L-glutamic acid producing recombinant strains modified with gene BBD29_09525 and their construction and application

By modifying the BBD29_09525 gene in L-glutamic acid-producing bacteria, the production capacity is enhanced, addressing the demand for higher yields and efficient recovery of L-glutamic acid.

JP7789070B2Active Publication Date: 2025-12-19INNER MONGOLIA EPPEN BIOTECH CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2023540760
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-12-30
Filing Date
2021-12-28
Publication Date
2025-12-19
Estimated Expiration
2041-12-28

AI Technical Summary

Technical Problem

Existing methods for producing L-glutamic acid by fermentation are inadequate to meet the increasing demand, necessitating improvements in the production capacity and efficiency of L-glutamic acid-producing bacteria.

Method used

Modifying or enhancing the expression of the bacterial gene BBD29_09525 or its homologous genes, specifically through point mutations, increased copy number, and use of recombinant vectors to overexpress the gene, thereby improving the bacterium's ability to produce L-glutamic acid.

Benefits of technology

The modified bacteria exhibit enhanced L-glutamic acid production capabilities, accumulating the target compound in bacterial cells or culture medium, allowing for higher yields, up to 0.5 g/L or more, and facilitating efficient recovery and purification processes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007789070000001
    Figure 0007789070000001
  • Figure 0007789070000002
    Figure 0007789070000002
  • Figure 0007789070000003
    Figure 0007789070000003
Patent Text Reader

Abstract

The present invention discloses a recombinant strain for producing L-glutamic acid by modifying gene BBD29_09525, and its construction method and application. The recombinant strain is an L-glutamic acid producing bacterium, and the polynucleotide encoding the amino acid sequence of SEQ ID NO:3 or its homologous sequence is improved, and the improved discovery may be that the polynucleotide encoding the amino acid sequence of SEQ ID NO:3 or its homologous sequence has a point mutation and is enhanced. The present invention relates to a genetically engineered bacterium in which the 337th base of the BBD29_09525 gene sequence is mutated from cytosine to thymine and the 113th proline of the encoded corresponding amino acid sequence is replaced with serine, and the BBD29_09525 gene or BBD29_09525 is used as a recombinant bacterium for producing L-glutamic acid. C337T It is advantageous to construct an engineered strain that can overexpress genes to improve L-glutamic acid production and transformation rate.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the fields of genetic engineering and microbiology, and specifically to a recombinant strain producing L-glutamic acid, and its construction method and application. [Background technology]

[0002] L-glutamic acid is an important amino acid, which is used in food, clinical medicine and other fields.

[0003] Conventionally, L-glutamic acid is mainly produced by fermentation using L-glutamic acid-producing bacteria belonging to the genera Brevibacterium, Corynebacterium, or Microbacterium, or mutants thereof.

[0004] L-glutamate is biosynthesized from α-ketoglutarate, an intermediate in the citrate cycle in microbial cells. There are two biosynthetic pathways for the formation of L-glutamate from α-ketoglutarate by the assimilation of ammonium ions. One pathway is the synthesis of L-glutamate catalyzed by glutamate dehydrogenase (GDH) in the presence of high concentrations of ammonium ions. The other pathway (GS / GOGAT pathway) is the synthesis of L-glutamate by glutamine synthetase and glutamine-ketoglutarate aminotransferase. Glutamine synthetase (GS) catalyzes the conversion of L-glutamic acid and ammonium ions into glutamine, while glutamine-ketoglutarate aminotransferase (glutamine-oxoglutaric acid amino transferase, also known as glutamate synthase (GOGAT)) catalyzes the synthesis of L-glutamic acid, synthesizing two molecules of L-glutamic acid from one molecule of glutamine already synthesized from GS and one molecule of α-ketoglutarate.

[0005] Improvements in the production of L-amino acids by fermentation may relate to the fermentation technique, e.g., agitation and oxygen supply, or to the composition of the nutrient medium, e.g., sugar concentration during fermentation, or to the processing of the fermented broth into a suitable product form, e.g., by drying and granulation of the fermented broth or by ion exchange chromatography, or may relate to the intrinsic performance properties of the relevant microorganism itself. Methods for improving the performance properties of these microorganisms include mutagenesis, selection and screening of mutants, and the resulting strains are resistant to metabolites or are nutritionally deficient for regulatory important metabolites, and produce L-amino acids, etc. Although there are already many methods that can increase L-glutamic acid production capacity, there is still a need to develop L-glutamic acid production methods to meet the ever-increasing demand. Summary of the Invention

[0006] An object of the present invention is to develop a new technique for improving the L-glutamic acid-producing ability of bacteria and to provide a method for effectively producing L-glutamic acid. To achieve the above object, the inventors of the present invention have discovered through research that the L-glutamic acid producing ability of bacteria can be improved by modifying or improving the expression of the bacterial gene BBD29_09525 or its homologous genes. Based on these discoveries, the present invention has been completed.

[0007] The present invention provides an L-glutamic acid-producing bacterium, wherein the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 or a homologous sequence thereof has been discovered. The present invention further provides a method for producing L-glutamic acid using the microorganism.

[0008] A first aspect of the present invention provides an L-glutamic acid-producing bacterium, which has improved discovery of polynucleotides encoding the amino acid sequence of SEQ ID NO: 3 or a homologous sequence thereof. According to the present invention, the improved discovery can be enhanced discovery of the polynucleotide, or a polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 or a homologous sequence thereof that has a point mutation, or a polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 or a homologous sequence thereof that has a point mutation and has enhanced discovery.

[0009] The amino acid sequence of SEQ ID NO:3 or a homologous sequence thereof is a protein encoded by the gene BBD29_09525 or a homologous gene thereof.

[0010] The bacterium has an enhanced ability to produce L-glutamic acid compared to an unmodified strain.

[0011] In the present invention, the term "bacterium capable of producing L-glutamic acid" refers to a bacterium that has the ability to produce and accumulate the target L-glutamic acid in a medium and / or bacterial cells to the following extent so that L-glutamic acid can be collected when the bacterium is cultured in the medium. The bacterium capable of producing L-glutamic acid may be a bacterium that can accumulate the target L-glutamic acid in a medium and / or bacterial cells in an amount greater than that obtainable by an unmodified strain.

[0012] The term "unmodified strain" refers to a control strain that has not been modified to have a particular characteristic. Thus, examples of unmodified strains include wild-type strains and parental strains.

[0013] The bacterium capable of producing L-glutamic acid may be a bacterium capable of accumulating the target L-glutamic acid in a medium at an amount of preferably 0.5 g / L or more, more preferably 1.0 g / L or more.

[0014] In the present invention, unless otherwise specified, the term "L-glutamic acid" refers to L-glutamic acid in free form, a salt thereof or a mixture thereof.

[0015] The polynucleotide may encode an amino acid sequence having about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more sequence identity with the amino acid sequence of SEQ ID NO:3. As used herein, the term "homology" refers to the percentage identity between two polynucleotide or two polypeptide modules. Sequence homology between one module and another can be measured by methods known in the art. For example, such sequence homology can be measured by the BLAST algorithm.

[0016] The expression of a polynucleotide can be enhanced by substituting or mutating the expression regulatory sequence, introducing mutations into the polynucleotide sequence, increasing the copy number of the polynucleotide introduced via a chromosomal insertion or vector, or a combination thereof.

[0017] The discovery regulatory sequence of a polynucleotide may be modified. The discovery regulatory sequence controls the discovery of a polynucleotide operably linked thereto and may include, for example, a promoter, terminator, enhancer, silencer, etc. The polynucleotide may have a change in the start codon. The copy number may be increased by incorporating the polynucleotide into a specific site on a chromosome. As used herein, a specific site may include, for example, a transposon site or an intergenic site. Alternatively, the copy number may be increased by incorporating the polynucleotide into a discovery vector and introducing the discovery vector into a host cell.

[0018] In one embodiment of the present invention, the copy number is increased by incorporating a polynucleotide or a polynucleotide with a point mutation into a specific site in the chromosome of a microorganism.

[0019] In one embodiment of the present invention, a polynucleotide with a promoter sequence or a polynucleotide with a promoter sequence having a point mutation is incorporated into a specific site in the chromosome of a microorganism to overexpress the nucleic acid sequence.

[0020] In one embodiment of the present invention, the copy number is increased by incorporating the polynucleotide or the polynucleotide having a point mutation into a discovery vector and introducing the discovery vector into a host cell.

[0021] In one embodiment of the present invention, a polynucleotide with a promoter sequence or a polynucleotide with a promoter sequence having a point mutation is incorporated into a discovery vector, and the discovery vector is introduced into a host cell to overexpress the nucleic acid sequence.

[0022] In one specific embodiment of the present invention, the polynucleotide may comprise the nucleotide sequence of SEQ ID NO:1.

[0023] In one embodiment of the present invention, the polynucleotide encoding the amino acid sequence of SEQ ID NO:3 has a point mutation such that the proline at position 113 of the amino acid sequence of SEQ ID NO:3 is replaced with a different amino acid.

