A novel PiggyBac transposon system and its applications

Abstract

The present invention provides a nucleic acid construct comprising the following elements: a transposon 3' terminal repeat sequence, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a transposase coding sequence, and a promoter that controls the expression of the transposase. The present invention also provides a host cell or pharmaceutical composition comprising the nucleic acid construct and applications thereof.

Description

[Technical Field]

[0001] The present invention relates to the field of transposon vectors, and more particularly to a novel PiggyBac transposon system and its applications. [Background technology]

[0002] The introduction of exogenous genes into target cells and their stable expression, allowing for genetic modification of target cells, is a prerequisite for many cell therapy techniques, including immune cell therapy. Compared to transient expression, stable expression of exogenous genes allows for integration into the genome of target cells, allowing for long-term stable expression despite multiple cell passages or changes in culture conditions. Commonly used genetic modification systems include virus-based vectors, eukaryotic expression plasmid vectors, and transposon vectors. Genetic modification or modification of human primary T cells using non-viral vector-based methods has proven extremely challenging. Therefore, the majority of laboratories worldwide still use viral vector systems, including retroviral vectors such as lentiviral vector systems, for genetic modification of cells. Although viral vector systems are widely used, they face significant challenges, including complex virus production processes, relatively high security risks, and high production costs.

[0003] In recent years, transposon vector systems have been used to modify immune cells and further to immunotherapeutic tumors. The first transposon to be used in mammals was the fish-derived "Sleeping Beauty" transposon. However, its use in genetic engineering of mammalian cells has been severely limited due to defects such as excessive repression and relatively small fragment sizes (approximately 5 kb). The PiggyBac transposon is a transposon system derived from Lepidoptera, and its ability to carry large fragments allows it to integrate into a variety of eukaryotic host cells. The PiggyBac (PB) transposon system transposes primarily via a "cut-paste" mechanism, but because it leaves no footprint at the original site after transposition, it has been used in genome research, gene therapy, cell therapy, stem cell induction, and induced differentiation after modification.

[0004] WO2019046815A1 discloses a conventional PiggyBac transposon-based binary system comprising a vector containing PiggyBac transposase and a helper vector containing 5' ITR and 3' ITR. By combining this PiggyBac transposon system with electroporation, foreign genes can be introduced into T cells, NK cells, and HSPC cells. However, this binary system is difficult to implement because transposition does not occur unless the PiggyBac transposase vector and the helper vector are simultaneously transfected into cells, necessitating high transfection requirements. Furthermore, the PiggyBac transposase, which is the mechanism behind the PiggyBac transposon system, uses a "cut-paste" mechanism to insert a transposition fragment into the genome. However, as long as PiggyBac transposase expression continues, the transposition fragment integrated into the genome is re-cut, resulting in genome instability and a substantial reduction in transposition efficiency. The transposition efficiency of the general PiggyBac binary transposon system in T cells is typically low, at around 10%. Furthermore, WO2019046815A1 also describes that plasmid DNA is highly toxic to T cells and that this toxicity to T cells is related to the amount of DNA used for electroporation. The binary system undoubtedly increases the amount of plasmid DNA required for electroporation, increasing the toxicity to cells, particularly T cells, and reducing the survival rate of T cells transfected with plasmid DNA.

[0005] CN105154473B discloses a unified PiggyBac transposon vector, which combines the PiggyBac transposase vector and helper vector of the conventional binary PiggyBac transposon system into a single vector. The PiggyBac expression cassette and the foreign gene expression cassette share the same bidirectional polyA sequence within the same expression vector. This creates a mechanism for self-inactivation by cutting the polyA in the integrated PiggyBac transposase expression cassette, thereby effectively reducing the continuous expression of the constitutive PiggyBac transposase and improving the transposition efficiency of the PiggyBac transposase. Furthermore, by simplifying the binary system into a single unified vector, the total amount of DNA is significantly reduced, reducing the toxicity of the foreign DNA to T cells. However, since the expression cassette for the PiggyBac transposase and the expression cassette for the foreign gene share the same bidirectional polyA sequence, the corresponding expression cassettes in both directions can influence each other, and it is expected that the integration efficiency mediated by the single transposon vector in certain types of cells will be further improved. Summary of the Invention [Problem to be solved by the invention]

[0006] Therefore, currently, there is no highly efficient single transposon system that can integrate foreign genes efficiently and quickly terminate the integration function. [Means for solving the problem]

[0007] The inventors have constructed an integration system based on the PiggyBac transposon that mediates foreign genes in a manner that allows for highly efficient integration and stable expression in host cells.

[0008] One aspect of the present invention relates to a nucleic acid construct comprising or consisting of the following elements: a transposon 3' terminal repeat, a first polyA sequence, an insulator sequence having a transcription termination function, and a transposon 5' terminal repeat. In one or more embodiments, the nucleic acid construct further comprises one or more elements selected from a transposase coding sequence, a promoter controlling expression of the transposase, a polyclonal insertion site, an enhancer, a 5' UTR, a second polyA sequence, and a foreign gene of interest.

[0009] The present invention further provides a nucleic acid construct comprising the following elements: a transposon 3' terminal repeat sequence, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a coding sequence for a transposase, and a promoter that controls the expression of the transposase.

[0010] In one or more embodiments, the nucleic acid construct further comprises one or more elements selected from a polyclonal insertion site, an enhancer, a 5'UTR, a second polyA sequence, and an exogenous gene of interest.

[0011] In one or more embodiments, any one or more of the coding sequence of the transposase, the promoter controlling expression of the transposase, the 5'UTR, and the second polyA sequence are located outside the region between the transposon 3' terminal repeat sequence and the transposon 5' terminal repeat sequence.

[0012] In one or more embodiments, the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a promoter that controls expression of a transposase, a coding sequence for the transposase, and a second polyA sequence.

[0013] In one or more embodiments, the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a coding sequence for a transposase, and a promoter that controls expression of the transposase.

[0014] In one or more embodiments, the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a promoter that controls expression of a transposase, a coding sequence for the transposase, and a second polyA sequence.

[0015] In one or more embodiments, the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an enhancer, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a coding sequence for a transposase, and a promoter that controls expression of the transposase.

[0016] In one or more embodiments, the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an enhancer, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a promoter that controls expression of a transposase, a coding sequence for the transposase, and a second polyA sequence.

[0017] In one or more embodiments, the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a coding sequence for a transposase, a 5' UTR, and a promoter that controls expression of the transposase.

[0018] In one or more embodiments, the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a promoter that controls expression of a transposase, a 5' UTR, a coding sequence for the transposase, and a second polyA sequence.

[0019] In one or more embodiments, the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an enhancer, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a coding sequence for a transposase, a 5' UTR, and a promoter that controls expression of the transposase.

[0020] In one or more embodiments, the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an enhancer, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a promoter that controls expression of a transposase, a 5' UTR, a coding sequence for the transposase, and a second polyA sequence.

[0021] In one or more embodiments, the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, an insulator sequence having a transcription termination function, a polyclonal insertion site, a first polyA sequence, a transposon 5' terminal repeat sequence, a promoter controlling expression of a transposase, a 5' UTR, a coding sequence for the transposase, and a second polyA sequence.

[0022] In one or more embodiments, the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, an insulator sequence having a transcription termination function, a polyclonal insertion site, a first polyA sequence, an enhancer, a transposon 5' terminal repeat sequence, a promoter controlling expression of a transposase, a 5' UTR, a coding sequence for the transposase, and a second polyA sequence.

[0023] In one or more embodiments, the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, an enhancer, an insulator sequence having a transcription termination function, a polyclonal insertion site, a first polyA sequence, a transposon 5' terminal repeat sequence, a promoter controlling expression of a transposase, a 5' UTR, a coding sequence for the transposase, and a second polyA sequence.

[0024] In one or more embodiments, the polyclonal insertion site is utilized to operably insert the coding sequence of the exogenous gene and a promoter controlling expression of any exogenous gene.

[0025] In one or more embodiments, the orientation of the tailing signal functions of the first and second polyA sequences is the same or opposite.

[0026] In one or more embodiments, the orientation of the transposase expression cassette and the orientation of the exogenous gene expression cassette are the same or opposite.

[0027] In one or more embodiments, the orientation of the transposase expression cassette and the orientation of the sequence between the transposon 3' terminal repeat and the transposon 5' terminal repeat are the same or opposite.

[0028] In one or more embodiments, each of the above elements is independently single copy or multicopy.

[0029] In one or more embodiments, the elements are directly linked or linked by a linker or an enzyme cleavage site.

[0030] In the nucleic acid construct according to any one of the present invention, the transposon 5' terminal repeat sequence and the transposon 3' terminal repeat sequence can be interchanged in position.

[0031] In one or more embodiments, the transposon 3' terminal repeat sequence is a PiggyBac transposon 3' terminal repeat sequence. In a preferred embodiment, the nucleotide sequence of the transposon 3' terminal repeat sequence is set forth in SEQ ID NO:1.

[0032] In one or more embodiments, the sequence of the polyclonal insertion site is shown in SEQ ID NO:2.

[0033] In one or more embodiments, the first polyA sequence is set forth in SEQ ID NO:3, 13 or 16.

[0034] In one or more embodiments, the second polyA sequence is set forth in SEQ ID NO:3, 13 or 16.

[0035] In one or more embodiments, the enhancer is selected from the group consisting of a CMV enhancer sequence, an SV40 enhancer, a human ε-globin 5'HS2 enhancer, and a chicken β-globin gene 5'HS4 enhancer. Preferably, the enhancer sequence is set forth in any one of SEQ ID NOs: 4, 26 to 28.

[0036] In one or more embodiments, the insulator sequence having a transcription termination function is shown in SEQ ID NO:5 or 15.

[0037] In one or more embodiments, the transposon 5' terminal repeat is a PiggyBac transposon 5' terminal repeat. In a preferred embodiment, the nucleotide sequence of the transposon 5' terminal repeat is set forth in SEQ ID NO:6.

[0038] In one or more embodiments, the transposase is a PiggyBac transposase. In one or more embodiments, the amino acid sequence of the PiggyBac transposase is set forth in SEQ ID NO:36, and preferably, the coding sequence of the PiggyBac transposase is set forth in SEQ ID NO:7.

[0039] In one or more embodiments, the 5'UTR sequence is selected from the 5'UTRs of the C3 gene, ORM1 gene, HPX gene, FGA gene, AGXT gene, ASL gene, APOA2 gene, and ALB gene. Preferably, the 5'UTR sequence is set forth in any one of SEQ ID NOs: 8, 17 to 24.

[0040] In one or more embodiments, the promoter is selected from the group consisting of a CMV promoter, a miniCMV promoter, a CMV53 promoter, a miniSV40 promoter, a miniTK promoter, an MLP promoter, a pJB42CAT5 promoter, a YB_TATA promoter, an EF1α promoter, an SV40 promoter, a Ubiquitin B promoter, a CAG promoter, an HSP70 promoter, a PGK-1 promoter, a β-actin promoter, a TK promoter, and a GRP78 promoter. Preferably, the promoter is selected from the group consisting of a miniCMV promoter, a CMV53 promoter, a miniSV40 promoter, a miniTK promoter, an MLP promoter, a pJB42CAT5 promoter, and a YB_TATA promoter. In one or more embodiments, the sequence of the promoter is set forth in any one of SEQ ID NOs: 9, 37 to 42. Preferably, the promoter is a miniCMV promoter, the sequence of which is set forth in SEQ ID NO: 9.

[0041] In one or more embodiments, the transposase coding sequence comprises or is operably linked to a coding sequence for a single or multiple copies of a nuclear localization signal, which in one or more embodiments is a c-myc nuclear localization signal, preferably having the sequence set forth in SEQ ID NO:35.

[0042] In one or more embodiments, the nucleic acid construct comprises the sequence shown in SEQ ID NO:10 or 14.

[0043] In one or more embodiments, the nucleic acid construct is a recombinant vector. In one or more embodiments, the nucleic acid construct is a recombinant cloning vector or a recombinant expression vector.

[0044] The present invention further provides a host cell comprising (1) a nucleic acid construct described in any one of the embodiments herein, and / or (2) a sequence between the transposon 3' terminal repeat sequence and the transposon 5' terminal repeat sequence of the nucleic acid construct described in any one of the embodiments herein.

[0045] In one or more embodiments, the host cell is a mammalian cell. In one or more embodiments, the host cell is selected from an immune cell, a Jurkat cell, a K562 cell, an embryonic stem cell, a tumor cell, a HEK293 cell, or a CHO cell.

[0046] In one or more embodiments, the immune cells are any one or more of T cells, B cells, CIK cells, LAK cells, NK cells, cytotoxic T cells (CTLs), dendritic cells (DCs), tumor-infiltrating lymphocytes (TILs), macrophages, NKT cells, and γδT cells. Selected from.

[0047] The present invention further provides a pharmaceutical composition comprising the nucleic acid construct or host cell according to any one of the embodiments herein and a pharmaceutically acceptable excipient.

