai Yingjun Co.): P23:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCACCGCATTCCCTTCATGAT 3'(SEQ ID NO:27) P24:5'ACGAATCCGCGCCTAGCCTTTTATCTACTTCCAAAAAACTGC 3'(SEQ ID NO:28) P25:5'GCAGTTTTTTGGAAGTAGATAAAAGGCTAGGCGCGGATTCGT 3'(SEQ ID NO:29) P26:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCGAGGGAAAGGATATCGA 3'(SEQ ID NO:30).

[0265] Using Corynebacterium glutamicum ATCC13032 as the template, PCR amplification was performed with primers P23 / P24 and P25 / P26 to obtain a 779 bp upstream homologous arm fragment and an 800 bp downstream homologous arm fragment. Next, overlap PCR was performed with primers P23 / P26 to obtain the complete homologous arm fragment (1539 bp). After PCR, the amplified product was isolated by electrophoresis, and the required 1539 bp DNA fragment was isolated using a column DNA gel extraction kit. This was then ligated into the shuttle plasmid pk18mobsacB, which had been digested with XbaI enzyme, using the NEBuider recombination system to obtain the knockout plasmid. This plasmid contains a kanamycin resistance marker.

[0266] The knockout plasmid was electrotransformed into the lysine-producing proprietary strain YP97158, and the cultured single colonies were subjected to PCR identification using the following primers (synthesized by Shanghai Yingjun Co., Ltd.): P27:5'CACCGCATTCCCTTCATGAT 3'(SEQ ID NO:31) P28:5'CGAGGGAAAGGATATCGA 3'(SEQ ID NO:32).

[0267] Strains that yielded bands of 1429 bp and 2401 bp by PCR amplification were positive strains, and strains that amplified the 2401 bp band were original strains. After screening the positive strains on 15% sucrose medium, they were cultured in kanamycin-containing and kanamycin-free media, respectively. Strains that grew in the kanamycin-free medium but not in the kanamycin-containing medium were further identified by PCR using P27 / P28 primers. The strain that amplified the 1429 bp band was a genetically engineered strain in which the NCgl1089 gene coding region had been knocked out and was designated YPL-4-022.

[0268] (6) L-lysine fermentation experiment Fermentation experiments were carried out using the strains constructed in the examples and the original strain YP97158 in a BLBIO-5GC-4-H fermentation tank (purchased from Shanghai Bailun Biotechnology Co., Ltd.) using the media shown in Table 1 and the control process shown in Table 2. Each strain was repeated three times, and the results are shown in Table 3.

[0269] TIFF0007768971000003.tif116170

[0270] TIFF0007768971000004.tif124170

[0271] TIFF0007768971000005.tif61170

[0272] From the results shown in Table 3, the NCgl1089 gene was overexpressed in Corynebacterium glutamicum, or a point mutation in the NCgl1089 gene coding region was introduced. G508A and overexpression contributes to improving L-lysine production, while weakening or knocking out the gene is detrimental to L-lysine accumulation.

[0273] Example 2 (1) Transformation vector pK18-NCgl0761 containing the point-mutated NCgl0761 gene coding region L31R Construction According to the Corynebacterium glutamicum ATCC13032 genome sequence published by NCBI, two pairs of primers were designed and synthesized to amplify the NCgl0761 gene coding region sequence. A point mutation was introduced into the NCgl0761 gene coding region (SEQ ID NO: 33) by allelic replacement in strain YP97158 (accession number: CGMCC No. 12856, date of deposit: August 16, 2016, depository: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing, Tel: 010-64807355, described in Chinese patent application CN106367432A, filed September 1, 2016, published February 1, 2017). The amino acid sequence corresponding to the encoded protein is SEQ ID NO: 35, and the 92nd T in the nucleotide sequence of the NCgl0761 gene was changed to G (SEQ ID NO: 36). NO:34), in which the 31st leucine in the amino acid sequence corresponding to the encoded protein is changed to arginine (SEQ ID NO:36:NCgl0761 L31R ) The primer design is as follows (synthesized by Shanghai Invitrogen): P1:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG CTTGCAGCTAACCTATACCCC3'(SEQ ID NO:37) P2:5'GCTTTTCAATATAATCACGTCCATCTGAGCCATC3'(SEQ ID NO:38) P3:5'GATGGCTCAGATGGACGTGATTATATTGAAAAGC3'(SEQ ID NO:39) P4:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC CTCCCAAATAATTGCCGC3'(SEQ ID NO:40)

[0274] Construction method: PCR amplification was performed using Corynebacterium glutamicum ATCC13032 as a template and primers P1 and P2, and P3 and P4, respectively. PCR system: 5 μL of 10× Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+The PCR mixture consisted of 4 μL of 25 mM ribonucleotides, 2 μL of each primer (10 pM), and 0.25 μL of ExTaq (5 U / μL) in a total volume of 50 μL. The PCR amplification consisted of 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 40 s, followed by over-extension at 72°C for 10 min. DNA fragments (NCgl0761 Up and NCgl0761 Down) containing the NCgl0761 gene coding region were obtained, each 636 bp and 681 bp in size. The two DNA fragments were separated and purified by agarose gel electrophoresis. A 1283 bp fragment was then amplified by overlap PCR using the two DNA fragments as templates and primers P1 and P4.