[0024] According to the present invention, preferably, proline at position 113 is replaced with serine.

[0025] According to the present invention, the amino acid sequence shown in SEQ ID NO:3, in which proline at position 113 is replaced with serine, is shown in SEQ ID NO:4.

[0026] In one embodiment of the present invention, the polynucleotide sequence having a point mutation is formed by a mutation at base 337 of the polynucleotide sequence shown in SEQ ID NO:1.

[0027] According to the present invention, the mutation comprises a cytosine (C) to thymine (T) mutation at base 337 of the polynucleotide sequence shown in SEQ ID NO:1.

[0028] In one embodiment of the invention, the polynucleotide sequence having the point mutation comprises the polynucleotide sequence shown in SEQ ID NO:2.

[0029] As used herein, the term "operable linkage" refers to a functional linkage between a regulatory sequence and a polynucleotide sequence, whereby the regulatory sequence controls the transcription and / or translation of the polynucleotide sequence. The regulatory sequence may be a strong promoter that can improve the expression level of the polynucleotide. The regulatory sequence may be a promoter derived from a microorganism belonging to the genus Corynebacterium, or a promoter derived from another microorganism. For example, the promoter may be a trc promoter, a gap promoter, a tac promoter, a T7 promoter, a lac promoter, a trp promoter, an araBAD promoter, or a cj7 promoter.

[0030] In one specific embodiment of the present invention, the promoter is a promoter of a polynucleotide encoding the amino acid sequence of SEQ ID NO:3 (BBD29_09525 gene).

[0031] As used herein, the term "vector" refers to a polynucleotide construct containing a gene regulatory sequence and a gene sequence and configured to locate a target gene in a suitable host cell. Alternatively, a vector may further refer to a polynucleotide construct containing a sequence capable of homologous recombination, whereby the vector introduced into a host cell can alter the regulatory sequence of an endogenous gene in the genome of the host cell or insert a locatable target gene into a specific site in the host's genome. In this regard, vectors used in the present invention may further contain a selectable marker that determines the introduction of the vector into a host cell or the integration of the vector into a chromosome of the host cell. The selectable marker may include a marker that confers a selectable phenotype, such as drug resistance, nutritional deficiency, resistance to cytotoxic agents, or the detection of a surface protein. In an environment treated with such a selection agent, transformed cells may be selected because only cells bearing the selectable marker can survive or exhibit a distinct phenotypic trait. Vectors as referred to herein are known to those of skill in the art and include, but are not limited to, plasmids, phage (such as lambda phage or M13 filamentous phage), cosmids (i.e., cosmids), or viral vectors.

[0032] In some specific embodiments of the present invention, the vectors used are pK18mobsacB plasmid, pXMJ19 plasmid.

[0033] As used herein, the term "transformation" refers to the introduction of a polynucleotide into a host cell so that the polynucleotide can replicate as an extragenomic element or as an inserted part of the genome of the host cell. The method for transforming a vector used in the present invention may include a method for introducing a nucleic acid into a cell. Alternatively, an electric pulse method may be performed depending on the host cell, as disclosed in the related art.

[0034] As used herein, the microorganism may be a yeast, a bacterium, an alga or a fungus.

[0035] According to the present invention, the bacterium is a microorganism belonging to the genus Corynebacterium, such as Corynebacterium acetoacidophilum, Corynebacterium acetoglutamicum, Corynebacterium callunae, Corynebacterium glutamicum, Brevibacterium flavum, Brevibacterium lactofermentum, Corynebacterium ammoniagenes, Corynebacterium pekinense, Brevibacterium saccharolyticum, and the like. saccharolyticum, Brevibacterium roseum, Brevibacterium thiogenitalis, and the like.

[0036] In one embodiment of the present invention, the microorganism belonging to the genus Corynebacterium is Corynebacterium glutamicum ATCC 13869.

[0037] In one embodiment of the present invention, the microorganism belonging to the genus Corynebacterium is Corynebacterium glutamicum YPGLU001, which is a high-yielding glutamic acid producing bacterium, and its conservation information is as follows: Species name: Corynebacterium glutamicum, Latin name: Corynebacterium glutamicum, Strain number: YPGLU001, Conservation organization: Center of Ordinary Microorganisms of the China Committee for the Conservation of Microorganisms, Conservation abbreviation: CGMCC, Address: No. 3, Hall No. 1, Beichen West Road, Chaoyang District, Beijing, Conservation date: November 23, 2020, Conservation center registration number: CGMCC No. 21220.

[0038] According to the present invention, the bacterium may further have other improvements related to improving L-glutamic acid production, for example, the discovery of enhancement or reduction of the activity or gene of an enzyme such as glutamate dehydrogenase, glutamine synthetase, or glutamine-ketoglutarate aminotransferase, or the gene may be replaced with an exogenous gene.

[0039] According to a second aspect of the present invention, there are provided a polynucleotide sequence, an amino acid sequence encoded by the polynucleotide sequence, a recombinant vector containing the polynucleotide sequence, and a recombinant strain containing the polynucleotide sequence.

[0040] According to the present invention, the polynucleotide sequence includes a polynucleotide that encodes a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:3, wherein the proline at position 113 of said sequence is replaced with a different amino acid.

[0041] According to the present invention, preferably, proline at position 113 is replaced with serine.

[0042] According to the present invention, the amino acid sequence shown in SEQ ID NO:3, in which proline at position 113 is replaced with serine, is shown in SEQ ID NO:4.

[0043] According to the present invention, preferably, the polynucleotide sequence encoding the polypeptide comprising the amino acid sequence shown in SEQ ID NO:3 comprises the polynucleotide sequence shown in SEQ ID NO:1.

[0044] In one embodiment of the invention, the polynucleotide sequence is formed by mutation of base 337 of the polynucleotide sequence shown in SEQ ID NO:1.

[0045] According to the present invention, the mutation refers to a change in the base / nucleotide at the site, and the mutation method may be at least one selected from mutagenesis, PCR-directed point mutation, and / or homologous recombination, etc. In the present invention, PCR-directed point mutation and / or homologous recombination are preferably used.

[0046] According to the present invention, the mutation comprises a cytosine (C) to thymine (T) mutation at base 337 of the polynucleotide sequence shown in SEQ ID NO:1.

[0047] In one embodiment of the invention, the polynucleotide sequence comprises the polynucleotide sequence shown in SEQ ID NO:2.

[0048] According to the present invention, the amino acid sequence comprises the amino acid sequence shown in SEQ ID NO:4.

[0049] According to the present invention, the recombinant vector is constructed by introducing the polynucleotide sequence into a plasmid.

[0050] In one embodiment of the invention, the plasmid is the pK18mobsacB plasmid.

[0051] In another embodiment of the invention, the plasmid is the pXMJ19 plasmid.

[0052] Specifically, the polynucleotide sequence and the plasmid may be constructed as a recombinant vector via the NEBuider recombination system.

[0053] According to the present invention, said recombinant strain comprises said polynucleotide sequence.

[0054] In one embodiment of the present invention, the starting strain of the recombinant strain is Corynebacterium glutamicum CGMCC No. 21220.

[0055] In one embodiment of the present invention, the starting strain of the recombinant strain is ATCC 13869.

[0056] According to a third aspect of the present invention, there is further provided a method for constructing a recombinant strain that produces L-glutamic acid.

[0057] According to the present invention, the construction method comprises: The method includes modifying the polynucleotide sequence of the wild-type BBD29_09525 gene shown in SEQ ID NO:1 in a host strain to generate a mutation at base 337 thereof, thereby obtaining a recombinant strain containing a mutated BBD29_09525-encoding gene.

[0058] According to the construction method of the present invention, the modification includes at least one of the following methods: mutagenesis, PCR fixed point mutation, and / or homologous recombination.

[0059] According to the construction method of the present invention, the mutation refers to a mutation of the 337th base in SEQ ID NO:1 from cytosine (C) to thymine (T). Specifically, the polynucleotide sequence containing the mutant BBD29_09525-encoding gene is set forth in SEQ ID NO:2.

[0060] Furthermore, the construction method includes: (1) modifying the nucleotide sequence of the wild-type BBD29_09525 gene shown in SEQ ID NO: 1 to introduce a mutation at base 337 thereof, thereby obtaining a mutant BBD29_09525 gene polynucleotide sequence; (2) constructing a recombinant vector by ligating the mutated polynucleotide sequence with a plasmid; and (3) introducing the recombinant vector into a host strain to obtain a recombinant strain containing the mutant BBD29_09525-encoding gene.

[0061] According to the construction method of the present invention, step (1) includes constructing a point-mutated BBD29_09525 gene. That is, based on the genome sequence of the unmodified strain, two pairs of primers, P1 and P2 and P3 and P4, for amplifying the BBD29_09525 gene fragment are synthesized, and point mutations are introduced into the wild-type BBD29_09525 gene SEQ ID NO: 1 by PCR-fixed point mutation method to obtain the point-mutated BBD29_09525 gene nucleotide sequence SEQ ID NO: 2, and BBD29_09525 C337T Let's say.