[0048] The present invention further provides an application of the nucleic acid construct or host cell according to any one of the embodiments herein in the manufacture of a drug, reagent or tool, or as a drug, reagent or tool, wherein the drug, reagent or tool is used to integrate an expression cassette of an exogenous gene into the genome of a target cell, or is used in gene therapy, cell therapy, stem cell induction or differentiation.

[0049] In one or more embodiments, the target cell is a mammalian cell. In one or more embodiments, the target cells are selected from T cells, Jurkat cells, K562 cells, embryonic stem cells, tumor cells, HEK293 cells, and CHO cells.

[0050] The present invention further provides a method for integrating an exogenous gene or an expression cassette thereof into the genome of a cell, the method comprising introducing into said cell a nucleic acid construct according to any one of the embodiments herein comprising an exogenous gene and optionally its promoter, and incubating said cell under conditions for integrating the exogenous gene or its expression cassette into the genome of the cell by means of any transposase.

[0051] In one or more embodiments, the transposase is a PiggyBac transposase.

[0052] In one or more embodiments, the introduction comprises viral-mediated transduction, microinjection, particle bombardment, biolistic transduction, electroporation, etc. In one embodiment of the invention, the introduction is electroporation.

[0053] In one or more embodiments, the cells are incubated for at least three passages. The present invention further provides a cell obtained by the method according to the present specification, the cell having an exogenous gene or an expression cassette thereof integrated into its genome. [Brief explanation of the drawings]

[0054] [Figure 1A] 1 is a schematic diagram of a nucleic acid construct according to the present specification. [Figure 1B] 1 is a schematic diagram of a nucleic acid construct according to the present specification. [Figure 2] These are fluorescent photographs of Jurkat cells electroporated with pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP. [Figure 3] These are the results of flow cytometry of Jurkat cells electroporated with pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP. [Figure 4] This shows the number of viable Jurkat cells electroporated with pKB20-EGFP, pKB201-EGFP, pKB202-EGFP, and pKC20-EGFP. [Figure 5] This shows the expression levels of PB transposase in Jurkat cells electroporated with pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP. [Figure 6] These are fluorescent photographs of K562 cells electroporated with pKB20-EGFP, pKB201-EGFP, pKB202-EGFP, and pKC20-EGFP. [Figure 7] This shows the number of viable cells in K562 cells electroporated with pKB20-EGFP, pKB201-EGFP, pKB202-EGFP, and pKC20-EGFP. [Figure 8] These are the results of flow cytometry of K562 cells electroporated with pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP. [Figure 9] Fluorescence positive rates of K562 cells electroporated with pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP, respectively. [Figure 10] These are fluorescent photographs of primary T cells electroporated with pKB20-EGFP, pKB201-EGFP, pKB202-EGFP, and pKC20-EGF. [Figure 11] These are the results of flow cytometry of T cells electroporated with pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP. [Figure 12] The positive rate results of electroporation of the double-plasmid PB transposon system into Jurkat cells. [Figure 13] This shows the positive rate results of electroporation of primary T cells with the double-plasmid PB transposon system. [Figure 14] Positive rates of Jurkat cells electroporated with pKB20-EGFP at reduced plasmid dosages. [Figure 15] This shows the time course of residual copy number of intracellular vectors. [Figure 16] Positive rate of Jurkat cells electroporated with pKB2003-EGFP. [Figure 17] Positive rate of primary T cells electroporated with pKB205-EGFP. [Figure 18] Schematic diagram of the genomic integration site mediated by the pKB20 vector in K562 sample 1. [Figure 19] Schematic diagram of the genomic integration site mediated by the pKB20 vector in K562 sample 2. [Figure 20] FIG. 1 is a schematic diagram of the genomic integration site mediated by the pKB20 vector in Jurkat sample 1. [Figure 21] FIG. 1 is a schematic diagram of the genomic integration site mediated by the pKB20 vector in Jurkat sample 2. [Figure 22] Flow cytometry results of the positive rate of primary T cells electroporated with pKB20-HER2CAR. [Figure 23] In vitro RTCA killing results of HER2CAR-T cells against target cells SKOV-3. [Figure 24] This is the result of flow cytometry of the positivity rate of primary T cells electroporated with pKB20-NY-ESO-1 TCR. [Figure 25] This shows the results of in vitro RTCA killing of NY-ESO-1 TCR-T against target cells A375. [Figure 26] This shows the results of flow cytometry of the positive rate of K562 cells electroporated with pNB328-EGFP. [Figure 27] This shows the flow cytometry results of the positive rate of primary T cells electroporated with pNB328-EGFP. DETAILED DESCRIPTION OF THE INVENTION

[0055] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (for example, in the Examples) can be combined with each other to form preferred embodiments.

[0056] Unless the context clearly dictates otherwise, as used in this specification and the appended claims, the singular forms "a," "an," and "said" include the plural. Similarly, the terms "a" (or "one"), "one or more," and "at least one" are used interchangeably herein. The term "comprises" and variations thereof are open-ended and are used in the specification and claims. Thus, the terms "comprises," "includes," and "containing" are used interchangeably.

[0057] Nucleic acid constructs and cells The term "nucleic acid construct" is defined herein as a single-stranded or double-stranded nucleic acid molecule, preferably an artificial nucleic acid molecule. Optionally, the nucleic acid construct further comprises one or more operably linked regulatory sequences, which are capable of regulating the expression of the coding sequence in a suitable host cell under compatible conditions. Expression should be understood to include any step involved in the production of a protein or polypeptide, including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion. The transposon system described herein is preferably a single nucleic acid construct, i.e., a single nucleic acid construct can achieve highly efficient transposition.

[0058] In the present invention, unless otherwise specified, the direction of the transposase expression cassette is defined as reverse. The direction and / or order of "this order" in the above "comprising the following elements in this order" refers to the order from upstream to downstream. In the present invention, unless otherwise specified, "along the forward direction" refers to the order from upstream to downstream, and "along the reverse direction" refers to the order from downstream to upstream.

[0059] In the present invention, the term "expression cassette" refers to all the elements necessary to express one gene, including a promoter, a coding sequence of the gene, and a PolyA tailing signal sequence.

[0060] The term "operably inserted / linked" is defined herein as a configuration in which a regulatory sequence is located at an appropriate site relative to a coding sequence of a DNA sequence so that the regulatory sequence controls the expression of a protein or polypeptide. In the nucleic acid construct of the present invention, one or more homologous or heterologous foreign genes and a promoter controlling the expression of any of the foreign genes are operably inserted into the polyclonal region by DNA recombination techniques, or the polyclonal region is replaced with one or more homologous or heterologous foreign gene coding sequences and a promoter controlling the expression of any of the foreign genes. The "operably linked" can be achieved by means of DNA recombination, and specifically, the nucleic acid construct is a recombinant nucleic acid construct.

[0061] As used herein, a "foreign gene" may be a nucleic acid molecule of any origin that is transferred into the genome of a host cell and then expressed or functions. Non-limiting examples of foreign genes include fluorescein reporter genes (e.g., green fluorescent protein, yellow fluorescent protein, etc.), luciferase genes (e.g., firefly luciferase, Renilla luciferase, etc.), naturally occurring functional protein genes, RNAi genes, and artificial chimeric genes (e.g., chimeric antigen receptor genes, Fc fusion protein genes, full-length antibody genes).

[0062] The term "coding sequence" is defined herein as that portion of a nucleic acid sequence which directly determines the amino acid sequence of its protein product. The boundaries of the coding sequence are typically determined by the ribosome binding site (in prokaryotes) upstream of and adjacent to the open reading frame at the 5' end of the mRNA and by the transcription termination sequence downstream of the open reading frame at the 3' end of the mRNA. A coding sequence may include, but is not limited to, DNA, cDNA, and recombinant nucleic acid sequences.

[0063] The term "regulatory sequences" is defined herein to include all components necessary or advantageous for the expression of the peptides of the present invention. Each regulatory sequence may be native or foreign to the nucleic acid sequence encoding the protein or polypeptide. These regulatory sequences include, but are not limited to, leader sequences, polyA sequences, propeptide sequences, promoters, signal sequences, and transcription terminators. At a minimum, regulatory sequences include promoters and transcription and translation termination signals. Linker regulatory sequences may be provided to introduce specific restriction sites to join the regulatory sequences to the coding region of the nucleic acid sequence encoding the protein or polypeptide.

[0064] The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence recognized by a host cell in which the nucleic acid sequence is to be expressed. The promoter sequence comprises a transcriptional regulatory sequence that mediates the expression of a protein or polypeptide. The promoter sequence is usually operably linked to the coding sequence from which the protein is to be expressed. The promoter may be any nucleotide sequence that shows transcriptional activity in the selected host cell, including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides that are homologous or heterologous to the host cell.

[0065] The regulatory sequence may be a suitable transcription termination sequence, i.e., a sequence recognized by a host cell to terminate transcription. The termination sequence is operably linked to the 3' end of the nucleic acid sequence encoding the protein or polypeptide. Any terminator that is functional in the host cell of choice may be used in the present invention.

[0066] The regulatory sequence may be a suitable leader sequence, i.e., an untranslated region of an mRNA that is important for translation in the host cell. The leader sequence is operably linked to the 5' end of the nucleic acid sequence encoding the polypeptide. Any terminator that is functional in the host cell of choice may be used in the present invention.

[0067] The regulatory sequence may be a signal peptide coding region, which encodes an amino acid sequence linked to the amino terminus of a protein or polypeptide and directs the encoded polypeptide to enter the cellular secretory pathway. The 5' end of the coding region of a nucleic acid sequence may naturally contain a signal peptide coding region naturally linked to a segment of the coding region in translational reading frame that secretes the polypeptide. Alternatively, the 5' end of the coding region may contain a signal peptide coding region foreign to the coding sequence. If the coding sequence does not normally contain a signal peptide coding region, it is necessary to add a foreign signal peptide coding region. Alternatively, the foreign signal peptide coding region may easily replace the native signal peptide coding region to promote secretion of the polypeptide. However, any signal peptide coding region capable of directing the expressed polypeptide to enter the secretory pathway of the host cell used is applicable to the present invention.

[0068] The nucleic acid construct of the present invention comprises a transposon 3' terminal repeat, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat, a transposase coding sequence, and a promoter controlling expression of the transposase. The nucleic acid construct further comprises one or more elements selected from a polyclonal insertion site, an enhancer, a 5' UTR, and a second polyA sequence. In a particularly preferred embodiment, the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat, a polyclonal insertion site, a first polyA sequence, an enhancer, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat, a transposase coding sequence, a 5' UTR, and a promoter controlling expression of the transposase, as shown in Figure 1A. In another particularly preferred embodiment, the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an enhancer, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a promoter controlling expression of a transposase, a 5' UTR, a transposase coding sequence, and a second polyA sequence, as shown in Figure 1B. Each element in the nucleic acid construct herein may be independently single-copy or multi-copy.

[0069] In the present specification, the transposon 5' terminal repeat sequence and the transposon 3' terminal repeat sequence can be interchanged. Preferably, the transposon 5' terminal repeat sequence is a PiggyBac transposon 5' terminal repeat sequence, and the transposon 3' terminal repeat sequence is a PiggyBac transposon 3' terminal repeat sequence.

[0070] As used herein, the transposase is preferably a PiggyBac transposase, the coding sequence of which contains or is operably linked to a coding sequence of a single or multiple copies of a nuclear localization signal, thereby improving transposition efficiency. An exemplary coding sequence of a PiggyBac transposase is shown in SEQ ID NO:7. An exemplary coding sequence of a nuclear localization signal is shown in SEQ ID NO:35.

[0071] The nucleic acid construct of the present invention may use polyA sequences for the transposase and the foreign gene. This design may shorten the overall length of the nucleic acid construct to some extent, allowing for the integration of a longer foreign gene for transposition. Alternatively, the nucleic acid construct of the present invention may use separate polyA sequences for the transposase and the foreign gene, and the tailing signal functions of both may be in the same or opposite directions. This design avoids interference between the corresponding expression cassettes in both directions by sharing the same bidirectional polyA sequence. The polyA sequence described herein may or may not have a transcription termination function in both directions. Preferably, the polyA sequences are independently selected from SEQ ID NO: 3, 13, or 16.

[0072] The nucleic acid construct of the present invention may use or further use an insulator sequence for transcription termination of the transposase and foreign gene. Therefore, any terminal of any polyA sequence may contain an insulator sequence. Preferably, the insulator sequence of the present invention is located between the transposon 5'-terminal repeat and the transposon 3'-terminal repeat. The insulator sequence of the present specification has a transcription termination function, and the sequence may be any sequence having a transcription termination function known in the art. Preferably, the insulator sequence having a transcription termination function is set forth in SEQ ID NO: 5 or 15.

[0073] Therefore, the transposase may achieve transcription termination using a polyA sequence, an insulator sequence, or a polyA sequence and an insulator sequence, and the foreign gene may achieve transcription termination using a polyA sequence, an insulator sequence, or a polyA sequence and an insulator sequence. Preferably, any of the insulator sequences is located between the transposon 5' terminal repeat and the transposon 3' terminal repeat.