[0275] PCR system: 5 μL of 10x Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ The PCR amplification was performed in a total volume of 50 μL, with 4 μL of 25 mM ATP, 2 μL of each primer (10 pM), and 0.25 μL of ExTaq (5 U / μL). The PCR amplification was performed with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 60 s, followed by 10 min of over-extension at 72°C.

[0276] This DNA fragment changes the 92nd thymine (T) in the YP97158 NCgl0761 gene coding region to guanine (G), resulting in a change in the 31st amino acid of the encoded protein from leucine (L) to arginine (R). This DNA fragment was purified after agarose gel electrophoresis and ligated with pK18mobsacB plasmid (purchased from Addgene, digested with Xbal I and BamH I enzymes) purified by double enzyme digestion at 50°C for 30 minutes using NEBuilder enzyme (purchased from NEB). The ligated product was transformed, and a single clone grown was identified by PCR as the positive vector pK18-NCgl0761. L31R The resulting plasmid contains a kanamycin resistance marker. L31RThe vector pK18-NCgl0761, which contained the correct point mutation (TG), was identified by sequencing at a sequencing company. L31R was stored until use.

[0277] (2) Point-mutated pK18-NCgl0761 L31R Construction of genetically engineered strains containing How to build it Allelic exchange plasmid pK18-NCgl0761 L31R was transformed by electric shock into the patented L-lysine-producing strain YP97158 (see WO2014121669A1 for construction methods; sequencing revealed that the wild-type NCgl0761 gene coding region was retained in the chromosome of the strain), and the cultured single colonies were identified using primer P1 and universal primer M13R. As a result, strains that could amplify a band of 1,369 bp were determined to be positive strains. The positive strains were cultured in a medium containing 15% sucrose, and the cultured single colonies were cultured in a medium containing and a medium not containing kanamycin. Strains that grew in a medium not containing kanamycin but not in a medium containing kanamycin were further identified by PCR using the following primers (synthesized by Shanghai Invitrogen): P5:5'GAATGGAATAGGAGAATTGCG 3'(SEQ ID NO:41) P6:5'CACCAGGCGTGGAAAGAG 3'(SEQ ID NO:42).

[0278] The PCR amplification product (267 bp) was denatured at 95°C for 10 minutes, treated in an ice bath for 5 minutes, and then subjected to SSCP electrophoresis (plasmid pK18-NCgl0761 L31RThe amplified fragment was used as a positive control, the YP97158 amplified fragment as a negative control, and water as a blank control. Because the fragment structures and electrophoretic positions differed, strains whose electrophoretic positions did not match those of the negative control fragments and matched those of the positive control fragments were strains in which allelic exchange had been successful. The positive strain NCgl0761 fragment was further amplified using PCR with primers P5 / P6, ligated into the PMD19-T vector, and sequenced. Sequence alignment revealed a mutated (TG) base sequence, indicating successful allelic exchange and designated this strain YPL-4-029.

[0279] (3) NCgl0761 and NCgl0761 in the genome L31R Construction of genetically engineered strains with overexpressed genes According to the wild-type Corynebacterium glutamicum ATCC13032 genome sequence published by NCBI, the upstream and downstream homologous arm fragments and NCgl0761 or NCgl0761 L31R Three pairs of primers were designed and synthesized to amplify the gene coding region and promoter region sequences, and NCgl0761 or NCgl0761 were introduced into strain YP97158 by homologous recombination. L31R gene was introduced.

[0280] The primer designs are as follows (synthesized by Shanghai Invitrogen): P7:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG AATGCGTTCTGGACTGAGG 3'(SEQ ID NO:43) P8:5'CCATCCATACCCCACTACATGTGCACCGAGAACAGATG 3'(SEQ ID NO:44) P9:5'CATCTGTTCTCGGTGCACATGTAGTGGGGTATGGATGG 3'(SEQ ID NO:45) P10:5'GATTTAATTGCGCCATCTGATTCTGGGTGAGGTTTCCGGCTCAG3'(SEQ ID NO:46) P11:5'CTGAGCCGGAAACCTCACCC AGAATCAGATGGCGCAATTAAATC 3'(SEQ ID NO:47) P12:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GCTATGACACCTTCAACGGATC 3'(SEQ ID NO:48).

[0281] Construction method: Using Corynebacterium glutamicum ATCC13032 or YPL-4-029 as a template, PCR amplification was performed with primers P7 / P8, P9 / P10, and P11 / P12, respectively, to amplify the upstream homology arm fragment 802 bp, NCgl0761 or NCgl0761 L31R The gene and its promoter fragment (737 bp) and downstream homology arm fragment (647 bp) were obtained. After the PCR reaction was completed, the three amplified fragments were recovered by electrophoresis using a column DNA gel extraction kit (TIANGEN). The three recovered fragments were ligated with the pK18mobsacB plasmid (purchased from Addgene, digested with the double enzymes Xbal I / BamH I) that had been purified by double enzyme digestion at 50°C for 30 minutes using NEBuilder enzyme (purchased from NEB). The ligation product was transformed, and the resulting single clones were identified by PCR using M13 primers. The positive integration plasmids, pK18mobsacB-NCgl0761 and pK18mobsacB-NCgl0761, were identified by PCR using M13 primers. L31R The plasmid contained a kanamycin resistance marker, and recombinants in which the plasmid had been integrated into the genome were obtained by kanamycin screening.