[0062] In one embodiment of the present invention, the unmodified strain genome may be derived from the ATCC 13869 strain, the genome sequence of which may be obtained from the NCBI site.

[0063] In one embodiment of the present invention, in step (1), the primers are as follows: P1:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG AAGGAATGTT GTCTGGGCGG 3'(SEQ ID NO:5) P2:5' GGCGTGCTGG CTGATTCTAA GGAATTCATC 3'(SEQ ID NO:6) P3:5' GATGAATTCC TTAGAATCAG CCAGCACGCC 3'(SEQ ID NO:7) P4:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGATAGGTCGA TTGTTGGTGT 3'(SEQ ID NO:8) In one embodiment of the present invention, the PCR amplification is carried out in the following manner: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 45 seconds (30 cycles), followed by over-extension at 72°C for 10 minutes.

[0064] In one embodiment of the present invention, the overlap PCR amplification is carried out in the following manner: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 90 seconds (30 cycles), followed by over-extension at 72°C for 10 minutes.

[0065] According to the construction method of the present invention, the step (2) includes the construction of a recombinant plasmid, and the isolated and purified BBD29_09525 C337T and pK18mobsacB plasmids were assembled using the NEBuider recombination system to obtain recombinant plasmids.

[0066] According to the construction method of the present invention, the step (3) includes constructing a recombinant strain, that is, transforming the recombinant plasmid into a host strain to obtain a recombinant strain.

[0067] In one embodiment of the present invention, the transformation in step (3) is an electrotransformation method.

[0068] In one embodiment of the invention, the host strain is ATCC 13869.

[0069] In one embodiment of the present invention, the host strain is Corynebacterium glutamicum CGMCC No. 21220.

[0070] In one embodiment of the invention, the recombination is achieved by homologous recombination.

[0071] According to a fourth aspect of the present invention, there is further provided a method for constructing a recombinant strain that produces L-glutamic acid.

[0072] According to the present invention, the construction method comprises: The upstream and downstream homologous arm fragments of BBD29_09525, the coding region of the BBD29_09525 gene and its promoter region sequence are amplified, and then BBD29_09525 or BBD29_09525 is inserted into the genome of the host strain by homologous recombination. C337TThe gene is introduced, and the strain is BBD29_09525 or BBD29_09525 C337T The method includes a step of achieving overexpression of the gene.

[0073] In one embodiment of the invention, the primers for amplifying the upstream homology arm fragment are: P7:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GACCCGCTTG CCATACGAAG 3'(SEQ ID NO:11) P8:5' CTGAAGCTTG AGGAAGCCTA A ATCTACTCAT CTGAAGAATC 3'(SEQ ID NO:12) In one embodiment of the invention, the primers for amplifying the downstream homology arm fragment are as follows:

[0074] P11:5' TCGACCTATC GTTATACAT TTCGTGGGCA CTCTGGTTTG 3'(SEQ ID NO:15) P12:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCATAAGAAAC AACCACTTCC 3'(SEQ ID NO:16) In one embodiment of the present invention, the primers for amplifying the gene coding region and its promoter region sequence are as follows:

[0075] P9:5' GATTCTTCAG ATGAGTAGAT TTAGGCTTCC TCAAGCTTCAG 3'(SEQ ID NO:13) P10:5' CAAACCAGAG TGCCCACGAA ATGTATAACG ATAGGTCGA 3'(SEQ ID NO:14) In one embodiment of the present invention, the P7 / P12 is further used as a primer to amplify a mixture of the amplified upstream homologous arm fragment, downstream homologous arm fragment, gene coding region and its promoter region sequence fragment as a template to obtain an integrated homologous arm fragment.

[0076] In one embodiment of the present invention, the PCR system used comprises 5 μL of 10×Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ The PCR mixture consisted of 4 μL of 25 mM ATP, 2 μL of each primer (10 pM), and 0.25 μL of ExTaq (5 U / μL), in a total volume of 50 μL. PCR amplification was performed as follows: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 120 seconds (30 cycles), and over-extension at 72°C for 10 minutes.

[0077] In one embodiment of the present invention, the NEBuider recombination system is employed to assemble the shuttle plasmid PK18mobsacB and the integrated homology arm fragment to obtain the integrated plasmid.

[0078] In one embodiment of the present invention, the integrative plasmid is transfected into a host strain and BBD29_09525 or BBD29_09525 is inserted into the genome of the host strain by homologous recombination. C337T Introducing a gene.

[0079] In one embodiment of the present invention, the host strain is Corynebacterium glutamicum CGMCC No. 21220.

[0080] In one embodiment of the invention, the host strain is ATCC 13869.

[0081] In one embodiment of the invention, the host strain is a strain having the polynucleotide sequence shown in SEQ ID NO:2.

[0082] According to a fifth aspect of the present invention, there is further provided a method for constructing a recombinant strain that produces L-glutamic acid.

[0083] According to the present invention, the construction method comprises: BBD29_09525 gene coding region and promoter region sequence, or BBD29_09525 C337T The gene coding region and promoter region sequences are amplified to construct an overexpression plasmid vector, and the vector is introduced into a host strain, and the strain is BBD29_09525 or BBD29_09525 C337T The method includes a step of achieving overexpression of the gene.

[0084] In one embodiment of the present invention, the primers for amplifying the gene coding region and its promoter region sequence are as follows: P17:5' GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCTTAGGCTTCC TCAAGCTTCAG 3'(SEQ ID NO:21) P18:5' ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACATGTATAACGATAGGTCGA 3'(SEQ ID NO:22).

[0085] In one embodiment of the present invention, the PCR system comprises 5 μL of 10×Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ The PCR amplification was carried out in the following cycles: 4 μL of 25 mM ATP, 2 μL of each primer (10 pM), and 0.25 μL of Ex Taq (5 U / μL), with a total volume of 50 μL. The PCR amplification was carried out in the following cycles: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 120 seconds, and over-extension at 72°C for 10 minutes.

[0086] In one embodiment of the present invention, the NEBuider recombination system is used to transfect the shuttle plasmid pXMJ19 with the promoter-containing BBD29_09525 or BBD29_09525 C337T The fragments are assembled to obtain the overexpression plasmid.

[0087] In one embodiment of the present invention, the host strain is Corynebacterium glutamicum CGMCC No. 21220.

[0088] In one embodiment of the invention, the host strain is ATCC 13869.

[0089] In one embodiment of the invention, the host strain is a strain having the polynucleotide sequence shown in SEQ ID NO:2.

[0090] The recombinant strain obtained in the present invention may be used alone for the fermentative production of L-glutamic acid, or may be mixed with other bacteria that produce L-glutamic acid to produce L-glutamic acid by fermentation.

[0091] According to another aspect of the present invention, there is provided a method for producing L-glutamic acid, the method comprising culturing the bacterium described above and obtaining L-glutamic acid from the culture.

[0092] The bacteria can be cultured in an appropriate medium under culture conditions known in the art. The medium may contain a carbon source, a nitrogen source, trace elements, and combinations thereof. The pH of the culture may be adjusted during the culture. The culture may also include preventing the generation of bubbles, for example, by using an antifoaming agent. The culture may also include injecting gas into the culture. The gas may include any gas capable of maintaining aerobic conditions in the culture. The culture temperature during the culture may be 20 to 45°C. The produced L-glutamic acid can be recovered from the culture by treating the culture with sulfuric acid or hydrochloric acid, and then using a combination of methods, such as anion exchange chromatography, concentration, crystallization, and isoelectric precipitation.