[0074] In the nucleic acid constructs of the present invention, a suitable transposase promoter sequence is a promoter sequence that can drive high-level expression of a transposase operably linked thereto, and includes, but is not limited to, the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters, such as, but not limited to, the actin promoter, myosin promoter, protoheme promoter, and creatine kinase promoter. In one or more embodiments, the transposase promoter is selected from the group consisting of the CMV promoter, miniCMV promoter, CMV53 promoter, miniSV40 promoter, miniTK promoter, MLP promoter, pJB42CAT5 promoter, YB_TATA promoter, EF1α promoter, SV40 promoter, Ubiquitin B promoter, CAG promoter, HSP70 promoter, PGK-1 promoter, β-actin promoter, TK promoter, and GRP78 promoter. Preferably, the promoter is selected from the group consisting of the miniCMV promoter, CMV53 promoter, miniSV40 promoter, miniTK promoter, MLP promoter, pJB42CAT5 promoter, and YB_TATA promoter. More preferably, the promoter is the miniCMV promoter. Because the miniCMV promoter is significantly shorter than the CMV promoter, the vector length is shorter, allowing for the integration of larger exogenous genes. In one or more embodiments, a 5'UTR sequence is added between the miniCMV and the transposase to enhance transcription and translation. The 5'UTR sequence is shown in any one of SEQ ID NOs: 8, 17 to 24.

[0075] The nucleic acid construct of the present invention may contain an enhancer, and the enhancer may be located at any end of any element in the nucleic acid construct described herein other than the enhancer. Preferably, the enhancer is located between the transposon 3' terminal repeat and the transposon 5' terminal repeat. More preferably, the enhancer is located downstream of the first polyA sequence. The enhancer sequence is set forth in any one of SEQ ID NOs: 4, 25 to 28. As used herein, the nucleic acid construct may contain none, one, or both of the 5' UTR sequence and the enhancer sequence, and the resulting nucleic acid construct can highly efficiently integrate a foreign gene into the genome of a cell.

[0076] It is also necessary to add a regulatory sequence that can regulate the expression of the polypeptide depending on the growth conditions of the host cell. Examples of regulatory systems include systems that can respond to chemical or physical stimuli (including the presence of a regulatory compound) and turn on or off gene expression. Other examples of regulatory sequences include regulatory sequences that cause gene amplification. In these examples, the regulatory sequence is operably linked to the nucleic acid sequence encoding the protein or polypeptide.

[0077] In a specific embodiment comprising one polyA signal sequence, the nucleic acid construct of the present invention comprises a PiggyBac transposon 3' terminal repeat (3'ITR) (SEQ ID NO:1), a polyclonal region (SEQ ID NO:2), a polyA signal sequence (SEQ ID NO:3, 13, or 16), an optional enhancer motif sequence (SEQ ID NO:4, or any one of SEQ ID NOs:25-28), an insulator sequence (SEQ ID NO:5 or 15), a reverse complement of a PiggyBac transposon 5' terminal repeat (5'ITR) (SEQ ID NO:6), a reverse complement of a PiggyBac transposase coding sequence (SEQ ID NO:7), a reverse complement of an optional 5'UTR sequence (SEQ ID NO:8, or any one of SEQ ID NOs:17-24), and a miniCMV promoter sequence (SEQ ID NO:9). and the reverse complement of SEQ ID NO:9), in that order. In one or more embodiments, the nucleic acid construct of the invention has the sequence shown in SEQ ID NO:10.

[0078] In a specific embodiment comprising two polyA signal sequences, the nucleic acid construct of the invention comprises a PiggyBac transposon 3' terminal repeat (3'ITR) (SEQ ID NO:1), a polyclonal region (SEQ ID NO:2), a first polyA signal sequence (SEQ ID NO:3, 13, or 16), an optional enhancer motif sequence (SEQ ID NO:4, or any one of SEQ ID NOs:25-28), an insulator sequence (SEQ ID NO:5 or 15), a PiggyBac transposon 5' terminal repeat (5'ITR) (SEQ ID NO:6), a miniCMV promoter sequence (SEQ ID NO:9), an optional 5'UTR sequence (SEQ ID NO:8, or any one of SEQ ID NOs:17-24), a coding sequence for PiggyBac transposase (SEQ ID NO:7), and a second polyA signal sequence (SEQ ID NO:8). In one or more embodiments, the nucleic acid construct of the invention comprises the sequence shown in SEQ ID NO:14.

[0079] In certain embodiments, the nucleic acid construct is a recombinant vector. The recombinant vector may be a recombinant cloning vector or a recombinant expression vector. Each element of the nucleic acid construct of the present invention may be incorporated into a variety of vectors, such as plasmids, phagemids, phage derivatives, animal viruses, and cosmids. Typically, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction enzyme sites, and one or more selectable markers.

[0080] To assess the expression of the introduced gene, the vector to be introduced into the cells may contain either a selectable marker gene or a reporter gene, or both, to identify and select cells from a group of cells. A selectable marker can be introduced into a single DNA and used in a co-transfection process. Both the selectable marker and the reporter gene may have appropriate regulatory sequences flanking them so that they can be expressed in the host cell. Useful selectable markers include Flag, HA, or V5. A reporter gene is used to identify potentially transfected cells and to assess the functionality of the regulatory sequences. After the DNA is introduced into the recipient cells, expression of the reporter gene is measured at an appropriate time. Suitable reporter genes include genes encoding luciferase, β-galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein.

[0081] A recombinant cloning vector is used to provide each element of the nucleic acid construct of the present invention and a coding sequence containing any foreign gene. The recombinant cloning vector may be a recombinant vector obtained by recombination of each element of the nucleic acid construct of the present invention with a pUC18, pUC19, pMD18-T, pMD19-T, pGM-T vector, pUC57, pMAX, or pDC315 series vector.

[0082] Recombinant expression vectors are used to integrate and express an expression cassette for a foreign gene into the genome of an appropriate host cell using each element of the nucleic acid construct of the present invention. Such vectors are suitable for replication and integration in eukaryotic cells. Typical cloning vectors contain transcription and translation terminators, an initiation sequence, and a promoter used to control the expression of the desired nucleic acid sequence. Recombinant expression vectors are recombinant vectors obtained by recombining each element of the nucleic acid construct of the present invention with a pCDNA3 series vector, a pCDNA4 series vector, a pCDNA5 series vector, a pCDNA6 series vector, a pRL series vector, a pUC57 vector, a pMAX vector, or a pDC315 series vector.

[0083] The recombinant vector (recombinant cloning vector or recombinant expression vector) may be a recombinant viral vector, including, but not limited to, a recombinant adenovirus vector, a recombinant adeno-associated virus vector, a recombinant retrovirus vector, a recombinant herpes simplex virus vector, or a recombinant vaccinia virus vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and molecular biology manuals.

[0084] The nucleic acid constructs described herein may typically be obtained by PCR amplification. Specifically, primers may be designed based on the nucleotide sequences disclosed herein, particularly the open reading frame sequences, and relevant sequences may be obtained by amplification using a commercially available cDNA library or a cDNA library prepared by conventional methods well known to those skilled in the art as a template. For long sequences, PCR amplification typically requires two or more rounds of amplification, followed by the ligation of the amplified fragments in the correct order. Alternatively, the nucleic acid constructs described herein may be directly synthesized.

[0085] The present invention further provides a host cell comprising a nucleic acid construct according to any one of the embodiments herein. Host cells include mammalian cells, as well as various cells used in mammalian cell production processes, such as E. coli cells, which can be used to provide the nucleic acid constructs or vectors described herein. In certain embodiments, the present invention provides a mammalian cell comprising the nucleic acid construct or vector described herein, including, but not limited to, T cells, B cells, CIK cells, LAK cells, NK cells, cytotoxic T cells (CTLs), dendritic cells (DCs), tumor-infiltrating lymphocytes (TILs), macrophages, NKT cells, γδ T cells, Jurkat cells, K562 cells, embryonic stem cells, tumor cells, HEK293 cells, and CHO cells.

[0086] Pharmaceutical Composition The pharmaceutical compositions of the present invention comprise a nucleic acid construct or cell described herein and a pharmaceutically acceptable additive. As used herein, a "pharmaceutically acceptable additive" refers to a pharmaceutically or food-acceptable vector, solvent, suspending agent, or excipient used to introduce the nucleic acid construct or cell of the present invention into an animal or human. As used herein, a pharmaceutically acceptable additive is non-toxic to recipients of the composition at the dosage and concentration employed. Various types of vectors or excipients commonly used for delivering therapeutic agents to living organisms, as known in the art, may be included. Exemplary additives may be liquid or solid and include, but are not limited to, pH adjusters, surfactants, carbohydrates, adjuvants, antioxidants, chelating agents, ionic strength enhancers, preservatives, carriers, glidants, sweeteners, dyes / colorants, flavoring agents, wetting agents, dispersing agents, suspending agents, stabilizers, isotonicity agents, solvents, or emulsifiers. In some embodiments, the pharmaceutically acceptable additive may include one or more inactive ingredients, including, but not limited to, stabilizers, preservatives, additives, adjuvants, sprays, compressed air or other suitable gases, or other suitable inactive ingredients used in combination with medicinal compounds. Specifically, suitable additives may be additives commonly used in the art for administering transposon systems or cells containing the same. Examples of suitable additives include various oils such as lactose, mannitol, and corn oil; PiggyBacS; saline; buffers such as polyethylene glycol, glycerin, polypropylene glycol, and dimethyl sulfoxide; amides such as dimethylacetamide; proteins such as albumin; detergents such as Tween 80; monosaccharides and oligosaccharides such as glucose; lactose; cyclodextrin; and starch.

[0087] Other pharmaceutical compositions will be apparent to those skilled in the art, including formulations in which the nucleic acid constructs or cells described herein are included in sustained or controlled release delivery formulations. Several other technologies for providing sustained or controllable delivery modes (e.g., liposomal vectors, biodegradable microparticles or porous beads, and depot injections) are also well known to those skilled in the art.

[0088] Pharmaceutical compositions for in vivo administration are usually provided in the form of a sterile preparation. Sterilization is achieved by filtration through sterile filtration membranes. If the composition is lyophilized, it is sterilized by this method before or after lyophilization and reconstitution. Compositions used for parenteral administration can be stored in lyophilized form or in solution. Parenteral compositions are usually placed into a container with a sterile access port, for example, an intravenous solution bag or vial with a stopper that can be pierced by a hypodermic injection needle.

[0089] Typically, the composition contains a therapeutically effective amount of the reagent described herein. A therapeutically effective amount is a dose that can treat, prevent, alleviate, and / or alleviate a disease or condition in a subject. These effects can be achieved by inserting a corresponding functional exogenous gene, which has a function corresponding to a specific application, such as a therapeutic function or an inducing function. The therapeutically effective amount is determined based on factors such as the patient's age, sex, the condition and its severity, and other physical conditions of the patient. The therapeutically effective amount may be administered as a single dose or as multiple doses depending on an effective treatment plan. In the present specification, the subject or patient is typically a mammal, particularly a human. Exemplarily, the composition contains the nucleic acid construct or cell described herein in a weight ratio of, for example, 0.001 to 50%, preferably 0.01 to 30%, and more preferably 0.05 to 10%.

[0090] The compositions herein may be used in combination with other agents that perform a function similar or equivalent to that performed by the exogenous gene, for example, agents that treat the disease or condition that the exogenous gene is intended to treat. The dosage of such agents may be determined by one of skill in the art.

[0091] The pharmaceutical compositions of the present invention may be in a variety of dosage forms, as long as they allow the active ingredient to be effectively delivered to a mammalian organism, and may be prepared in a unit dosage form. Dosage forms may be selected from, for example, gels, sprays, tablets, capsules, powders, particles, syrups, solutions, suspensions, injections, powders, pills, time-release formulations, infusions, suspensions, etc. Those skilled in the art may easily select a dosage form suitable for the type of disease to be prevented or treated by the nucleic acid constructs or cells of the present invention. From the viewpoint of ease of preparation and storage, preferred compositions are solid compositions, particularly tablets and solid- or liquid-filled capsules. The nucleic acid constructs or cells of the present invention or compositions thereof may be stored in sterilized equipment suitable for injection or intravenous infusion. The nucleic acid constructs or cells of the present invention or compositions thereof may be stored in an appropriate container and further placed in a reagent kit or drug box.

[0092] Methods and Applications The present inventors have demonstrated through their research that the nucleic acid construct described herein can achieve highly efficient genome integration of a foreign gene in a controllable manner. When a foreign gene is integrated into a genome, it can effectively terminate the transcriptional expression of PiggyBac transposase and function as an insulator for the foreign gene expression cassette, thereby reducing the impact on gene expression near the integration site of the integrated foreign gene expression cassette. Therefore, the present invention relates to a method for integrating a foreign gene or its expression cassette into the genome of a cell, comprising introducing into the cell a nucleic acid construct according to any one of the embodiments described herein, comprising a foreign gene and an optional promoter thereof, and incubating the cell under conditions in which the foreign gene or its expression cassette is integrated into the cell genome by an optional PiggyBac transposase. The present invention also provides a cell obtained by the above method, in which a foreign gene or its expression cassette is integrated into the genome.