[0282] PCR system: 5 μL of 10x Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ The PCR amplification was performed in a total volume of 50 μL, with 4 μL of 25 mM ATP, 2 μL of each primer (10 pM), and 0.25 μL of ExTaq (5 U / μL). The PCR amplification was performed with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 60 s, and over-extension at 72°C for 10 min.

[0283] The two integrating plasmids that were found to be correct as a result of sequencing were electrotransformed into the patented L-lysine-producing strain YP97158, and the cultivated single colonies were subjected to PCR identification using P13 / P14 primers. Those that amplified a 1,325 bp fragment by PCR were positive strains, while those that did not produce a fragment by amplification were original strains. The positive strains were cultivated in a medium containing 15% sucrose, and the cultivated single colonies were further subjected to PCR identification using P15 / P16 primers. Those that amplified a 1,002 bp fragment were identified as NCgl0761 or NCgl0761. L31R The positive strains, in which the gene had been integrated into the YP97158 genome, were designated YPL-4-030 (without the mutation site) and YPL-4-031 (with the mutation site): P13:5'TCCAAGGAAGATACACGCC 3'(SEQ ID NO:49) P14:5'GCCTTGTTAATATCTTCCC 3'(SEQ ID NO:50) P15:5'GGGAAGATATTAACAAGGC 3'(SEQ ID NO:51) P16:5'CGTTGGAATCTTGCGTTG 3'(SEQ ID NO:52).

[0284] (4) NCgl0761 or NCgl0761 in the plasmid L31R Construction of genetically engineered strains with overexpressed genes According to the wild-type Corynebacterium glutamicum ATCC13032 genome sequence published by NCBI, NCgl0761 or NCgl0761 L31R A pair of primers for amplifying the gene coding region and promoter region sequence was designed and synthesized. The primer design is as follows (synthesized by Shanghai Invitrogen): P17:5' GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCC ATGTAGTGGGGTATGGATGG 3'(SEQ ID NO:53) P18:5' ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC GTGAGGTTTCCGGCTCAG 3'(SEQ ID NO:54).

[0285] Construction method: Using Corynebacterium glutamicum ATCC13032 and YPL-4-029 as templates, PCR amplification was performed with primers P17 / P18 to obtain NCgl0761 or NCgl0761 L31R The gene and its promoter fragment (737 bp) were obtained, and the amplified product was recovered by electrophoresis and purified using a column DNA gel extraction kit. The recovered DNA fragment was ligated with the shuttle plasmid pXMJ19, which had been digested with EcoRI enzyme and recovered, using NEBuilder enzyme (purchased from NEB) at 50°C for 30 minutes. The ligated product was transformed and grown into a single clone, which was identified by PCR using M13 primers. The positive overexpression plasmids pXMJ19-NCgl0761 and pXMJ19-NCgl0761 were identified. L31R The plasmid was then subjected to sequencing. The plasmid contains a chloramphenicol resistance marker, allowing the strain to be determined as to whether the plasmid had been transformed with chloramphenicol.

[0286] PCR system: 5 μL of 10x Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U / μL) 0.25 μL, total volume 50 μL.

[0287] The PCR amplification was carried out with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 60 s, and over-extension at 72°C for 10 min.

[0288] Sequencing results: Correct pXMJ19-NCgl0761 and pXMJ19-NCgl0761 L31RThe plasmids were each electrotransformed into the proprietary strain YP97158, an L-lysine-producing bacterium, and the cultured single colonies were identified by PCR using primers M13 / P18. The strains that amplified a 745 bp fragment by PCR were positive and designated YPL-4-032 (without the mutation site) and YPL-4-033 (with the mutation site).

[0289] (5) Construction of a genetically engineered strain lacking the NCgl0761 gene in the genome Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers were synthesized to amplify fragments at both ends of the NCgl0761 gene coding region, forming upstream and downstream homologous arm fragments. The primer designs are as follows (synthesized by Shanghai Yingjun Co.): P19:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GTATCTGGAGAGAAGAAGGAGC 3'(SEQ ID NO:55) P20:5'GCCTTGTTAATATCTTCCCGAATACATGCCGCAATCTCCTATTC3'(SEQ ID NO:56) P21:5'GAGAATTGCGGCATGTATTCGGGAAGATATTAACAAGGC 3'(SEQ ID NO:57) P22:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC CCGCAGATTACTAAGGCTG 3'(SEQ ID NO:58).