[0093] In the present invention, SEQ ID NO:1:BBD29_09525 wild type ORF sequence ATGTCAGATT CCCCGAAGAA CGCACCGAGG ATTACCGATG AGGCAGATGT AGTTCTCATT GGTGCCGGTA TCATGAGCTC CACGCTGGGT GCAATGCTGC GTCAGCTGGA GCCAAGCTGG ACTCAGATCG TCTTCGAGCG TTTGGATGGA CCGGCACAAG AGTCGTCCTC CCCGTGGAAC AATGCAGGAA CCGGCCACTC TGCTCTATGC GAGCTGAACT ACACCCCAGA GGTTAAGGGC AAGGTTGAAA TTGCCAAGGC TGTAGGAATC AACGAGAAGT TCCAGGTTTC CCGTCAGTTC TGGTCTCACC TCGTTGAAGA GGGCGTGCTG GCTGAT CCTA AGGAATTCAT CAACCCTGTT CCTCACGTAT CTTTCGGCCA GGGCGCAGAC CAGGTTGCAT ACATCAAGGC TCGCTACGAA GCTTTGAAGG ATCACCCACT CTTCCAGGGC ATGACCTACG CTGACGATGA AGCTACCTTC ACCGAGAAGC TGCCTTTGAT GGCAAAGGGC CGTGACTTCT CTGATCCAGT AGCAATCTCT TGGATCGATG AAGGCACCGA CATCAACTAC GGTGCTCAGA CCAAGCAGTA CCTGGATGCA TCTGAAGTTG AAGGCACTGA AATCCGCTAT GGCCACGAAG TCAAGAGCAT CAAGGCTGAT GGCGCAAAGT GGATCGTGAC CGTCAAGAAC GTACACACTG GCGACACCAA GACCATCAAG GCAAACTTCG TGTTCGTCGG CGCAGGCGGG TACGCACTGG ATCTGCTTCG CAGCGCAGGC ATCCCACAGG TCAAGGGCTT CGCTGGATTC CCAGTATCCG GCCTGTGGCT TCGTTGCACC AACGAGGAAC TGATCGAGCA GCACGCAGCC AAGGTATATG GCAAGGCATC TGTTGGCGCT CCTCCAATGT CTGTTCCTCA CCTTGACACC CGCGTTATCG AGGGTGAAAA GGGTCTGCTC TTTGGACCTT ACGGTGGCTG GACCCCTAAG TTCTTGAAGG AAGGCTCCTA CCTGGACCTG TTCAAGTCCA TCCGCCCAGA CAACATTCCT TCCTACCTTG GCGTTGCTGC TCAGGAATTT GATCTGACCA AGTACCTTGT CACTGAAGTT CTCAAGGACC AGGACAAGCG TATGGATGCT CTTCGCGAGT ACATGCCAGA GGCACAAAAC GGCGATTGGG AGACCATCGT TGCCGGACAG CGTGTTCAGG TTATTAAGCC TGCAGGATTC CCTAAGTTCGGTTCCCTGGA ATTCGGCACC ACCTTGATCA ACAACTCCGA AGGCACCATC GCCGGATTGC TCGGTGCTTC CCCTGGAGCA TCCATCGCAC CTTCCGCAAT GATCGAGCTG CTTGAGCGTT GCTTCGGTGA CCGCATGATC GAGTGGGGCG ACAAGCTGAA GGACATGATC CCTTCCTACG GCAAGAAGCT TGCTTCCGAG CCAGCACTGT TTGAGCAGCA GTGGGCACGC ACCCAGAAGA CCCTGAAGCT TGAGGAAGCC TAA SEQ ID NO:2:BBD29_09525 C337T ORF sequence ATGTCAGATT CCCCGAAGAA CGCACCGAGG ATTACCGATG AGGCAGATGT AGTTCTCATT GGTGCCGGTA TCATGAGCTC CACGCTGGGT GCAATGCTGC GTCAGCTGGA GCCAAGCTGG ACTCAGATCG TCTTCGAGCG TTTGGATGGA CCGGCACAAG AGTCGTCCTC CCCGTGGAAC AATGCAGGAA CCGGCCACTC TGCTCTATGC GAGCTGAACT ACACCCCAGA GGTTAAGGGC AAGGTTGAAA TTGCCAAGGC TGTAGGAATC AACGAGAAGT TCCAGGTTTC CCGTCAGTTC TGGTCTCACC TCGTTGAAGA GGGCGTGCTG GCTGAT TCTA AGGAATTCAT CAACCCTGTT CCTCACGTAT CTTTCGGCCA GGGCGCAGAC CAGGTTGCAT ACATCAAGGC TCGCTACGAA GCTTTGAAGG ATCACCCACT CTTCCAGGGC ATGACCTACG CTGACGATGA AGCTACCTTC ACCGAGAAGC TGCCTTTGAT GGCAAAGGGC CGTGACTTCT CTGATCCAGT AGCAATCTCT TGGATCGATG AAGGCACCGA CATCAACTAC GGTGCTCAGA CCAAGCAGTA CCTGGATGCA TCTGAAGTTG AAGGCACTGA AATCCGCTAT GGCCACGAAG TCAAGAGCAT CAAGGCTGAT GGCGCAAAGT GGATCGTGAC CGTCAAGAAC GTACACACTG GCGACACCAA GACCATCAAG GCAAACTTCG TGTTCGTCGG CGCAGGCGGG TACGCACTGG ATCTGCTTCG CAGCGCAGGC ATCCCACAGG TCAAGGGCTT CGCTGGATTC CCAGTATCCG GCCTGTGGCT TCGTTGCACC AACGAGGAAC TGATCGAGCA GCACGCAGCC AAGGTATATG GCAAGGCATC TGTTGGCGCT CCTCCAATGT CTGTTCCTCA CCTTGACACC CGCGTTATCG AGGGTGAAAA GGGTCTGCTC TTTGGACCTT ACGGTGGCTG GACCCCTAAG TTCTTGAAGG AAGGCTCCTA CCTGGACCTG TTCAAGTCCA TCCGCCCAGA CAACATTCCT TCCTACCTTG GCGTTGCTGC TCAGGAATTT GATCTGACCA AGTACCTTGT CACTGAAGTT CTCAAGGACC AGGACAAGCG TATGGATGCT CTTCGCGAGT ACATGCCAGA GGCACAAAAC GGCGATTGGG AGACCATCGT TGCCGGACAG CGTGTTCAGG TTATTAAGCC TGCAGGATTC CCTAAGTTCGGTTCCCTGGA ATTCGGCACC ACCTTGATCA ACAACTCCGA AGGCACCATC GCCGGATTGC TCGGTGCTTC CCCTGGAGCA TCCATCGCAC CTTCCGCAAT GATCGAGCTG CTTGAGCGTT GCTTCGGTGA CCGCATGATC GAGTGGGGCG ACAAGCTGAA GGACATGATC CCTTCCTACG GCAAGAAGCT TGCTTCCGAG CCAGCACTGT TTGAGCAGCA GTGGGCACGC ACCCAGAAGA CCCTGAAGCT TGAGGAAGCC TAA SEQ ID NO:3:BBD29_09525 wild-type encoded protein amino acid sequence MSDSPKNAPR ITDEADVVLI GAGIMSSTLG AMLRQLEPSW TQIVFERLDG PAQESSSPWN NAGTGHSALC ELNYTPEVKG KVEIAKAVGI NEKFQVSRQF WSHLVEEGVL ADPKEFINPV PHVSFGQGAD QVAYIKARYE ALKDHPLFQG MTYADDEATF TEKLPLMAKG RDFSDPVAIS WIDEGTDINY GAQTKQYLDA SEVEGTEIRY GHEVKSIKAD GAKWIVTVKN VHTGDTKTIK ANFVFVGAGG YALDLLRSAG IPQVKGFAGF PVSGLWLRCT NEELIEQHAA KVYGKASVGA PPMSVPHLDT RVIEGEKGLL FGPYGGWTPK FLKEGSYLDL FKSIRPDNIP SYLGVAAQEF DLTKYLVTEV LKDQDKRMDA LREYMPEAQN GDWETIVAGQ RVQVIKPAGF PKFGSLEFGT TLINNSEGTI AGLLGASPGA SIAPSAMIEL LERCFGDRMI EWGDKLKDMI PSYGKKLASE PALFEQQWAR TQKTLKLEEA SEQ ID NO:4:BBD29_09525 P113S encoded protein amino acid sequence MSDSPKNAPR ITDEADVVLI GAGIMSSTLG AMLRQLEPSW TQIVFERLDG PAQESSSPWN NAGTGHSALC ELNYTPEVKG KVEIAKAVGI NEKFQVSRQF WSHLVEEGVL ADSKEFINPV PHVSFGQGAD QVAYIKARYE ALKDHPLFQG MTYADDEATF TEKLPLMAKG RDFSDPVAIS WIDEGTDINY GAQTKQYLDA SEVEGTEIRY GHEVKSIKAD GAKWIVTVKN VHTGDTKTIK ANFVFVGAGG YALDLLRSAG IPQVKGFAGF PVSGLWLRCT NEELIEQHAA KVYGKASVGA PPMSVPHLDT RVIEGEKGLL FGPYGGWTPK FLKEGSYLDL FKSIRPDNIP SYLGVAAQEF DLTKYLVTEV LKDQDKRMDA LREYMPEAQN GDWETIVAGQ RVQVIKPAGF PKFGSLEFGT TLINNSEGTI AGLLGASPGA SIAPSAMIEL LERCFGDRMI EWGDKLKDMI PSYGKKLASE PALFEQQWAR TQKTLKLEEA BBD29_09525 P113S Namely BBD29_09525 P113S.

[0094] The present invention further provides a protein, designated protein BBD29_09525 P113S and the protein is A1) a protein having the amino acid sequence SEQ ID No. 4; A2) A protein having 80% or more identity and the same function as the protein shown in A1), which is obtained by substituting and / or deleting and / or adding amino acid residues in the amino acid sequence shown in SEQ ID No. 4; A3) A fusion protein having the same function obtained by linking a tag to the N-terminus and / or C-terminus of A1) or A2).

[0095] The present invention further provides a nucleic acid molecule, designated BBD29_09525 C337T The nucleic acid molecule BBD29_09525 C337T teeth, B1) BBD29_09525 encoding the protein P113S a nucleic acid molecule of B2) a DNA molecule whose coding sequence is shown in SEQ ID No. 2; B3) The nucleotide sequence may be any one of the DNA molecules shown in SEQ ID No. 2.