[0093] Methods for incorporating nucleic acid constructs into cells are known in the art. Vectors can be easily incorporated into host cells, such as mammalian, bacterial, yeast, or insect cells, by any method known in the art. For example, vectors can be introduced into host cells by physical, chemical, or biological means. Exemplary physical or chemical methods include calcium phosphate precipitation, lipid-mediated transfection, microinjection, particle bombardment, microinjection, biolistic transduction, electroporation, colloidal dispersion systems, macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems (including oil-in-water emulsions, micelles, mixed micelles, and liposomes). Biological methods for incorporating nucleic acid constructs into host cells include virus-mediated transduction, particularly retroviral vectors. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, etc. Selected nucleic acid sequences may be inserted into vectors and packaged into retroviral particles using techniques well known in the art. The recombinant virus is then isolated and delivered to target cells in vivo or in vitro. Reagents used to package the virus are well known in the art and include common lentiviral vector systems, including, for example, pRsv-REV, pMDlg-pRRE, pMD2G, target interference plasmids, etc.

[0094] The present invention further provides an application of the nucleic acid construct or host cell described in any one of the embodiments herein in the manufacture of a drug, reagent, or tool, or as a drug, reagent, or tool, wherein the drug, reagent, or tool is used to integrate an expression cassette of an exogenous gene into the genome of a target cell, or is used for gene therapy, cell therapy, stem cell induction, or differentiation. In one or more embodiments, the target cell is a mammalian cell, including, but not limited to, a T cell, a B cell, a CIK cell, a LAK cell, a NK cell, a cytotoxic T cell (CTL), a dendritic cell (DC), a tumor-infiltrating lymphocyte (TIL), a macrophage, a NKT cell, a γδ T cell, a Jurkat cell, a K562 cell, an embryonic stem cell, a tumor cell, a HEK293 cell, or a CHO cell.

[0095] <Specific embodiment> <Embodiment 1> A nucleic acid construct comprising or consisting of the following elements: a transposon 3' terminal repeat sequence, a first polyA sequence, an insulator sequence having a transcription termination function, and a transposon 5' terminal repeat sequence, Preferably, the nucleic acid construct further comprises one or more elements selected from a coding sequence for a transposase, a promoter that controls expression of the transposase, a polyclonal insertion site, an enhancer, a 5'UTR, a second polyA sequence, and a foreign gene of interest; Preferably, any one or more of the coding sequence of the transposase, the promoter controlling expression of the transposase, the 5'UTR, and the second polyA sequence are located outside the region between the transposon 3' terminal repeat sequence and the transposon 5' terminal repeat sequence.

[0096] <Embodiment 2> 2. The nucleic acid construct according to embodiment 1, comprising the following elements: a transposon 3' terminal repeat sequence, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a coding sequence for a transposase, and a promoter that controls expression of the transposase; Preferably, the nucleic acid construct further comprises one or more elements selected from a polyclonal insertion site, an enhancer, a 5'UTR, a second polyA sequence, and a foreign gene of interest.

[0097] <Embodiment 3> 3. The nucleic acid construct of embodiment 2, comprising: the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a coding sequence for a transposase, and a promoter that controls expression of the transposase; the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an enhancer, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a coding sequence for a transposase, and a promoter that controls expression of the transposase; the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a coding sequence for a transposase, a 5' UTR, and a promoter that controls expression of the transposase; the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an enhancer, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a coding sequence for a transposase, a 5' UTR, and a promoter that controls expression of the transposase; the nucleic acid construct comprises, in this order, a transposon 3'-terminal repeat sequence, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5'-terminal repeat sequence, a promoter that controls expression of a transposase, a coding sequence for the transposase, and a second polyA sequence; the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a promoter that controls expression of a transposase, a coding sequence for the transposase, and a second polyA sequence; the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an enhancer, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a promoter that controls expression of a transposase, a coding sequence for the transposase, and a second polyA sequence; the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a promoter controlling expression of a transposase, a 5' UTR, a coding sequence for the transposase, and a second polyA sequence; or the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an enhancer, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a promoter that controls expression of a transposase, a 5' UTR, a transposase coding sequence, and a second polyA sequence; the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, an insulator sequence having a transcription termination function, a polyclonal insertion site, a first polyA sequence, a transposon 5' terminal repeat sequence, a promoter that controls expression of a transposase, a 5' UTR, a coding sequence for the transposase, and a second polyA sequence; the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, an insulator sequence having a transcription termination function, a polyclonal insertion site, a first polyA sequence, an enhancer, a transposon 5' terminal repeat sequence, a promoter controlling expression of a transposase, a 5'UTR, a coding sequence for the transposase, and a second polyA sequence; or The nucleic acid construct comprises, in this order: a transposon 3' terminal repeat sequence, an enhancer, an insulator sequence having a transcription termination function, a polyclonal insertion site, a first polyA sequence, a transposon 5' terminal repeat sequence, a promoter that controls the expression of a transposase, a 5'UTR, a coding sequence for the transposase, and a second polyA sequence.

[0098] <Embodiment 4> The nucleic acid construct according to any one of embodiments 1 to 3, wherein the nucleic acid construct comprises: the orientation of the transposase expression cassette and the orientation of the foreign gene expression cassette are the same or opposite; the orientation of the transposase expression cassette and the orientation of the sequence between the transposon 3' terminal repeat sequence and the transposon 5' terminal repeat sequence are the same or opposite; the transposon 5' terminal repeat and the transposon 3' terminal repeat can exchange positions; the transposon 3'-terminal repeat sequence is a PiggyBac transposon 3'-terminal repeat sequence; the transposon 5' terminal repeat sequence is a PiggyBac transposon 5' terminal repeat sequence; the enhancer is selected from the group consisting of a CMV enhancer sequence, an SV40 enhancer, a human ε-globin 5′HS2 enhancer, and a chicken β-globin gene 5′HS4 enhancer; the transposase is a PiggyBac transposase; the 5'UTR is selected from the 5'UTRs of the C3 gene, ORM1 gene, HPX gene, FGA gene, AGXT gene, ASL gene, APOA2 gene, and ALB gene; the promoter is selected from the group consisting of a CMV promoter, a miniCMV promoter, a CMV53 promoter, a miniSV40 promoter, a miniTK promoter, an MLP promoter, a pJB42CAT5 promoter, a YB_TATA promoter, an EF1α promoter, an SV40 promoter, a Ubiquitin B promoter, a CAG promoter, an HSP70 promoter, a PGK-1 promoter, a β-actin promoter, a TK promoter, and a GRP78 promoter; A nucleic acid construct characterized in that the coding sequence of the transposase has one or more characteristics selected from the following: the coding sequence of a single copy or multiple copies of a nuclear localization signal, or the coding sequence is operably linked thereto.

[0099] <Embodiment 5> The nucleic acid construct according to any one of embodiments 1 to 3, wherein the nucleic acid construct comprises: the nucleotide sequence of the transposon 3' terminal repeat sequence is set forth in SEQ ID NO:1; the nucleotide sequence of the transposon 5' terminal repeat sequence is set forth in SEQ ID NO:6; the sequence of the polyclonal insertion site is set forth in SEQ ID NO:2; the first polyA sequence is set forth in SEQ ID NO: 3, 13 or 16; the second polyA sequence is set forth in SEQ ID NO: 3, 13 or 16; The enhancer sequence is represented by any one of SEQ ID NOs: 4, 26 to 28; the insulator sequence is set forth in SEQ ID NO: 5 or 15; the amino acid sequence of the PiggyBac transposase is set forth in SEQ ID NO:36, and preferably the coding sequence of the PiggyBac transposase is set forth in SEQ ID NO:7; The 5'UTR sequence is set forth in any one of SEQ ID NOs: 8, 17 to 24; The sequence of the promoter is shown in any one of SEQ ID NO: 9, SEQ ID NO: 37 to 42; A nucleic acid construct characterized in that the nuclear localization signal is a c-myc nuclear localization signal, preferably having one or more characteristics selected from the following: the nuclear localization signal has the sequence shown in SEQ ID NO:35.

[0100] <Embodiment 6> A nucleic acid construct according to any one of embodiments 1 to 3, the nucleic acid construct comprises the sequence shown in SEQ ID NO: 10 or 14; or A nucleic acid construct, characterized in that said nucleic acid construct is a recombinant vector, preferably said nucleic acid construct is a recombinant cloning vector or a recombinant expression vector.

[0101] <Embodiment 7> A host cell comprising: (1) A nucleic acid construct according to any one of embodiments 1 to 6, and / or (2) A sequence between the transposon 3'-terminal repeat sequence and the transposon 5'-terminal repeat sequence of the nucleic acid construct according to any one of embodiments 1 to 6, Preferably, the host cell is a mammalian cell, More preferably, the host cell is selected from T cells, Jurkat cells, K562 cells, embryonic stem cells, tumor cells, HEK293 cells, and CHO cells.

[0102] <Embodiment 8> A pharmaceutical composition comprising the nucleic acid construct according to any one of embodiments 1 to 6 or the host cell according to embodiment 8, and a pharmaceutically acceptable additive.

[0103] <Embodiment 9> The use of the nucleic acid construct according to any one of embodiments 1 to 6 or the host cell according to embodiment 7 in the manufacture of a drug, reagent or tool, or as a drug, reagent or tool, wherein the drug, reagent or tool is used to integrate an expression cassette of an exogenous gene into the genome of a target cell, or is used in gene therapy, cell therapy, stem cell induction or differentiation, Preferably, the target cell is a mammalian cell; More preferably, the target cells are selected from immune cells, Jurkat cells, K562 cells, embryonic stem cells, tumor cells, HEK293 cells, CHO cells, More preferably, the immune cells are selected from one or more of T cells, B cells, CIK cells, LAK cells, NK cells, cytotoxic T cells (CTLs), dendritic cells (DCs), tumor-infiltrating lymphocytes (TILs), macrophages, NKT cells, and γδT cells.

[0104] <Embodiment 10> 10. A method for integrating an exogenous gene or an expression cassette thereof into the genome of a cell, comprising: introducing into said cell the nucleic acid construct according to any one of embodiments 1 to 6, comprising an exogenous gene and any promoter thereof; and incubating said cell under conditions for integrating the exogenous gene or the expression cassette thereof into the genome of said cell by any transposase, wherein said exogenous gene and any promoter thereof are located at a polyclonal insertion site of said nucleic acid construct; Preferably, the method wherein the transposase is a PiggyBac transposase.

[0105] Advantages of this invention: 1) The transposon-based vector system of the present invention has multiple regulatory elements that regulate PiggyBac expression and the integration of foreign genes mediated by it at multiple stages. The promoter used herein, which drives the expression of PiggyBac transposase, reduces expression intensity and shortens DNA length. Furthermore, an enhancer element is incorporated to instantly enhance transposase expression in the intact plasmid, fulfilling the excision and integration functions of PiggyBac transposase. When the expression cassette for the foreign gene is excised from the intact plasmid, the enhancer's enhancing effect on the promoter is lost, resulting in highly efficient opening or closing of the PiggyBac transposase. This results in a short-term peak in transposase expression and then a decline, mediating the integration of the foreign gene and significantly reducing cytotoxicity.

[0106] 2) The addition of a 5'UTR sequence downstream of the promoter, in combination with an enhancer element, instantly increases the expression intensity of the transposase, thereby sufficiently increasing the expression intensity of the PiggyBac transposase and improving the overall integration efficiency.As shown in the Examples below, the integration efficiency of the transposon-based vector system of the present invention was significantly improved.

[0107] 3) The PiggyBac expression cassette employs an insulator sequence with a transcription termination effect, which effectively terminates transcription before the integration of the foreign gene, allowing the transposase gene to be expressed. When a foreign gene was integrated into the genome, deletion of the insulator sequence with a transcription termination effect effectively terminated the transcriptional expression of the PiggyBac transposase. Furthermore, when the insulator sequence with a transcription termination effect and the foreign gene expression cassette were integrated into the genome, the insulator blocked the influence of foreign gene expression on neighboring regions in the genome, thereby reducing the influence of the integrated foreign gene expression cassette on gene expression near the integration site.

[0108] 4) The transposon vector system of the present invention has fewer insertion sites in the genome and fewer insertion sites within genes, so it has less impact on genome stability.