[0290] Construction method: Using Corynebacterium glutamicum ATCC13032 as the template, PCR amplification was performed with primers P19 / P20 and P21 / P22, respectively, to obtain a 658-bp upstream homologous arm fragment and a 716-bp downstream homologous arm fragment. Next, overlap PCR was performed with primers P19 / P22 to obtain the complete homologous arm fragment (1,335 bp). The amplified products were electrophoresed and purified using a column DNA gel extraction kit. The recovered DNA fragment was ligated with a double-digested and purified pK18mobsacB plasmid (purchased from Addgene, digested with Xbal I and BamH I, respectively) using NEBuilder enzyme (purchased from NEB) at 50°C for 30 minutes. The ligated product was transformed, and a single clone was grown and identified by PCR using M13 primers. The positive knockout vector pK18-ΔNCgl0761 was obtained, and the plasmid was subjected to sequencing. The plasmid contains kanamycin resistance as a screening marker.

[0291] PCR system: 5 μL of 10x Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U / μL) 0.25 μL, total volume 50 μL.

[0292] The PCR amplification was carried out with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 90 s, followed by over-extension at 72°C for 10 min.

[0293] The knockout plasmid pK18-ΔNCgl0761, which was found to be correct as a result of sequencing, was electrotransformed into the lysine-producing proprietary strain YP97158, and the cultivated single colonies were identified by PCR using the following primers (synthesized by Shanghai Yingjun Co., Ltd.): P23:5'GTATCTGGAGAGAAGAAGGAGC 3'(SEQ ID NO:59) P24:5'CCGCAGATTACTAAGGCTG 3'(SEQ ID NO:60).

[0294] Strains that amplified both the 1374 bp and 1520 bp bands by PCR were positive strains, while strains that amplified only the 1520 bp band were original strains. Positive strains were screened on 15% sucrose medium and then cultured in kanamycin-containing and kanamycin-free media. Strains that grew in the kanamycin-free medium but not in the kanamycin-containing medium were further identified by PCR using P23 / P24 primers. Strains that amplified the 1374 bp band were identified as positive strains with the NCgl0761 gene coding region knocked out. The NCgl0761 fragment from the positive strains was further amplified by PCR using P23 / P24 primers, ligated into the PMD19-T vector, and sequenced. The correct strain was designated YPL-4-034.

[0295] (6) L-lysine fermentation experiment Fermentation experiments were carried out using the strains constructed in the examples and the original strain YP97158 in a BLBIO-5GC-4-H fermentation tank (purchased from Shanghai Bailun Biotechnology Co., Ltd.) using the media shown in Table 4 and the control process shown in Table 5. Each strain was repeated three times, and the results are shown in Table 6.

[0296] TIFF0007768971000006.tif114170

[0297] TIFF0007768971000007.tif124170

[0298] TIFF0007768971000008.tif62170

[0299] From the results shown in Table 6, the NCgl0761 gene was overexpressed in Corynebacterium glutamicum, or a point mutation in the NCgl0761 gene coding region was introduced. L31RGenetic overexpression contributes to improving the production amount and conversion rate of L-lysine, while gene weakening or knockout is detrimental to the accumulation of L-lysine and also reduces the conversion rate.

[0300] (7) The NCgl0761 gene is introduced into a glutamic acid-producing strain to overexpress it, or a point mutation in the NCgl0761 gene coding region is introduced. L31R and overexpression were carried out, and fermentation experiments were carried out.

[0301] According to the methods of Examples (1) to (5), using the same primers and experimental conditions, the point-mutated pK18-NCgl0761 was prepared using Corynebacterium ATCC13869 as the starting strain and ATCC 13869 as the expression strain. L31R A glutamic acid-producing genetically engineered strain (YPG-001) containing NCgl0761 (YPG-002) or NCgl0761 in the genome. L31R (YPG-003) A glutamate-producing genetically engineered strain overexpressing the gene NCgl0761 (YPG-004) or NCgl0761 in the plasmid L31R We obtained a glutamic acid-producing genetically engineered strain that overexpressed the NCgl0761 gene (YPG-005), and a glutamic acid-producing genetically engineered strain (YPG-006) that lacked the NCgl0761 gene in its genome.

[0302] Fermentation experiments were carried out using the strains constructed in the examples and the original strain ATCC 13869 in a BLBIO-5GC-4-H fermentation tank (purchased from Shanghai Bailun Biotechnology Co., Ltd.) using the media shown in Table 7 and the control process shown in Table 8. Each strain was repeated three times, and the results are shown in Table 9.

[0303] TIFF0007768971000009.tif134170

[0304] TIFF0007768971000010.tif74170

[0305] TIFF0007768971000011.tif61170

[0306] From the results shown in Table 9, the NCgl0761 gene was overexpressed in Corynebacterium glutamicum, or a point mutation NCgl0761 in the NCgl0761 gene coding region was introduced. L31R and overexpression contribute to improving L-glutamic acid production and conversion rate, while weakening or knocking out the gene is detrimental to L-glutamic acid accumulation and reduces the conversion rate.