[0096] The DNA molecule shown in SEQ ID No. 2 is BBD29_09525 according to the present invention. C337T It's genetic.

[0097] The DNA molecule shown in SEQ ID No. 2 (BBD29_09525 C337T The gene) encodes the protein BBD29_09525, which is shown in SEQ ID No. 4. P113S Code the following.

[0098] Protein BBD29_09525 P113S The serine (S) at position 113 in the amino acid sequence (SEQ ID No. 4) was mutated from proline (P).

[0099] The present invention further provides a biological material, the biological material comprising: C1) the nucleic acid molecule BBD29_09525 C337T a discovery cassette comprising: C2) the nucleic acid molecule BBD29_09525 C337T or a recombinant vector comprising the discovery cassette described in C1), C3) The nucleic acid molecule BBD29_09525 C337T or C1) a recombinant microorganism comprising the discovery cassette described above; or C2) a recombinant microorganism comprising the recombinant vector.

[0100] The present invention provides F1) Application of any one of the microorganisms D1) to D8) in controlling the production of L-glutamic acid; F2) Application of any one of D1) to D8) in the construction of a genetically engineered strain producing L-glutamic acid; F3) Further providing any one of the applications D1) to D8) in any one of the applications D1) to D8) in the production of L-glutamic acid; Here, the above D1) to D8) are: D1) Protein BBD29_09525 P113S , D2) The nucleic acid molecule BBD29_09525 C337T , D3) the biological material; D4) a DNA molecule having the nucleotide sequence SEQ ID No. 1; D5) DNA molecules having 90% or more identity to the DNA molecule shown in SEQ ID No. 1 and having the same function, which are obtained by modifying and / or substituting and / or deleting and / or adding one or more nucleotides from the nucleotide sequence shown in SEQ ID No. 1; D6) A discovery cassette comprising a DNA molecule according to D4) or D5). D7) A recombinant vector comprising the DNA molecule according to D4) or D5), or a recombinant vector comprising the discovery cassette according to D6). D8) A recombinant microorganism comprising a DNA molecule according to D4) or D5), or a recombinant microorganism comprising a discovery cassette according to D6), or a recombinant microorganism comprising a recombinant vector according to D7).

[0101] The DNA molecule shown in SEQ ID No. 1 is the BBD29_09525 gene described in the present invention.

[0102] The DNA molecule shown in SEQ ID No. 1 (BBD29_09525 gene) encodes the protein shown in SEQ ID No. 3.

[0103] As used herein, "identity" refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of amino acid sequences can be measured using an international Internet homology search site, such as the BLAST page on the NCBI homepage. For example, in the extended BLAST 2.1, the identity (%) of a pair of amino acid sequences can be calculated by searching for and calculating the identity using blastp as the program, setting the Expect value to 10, turning off all filters, and using BLOSUM62 as the matrix, with the gap existence cost, per residue gap cost, and lambda ratio set to 11, 1, and 0.85 (default values), respectively.

[0104] As used herein, the 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0105] As used herein, the 90% or greater identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0106] Controlling the amount of L-glutamic acid produced by a microorganism as described herein may mean increasing or decreasing the amount of L-glutamic acid accumulated in the microorganism (i.e., promoting or suppressing the biosynthesis of L-glutamic acid).

[0107] The present invention further provides a method for improving L-glutamic acid production in a microorganism, the method comprising: E1) and the nucleic acid molecule BBD29_09525 in the target microorganism C337T and obtaining a microorganism having a higher L-glutamic acid production capacity than the target microorganism. E2) to obtain a microorganism in which the amount or content of the DNA molecule described in D4) or D5) in the target microorganism is higher than that of the target microorganism, and the amount of L-glutamic acid produced is higher than that of the target microorganism. E3) mutating the DNA molecule having the nucleotide sequence of SEQ ID No. 1 in the target microorganism to obtain a microorganism that produces L-glutamic acid at a higher level than the target microorganism.

[0108] In the above method, the mutation may be a point mutation, ie, a mutation of a single nucleotide.

[0109] In the above method, the point mutation may be one that mutates the proline residue at position 113 of the amino acid sequence encoded by the DNA molecule shown in SEQ ID No. 1 to another amino acid residue.

[0110] In the above method, the point mutation is a mutation of proline at position 113 in the amino acid sequence encoded by the DNA molecule shown in SEQ ID No. 1 to serine, resulting in a mutant protein BBD29_09525 having the amino acid sequence of SEQ ID No. 4. P113S It may be possible to obtain the above.

[0111] The mutation refers to a gene fixed point mutation, which changes one or more bases in a gene, thereby changing the corresponding amino acid sequence of the protein, producing a new protein, or generating a new function in the original protein. Gene fixed point mutation techniques, such as oligonucleotide primer-mediated fixed point mutation, PCR-mediated fixed point mutation, or cassette mutation, are well known to those skilled in the art.

[0112] The point mutation described herein may be a single base substitution, a single base insertion, or a single base deletion, and specifically may be a single base substitution. The single base substitution may be an allelic substitution.

[0113] The point mutation may be a nucleic acid modification of cytosine (C) at position 337 of the BBD29_09525 gene (SEQ ID No. 1).

[0114] Specifically, the point mutation may be a mutation of cytosine (C) at position 337 of the BBD29_09525 gene (SEQ ID No. 1) to thymine (T) to obtain the DNA molecule shown in SEQ ID No. 2.

[0115] In the present specification, the recombinant vector is specifically the recombinant vector pK18-BBD29_09525 C337T , PK18mobsacB-BBD29_09525, PK18mobsacB-BBD29_09525 C337T , pXMJ19-BBD29_09525 or pXMJ19-BBD29_09525 C337T may be.

[0116] The recombinant vector pK18-BBD29_09525 C337T is a recombinant vector obtained by replacing the fragment (small fragment) between the XbaI and BamHI recognition sites of the pK18mobsacB vector with the DNA fragment shown at positions 37 to 1466 of SEQ ID No. 29 in the Sequence Listing, while maintaining the other sequences of the pK18mobsacB vector. C337T The mutation in the gene BBD29_09525 is shown in SEQ ID No. C337T It comprises a DNA molecule shown at positions 1 to 1051 of the

[0117] The recombinant vector PK18mobsacB-BBD29_09525 is used to integrate a foreign gene into the BBD29_09525 host chromosome and overexpress the wild-type BBD29_09525 gene during bacterial production. The recombinant vector PK18mobsacB-BBD29_09525 is a recombinant vector obtained by replacing the fragment (small fragment) between the XbaI and / BamHI recognition sites of the pK18mobsacB vector with the DNA fragment represented by positions 37 to 3407 of SEQ ID No. 30 in the Sequence Listing, while maintaining the other sequences of the pK18mobsacB vector.

[0118] The recombinant vector PK18mobsacB-BBD29_09525 C337T The foreign gene was BBD29_09525 C337T The mutant gene BBD29_09525 was integrated into the host chromosome and mutated during bacterial production. C337T The recombinant vector PK18mobsacB-BBD29_09525 is used to overexpress C337T is a recombinant vector obtained by replacing the fragment (small fragment) between the XbaI and BamHI recognition sites of the pK18mobsacB vector with the DNA fragment shown at positions 37 to 3407 of SEQ ID No. 31 in the Sequence Listing, while maintaining the other sequences of the pK18mobsacB vector.

[0119] The recombinant vector pXMJ19-BBD29_09525 is used to extrachromosomally integrate a foreign gene via the BBD29_09525 plasmid and overexpress the wild-type BBD29_09525 gene during bacterial production. The recombinant vector pXMJ19-BBD29_09525 is a recombinant vector obtained by replacing the fragment (small fragment) between the EcoR I and Kpn I recognition sites of the pXMJ19 vector with the DNA fragment represented by positions 37 to 1927 of SEQ ID No. 32 in the Sequence Listing, while maintaining the other sequences of the pXMJ19 vector.

[0120] The recombinant vector pXMJ19-BBD29_09525 C337Tis BBD29_09525 C337T The foreign gene was introduced extrachromosomally via the plasmid, and the mutant gene BBD29_09525 was introduced during bacterial production. C337T The recombinant vector pXMJ19-BBD29_09525 is used to overexpress C337T is a recombinant vector obtained by replacing the fragment (small fragment) between the EcoR I and Kpn I recognition sites of the pXMJ19 vector with the DNA fragment shown at positions 37 to 1927 of SEQ ID No. 33 in the sequence listing, while maintaining the other sequences of the pXMJ19 vector intact.

[0121] The recombinant vector pK18-BBD29_09525 C337T , PK18mobsacB-BBD29_09525, PK18mobsacB-BBD29_09525 C337T , pXMJ19-BBD29_09525 and pXMJ19-BBD29_09525 C337T are all within the scope of protection of the present invention.

[0122] In the present specification, the recombinant microorganism may specifically be recombinant bacteria YPG-007, YPG-008, YPG-009, YPG-010 or YPG-011.