[0109] 5) mRNA levels have little effect on gene expression profiles. Next, embodiments of the present invention are described in detail with reference to examples. Those skilled in the art should understand that the following examples are used to explain the present invention and do not limit the scope of the present invention. If specific techniques or conditions are not specified in the examples, the techniques or conditions will be those described in literature in this field (see, for example, Joseph Sambrook et al., translated by Huang Pedang et al., "Molecular Cloning: A Laboratory Manual," 3rd Edition, Scientific Press) or the product instructions. Reagents or instruments for which the manufacturer is not specified are all common commercially available products. All cell lines used in the following examples were purchased from ATCC. [Example]

[0110] Example 1: Vector construction pKB20: A long sequence (SEQ ID NO:1) consisting of the PiggyBac transposon 3' terminal repeat (3'ITR) (SEQ ID NO:1), a polyclonal region (SEQ ID NO:2), a bGH polyA signal sequence (SEQ ID NO:3), an enhancer motif sequence (SEQ ID NO:4), an insulator sequence with transcription termination function (C2 transcription arrest site, SEQ ID NO:5), the reverse complement of the PiggyBac transposon 5' terminal repeat (5'ITR) (SEQ ID NO:6), the reverse complement of the PiggyBac transposase coding sequence (SEQ ID NO:7), the reverse complement of the 5'UTR sequence (SEQ ID NO:8), and the reverse complement of the miniCMV promoter sequence (SEQ ID NO:9), in this order. The resulting fragments were ligated to form the plasmid pKB20 (NO:10), which was then synthesized by Shanghai Jerui Biotechnology Co., Ltd. AgeI and AscI enzyme cleavage sites were added to both ends of the fragment, which was then inserted into pUC57 (purchased from Shanghai Jerui Biotechnology) and named pKB20. The plasmid schematic is shown in Figure 1A.

[0111] pKB20-EGFP: The EF1A promoter sequence with an NFAT motif (SEQ ID NO: 11) was inserted between the XbaI and EcoRI sites of the polyclonal region of pKB20, and the EGFP coding sequence (SEQ ID NO: 12) was inserted between the EcoRI and SalI sites. This construct was named pKB20-EGFP. The EF1A promoter sequence with an NFAT motif and the EGFP coding sequence were synthesized by Shanghai Jierui Biotechnology Co., Ltd.

[0112] pKB205: PiggyBac transposon 3' terminal repeat (3'ITR) (SEQ ID NO:1), polyclonal clone (MCS) region (SEQ ID NO:2), bGH polyA signal sequence (SEQ ID NO:3), enhancer motif sequence (SEQ ID NO:4), insulator sequence with transcription termination function (C2 transcription arrest site, SEQ ID NO:5), PiggyBac transposon 5' terminal repeat (5'ITR) (SEQ ID NO:6), miniCMV promoter sequence (SEQ ID NO:9), 5'UTR sequence (SEQ ID NO:8), PiggyBac transposase coding sequence (SEQ ID NO:7), and SV40 polyA signal sequence (SEQ ID NO:13) in this order. The resulting fragments were ligated to form the plasmid pKB205 (NO:14), which was then synthesized by Shanghai Jerui Biotechnology Co., Ltd. AgeI and AscI enzyme cleavage sites were added to both ends of the fragment, which was then inserted into pUC57 (purchased from Shanghai Jerui Biotechnology) and named pKB205. The plasmid schematic is shown in Figure 1B.

[0113] pKB205-EGFP: The EF1A promoter sequence with an NFAT motif (SEQ ID NO: 11) was inserted between the XbaI and EcoRI sites of the polyclonal region of pKB205, and the EGFP coding sequence (SEQ ID NO: 12) was inserted between the EcoRI and SalI sites. This construct was named pKB205-EGFP. The EF1A promoter sequence with an NFAT motif and the EGFP coding sequence were synthesized by Shanghai Jierui Biotechnology Co., Ltd.

[0114] The following plasmids are obtained in the same manner. pKB201-EGFP: Obtained by deleting the enhancer motif sequence from the pKB20-EGFP sequence.

[0115] pKB202-EGFP: Obtained by deleting the 5'UTR sequence from the pKB20-EGFP sequence.

[0116] pKB2003-EGFP: Obtained by deleting the enhancer motif sequence and 5'UTR sequence from the pKB20-EGFP sequence.

[0117] pKC20-EGFP: This is obtained by deleting the miniCMV promoter sequence, 5'UTR sequence, and the coding sequence of PiggyBac transposase including the nuclear localization signal from the pKB20-EGFP sequence.

[0118] pK201-PB: This is obtained by deleting the 5'UTR, 5'ITR, enhancer motif, bGH polyA signal sequence, polyclonal site, and 3'ITR from the pKB20 sequence, leaving only the miniCMV, the coding sequence for the PiggyBac transposase including the nuclear localization signal, and the insulator sequence with transcription termination function.

[0119] pKB20I1-EGFP: This is obtained by replacing the insulator sequence having the transcription termination function in pKB20-EGFP with the transcription arrest site of the human α2 globin gene (SEQ ID NO: 15).

[0120] pKB20A1-EGFP: Obtained by replacing the bGH polyA in pKB20-EGFP with SEQ ID NO:16.

[0121] pKB20A2-EGFP: Obtained by replacing the bGH polyA in pKB20-EGFP with the SV40 polyA signal sequence (SEQ ID NO: 13).

[0122] pKB20U1-EGFP: Obtained by replacing the 5'UTR sequence in pKB20-EGFP with the 5'UTR of the C3 gene (SEQ ID NO: 17).

[0123] pKB20U2-EGFP: Obtained by replacing the 5'UTR sequence in pKB20-EGFP with the 5'UTR of the ORM1 gene (SEQ ID NO: 18).

[0124] pKB20U3-EGFP: Obtained by replacing the 5'UTR sequence in pKB20-EGFP with the 5'UTR of the HPX gene (SEQ ID NO: 19).

[0125] pKB20U4-EGFP: Obtained by replacing the 5'UTR sequence in pKB20-EGFP with the 5'UTR of the FGA gene (SEQ ID NO: 20).

[0126] pKB20U5-EGFP: Obtained by replacing the 5'UTR sequence in pKB20-EGFP with the 5'UTR of the AGXT gene (SEQ ID NO: 21).

[0127] pKB20U6-EGFP: Obtained by replacing the 5'UTR sequence in pKB20-EGFP with the 5'UTR of the ASL gene (SEQ ID NO: 22).

[0128] pKB20U7-EGFP: Obtained by replacing the 5'UTR sequence in pKB20-EGFP with the 5'UTR of the APOA2 gene (SEQ ID NO: 23).

[0129] pKB20U8-EGFP: Obtained by replacing the 5'UTR sequence in pKB20-EGFP with the 5'UTR of the ALB gene (SEQ ID NO: 24).

[0130] pKB20E1-EGFP: Obtained by replacing the enhancer motif sequence in pKB20-EGFP with the CMV enhancer sequence (SEQ ID NO: 25).

[0131] pKB20E2-EGFP: Obtained by replacing the enhancer motif sequence in pKB20-EGFP with the SV40 enhancer sequence (SEQ ID NO: 26).

[0132] pKB20E3-EGFP: Obtained by replacing the enhancer motif sequence in pKB20-EGFP with the human ε-globin 5'HS2 enhancer sequence (SEQ ID NO: 27).

[0133] pKB20E4-EGFP: Obtained by replacing the enhancer motif sequence in pKB20-EGFP with the chicken β-globin gene 5'HS4 enhancer sequence (SEQ ID NO: 28).

[0134] pKB20P1-EGFP: Obtained by replacing the miniCMV sequence in pKB20-EGFP with the CMV53 promoter (SEQ ID NO:37).

[0135] pKB20P2-EGFP: Obtained by replacing the miniCMV sequence in pKB20-EGFP with the miniSV40 promoter (SEQ ID NO: 38).

[0136] pKB20P3-EGFP: obtained by replacing the miniCMV sequence in pKB20-EGFP with the miniTK promoter (SEQ ID NO:39).

[0137] pKB20P4-EGFP: obtained by replacing the miniCMV sequence in pKB20-EGFP with the MLP promoter (SEQ ID NO: 40).

[0138] pKB20P5-EGFP: obtained by replacing the miniCMV sequence in pKB20-EGFP with the pJB42CAT5 promoter (SEQ ID NO: 41).

[0139] pKB20P6-EGFP: obtained by replacing the miniCMV sequence in pKB20-EGFP with YB_TATA (SEQ ID NO: 42).

[0140] Example 2: Integration of pKB vector containing EGFP expression cassette in Jurkat cells 5 x 10 rapidly growing, low-passage Jurkat cells 65 μg of pKB20-EGFP, pKB201-EGFP, pKB202-EGFP, or pKC20-EGFP was transfected into the cell nuclei using a Lonza2b-Nucleofector device (see the device instruction manual) and cultured in a 37°C, 5% CO2 incubator. After the cells reached confluence, they were subcultured at a ratio of 1:10. Images were taken and observed under a fluorescence microscope on days 7, 10, and 14 after electroporation. Changes in the proportion of EGFP-positive cells were detected using a flow cytometer on days 7, 10, and 14 after electroporation (after three passages). Jurkat cells not transfected with the plasmid served as a control for flow cytometry. Cell fluorescence intensity was monitored under a fluorescence microscope throughout the entire electroporation process. Viable cells were counted on days 5, 7, 10, and 14 after electroporation to observe the effect of electroporation of the pKB vector on the proliferation of Jurkat cells.

[0141] The plasmid was diluted 1:10 and passaged. Unintegrated plasmids were rapidly eliminated as the cells divided. After three passages (approximately 13 days), green fluorescent-positive cells were considered to have stably integrated the green fluorescent expression cassette. The efficiency of integration was determined by detecting the proportion of green fluorescent-positive cells using flow cytometry.

[0142] The results are shown in Figures 2–4. Figure 2 shows that by 10 days after electroporation, a large number of highly fluorescent cells were visible in Jurkat cells electroporated with pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP. Jurkat cells electroporated with pKC20-EGFP, which lacks the PiggyBac transposase expression cassette, showed almost no fluorescence. This indicates that the vector carrying the PiggyBac transposase expression cassette successfully integrated EGFP into the genome in Jurkat cells. On the other hand, the vector lacking the PiggyBac transposase expression cassette was unable to effectively mediate the integration of the exogenous EGFP gene.

[0143] Figure 3 shows the flow cytometry results of Jurkat cells electroporated with pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP on day 7 after electroporation. The results show that the positive cell rate of Jurkat cells electroporated with pKB20-EGFP was over 67% on days 7 and 10, and maintained a high positive rate of 65% on day 14 after three passages. The positive rates of cells electroporated with pKB201-EGFP and pKB202-EGFP were approximately 48% on day 7 and exceeded 27% and 26%, respectively, on day 14 after three passages.

[0144] Figure 4 shows that there was no significant difference in the number of viable cells 5, 7, 10, or 14 days after electroporation between Jurkat cells electroporated with the plasmids pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP, which contain the PB transposase expression cassette, and Jurkat cells electroporated with pKC20-EGFP, which does not contain the PB transposase expression cassette. This indicates that the introduction of the plasmid containing the PB transposase expression cassette does not affect the proliferation of Jurkat cells.

[0145] The above results show that pKB20-EGFP has a very high integration rate and positive expression rate of foreign genes after electroporation into Jurkat cells, while pKB201-EGFP and pKB202-EGFP have relatively high integration and positive expression rates of foreign genes after electroporation into Jurkat cells, but these are lower than the levels after electroporation of pKB20-EGFP. Furthermore, the integration of pKB series vectors has little effect on cell proliferation.

[0146] Example 3: Time curve of PB transposase expression after electroporation of pKB vector into Jurkat cells 5 x 10 rapidly growing, low-passage Jurkat cells 6Cell nuclei were transfected with 5 μg of each of pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP using a single-cell Lonza2b-Nucleofector (see the instrument's instruction manual) and cultured at 37°C and 5% CO. Cells were harvested 6, 12, 24, 48, 96 hours, and 15 days after electroporation, and RNA was extracted. The expression level of the PB transposase was quantitatively detected by RT-PCR using β-actin as an internal reference. The results are shown in Figure 5.

[0147] Figure 5 shows that PB transposase expression levels in Jurkat cells electroporated with pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP all peaked at 6 h and then began to decline significantly. Cells electroporated with pKB20-EGFP and pKB201-EGFP had significantly higher PB transposase expression levels at 6 h than cells electroporated with pKB202-EGFP. Cells electroporated with pKB20-EGFP and pKB201-EGFP showed a rapid decline in PB transposase expression at 24 h. PB transposase expression levels in all cells declined significantly by 96 h and were undetectable by day 15.

[0148] Example 4: Integration of pKB vector containing EGFP expression cassette into K562 cells 5 x 10 rapidly growing, low-passage K562 cells 65 μg of pKB20-EGFP, pKB201-EGFP, pKB202-EGFP, or pKC20-EGFP was transfected into the cell nuclei using a Lonza2b-Nucleofector device (see the device instruction manual) and cultured in a 37°C, 5% CO2 incubator. After the cells reached confluence, they were subcultured at a ratio of 1:10. Photographs were taken and observed under a fluorescence microscope on days 1, 7, and 10 after electroporation. Changes in the proportion of EGFP-positive cells were detected using a flow cytometer on days 10 and 14 after electroporation (after three passages). K562 cells not transfected with the plasmid served as a flow cytometry control. Cell fluorescence intensity was monitored under a fluorescence microscope throughout the entire electroporation process. Viable cells were counted on days 5, 7, 10, and 14 after electroporation to observe the effect of electroporation of the pKB vector on the proliferation of K562 cells.