[0307] Example 3 (1) Transformation vector pK18-ptsS containing the point-mutated ptsS gene coding region M162T Construction According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers were designed and synthesized to amplify the ptsS gene coding region sequence. A point mutation was introduced into the ptsS gene coding region (SEQ ID NO: 61) of strain YP97158 (accession number: CGMCC No. 12856, date of deposit: August 16, 2016, depository: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing, Tel: 010-64807355, described in Chinese patent application CN106367432A (filed September 1, 2016, published February 1, 2017)) by allele substitution. The amino acid sequence corresponding to the encoded protein is SEQ ID NO: 63, and the 485th thymine T in the nucleotide sequence of the ptsS gene was replaced with a cytosine C (SEQ ID NO: 64). NO:62), in which case the methionine at position 162 of the amino acid sequence corresponding to the encoded protein is changed to threonine (SEQ ID NO:64:ptsS M162T ) The primer design is as follows (synthesized by Shanghai Invitrogen): P1:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GACACCTGAAGCACCTGC 3'(SEQ ID NO:65) P2:5'GAGATGATCAACCTCACGGCATCTGCGC 3'(SEQ ID NO:66) P3:5'GCGCAGATGCCGTGAGGTTGATCATCTC 3'(SEQ ID NO:67) P4:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GATGGACAGGTTTCATTCGC3'(SEQ ID NO:68).

[0308] Construction method: PCR amplification was performed using Corynebacterium glutamicum ATCC13032 as a template and primers P1 and P2, and P3 and P4, respectively. PCR system: 5 μL of 10× Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ The total volume was 50 μL. The PCR amplification consisted of 4 μL of 25 mM ATP, 2 μL of each primer (10 pM), and 0.25 μL of ExTaq (5 U / μL). The PCR amplification consisted of 5 min of pre-denaturation at 94°C, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 40 s, followed by 10 min of over-extension at 72°C. Two DNA fragments (ptsS Up and ptsS Down), each measuring 666 bp and 703 bp, containing the ptsS gene coding region, were obtained. The two DNA fragments were separated and purified by agarose gel electrophoresis. A 1341 bp fragment was then obtained by overlap PCR amplification using the two DNA fragments as templates and primers P1 and P4.

[0309] PCR system: 5 μL of 10x Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ The PCR amplification was performed in a total volume of 50 μL, with 4 μL of 25 mM ATP, 2 μL of each primer (10 pM), and 0.25 μL of ExTaq (5 U / μL). The PCR amplification was performed with 5 min of pre-denaturation at 94°C, 30 cycles of denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 90 s, followed by 10 min of over-extension at 72°C.

[0310] This DNA fragment changes the 485th thymine (T) in the YP97158ptsS gene coding region to a cytosine (C), resulting in a change from methionine (M) to threonine (T) at the 162nd amino acid encoding the protein. This DNA fragment was purified after agarose gel electrophoresis and ligated with the pK18mobsacB plasmid (purchased from Addgene, digested with Xbal I and BamH I enzymes) that had been double-digested and purified, at 50°C for 30 minutes using NEBuilder enzyme (purchased from NEB). The ligated product was transformed, and single clones were identified by PCR analysis to identify the vector pK18-ptsS. M162T The resulting plasmid contains a kanamycin resistance marker. M162T The vector pK18-ptsS containing the correct point mutation (TC) was identified by sequencing at a sequencing company. M162T was stored until use.

[0311] (2) Point-mutated ptsS M162T Construction of genetically engineered strains containing Construction method: Allelic exchange plasmid pK18-ptsS M162T was transformed by electric shock into the patented L-lysine-producing strain YP97158 (see WO2014121669A1 for construction methods; sequencing revealed that the strain chromosome contains a wild-type ptsS gene coding region), and the cultured single colonies were identified using primer P1 and universal primer M13R. Strains capable of amplifying a 1,393 bp band were determined to be positive. Positive strains were cultured in a medium containing 15% sucrose, and the cultured single colonies were cultured in a medium containing and a medium not containing kanamycin. Strains that grew in the kanamycin-free medium but not in the kanamycin-containing medium were further identified by PCR using the following primers (synthesized by Shanghai Invitrogen): P5:5'CCACATTGGCATTTCGCC 3'(SEQ ID NO:69) P6:5'CGCTGATTCCAATCTTGG 3'(SEQ ID NO:70)

[0312] The PCR amplification product (311 bp) was denatured at 95°C for 10 minutes, treated in an ice bath for 5 minutes, and then subjected to sscp electrophoresis (plasmid pK18-ptsS M162T The amplified fragment was used as a positive control, the YP97158 amplified fragment as a negative control, and water as a blank control. Because the fragment structures and electrophoretic positions differed, strains whose electrophoretic positions did not match those of the negative control fragments and matched those of the positive control fragments were strains in which allelic exchange had been successful. The ptsS fragment of the positive strain was further amplified using primers P5 / P6 PCR, ligated into the PMD19-T vector, and sequenced. Sequence alignment revealed a mutated (AG) base sequence, indicating successful allelic exchange and designated this strain as YPL-4-035.

[0313] (3) PtsS or PtsS in the genome M162T Construction of genetically engineered strains with overexpressed genes According to the wild-type Corynebacterium glutamicum ATCC13032 genome sequence published by NCBI, the upstream and downstream homologous arm fragments and PtsS or PtsS M162T Three pairs of primers were designed and synthesized to amplify the gene coding region and promoter region sequences, and PtsS was transfected into strain YP97158 by homologous recombination. M162T gene was introduced.