[0123] The recombinant bacterium YPG-007 contains the recombinant vector pK18-BBD29_09525 C337T The recombinant bacterium YPG-007 is a recombinant bacterium obtained by transforming Corynebacterium glutamicum CGMCC No. 21220, and the recombinant bacterium YPG-007 contains the mutant gene BBD29_09525 shown in SEQ ID No. 2. C337T Includes.

[0124] The recombinant bacterium YPG-008 contains two copies of the BBD29_09525 gene shown in SEQ ID No. 1, and the recombinant bacterium containing two copies of the BBD29_09525 gene can significantly and stably increase the amount of the BBD29_09525 gene. The recombinant bacterium YPG-008 is an engineered bacterium that overexpresses the wild-type BBD29_09525 gene in its genome.

[0125] The recombinant strain YPG-009 contains the mutation BBD29_09525 shown in SEQ ID No. 2. C337T The recombinant strain YPG-009 contains the mutant BBD29_09525 gene. C337T It is an engineered fungus that overexpresses genes.

[0126] The recombinant strain YPG-010 contains two copies of the BBD29_09525 gene shown in SEQ ID No. 1. The recombinant strain YPG-010 is an engineered strain that overexpresses the wild-type BBD29_09525 gene on a plasmid, i.e., the plasmid pXMJ19-BBD29_09525 overexpresses it extrachromosomally.

[0127] The recombinant strain YPG-011 contains the mutation BBD29_09525 shown in SEQ ID No. 2. C337T The recombinant strain YPG-011 contains the mutant BBD29_09525 gene on the plasmid. C337T The engineered strain overexpressing the gene, i.e., the plasmid pXMJ19-BBD29_09525 C337T is overexpressed extrachromosomally.

[0128] The recombinant strains YPG-007, YPG-008, YPG-009, YPG-010 and YPG-011 are all within the scope of protection of the present invention.

[0129] The present invention further provides a method for constructing said recombinant microorganism, said method comprising: F1) the nucleic acid molecule BBD29_09525 C337T into a target microorganism to obtain the recombinant microorganism; F2) introducing the DNA molecule shown in SEQ ID No. 1 into a target microorganism to obtain said recombinant microorganism; F3) editing the DNA molecule shown in SEQ ID No. 1 using gene editing means (e.g., single-base gene editing) to include the DNA molecule shown in SEQ ID No. 2 in the target microorganism.

[0130] The introduction may be performed by transforming a vector carrying the DNA molecule of the present invention into a host bacterium using known transformation methods such as chemical transformation or electroshock transformation. The introduced DNA molecule may be a single copy or multiple copies. The introduction may involve integration of the foreign gene into the host chromosome, or the plasmid may be present extrachromosomally.

[0131] The present invention further provides a method for producing L-glutamic acid, the method comprising producing L-glutamic acid using any one of the recombinant microorganisms described herein.

[0132] In the above method, the method may be a fermentation method for producing L-glutamic acid, and the recombinant microorganism may be a Corynebacterium, specifically Corynebacterium glutamicum and its mutants.

[0133] Preservation information: Species name: Corynebacterium glutamicum, Latin name: Corynebacterium glutamicum, Strain number: YPGLU001, Preservation organization: Center of Ordinary Microorganisms, China Committee for the Preservation and Management of Microbial Species, Preservation organization abbreviation: CGMCC, Address: No. 3, Hall 1, Beichen West Road, Chaoyang District, Beijing, Preservation date: November 23, 2020, Preservation center registration number: CGMCC No. 21220. DETAILED DESCRIPTION OF THE INVENTION

[0134] The present invention will be described in more detail below in connection with specific embodiments, and the examples provided are not intended to limit the scope of the present invention, but merely to illustrate the present invention. The examples provided below can serve as guidelines for further improvements by those skilled in the art, and do not constitute limitations of the present invention in any way.

[0135] Unless otherwise specified, the experimental methods in the following examples are all conventional methods and are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. Materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0136] In the following examples, the composition of the basal medium used to culture the above strains is the same, to which sucrose, kanamycin, chloramphenicol, etc., as required for the medium composition, are added. The composition of the basal medium is shown in Table 1. [Table 1] In the following examples, Corynebacterium glutamicum YPGLU001 CGMCC No. 21220 was preserved at the Center of Ordinary Microorganisms of the China Commission for the Collection and Management of Microbial Species of China (abbreviated as CGMCC, address: No. 3, Beichen West Road, Chaoyang District, Beijing, China, Institute of Microbiology, Chinese Academy of Sciences) on November 23, 2020, with the preservation registration number CGMCC No. 21220. Corynebacterium glutamicum YPGLU001 is also known as Corynebacterium glutamicum CGMCC No. 21220.

[0137] Example 1 Transformation vector pK18-BBD29_09525 containing the point-mutated BBD29_09525 gene coding region C337T Construction Based on the genome sequence of Corynebacterium glutamicum ATCC 13869 published by NCBI, two pairs of primers were designed and synthesized to amplify the BBD29_09525 gene coding region sequence. Point mutations were introduced into the Corynebacterium glutamicum CGMCC No. 21220 strain (the BBD29_09525 gene coding region on the chromosome of this strain, confirmed by sequencing, is identical to that of ATCC 13869) by allele substitution. The amino acid sequence of the corresponding encoded protein is SEQ ID NO: 3, which is a sequence from cytosine (C) to thymine (T) at position 337 of the nucleotide sequence of the BBD29_09525 gene (SEQ ID NO: 2: BBD29_09525 C337T ) and the 113th amino acid in the encoded protein has been changed from proline (P) to serine (S) (SEQ ID NO:4:BBD29_09525 P113S).

[0138] The point mutation involves a mutation of cytosine (C) at position 337 in the nucleotide sequence of the BBD29_09525 gene (SEQ ID No. 1) to thymine (T), resulting in a DNA molecule shown in SEQ ID No. 2 (mutated BBD29_09525 gene, designated BBD29_09525 C337T (which is the result).

[0139] Here, the DNA molecule shown in SEQ ID No. 1 encodes the amino acid sequence of the protein of SEQ ID No. 3 (the protein name is protein BBD29_09525).

[0140] The DNA molecule shown in SEQ ID No. 2 is a mutant protein having the amino acid sequence of SEQ ID No. 4 (the mutant protein is designated BBD29_09525 P113S The mutant protein BBD29_09525 P113S The serine (S) at position 113 in the amino acid sequence (SEQ ID No. 4) was mutated from proline (P).

[0141] Overlap PCR technology was used to perform gene-fixed point mutation. The primers were designed as follows (synthesized by Shanghai Invitrogen), and the bases in bold are the mutation positions: P1:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG AAGGAATGTT GTCTGGGCGG 3'(SEQ ID NO:5) P2:5' GGCGTGCTGG CTGAT T CTAA GGAATTCATC 3'(SEQ ID NO:6) P3:5' GATGAATTCC TTAG A ATCAG CCAGCACGCC 3'(SEQ ID NO:7) P4:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGATAGGTCGA TTGTTGGTGT 3'(SEQ ID NO:8) Construction method: Using Corynebacterium glutamicum ATCC 13869 as a template, PCR amplification was performed with primers P1 and P2, and P3 and P4, respectively, to obtain two DNA fragments (BBD29_09525 Up and BBD29_09525 Down) of the BBD29_09525 gene coding region containing the mutated bases, each measuring 766 bp and 768 bp, respectively.

[0142] The PCR system consisted of 5 μL of 10 × Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U / μL) 0.25 μL, total volume 50 μL.

[0143] The PCR amplification was performed using a 30-cycle strategy consisting of pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 45 seconds, followed by over-extension at 72°C for 10 minutes. Two DNA fragments (BBD29_09525 Up and BBD29_09525 Down), each measuring 766 bp and 768 bp, containing the BBD29_09525 gene coding region, were obtained.

[0144] The two DNA fragments (BBD29_09525 Up and BBD29_09525 Down) were separated and purified by agarose gel electrophoresis, and the target band was recovered. Using these two DNA fragments as templates and P1 and P4 as primers, overlap PCR was performed to obtain a 1504 bp fragment named BBD29_09525 Up-Down (the sequence is shown in SEQ ID No. 29). In the DNA fragment shown in SEQ ID No. 29, positions 37 to 1087 are the same as BBD29_09525 Up-Down, including the mutation site. C337T It is a gene fragment (i.e., positions 1 to 1051 of SEQ ID No. 2).

[0145] The overlap PCR system consisted of 5 μL of 10 × Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U / μL) 0.25 μL, total volume 50 μL.

[0146] The overlap PCR amplification was performed in the following format: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 90 seconds, 30 cycles, and over-extension at 72°C for 10 minutes.

[0147] This DNA fragment, BBD29_09525 Up-Down (SEQ ID No. 29), contains a mutation and was used to modify Corynebacterium glutamicum CGMCC No. 21220 by introducing the 337th nucleic acid of the BBD29_09525 gene coding region. Specifically, the 337th cytosine (C) in the BBD29_09525 gene coding region in Corynebacterium glutamicum CGMCC No. 21220 was changed to thymine (T), and the 113th amino acid of the final encoded protein was changed from proline (P) to serine (S).