[0149] The plasmid was diluted 1:10 and passaged. Unintegrated plasmids were rapidly eliminated as the cells divided. After three passages (approximately 13 days), green fluorescent-positive cells were considered to have stably integrated the green fluorescent expression cassette. The efficiency of integration was determined by detecting the proportion of green fluorescent-positive cells using flow cytometry.

[0150] The results are shown in Figures 6-9. Figure 6 shows that by 10 days after electroporation, a large number of highly fluorescent cells were visible in K562 cells electroporated with pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP. In K562 cells electroporated with pKC20-EGFP, which lacks the PiggyBac transposase expression cassette, very few highly fluorescent cells were visible. This indicates that the vector carrying the PiggyBac transposase expression cassette successfully integrated EGFP into the genome in K562 cells. In contrast, the vector lacking the PiggyBac transposase expression cassette was unable to effectively mediate the integration of the exogenous EGFP gene.

[0151] Figure 7 shows that there was no significant difference in the number of viable cells 5, 7, 10, and 14 days after electroporation between cells electroporated with the plasmids pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP, which contain the PB transposase expression cassette, and cells electroporated with pKC20-EGFP, which does not contain the PB transposase expression cassette. This indicates that the introduction of the plasmid containing the PB transposase expression cassette does not affect the proliferation of K562 cells.

[0152] Figure 8 shows the flow cytometry results of cells electroporated with pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP on days 10 and 14 after electroporation. The results show that cells electroporated with pKB20-EGFP and pKB201-EGFP had a cellular fluorescence positive rate of 75% and 73%, respectively, on day 10, and maintained a fluorescence positive rate of over 70% on day 14 after electroporation (after more than three passages), demonstrating very high integration efficiency. Cells electroporated with pKB202-EGFP had a fluorescence positive rate of just under 70% on day 10 after electroporation, and maintained a fluorescence positive rate of just under 70% on day 14 after electroporation (after more than three passages).

[0153] Figure 9 shows that the fluorescence positivity rate of K562 cells electroporated with pKB20-EGFP and pKB201-EGFP vectors changed little from 10 to 14 days after electroporation, remaining above 70% and slightly below 75%, while the fluorescence positivity rate of K562 cells electroporated with pKB202-EGFP vectors did not decrease significantly from 10 to 14 days after electroporation, being slightly lower than 70%.

[0154] The above results show that pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP have very high integration rates and positive expression rates of foreign genes after electroporation into K562 cells.

[0155] Example 5: Integration of pKB vector containing EGFP expression cassette in primary T cells 5 x 10 freshly isolated peripheral blood mononuclear cells (PBMCs) per set 6Four sets of cells were prepared, and 5 μg of each of pKB20-EGFP, pKB201-EGFP, pKB202-EGFP, and pKC20-EGFP was electroporated into the cell nuclei using a Lonza Nucleofector-2b electroporator (see the instrument manual). The cells were then cultured in AIM-V medium at 37°C in a 5% CO2 incubator. After 6 hours, the cells were transferred to a 6-well plate containing 30 ng / mL anti-CD3 antibody and 3000 IU / mL IL-2 (purchased from NOvoprotein) and cultured at 37°C in a 5% CO2 incubator. After growing to confluence, the cells were diluted 1:10 and passaged. On days 1, 7, and 10 after electroporation, cells electroporated with pKB20-EGFP, pKB201-EGFP, pKB202-EGFP, and pKC20-EGFP were observed and photographed using a fluorescence microscope, respectively. On days 7, 10, and 14 after electroporation, cells electroporated with pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP were detected by flow cytometry, and the results are shown in Figures 10 and 11.

[0156] Figure 10 shows that up to 10 days after electroporation, a large number of highly fluorescent cells were visible in T cells electroporated with pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP. In T cells electroporated with pKC20-EGFP, which lacks the PiggyBac transposase expression cassette, very few highly fluorescent cells were visible. This indicates that the vector carrying the PiggyBac transposase expression cassette has integrated EGFP into the genome in T cells. In contrast, the vector lacking the PiggyBac transposase expression cassette cannot effectively mediate the integration of the exogenous EGFP gene.

[0157] Figure 11 shows the flow cytometry results of T cells electroporated with pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP on days 7 to 14 after electroporation. The results show that T cells electroporated with pKB20-EGFP reached a cell positivity rate of just under 74% on day 7 and maintained a cell positivity rate of just under 72% on day 14 after electroporation (after three passages). T cells electroporated with pKB201-EGFP and pKB202-EGFP reached a cell positivity rate of just under 70% on day 7 after electroporation and maintained a cell positivity rate of 66% and over 62%, respectively, on day 14 after electroporation (after three passages).

[0158] The above results show that pKB20-EGFP, pKB201-EGFP, and pKB202-EGFP have very high integration rates and positive expression rates of foreign genes after electroporation into primary T cells.

[0159] <Example 6> Detection of integration efficiency after electroporation of double-plasmid PB transposon system into Jurkat cells 1 x 10 rapidly growing, low-passage Jurkat cells 7 Each group contains 5 × 10 cells. 6 A mixture of 4 μg of pK201-PB + 3 μg of pKC20-EGFP and a mixture of 3 μg of pK201-PB + 4 μg of pKC20-EGFP were prepared, and the nuclei of group A and group B cells were electroporated using a Lonza2b-Nucleofector device (see the device instruction manual) and cultured in a 37°C, 5% CO2 incubator. After cells reached confluence, they were subcultured at a ratio of 1:10. Photographs were taken under a fluorescence microscope on days 7, 10, and 14 after electroporation (after three passages). Changes in the proportion of EGFP-positive cells were detected using a flow cytometer on days 7, 10, and 14 after electroporation (after three passages). Jurkat cells not transfected with the plasmid served as a control for flow cytometry.

[0160] The results are shown in Figure 12. The results showed that Jurkat cells electroporated with 4 μg of pK201-PB + 3 μg of pKC20-EGFP had a cell positivity rate of over 43% on day 7 after electroporation, which decreased to 13.31% on day 14 after electroporation (after three passages). Similarly, Jurkat cells electroporated with 3 μg of pK201-PB + 4 μg of pKC20-EGFP had a cell positivity rate of over 52% on day 7 after electroporation, which decreased to 10.57% on day 14 after electroporation (after three passages).

[0161] According to the above results, the integration efficiency of the double-vector transposon system expressing the PB transposase and the foreign gene in Jurkat cells is much lower than that of the single-vector pKB system mentioned above.

[0162] <Example 7> Detection of integration efficiency after electroporation of double-plasmid PB transposon system into primary T cells 5 × 10 freshly isolated peripheral blood mononuclear cells (PBMCs) 6 Nuclei were electroporated using a Lonza Nucleofector-2b electroporator (see the instrument manual). Cells were then cultured in AIM-V medium at 37°C in a 5% CO2 incubator. After 6 hours, the cells were transferred to a 6-well plate containing 30 ng / mL anti-CD3 antibody and 3000 IU / mL IL-2 (purchased from NOvoprotein) and cultured at 37°C in a 5% CO2 incubator. After growing to confluence, the cells were diluted 1:10 and passaged. Cells were detected by flow cytometry on days 7 and 14 after electroporation.

[0163] The results are shown in Figure 13. The results showed that primary cells electroporated with 4 μg of pK201-PB + 3 μg of pKC20-EGFP had a cell positivity rate of 16.20% on day 7 after electroporation, which decreased to 15.34% on day 14 after electroporation (after 3 passages).

[0164] According to the above results, the integration efficiency of the double-vector transposon system expressing the PB transposase and the foreign gene in primary T cells was significantly lower than that of the single-vector pKB system mentioned above.

[0165] <Example 8> Detection of integration efficiency after electroporation of pKB vector with reduced amount of plasmid into Jurkat cells 5 x 10 rapidly growing, low-passage Jurkat cells 6 3 μg of pKB20-EGFP plasmid was electroporated into the cell nuclei using a Lonza2b-Nucleofector device (see the device manual) and cultured in a 37°C, 5% CO2 incubator. After the cells reached confluence, they were subcultured at a ratio of 1:10. Changes in the proportion of EGFP-positive cells were detected using a flow cytometer on days 7, 10, and 14 after electroporation (after three passages). Jurkat cells not transfected with the plasmid served as a control for flow cytometry.

[0166] The results are shown in Figure 14. The results show that Jurkat cells electroporated with 3 µg of pKB20-EGFP plasmid had a cell positivity rate of over 66% on day 7 after electroporation, and maintained a cell positivity rate of just under 63% on day 14 after electroporation (after three passages), which is close to the cell positivity rate on day 14 when Jurkat cells were electroporated with 6 µg of pKB20-EGFP plasmid in Example 2.

[0167] Based on the results of Example 2, the integration efficiency of the pKB vector system in cells remained almost unchanged after the amount of pKB20-EGFP plasmid used for electroporation was halved. Therefore, the pKB vector system of the present invention can achieve the same integration efficiency even when the amount of DNA is reduced. This reduces the amount of DNA used for electroporation, which further reduces the toxicity of DNA to T cells and reduces the amount of residual plasmid DNA in cells after electroporation.

[0168] <Example 9> Detection of the copy number of residual plasmid of intracellular pKB vector Jurkat cells and K562 cells were electroporated with 5 μg of pKB20-EGFP using the methods of Examples 2 and 4, respectively, and the cells were harvested 10, 14, and 20 days after electroporation. Jurkat cells were electroporated with 3 μg of pKB20-EGFP using the method of Example 8, referring to the instrument's instruction manual, and the cells were harvested 10, 12, and 14 days after electroporation. Fresh PBMCs were electroporated with 5 μg of pKB20-EGFP using the method of Example 5, and the cells were harvested 10, 12, and 14 days after electroporation. All procedures were repeated three times. The residual plasmid levels at different time points in all harvested cells containing the PB transposase expression cassette were detected using TaqMan probe fluorescent quantitative PCR.

[0169] 1) The pKB20-EGFP plasmid containing the PB transposase expression cassette was used as the standard, and a plasmid containing the internal reference gene Actin was used as the internal reference standard. 10-fold gradient diluted standards were prepared for each.

[0170] 2) Total DNA was extracted from cells electroporated with pKB20-EGFP on the specified days and used as a sample for detecting the PB transposase gene and actin gene.

[0171] 3) A PCR reaction system was set up to amplify the PB transposase gene and the internal reference Actin gene for the target sample. A gradient dilution standard of the PB gene and a gradient dilution standard of the Actin gene were amplified to generate standard curves for the PB gene and the Actin gene, respectively. The primers, probe sequences, and reaction system for amplifying the PB gene and the Actin gene are shown below.

[0172] PB gene amplification: PB-F:5'ggacgagatctacgccttct(SEQ ID NO:29) PB-R:5'ctcatcacgctcacgtacac(SEQ ID NO:30) PB-Probe: 5'tgcgcacggcggtcatcacc (SEQ ID NO: 31) Actin gene amplification: Actin-F:5'gggacctgactgactacctc(SEQ ID NO:32) Actin-R:5'aatgtcacgcacgatttccc(SEQ ID NO:33) Actin-probe:5'caccgagcgcggctacagct(SEQ ID NO:34)

[0173] [Table 1]

[0174] 4) Real-time fluorescent quantitative PCR was used to amplify the target samples and standards. The reaction system is shown in Table 1. The reaction process was (1) 50°C for 2 minutes; (2) 95°C for 10 minutes; and (3) 95°C for 15 seconds, 60°C for 1 minute, with a total of 40 cycles. A standard curve was created and used to calculate the residual plasmid amount. The copy number was calculated as PB copy number / Actin copy number × 2.

[0175] The results are shown in Figure 15. When the amount of plasmid used for electroporation was 5 μg, the normal amount, the residual plasmid copy number in the cells rapidly decreased over time. When the cells were cultured up to 14 days after electroporation (after three passages), the residual plasmid copy number per Jurkat cell was less than 10, and the residual plasmid copy number per K562 cell and per primary T cell was less than 5. When the cells were cultured up to 20 days after electroporation, the residual plasmid copy number per Jurkat cell and per K562 cell was less than 1. When the amount of plasmid used for electroporation was reduced to 3 μg, the residual plasmid content in Jurkat cells after electroporation was even more significantly reduced compared to when 5 μg of plasmid was electroporated, with the plasmid copy number per cell being less than 10 on day 10 and less than 1 copy on day 14.

[0176] The above results demonstrate that the vectors of the present invention fully perform their genome integration function and have very low levels of residual plasmid DNA in host cells. Furthermore, as shown in Example 8, the pKB series vectors of the present invention, while ensuring high integration efficiency after electroporation, can reduce the amount of plasmid DNA used, thereby further reducing the residual plasmid DNA in cells after electroporation.

[0177] Example 10: Integration of pKB2003-EGFP vector into cells after electroporation Using the methods described in Examples 2 and 4 above, the pKB2003-EGFP plasmid was electroporated into Jurkat cells and K562 cells, respectively, and the cell positivity was detected by flow cytometry on days 7, 10, and 14 after electroporation. The results are shown in Figure 16. Jurkat cells electroporated with pKB2003-EGFP reached a positive cell rate of 49% and over 48% on days 7 and 10, respectively, and maintained a high positive rate of just under 48% on day 14 after three passages. K562 cells electroporated with pKB2003-EGFP reached a positive cell rate of just under 70% on days 7 and 10, and maintained a high positive rate of over 66% on day 14 after three passages.