[0314] The primer designs are as follows (synthesized by Shanghai Invitrogen): P7:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG AATGCGTTCTGGACTGAGG 3'(SEQ ID NO:71) P8:5'GTGACTCTACGCATCTTTGACAGTGCACCG AGAACAGATG 3'(SEQ ID NO:72) P9:5'CATCTGTTCTCGGTGCACTGTCAAAGATGCGTA GAGTCAC 3'(SEQ ID NO:73) P10:5'CTTGATTTAATTGCGCCATCTGATTCTGGGTCTGTGGATCGTGG TGGTG 3'(SEQ ID NO:74) P11:5'CACCACCACGATCCACAGACCCAGAATCAGATGGCGCAATTAAAT CAAG 3'(SEQ ID NO:75) P12:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GCTATGACACCTTCAACGGATC 3'(SEQ ID NO:76).

[0315] Construction method: Using Corynebacterium glutamicum ATCC13032 or YPL-4-035 as a template, PCR amplification was performed with primers P7 / P8, P9 / P10, and P11 / P12, respectively, to obtain the upstream homology arm fragment 802 bp, PtsS, or PtsS. M162T The gene and its promoter fragment (2354 bp) and downstream homology arm fragment (647 bp) were obtained. After the PCR reaction was completed, the three amplified fragments were recovered by electrophoresis using a column DNA gel extraction kit. The three recovered fragments were ligated with the pK18mobsacB plasmid (purchased from Addgene, digested with Xbal I and BamH I enzymes) that had been double-digested and purified, using NEBuilder enzyme (purchased from NEB) at 50°C for 30 minutes. The ligation product was transformed, and a single clone was grown. PCR identification identified the positive integrated plasmid, pK18mobsacB-PtsS or PtsS. M162T and pK18mobsacB-PtsS M162T The plasmid contains a kanamycin resistance marker, and recombinants in which the plasmid has been integrated into the genome can be obtained by kanamycin screening.

[0316] PCR system: 5 μL 10× Ex Taq Buffer, 4 μL dNTP Mixture (2.5 mM each), 4 μL Mg2+ (25 mM), 2 μL each primer (10 pM), 0.25 μL Ex Taq (5 U / μL), total volume 50 μL. The PCR amplification was performed with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 60 s, and over-extension at 72°C for 10 min.

[0317] The two integrating plasmids that were found to be correct as a result of sequencing were electrotransformed into the patented L-lysine producing strain YP97158, and the cultivated single colonies were subjected to PCR identification using P13 / P14 primers. Those containing a 1298 bp fragment by PCR amplification were positive strains, while those without a fragment by amplification were original strains. The positive strains were cultivated in a medium containing 15% sucrose, and the cultivated single colonies were further subjected to PCR identification using P15 / P16 primers. Those with an amplified fragment of 1133 bp were identified as PtsS or PtsS. M162T The positive strains, in which the gene had been integrated into the YP97158 genome, were designated YPL-4-036 (without the mutation site) and YPL-4-037 (with the mutation site): P13:5'TCCAAGGAAGATACACGCC 3'(SEQ ID NO:77) P14:5'GTGGAAAGATTGTGGTGGC 3'(SEQ ID NO:78) P15:5'CATCCAGACTTTGGCGATC 3'(SEQ ID NO:79) P16:5'CGTTGGAATCTTGCGTTG 3'(SEQ ID NO:80).

[0318] (4) PtsS or PtsS in the plasmid M162T Construction of genetically engineered strains with overexpressed genes According to the wild-type Corynebacterium glutamicum ATCC13032 genome sequence published by NCBI, PtsS or PtsS M162TA pair of primers for amplifying the gene coding region and promoter region sequence was designed and synthesized. The primer design is as follows (synthesized by Shanghai Invitrogen): P17:5' GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCC TGTCA AAGATG CGTAGAGTCAC 3'(SEQ ID NO:81) P18:5' ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC GTCTGTGGATCGTGGTGGTG3'(SEQ ID NO:82).

[0319] Construction method: PCR amplification was performed using ATCC13032 and YPL-4-035 as templates with primers P17 / P18 to obtain PtsS or PtsS M162T A gene and promoter fragment of 2354 bp was obtained, and the amplified product was electrophoresed and purified using a column DNA gel extraction kit. The recovered DNA fragment was digested with EcoRI enzyme and then ligated with the shuttle plasmid pXMJ19 recovered from the digest using NEBuilder enzyme (purchased from NEB) at 50°C for 30 minutes. The ligated product was transformed and grown into a single clone, which was identified by PCR using M13 primers. The positive overexpression plasmids pXMJ19-PtsS and pXMJ19-PtsS were identified. M162T The plasmid was then subjected to sequencing. The plasmid contains a chloramphenicol resistance marker, allowing the strain to be determined whether the plasmid was transformed with chloramphenicol.

[0320] PCR system: 5 μL of 10x Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U / μL) 0.25 μL, total volume 50 μL.