[0148] The pK18mobsacB plasmid (purchased from Addgene) was digested with Xba I / BamH I enzymes and then subjected to agarose gel electrophoresis to identify BBD29_09525. C337T The linearized pK18mobsacB plasmid was isolated and purified, and further assembled using the NEBuider recombination system to produce the vector pK18-BBD29_09525. C337T The plasmid contains a kanamycin resistance marker. C337T The vector pK18-BBD29_09525 containing the correct point mutation (CT) was identified by sequencing. C337T was saved and prepared.

[0149] Specifically, the DNA fragment (BBD29_09525 Up-Down) was separated by agarose gel electrophoresis, purified, and then enzymatically digested (Xba I / BamH I). The purified pK18mobsacB plasmid (purchased from Addgene, enzymatically digested with Xba I / BamH I) was ligated with NEBuilder enzyme (purchased from NEB) at 50°C for 30 minutes. The ligated product was transformed into DH5α (purchased from TAKARA), and the grown monoclonal clones were identified by PCR to be the positive recombinant vector pK18-BBD29_09525. C337T The recombinant vector contained kanamycin resistance (Kan r ) marker is included. Correct recombinant vector pK18-BBD29_09525 for enzyme cleavageC337T The resulting vector was sent to a sequencing company for sequencing verification, and the recombinant vector pK18-BBD29_09525 containing the correct point mutation (CT) was identified. C337T was saved and prepared.

[0150] The recombinant vector pK18-BBD29_09525 C337T is a recombinant vector obtained by replacing the fragment (small fragment) between the XbaI and BamHI recognition sites of the pK18mobsacB vector with the DNA fragment shown at positions 37 to 1466 of SEQ ID No. 29 in the Sequence Listing, while maintaining the other sequences of the pK18mobsacB vector.

[0151] The recombinant vector pK18-BBD29_09525 C337T The mutation in the gene BBD29_09525 is shown in SEQ ID No. C337T It comprises a DNA molecule shown at positions 1 to 1051 of the

[0152] Example 2 Point mutation BBD29_09525 C337T Construction of engineered strains containing Construction method: isosite replacement plasmid pK18-BBD29_09525 in Example 1 C337T The gene was electrotransformed into Corynebacterium glutamicum CGMCC No. 21220 and cultured in a medium whose composition and culture conditions are shown in Table 1. Single colonies were identified using primer P1 and universal primer M13R. Strains that amplified a band of approximately 1511 bp were identified as positive strains. The positive strains were then cultured on a medium containing 15% sucrose. The resulting single colonies were then cultured on a medium containing kanamycin and a medium lacking kanamycin. Strains that grew on the selective kanamycin-free medium but not on the kanamycin-containing medium were further identified by PCR using the following primers (synthesized by Shanghai Invitrogen Co., Ltd.): P5:5' CATCAAAGGC AGCTTCTCGG 3'(SEQ ID NO:9) P6:5' ACTACACCCC AGAGGTTAAG 3'(SEQ ID NO:10) The PCR amplification product was subjected to high-temperature denaturation, ice bath, and SSCP electrophoresis (plasmid pK18-BBD29_09525 C337T The amplified fragment of ATCC 13869 was used as the positive control, the amplified fragment of ATCC 13869 was used as the negative control, and water was used as the blank control. SSCP electrophoresis was performed using PAGE preparation and electrophoresis conditions as shown in Table 2. Because the fragment structures differed and the electrophoretic positions differed, strains whose electrophoretic positions did not match those of the negative control fragments but matched those of the positive control fragments were considered to have successfully undergone isosite substitution. The first fragment from the strain with successful isosite substitution was further amplified by PCR using primers P5 and P6, ligated into the PMD19-T vector, and sequenced. Sequence comparison revealed that the isosite substitution of the sequence-verified strain with a mutation in the base sequence was successful, and the strain was designated YPG-007.

[0153] The recombinant strain YPG-007 contains the mutant gene BBD29_09525 shown in SEQ ID No. 2. C337T Includes. [Table 2]

[0154] Example 3 BBD29_09525 or BBD29_09525 in the genome C337T Construction of engineered strains for gene overexpression During bacterial production, the wild-type BBD29_09525 gene or its mutant gene BBD29_09525 C337T To further verify that overexpression of BBD29_09525 can improve L-glutamic acid production, the foreign gene was integrated into the host chromosome and the BBD29_09525 gene or BBD29_09525 C337T An engineered strain was constructed to overexpress the gene.

[0155] Based on the genome sequence of Corynebacterium glutamicum ATCC 13869 published by NCBI, three pairs of primers were designed and synthesized to amplify the upstream and downstream homologous arm fragments and the coding and promoter sequences of the BBD29_09525 gene. These primers were then inserted into the strain Corynebacterium glutamicum CGMCC No. 21220 via homologous recombination. C337T gene was introduced.

[0156] The primers are designed as follows (synthesized by Shanghai Invitrogen Company): P7:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GACCCGCTTG CCATACGAAG 3'(SEQ ID NO:11) P8:5' CTGAAGCTTG AGGAAGCCTA A ATCTACTCAT CTGAAGAATC 3'(SEQ ID NO:12) P9:5' GATTCTTCAG ATGAGTAGAT TTAGGCTTCC TCAAGCTTCAG 3'(SEQ ID NO:13) P10:5' CAAACCAGAG TGCCCACGAA ATGTATAACG ATAGGTCGA 3'(SEQ ID NO:14) P11:5' TCGACCTATC GTTATACAT TTCGTGGGCA CTCTGGTTTG 3'(SEQ ID NO:15) P12:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCATAAGAAAC AACCACTTCC 3'(SEQ ID NO:16) Construction method: Using Corynebacterium glutamicum ATCC 13869 or YPG-007 as a template, PCR amplification was performed with primers P7 / P8, P9 / P10, and P11 / P12, respectively, to obtain an upstream homology arm fragment of approximately 807 bp, a BBD29_09525 gene coding region and promoter fragment of approximately 1931 bp, or BBD29_09525 C337TA gene coding region and promoter region fragment of approximately 1931 bp and a downstream homologous arm fragment of approximately 787 bp were obtained. Further amplification was performed using the mixture of the three amplified fragments as a template with primers P7 / P12 to obtain integrated homologous arm fragments 1 and 2 (integrated homologous arm fragment 1, 3445 bp in size, sequence shown in SEQ ID No. 30; integrated homologous arm fragment 2, 3445 bp in size, sequence shown in SEQ ID No. 31). After PCR, the amplified product was recovered by electrophoresis, and the required DNA fragment of approximately 3445 bp was recovered using a column-type DNA gel recovery kit (TIANGEN). This was ligated to the shuttle plasmid PK18mobsacB recovered by XbaI enzyme digestion using the NEBuider recombination system to generate the integrated plasmid (i.e., recombinant vector) PK18mobsacB-BBD29_09525 or PK18mobsacB-BBD29_09525. C337T The plasmid contains a kanamycin resistance marker, and recombinants in which the plasmid has been integrated into the genome can be obtained by kanamycin screening.

[0157] The recombinant vector PK18mobsacB-BBD29_09525 is a recombinant vector obtained by replacing the fragment (small fragment) between the XbaI and / BamHI recognition sites of the pK18mobsacB vector with the DNA fragment represented by positions 37 to 3407 of SEQ ID No. 30 in the Sequence Listing, while maintaining the other sequences of the pK18mobsacB vector intact.

[0158] The recombinant vector PK18mobsacB-BBD29_09525 C337T is a recombinant vector obtained by replacing the fragment (small fragment) between the XbaI and BamHI recognition sites of the pK18mobsacB vector with the DNA fragment shown at positions 37 to 3407 of SEQ ID No. 31 in the Sequence Listing, while maintaining the other sequences of the pK18mobsacB vector.

[0159] The PCR system consisted of 5 μL of 10× Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U / μL) 0.25 μL, total volume 50 μL.

[0160] The PCR amplification was carried out in the following format: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 120 seconds (30 cycles), and over-extension at 72°C for 10 minutes.

[0161] Two integrative plasmids (PK18mobsacB-BBD29_09525 and PK18mobsacB-BBD29_09525 C337T ) were electrotransformed into the Corynebacterium glutamicum strain CGMCC No. 21220, and the resulting single colonies were PCR-identified using P13 / P14 primers. Those containing a PCR-amplified fragment of approximately 1821 bp were positive strains, while those that failed to amplify the fragment were virulent strains. After 15% sucrose screening, the positive strains were cultured on media containing and without kanamycin, respectively. Strains that grew on the media without kanamycin but did not grow on the media containing kanamycin were further PCR-identified using P15 / P16 primers. Those that amplified a fragment of approximately 1769 bp were identified as BBD29_09525 or BBD29_09525. C337T The strains were designed by integrating the gene into the Corynebacterium glutamicum CGMCC No. 21220 genome and named YPG-008 (without mutation point) and YPG-009 (with mutation point).