[0178] According to the above results, the pKB2003 vector can integrate and express foreign genes in cells with high efficiency.

[0179] Example 11: Integration of pKB series vectors replaced with regulatory element sequences in cells after electroporation The amount of electroporated plasmid used was reduced to 3 μg each by the methods described in Examples 2, 4, and 5, and Jurkat cells, K562 cells, and PBMCs derived from healthy human blood were infected with pKB20I1-EGFP, pKB20A1-EGFP, pKB20A2-EGFP, pKB20U1-EGFP, pKB20U2-EGFP, pKB20U3-EGFP, pKB20U4-EGFP, pKB20U5-EGFP, pKB20U6-EGFP, and pKB20U 7-EGFP, pKB20U8-EGFP, pKB20E1-EGFP, pKB20E2-EGFP, pKB20E3-EGFP, pKB20E4-EGFP, pKB20P1-EGFP, pKB20P2-EGFP, pKB20P3-EGFP, pKB20P4-EGFP, pKB20P5-EGFP, and pKB20P6-EGFP plasmids were electroporated, respectively, and the cell positivity rate was detected by flow cytometry 14 days after electroporation. The results are shown in Table 2.

[0180] [Table 2]

[0181] According to the results in Table 2, the pKB series plasmid vectors replaced with the above regulatory element sequences can be integrated into the genomes of different cells with high efficiency, and the integration rate in each of the above cells is at the same level as that of pKB20-EGFP.

[0182] Example 12: Detection of integration efficiency after electroporation of pKB205-EGFP vector into primary T cells The amount of electroporated plasmid was reduced to 3 μg using the method described in Example 5, and pKB205-EGFP was electroporated into PBMCs derived from healthy human blood. The cell positivity rate was detected by flow cytometry on days 7 and 14 after electroporation.

[0183] The results are shown in Figure 17. The cell positive rate of pKB205-EGFP-electroporated T cells exceeded 42% on day 7 and remained above 36% on day 14 (three passages after electroporation). This indicates that electroporation of the pKB205-EGFP vector into primary T cells resulted in a relatively high integration rate and positive expression rate of the foreign gene.

[0184] Example 13: Analysis of pKB vector integration sites in Jurkat and K562 cells Two sets of Jurkat cells and two sets of K562 cells were prepared and electroporated with the pKB20-EGFP plasmid as described in Examples 2 and 4. After 14 days of culture, the cells were harvested, genomic DNA extracted, and whole genome sequencing was performed by Crystal Biotechnology (Shanghai) Co., Ltd. to analyze the distribution of EGFP insertion sites in the genome. The results are shown in Figures 18-21 and Table 3. Figures 18, 19, 20, and 21 are schematic diagrams of the genomic integration sites mediated by the pKB20 vector in K562 sample 1, K562 sample 2, Jurkat sample 1, and Jurkat sample 2, respectively.

[0185] [Table 3]

[0186] According to the results of Figures 18 to 21 and Table 3, the integration of foreign genes into the genome of cells mediated by the pKB20 vector of the present invention mainly occurs in intergenic and intron regions, with fewer integration sites in exon regions and regions involved in the regulation of gene expression (e.g., 3'UTR). Therefore, the integration of foreign genes into the genome of cells mediated by the pKB20 vector has very little effect on the gene expression of the cells themselves.

[0187] Example 14: Analysis of mRNA expression profile after integration of pKB vector in Jurkat cells and K562 cells Jurkat cells and K562 cells were electroporated with the pKB20-EGFP plasmid using the methods described in Examples 2 and 4 above, respectively, with 4 μg of plasmid used. Cells were harvested 14 days after electroporation for mRNA sequencing and expression profile analysis, and the mRNA expression profiles were compared with those of Jurkat cells and K562 cells that had not been electroporated with the plasmid. Duplicate samples were provided for analysis for K562 and Jurkat.

[0188] The results of sequencing and analysis showed that compared with control cells not electroporated with either plasmid, the mRNA expression of genes adjacent to the pKB20 integration site electroporated with pKB20-EGFP was small, and the differential expression of related genes is shown in Tables 4 to 7. Therefore, the integration of the pKB vector of the present invention into the genome has a relatively small impact on the genomic stability and gene expression profile of the cells.

[0189] [Table 4]

[0190] [Table 5]

[0191] [Table 6]

[0192] [Table 7]

[0193] Example 15: Preparation of pKB20-HER2CAR vector and HER2CAR-T cells The EF1A promoter sequence (SEQ ID NO: 11) with an NFAT motif was inserted between the XbaI and EcoRI sites of the polyclonal region of pKB20, and the HER2CAR coding sequence (SEQ ID NO: 43) was inserted between the EcoRI and SalI sites, and the resulting construct was named pKB20-HER2CAR. The EF1A promoter sequence with an NFAT motif and the HER2CAR coding sequence were synthesized by Shanghai Jierui Biotechnology Co., Ltd.

[0194] HER2-targeting CAR-T cells were produced by electroporating the pKB20-HER2CAR vector into PBMCs isolated from peripheral blood as follows: PBMCs were purchased from AllCells and derived from the peripheral blood of healthy adults.

[0195] 1) Collect the suspended cells in a 50 ml centrifuge tube and centrifuge at 1200 rpm for 3 minutes.

[0196] 2) Discard the supernatant, resuspend the cells in saline, centrifuge at 1200 rpm for 3 minutes, discard the saline, and repeat this process to count the cells.

[0197] 3) Take two 1.5 ml centrifuge tubes and add 5 x 10 6 Add the cells and centrifuge at 1200 rpm for 3 minutes.

[0198] 4) Discard the supernatant, take an electroporation reagent kit (purchased from Lonza), add 18 μL of solution I reagent and 82 μL of solution II reagent, add 5 μg of pKB20 blank plasmid to the first tube as a control, and add 5 μg of pKB20-HER2CAR plasmid to the second tube.

[0199] 5) Transfer the cell suspension mixed with the plasmid from the centrifuge tube to the electroporation cup, place it in the electroporator, and select program T020 to perform electroporation.

[0200] 6) Transfer the electroporated cell suspension with the micropipette provided in the reagent kit to a 12-well plate containing AIM-V culture medium (AIM-V culture medium containing 2% FBS), mix evenly, and culture in a 37°C, 5% CO2 incubator. In addition, add 5 μg / mL of HER2 extracellular domain antigen (

[0201] [Table 8]

[0202] Coat two wells of a 6-well plate with a mixture containing 10004-H08H) and 5 μg / mL of CD28 antibody (ThermoFisher 14-0281-82), adding 1 mL to each well, and incubate the 6-well plate at 37°C.

[0203] 7) After 6 hours, electroporated cells were cultured at 37°C in a 5% CO2 incubator. The cells were then transferred to a 6-well plate coated with HER2 extracellular domain antigen and CD28 antibody, and supplemented with IL-2 at a final concentration of 100 IU / mL to make a 3mL culture medium. After 4-5 days of culture, T cell growth was observed. The activated cells were then transferred to AIM-V medium containing 2% FBS and continued to be cultured until the required volume was reached to obtain HER2CAR-T cells. Cells transferred to the pKB20 blank were used as control mock-T cells.

[0204] Example 16: Detection of CAR-expressing positive cells in HER2CAR-T cells 1) 1 × 10 HER2CAR-T cells prepared in Example 15 6 The cells were collected and centrifuged at 1000 rpm for 3 minutes.

[0205] 2) Discard the supernatant, add saline, resuspend the cells, and centrifuge at 1000 rpm for 3 minutes.

[0206] 3) Discard the supernatant, add 100 μL of saline to each tube, resuspend the cells, and add 1 μL of biotin-labeled HER2 antigen (

[0207] [Table 9]

[0208] (purchased from Eppendorf, product number: HER-HM402) and incubated at 4°C for 30 minutes.

[0209] 4) Add an appropriate amount of saline to each well, centrifuge at 1000 rpm for 3 minutes, wash twice, and discard the supernatant.

[0210] 5) Add 100 μL of saline to each well to resuspend the cells, add 1 μL of PE-labeled streptavidin (purchased from ThermoFisher, product number: S20982), mix thoroughly, and incubate at 4° C. for 30 minutes.

[0211] 6) Add an appropriate amount of saline to each well, centrifuge at 1000 rpm for 3 minutes, wash twice, and discard the supernatant.

[0212] 7) Resuspend in 400 μL of saline and detect using a flow cytometer. The results are shown in Figure 22. The percentage of cells that were PE-positive reached 93.41%, indicating that the percentage of CAR-expressing cells was over 90% in the HER2CAR-T cells produced by electroporating the pKB20-HER2CAR plasmid into PBMCs.

[0213] Example 17: Cell-killing function test of HER2-CAR-T The in vitro killing activity of the HER2CAR-T cells obtained in Example 15 was detected using ACEA's real-time label-free cell function analyzer (RTCA). The specific steps are as follows:

[0214] (1) Zero setting: Add 50 μL of DMEM culture medium to each well, place it in the device, select step 1, and perform zero setting.

[0215] (2) Target cell plating: Human ovarian cancer cells SKOV-3 (purchased from ATCC, HER2 expression positive) were plated at 10 cells per well. 4 The cells are plated at 50 μL / cell onto a plate containing a detection electrode, left to stand for several minutes until the cells become stable, then placed in the device, and step 2 is initiated to culture the cells.

[0216] (3) Addition of effector cells: After culturing the target cells for 18 hours, 50 μL of control cells (Mock-T) and effector cells (HER2CAR-T) were added per well. Three ET ratios (1:1, 2:1, and 4:1) were set for HER2CAR-T, while Mock-T was set at a 4:1 ET ratio. The ET ratio was calculated based on the total number of viable cells. After co-culture had commenced and the cells had been in culture for over 60 hours, the cell growth curve was observed.

[0217] The results are shown in Figure 23. The killing curves of the control Mock-T cell group and the SKOV-3 tumor cell group show similar trends, indicating that the killing effect of Mock-T cells on SKOV-3 cells is small. HER2CAR-T showed significant killing effect on SKOV-3 cells at three ET ratios: 1:1, 2:1, and 4:1, and the killing effect significantly increased with increasing ET ratio.

[0218] Example 18: Preparation of pKB20-NY-ESO-1-TCR vector and NY-ESO-1 TCR-T cells Construction of pKB20-NY-ESO-1-TCR vector: A coding sequence was synthesized to recognize the NY-ESO-1 antigen peptide SLLMWITQC (HLA-*02:01) TCR α and β chain gene DNA sequences, linked by a DNA sequence encoding the P2A peptide fragment. The resulting sequence is shown in SEQ ID NO:44. Furthermore, a DNA sequence encoding EGFP was ligated to the 3' end of SEQ ID NO:44 via the DNA encoding the P2A peptide fragment to obtain the NY-ESO-1-TCR gene covalently linking the EGFP reading frame. The resulting sequence is shown in SEQ ID NO:45. An EF1A promoter sequence (SEQ ID NO:11) carrying an NFAT motif was inserted between the XbaI and EcoRI sites of the polyclonal region of pKB20, and the coding sequence of the NY-ESO-1-TCR gene covalently linking the EGFP reading frame (SEQ ID NO:45) was inserted between the EcoRI and SalI sites. This was designated pKB20-NY-ESO-1-TCR. The coding sequence of the NY-ESO-1-TCR gene, which covalently links the EF1A promoter sequence containing the NFAT motif and the EGFP reading frame, was synthesized by Shanghai Jierui Biotechnology Co., Ltd.

[0219] NY-ESO-1 TCR-T cell production: A 6-well plate was coated with a coating solution containing 5 μg / ml anti-CD3 antibody (ThermoFisher 14-0037-82) and 5 μg / ml anti-CD28 antibody (ThermoFisher 14-0281-82) for 2-4 hours at room temperature. The coating solution was then aspirated, and the well plate was washed 1-3 times with saline. Then, AIM-V medium containing 2% FBS was added and prepared for use. Human peripheral blood PBMCs (HLA-*02:01, purchased from ALLCELLS) were resuscitated in a 37°C water bath and cultured for 2-4 hours. The non-adherent suspension cells were naive T cells. The suspension cells were collected in a 15ml centrifuge tube and centrifuged at 1200 rpm for 3 minutes. The supernatant was discarded, and saline was added. The plate was then centrifuged at 1200 rpm for 3 minutes. The saline was discarded, and this process was repeated. The washed naive T cells are then transferred to antibody-coated wells containing the prepared medium and cultured at 37°C and 5% CO2 for 3-4 days before use in subsequent experiments.

[0220] Cells expressing NY-ESO-1 TCR-T were prepared by electroporation as follows:

[0221] 1) Add 2 mL of AIM-V medium to two wells of a 12-well plate in advance, then place in an incubator and preheat at 37°C and 5% CO2 for 1 hour.

[0222] 2) Prepare two wells using the electroporation solution in the single-use amount per well as shown in Table 8 below.