[0321] The PCR amplification was carried out with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 60 s, and over-extension at 72°C for 10 min.

[0322] Sequencing results: Correct pXMJ19-PtsS and pXMJ19-PtsS M162T The plasmid was electrotransformed into the proprietary strain YP97158, an L-lysine-producing bacterium, and single colonies were cultured and identified by PCR using primers M13 / P18. Those strains containing a 2362 bp fragment in PCR amplification were positive strains and named YPL-4-038 (without the mutation site) and YPL-4-039 (with the mutation site).

[0323] (5) Construction of a genetically engineered strain lacking the PtsS gene in its genome Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers were synthesized to amplify fragments at both ends of the PtsS gene coding region, forming upstream and downstream homologous arm fragments. The primer designs are as follows (synthesized by Shanghai Yingjun Co.): P19:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GCCGTTAT C AAT CAAGCGC3'(SEQ ID NO:83) P20:5'CGCCAAAGTCTGGATGATGGTGGAAAGATTGTGGTGGC 3'(SEQ ID NO:84) P21:5'GCCACCACAATCTTTCCACCATCATCCAGACTTTGGCGATCC 3'(SEQ ID NO:85) P22:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GCAGTA AA CGGTTCTGATGC3'(SEQ ID NO:86).

[0324] Construction method: Using Corynebacterium glutamicum ATCC13032 as the template, PCR amplification was performed with primers P19 / P20 and P21 / P22, respectively, to obtain a 794-bp upstream homologous arm fragment and a 703-bp downstream homologous arm fragment. Next, overlap PCR was performed with primers P19 / P22 to obtain the complete homologous arm fragment (1459 bp). The amplified products were electrophoresed and purified using a column DNA gel extraction kit. The recovered DNA fragment was ligated with a double-digested and purified pK18mobsacB plasmid (purchased from Addgene, digested with Xbal I and BamH I, respectively) using NEBuilder enzyme (purchased from NEB) at 50°C for 30 minutes. The ligation product was transformed, and single clones grown were identified by PCR using M13 primers. The positive knockout vector pK18-ΔPtsS was obtained, and the plasmid was subjected to sequencing. The plasmid contains a kanamycin resistance marker.

[0325] PCR system: 5 μL of 10x Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ The PCR amplification was performed in a total volume of 50 μL with 4 μL of 25 mM ATP, 2 μL of each primer (10 pM), and 0.25 μL of ExTaq (5 U / μL). The PCR amplification was performed with 30 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 90 s, followed by over-extension at 72°C for 10 min.

[0326] The knockout plasmid pK18-ΔPtsS, which was found to be correct as a result of sequencing, was electrotransformed into the lysine-producing proprietary strain YP97158, and the cultivated single colonies were identified by PCR using the following primers (synthesized by Shanghai Yingjun Co., Ltd.): P23:5'TGTCAAAGATGCGTAGAGTCAC 3'(SEQ ID NO:87) P24:5'GGTTTCATTCGCTTTCCG 3'(SEQ ID NO:88).

[0327] Strains that amplified both the 758 bp and 2249 bp bands by PCR were positive strains, while strains that amplified only the 2249 bp band were original strains. After screening the positive strains on 15% sucrose medium, they were cultured in kanamycin-containing and kanamycin-free media, respectively. Strains that grew in the kanamycin-free medium but not in the kanamycin-containing medium were further identified by PCR using P23 / P24 primers. Strains that amplified the 758 bp band were positive strains with the PtsS gene coding region knocked out. The PtsS fragment from the positive strains was further amplified by PCR using P23 / P24 primers, ligated into the PMD19-T vector, and sequenced. The strain identified as correct was designated YPL-4-040.

[0328] (6) L-lysine fermentation experiment Fermentation experiments were carried out using the strains constructed in the examples and the original strain YP97158 in a BLBIO-5GC-4-H fermentation tank (purchased from Shanghai Bailun Biotechnology Co., Ltd.) using the media shown in Table 10 and the control process shown in Table 11. Each strain was repeated three times, and the results are shown in Table 12.

[0329] TIFF0007768971000012.tif114170

[0330] TIFF0007768971000013.tif136170

[0331] TIFF0007768971000014.tif98170

[0332] From the results shown in Table 12, the point mutation PtsS in the PtsS gene coding region in Corynebacterium glutamicum M162T Genetic overexpression contributes to improving L-lysine production and conversion rate, while gene weakening or knockout is detrimental to L-lysine accumulation and also reduces the conversion rate.

[0333] (7) Overexpression of the PtsS gene is introduced into glutamic acid-producing strains, or a point mutation in the PtsS gene coding region is introduced. M162T and overexpression were performed, followed by fermentation experiments.

[0334] According to the methods of (1) to (5) of this Example, using similar primers and experimental conditions, Corynebacterium ATCC 13869 was used as the starting bacterium and ATCC 13869 was used as the expression bacterium, and the point-mutated ptsS M162T A glutamate-producing genetically engineered strain containing ptsS and ptsS in the genome M162T Glutamate-producing genetically engineered strains overexpressing the genes ptsS and ptsS on plasmids M162T We obtained a genetically engineered strain for glutamic acid production in which the gene was overexpressed, and a genetically engineered strain for glutamic acid production in which the ptsS gene was deleted in the genome.