[0223] [Table 10]

[0224] 3) The activated T cells were collected and placed in two EP tubes. Each EP tube contained 5 x 10 cells. 6 The cells were placed in a 500 μL syringe and centrifuged at 1200 rpm for 5 minutes. The supernatant was discarded, and the cells were resuspended in 500 μL saline. The centrifugation step was repeated to wash and precipitate the cells.

[0225] 4) 4 μg each of the plasmid pKB20-NY-ESO-1-TCR and pKB20-EGFP vector was added to the two-well electroporation solution system prepared in 2), and then allowed to stand at room temperature for 30 minutes or less.

[0226] 5) From the two tubes of activated T cells resuspended in the electroporation solution containing the plasmid prepared in 4), slowly aspirate 100 μL of cell resuspension per tube and transfer it to a LONZA 100 μL electroporation cup. Place the electroporation cup in the LONZA Nucleofector. (商標) 2b Place the cell in the electroporation chamber and start the electroporation program. Select T-020 as the electroporation program.

[0227] 6) After electroporation was completed, the electroporation cup was slowly removed, and the cell suspension was aspirated and transferred to an EP tube. 200 μL of prewarmed AIM-V medium was added per tube, then transferred to a well containing prewarmed AIM-V medium in the 12-well plate described in 1) and cultured at 37°C and 5% CO2. After 1 hour of culture, compound G150 (purchased from MedChemExpress) was added to a final concentration of 5 μM. The cells were then cultured for 13 days, during which time they were passaged according to their proliferation status. After 13 days, the cell number and cell viability of each electroporated sample were determined, and NY-ESO-1 TCR-T cells and mock-T cells were produced, respectively.

[0228] Example 19: Detection of NY-ESO-1 TCR-T cells and NY-ESO-1 TCR expression positive cells 1) 1 × 10 NY-ESO-1 TCR-T cells prepared in Example 18 6 The cells were collected and centrifuged at 1000 rpm for 3 minutes.

[0229] 2) Discard the supernatant, add saline, resuspend the cells, and centrifuge at 1000 rpm for 3 minutes.

[0230] 3) Detect using a flow cytometer. The results are shown in Figure 24. The percentage of EGFP-positive cells was 37.57%. The NY-ESO-1 TCR α and β chain gene DNA sequences and the EGFP coding DNA sequence are linked by the P2A peptide fragment coding sequence, so EGFP-positive cells can indirectly reflect the expression of the NY-ESO-1 TCR gene. We estimate that the percentage of NY-ESO-1 TCR-positive cells is approximately 37%.

[0231] Example 20: Cell-killing function test of NY-ESO-1 TCR-T The in vitro killing activity of the NY-ESO-1 TCR-T cells obtained in Example 18 was detected using a real-time label-free cell function analyzer (RTCA) from ACEA. The specific steps are as follows:

[0232] (1) Zero setting: Add 50 μL of DMEM culture medium to each well, place it in the device, select step 1, and zero set.

[0233] (2) Target cell plating: Human malignant melanoma cell line A375 (purchased from ATCC, NY-ESO-1 expression positive) was plated at 10 cells / well. 4 The cells are plated at 50 μL / cell onto a plate containing a detection electrode, left to stand for several minutes until the cells become stable, then placed in the device, and step 2 is initiated to culture the cells.

[0234] (3) Addition of effector cells: After culturing the target cells for 18 hours, the cell index was observed. When the cell index was 1, 50 μL of control cells (Mock-T) and effector cells (NY-ESO-1 TCR-T) were added per well. Two ET ratios (0.25:1 and 0.5:1) were set for NY-ESO-1 TCR-T, while Mock-T was set at 0.5:1. The ET ratio was calculated based on the number of cells expressing NY-ESO-1 TCR. After 70 hours of co-culture, the cell growth curve was observed.

[0235] The results are shown in Figure 25. The killing curves of the control Mock-T cell group and the A375 tumor cell group nearly overlap, indicating that the Mock-T cells have almost no killing effect on A375 cells. NY-ESO-1 TCR-T showed significant killing effect on A375 cells at two ET ratios of 0.25:1 and 0.5:1, and the killing effect significantly increased with increasing ET ratio.

[0236] Comparative Example 1: Integration of pNB vector containing EGFP expression cassette in K562 cells The pNB vector and pNB328-EGFP were constructed using the methods described in Example 1 on page 15 of Chinese Patent CN105154473B and Example 2 on page 16 of the specification. Using the method described in Example 4 of the present application, K562 cells stably expressing EGFP were produced by electroporation using pNB328-EGFP, and EGFP-positive cells were detected by flow cytometry 14 days after electroporation (three passages).

[0237] The results are shown in Figure 26. The percentage of EGFP-expressing K562 cells was 45.54% 14 days after electroporation.

[0238] Comparative Example 2: Integration of pNB vector containing EGFP expression cassette in primary T cells Primary T cells stably expressing EGFP were produced by electroporation using pNB328-EGFP using the method described in Example 5 of the present application, and EGFP-positive cells were detected by flow cytometry 14 days after electroporation (cells had been cultured for three passages). The PBMCs used for electroporation and Example 5 were from the same lot. EGFP-positive cells were detected by flow cytometry 14 days after electroporation (cells had been cultured for three passages).

[0239] The results are shown in Figure 27. The percentage of EGFP-expressing positive T cells 14 days after electroporation was 34.60%.

[0240] Although the specific embodiments of the present invention have been described in detail, it should be understood that those skilled in the art may make various modifications and substitutions to the details based on all the teachings disclosed, and these modifications fall within the scope of protection of the present invention. The full scope of the present invention is set forth in the appended claims and any equivalents thereof.

Claims

1. a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a transposase coding sequence, and a promoter controlling expression of the transposase, in this order, wherein the orientation of the transposase expression cassette is opposite to the orientation of the sequence between the transposon 3' terminal repeat sequence and the transposon 5' terminal repeat sequence, wherein the transposase is a PiggyBac transposase, the transposon 3' terminal repeat sequence is a PiggyBac transposon 3' terminal repeat sequence, and the transposon 5' terminal repeat sequence is a PiggyBac transposon 5' terminal repeat sequence; or A nucleic acid construct comprising, in this order, a transposon 3' terminal repeat, a polyclonal insertion site, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat, a promoter that controls expression of a transposase, a coding sequence for the transposase, and a second polyA sequence, wherein the orientation of the transposase expression cassette is the same as the orientation of the sequences between the transposon 3' terminal repeat and the transposon 5' terminal repeat, and wherein the transposase is a PiggyBac transposase, the transposon 3' terminal repeat is a PiggyBac transposon 3' terminal repeat, and the transposon 5' terminal repeat is a PiggyBac transposon 5' terminal repeat.

2. 2. The nucleic acid construct of claim 1, wherein the insulator sequence is as set forth in SEQ ID NO:

5.

3. The nucleic acid construct according to claim 1 or 2, further comprising one or more elements selected from an enhancer, a 5'UTR, and a foreign gene.

4. 3. The nucleic acid construct according to claim 1 or 2, the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an enhancer, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a coding sequence for a transposase, and a promoter that controls expression of the transposase; the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a coding sequence for a transposase, a 5' UTR, and a promoter that controls expression of the transposase; the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an enhancer, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a coding sequence for a transposase, a 5' UTR, and a promoter that controls expression of the transposase; the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an enhancer, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a promoter that controls expression of a transposase, a coding sequence for the transposase, and a second polyA sequence; the nucleic acid construct comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a promoter controlling expression of a transposase, a 5'UTR, a coding sequence for the transposase, and a second polyA sequence; or The nucleic acid construct is characterized in that it comprises, in this order, a transposon 3' terminal repeat sequence, a polyclonal insertion site, a first polyA sequence, an enhancer, an insulator sequence having a transcription termination function, a transposon 5' terminal repeat sequence, a promoter that controls the expression of a transposase, a 5'UTR, a transposase coding sequence, and a second polyA sequence.

5. The 5'UTR is selected from the group consisting of the 5'UTRs of the C3 gene, the ORM1 gene, the HPX gene, the FGA gene, the AGXT gene, the ASL gene, the APOA2 gene, and the ALB gene, and / or 5. The nucleic acid construct of claim 4, wherein the enhancer is selected from the group consisting of a CMV enhancer sequence, an SV40 enhancer, a human ε globin 5' HS2 enhancer, and a chicken β globin gene 5' HS4 enhancer.

6. The nucleic acid construct described in claim 5, wherein the sequence of the enhancer is shown in any one of SEQ ID NO: 4, 26 to 28.

7. 3. The nucleic acid construct according to claim 1 or 2, wherein the nucleic acid construct comprises: the orientation of the transposase expression cassette and the orientation of the foreign gene expression cassette are the same or opposite; the transposon 5' terminal repeat and the transposon 3' terminal repeat can exchange positions; the promoter is selected from the group consisting of a CMV promoter, a miniCMV promoter, a CMV53 promoter, a miniSV40 promoter, a miniTK promoter, an MLP promoter, a pJB42CAT5 promoter, a YB_TATA promoter, an EF1α promoter, an SV40 promoter, a Ubiquitin B promoter, a CAG promoter, an HSP70 promoter, a PGK-1 promoter, a β-actin promoter, a TK promoter, and a GRP78 promoter; A nucleic acid construct characterized in that the coding sequence of the transposase comprises or has one or more of the following characteristics operably linked to a coding sequence of a single or multiple copies of a nuclear localization signal.

8. The nucleic acid construct described in claim 7, characterized in that the nuclear localization signal is a c-myc nuclear localization signal.

9. 3. The nucleic acid construct according to claim 1 or 2, wherein the nucleic acid construct comprises: the nucleotide sequence of the transposon 3' terminal repeat sequence is set forth in SEQ ID NO: 1; the nucleotide sequence of the transposon 5' terminal repeat sequence is set forth in SEQ ID NO: 6; the sequence of the polyclonal insertion site is shown in SEQ ID NO: 2; the first polyA sequence is set forth in SEQ ID NO: 3, 13 or 16; the second polyA sequence is set forth in SEQ ID NO: 3, 13 or 16; The amino acid sequence of the PiggyBac transposase is set forth in SEQ ID NO: 36; the nucleic acid construct further comprises a 5'UTR, and the sequence of the 5'UTR is set forth in any one of SEQ ID NOs: 8, 17 to 24; A nucleic acid construct, characterized in that the sequence of the promoter is set forth in any one of SEQ ID NO: 9, SEQ ID NO: 37 to SEQ ID NO:

42.

10. the coding sequence of the PiggyBac transposase is set forth in SEQ ID NO: 7, and / or 8. The nucleic acid construct of claim 7, wherein the nuclear localization signal has the sequence shown in SEQ ID NO:

35.

11. 3. The nucleic acid construct according to claim 1 or 2, the nucleic acid construct comprises the sequence shown in SEQ ID NO: 10 or 14; or A nucleic acid construct, wherein the nucleic acid construct is a recombinant vector.

12. The nucleic acid construct of claim 11, wherein the nucleic acid construct is a recombinant cloning vector or a recombinant expression vector.

13. A host cell comprising: A host cell comprising the nucleic acid construct of any one of claims 1 to 12.

14. The host cell of claim 13 , wherein the host cell is a mammalian cell.

15. The host cell according to claim 13 or 14, wherein the host cell is selected from immune cells, Jurkat cells, K562 cells, embryonic stem cells, tumor cells, HEK293 cells, and CHO cells.

16. The host cell according to claim 15, wherein the immune cell is selected from one or more of T cells, B cells, CIK cells, LAK cells, NK cells, cytotoxic T cells, dendritic cells, tumor-infiltrating lymphocytes, macrophages, NKT cells, and γδT cells.

17. A pharmaceutical composition comprising the nucleic acid construct according to any one of claims 1 to 12 or the host cell according to any one of claims 13 to 16, and a pharmaceutically acceptable additive.

18. 17. An application of the nucleic acid construct of any one of claims 1 to 12 or the host cell of any one of claims 13 to 16 in the manufacture of a drug, reagent or tool, wherein the drug, reagent or tool is used to integrate an expression cassette of an exogenous gene into the genome of a target cell, or is used in gene therapy, cell therapy, stem cell induction or differentiation.

19. 19. The application according to claim 18, wherein said target cells are selected from immune cells, Jurkat cells, K562 cells, embryonic stem cells, tumor cells, HEK293 cells, CHO cells.

20. 20. The application according to claim 19, wherein the immune cells are selected from one or more of T cells, B cells, CIK cells, LAK cells, NK cells, cytotoxic T cells (CTL), dendritic cells (DC), tumor infiltrating lymphocytes (TIL), macrophages, NKT cells, and γδT cells.

21. 13. A method for integrating a foreign gene or an expression cassette thereof into the genome of a cell, the method comprising: introducing into the cell the nucleic acid construct according to any one of claims 1 to 12, comprising a foreign gene and its promoter; and incubating the cell under conditions for integrating the foreign gene or its expression cassette into the genome of the cell by PiggyBac transposase, wherein the foreign gene and its promoter are located at a polyclonal insertion site of the nucleic acid construct.

Images