[0335] Fermentation experiments were carried out using the strains constructed in the examples and the original strain ATCC 13869 in a BLBIO-5GC-4-H fermentation tank (purchased from Shanghai Bailun Biotechnology Co., Ltd.) using the media shown in Table 13 and the control process shown in Table 14. Each strain was repeated three times, and the results are shown in Table 15.

[0336] TIFF0007768971000015.tif135170

[0337] TIFF0007768971000016.tif98170

[0338] TIFF0007768971000017.tif62170

[0339] From the results shown in Table 15, the point mutation PtsS in the PtsS gene coding region in Corynebacterium glutamicum M162T and / or overexpression contributes to improving L-glutamic acid production and conversion rate, whereas weakening or knocking out the gene is detrimental to L-glutamic acid accumulation and reduces the conversion rate.

[0340] Although the embodiments of the present invention have been described above, the present invention is not limited to the above embodiments. All modifications, equivalent replacements, improvements, etc. made without departing from the spirit and principles of the present invention are intended to be included in the patent scope of the present invention.

Claims

1. A microorganism that produces an L-amino acid, Improved expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO: 3, which contains a point mutation that results in a substitution of lysine for glutamic acid at position 170 of the amino acid sequence of SEQ ID NO: 3, and / or Improved expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO:63 having a point mutation that replaces methionine at position 162 of the amino acid sequence of SEQ ID NO:63 with threonine. and A microorganism characterized in that the microorganism is Corynebacterium glutamicum.

2. The microorganism described in claim 1, characterized in that the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 comprises the nucleotide sequence of SEQ ID NO: 1, and the polynucleotide encoding the amino acid sequence of SEQ ID NO: 63 comprises the nucleotide sequence of SEQ ID NO:

61.

3. The polynucleotide sequence having a point mutation is a polynucleotide sequence having a mutation at base 508 of the polynucleotide sequence shown in SEQ ID NO: 1, The polynucleotide having a point mutation is a polynucleotide having a mutation at base 485 of the polynucleotide sequence shown in SEQ ID NO:

61.

3. The microorganism according to claim 1 or 2, characterized in that

4. 4. The microorganism according to claim 3, wherein the mutation comprises a mutation from guanine (G) to adenine (A) at the 508th base of the polynucleotide sequence shown in SEQ ID NO:

1.

5. 4. The microorganism of claim 3, wherein the polynucleotide sequence having a point mutation comprises the polynucleotide sequence shown in SEQ ID NO:

2.

6. 4. The microorganism according to claim 3, wherein the mutation comprises a mutation from thymine (T) to cytosine (C) at the 485th base of the polynucleotide sequence shown in SEQ ID NO:

61.

7. 4. The microorganism of claim 3, wherein the polynucleotide sequence having a point mutation comprises the polynucleotide sequence shown in SEQ ID NO:

62.

8. The microorganism according to any one of claims 1 to 7, characterized in that the microorganism is Corynebacterium glutamicum YP97158 or ATCC 13869.

9. A polynucleotide encoding the amino acid sequence represented by SEQ ID NO: 3, in which glutamic acid at position 170 is substituted with lysine; and / or A polynucleotide encoding the amino acid sequence of SEQ ID NO: 63, in which methionine at position 162 is replaced with threonine. A polynucleotide comprising:

10. The polynucleotide of claim 9, comprising a polynucleotide encoding the amino acid sequence shown in SEQ ID NO:

4.

11. The polynucleotide according to claim 9, wherein the 508th base of the polynucleotide sequence shown in SEQ ID NO: 1 is mutated.

12. 10. The polynucleotide of claim 9, wherein the mutation is a mutation from guanine (G) to adenine (A) at base 508 of the polynucleotide sequence shown in SEQ ID NO:

1.

13. 10. The polynucleotide of claim 9, comprising the polynucleotide sequence set forth in SEQ ID NO:

2.

14. The polynucleotide of claim 9, comprising a polynucleotide encoding the amino acid sequence set forth in SEQ ID NO:

64.

15. The polynucleotide according to claim 9, wherein the 485th base of the polynucleotide sequence shown in SEQ ID NO: 61 is mutated.

16. 10. The polynucleotide of claim 9, wherein the mutation comprises a change from thymine (T) to cytosine (C) at base 485 of the polynucleotide sequence set forth in SEQ ID NO:

61.

17. The polynucleotide of claim 9, comprising the polynucleotide sequence set forth in SEQ ID NO:

62.

18. A polypeptide characterized by comprising the amino acid sequence shown in SEQ ID NO: 4 or SEQ ID NO:

64.

19. A recombinant vector comprising the polynucleotide of claim 9.

20. 1. A method for producing an L-amino acid, comprising: A method for producing an L-amino acid, comprising culturing the microorganism according to any one of claims 1 to 8 and recovering an L-amino acid from the culture.

21. 21. The method of claim 20, wherein the L-amino acid is L-glutamic acid or L-lysine.

Images