[0162] The recombinant strain YPG-008 contains two copies of the BBD29_09525 gene shown in SEQ ID No. 1, which can significantly and stably increase the amount of the BBD29_09525 gene. The recombinant strain YPG-008 is an engineered strain that overexpresses the wild-type BBD29_09525 gene in its genome.

[0163] The recombinant strain YPG-009 contains the mutation BBD29_09525 shown in SEQ ID No. 2. C337T The recombinant strain YPG-009 contains the mutant BBD29_09525 gene. C337T It is an engineered fungus that overexpresses genes.

[0164] The PCR primers are as follows: P13:5' GTCCAAGGTG ACGGCCGCAC 3'(SEQ ID NO:17) P14:5' TGACTTCTCT GATCCAGTAG 3' (SEQ ID NO:18) P15:5' GTACTGCTTG GTCTGAGCAC 3' (SEQ ID NO:19) P16:5' ATATTCGGCC CAGCAGCAGC 3' (SEQ ID NO:20)

[0165] Example 4 Plasmid BBD29_09525 or BBD29_09525 C337T Construction of engineered strains for gene overexpression Based on the genome sequence of Corynebacterium glutamicum ATCC 13869 published by NCBI, a pair of primers was designed and synthesized to amplify the coding region and promoter region sequence of the BBD29_09525 gene. The primers were designed as follows (synthesized by Shanghai Invitrogen): P17:5' GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCTTAGGCTTCC TCAAGCTTCAG 3'(SEQ ID NO:21) P18:5' ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACATGTATAACGATAGGTCGA 3'(SEQ ID NO:22) Construction method: Using YPG-008 or YPG-007 as a template, PCR amplification was performed with primers P17 / P18 to obtain the BBD29_09525 gene and its promoter fragment (1961 bp) (SEQ ID No. 32) or BBD29_09525C337T The gene and its promoter fragment (1961 bp, SEQ ID No. 33) were obtained. The amplified product was then electrophoresed and the required 1961 bp DNA fragment was isolated using a column-type DNA gel collection kit. The fragment was then ligated with the shuttle plasmid pXMJ19, which had been isolated by EcoR I / Kpn I enzyme digestion, using the NEBuider recombination system to generate the overexpression plasmid (i.e., recombinant vector) pXMJ19-BBD29_09525 or pXMJ19-BBD29_09525. C337T The plasmid contains a chloramphenicol resistance marker, and the resulting plasmid can be transformed into the strain after chloramphenicol screening.

[0166] The recombinant vector pXMJ19-BBD29_09525 is a recombinant vector obtained by replacing the fragment (small fragment) between the EcoR I and Kpn I recognition sites of the pXMJ19 vector with the DNA fragment shown at positions 37 to 1927 of SEQ ID No. 32 in the sequence listing, while maintaining the other sequences of the pXMJ19 vector intact.

[0167] The recombinant vector pXMJ19-BBD29_09525 C337T is a recombinant vector obtained by replacing the fragment (small fragment) between the EcoR I and Kpn I recognition sites of the pXMJ19 vector with the DNA fragment shown at positions 37 to 1927 of SEQ ID No. 33 in the sequence listing, while maintaining the other sequences of the pXMJ19 vector intact.

[0168] The PCR system consisted of 5 μL of 10× Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U / μL) 0.25 μL, total volume 50 μL.

[0169] The PCR amplification was carried out in the following format: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 120 seconds (30 cycles), and over-extension at 72°C for 10 minutes.

[0170] Two plasmids (pXMJ19-BBD29_09525 and pXMJ19-BBD29_09525 C337T ) were introduced into the Corynebacterium glutamicum strain CGMCC No. 21220 by electrotransformation, and the resulting single colonies were analyzed by PCR using the M13R(-48) and P18 primers. The transferred strains contained a PCR-amplified fragment of approximately 2000 bp in size and were named YPG-010 (without the point mutation) and YPG-011 (with the point mutation).

[0171] The recombinant strain YPG-010 contains two copies of the BBD29_09525 gene shown in SEQ ID No. 1. The recombinant strain YPG-010 is an engineered strain that overexpresses the wild-type BBD29_09525 gene on a plasmid, i.e., the plasmid pXMJ19-BBD29_09525 overexpresses it extrachromosomally.

[0172] The recombinant strain YPG-011 contains the mutation BBD29_09525 shown in SEQ ID No. 2. C337T The recombinant strain YPG-011 contains the mutant BBD29_09525 gene on the plasmid. C337T The engineered strain overexpressing the gene, i.e., the plasmid pXMJ19-BBD29_09525 C337T is overexpressed extrachromosomally.

[0173] Example 5 Construction of an engineered strain with the BBD29_09525 gene deleted in the genome Based on the genome sequence of Corynebacterium glutamicum ATCC 13869 published by NCBI, two pairs of primers were synthesized to amplify fragments at both ends of the BBD29_09525 gene coding region, forming the upstream and downstream homologous arm fragments. The primers were designed as follows (synthesized by Shanghai Yingjun Co., Ltd.): P19:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGGCCTGACTGA TTTTGGGCTG 3'(SEQ ID NO:23) P20:5' GAGATAAAAGGAAGTTGAACATCTTCTAACTGCTTTCTTT 3'(SEQ ID NO:24) P21:5' AAAGAAAGCAGTTAGAAGATGTTCAACTTCCTTTTATCTC 3'(SEQ ID NO:25) P22:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCAGATGACCTC GGCAGCAGCT 3'(SEQ ID NO:26) Construction method: Using Corynebacterium glutamicum ATCC 13869 as the template, PCR amplification was performed with primers P19 / P20 and P21 / P22, respectively, to obtain an 804 bp upstream homologous arm fragment and an 807 bp downstream homologous arm fragment. Further overlap PCR with primers P19 / P22 yielded the entire 1571 bp homologous arm fragment. After PCR, the amplified product was recovered by electrophoresis, and the required 1571 bp DNA fragment was isolated using a column-type DNA gel recovery kit. This was then ligated with the shuttle plasmid pk18mobsacB, recovered by XbaI digestion, using the NEBuider recombination system to obtain the knockout plasmid. This plasmid contains a kanamycin resistance marker.

[0174] The knockout plasmid was introduced into the strain Corynebacterium glutamicum CGMCC No. 21220 by electrotransformation, and the resulting single colonies were analyzed by PCR using the following primers (synthesized by Shanghai Yingjun Co., Ltd.): P23:5' GCCTGACTGA TTTTGGGCTG 3'(SEQ ID NO:27) P24:5' AGATGACCTC GGCAGCAGCT 3'(SEQ ID NO:28) Strains that amplified the 1497 bp and 3000 bp bands were identified as positive strains, while strains that amplified only the 3000 bp band were identified as original strains. Positive strains were screened on 15% sucrose medium and then cultured on medium with and without kanamycin. Strains that grew on the selective kanamycin-free medium but not on the kanamycin-containing medium were further identified by PCR using P23 / P24 primers. The strain that amplified the 1497 bp band was identified as a genetically engineered strain with the BBD29_09525 gene knockout, designated YPG-012 (the BBD29_09525 gene in the genome of Corynebacterium glutamicum CGMCC No. 21220 was knocked out).

[0175] Example 6 L-glutamic acid fermentation experiment Fermentation experiments were performed using the strains constructed in Examples 2-5 (YPG-007, YPG-008, YPG-009, YPG-010, YPG-011, and YPG-012) and the original strain Corynebacterium glutamicum CGMCC No. 21220 in a BLBIO-5GC-4-H fermentor (purchased from Shanghai Bailun Biotechnology Co., Ltd.) using the media listed in Table 3 and the control process listed in Table 4. Each strain was repeated three times, and the results are shown in Table 5. [Table 3] [Table 4] [Table 5] As shown in Table 5, the results were obtained by overexpressing the BBD29_09525 gene in Corynebacterium glutamicum or by introducing a point mutation BBD29_09525 in the coding region of the BBD29_09525 gene. C337T and / or the BBD29_09525 gene or its mutant gene BBD29_09525 C337TOverexpression of the BBD29_09525 gene is advantageous for improving L-glutamic acid production, while weakening or knocking out the BBD29_09525 gene is disadvantageous for L-glutamic acid accumulation.

[0176] The present invention has been described in detail above. Those skilled in the art can practice the present invention more broadly with equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without undue experimentation. While the present invention provides specific examples, it should be understood that the present invention can be further improved. In summary, in accordance with the principles of the present invention, this application is intended to cover any modifications, uses, or improvements of the present invention, including modifications using conventional techniques known in the art that deviate from the scope disclosed in this application. Applications of some basic features may be made within the scope of the following appended claims. [Industrial Applicability]

[0177] The present inventors have discovered that weakening or knocking out the BBD29_09525 gene, so that the product encoded by the gene affects the ability to produce L-glutamic acid, and by introducing point mutations into the coding sequence or increasing the copy number or overexpressing the gene to obtain a recombinant strain, the resulting strain is advantageous in producing higher concentrations of glutamic acid than the unmodified strain.

[0178] Specifically, the present invention first introduced a point mutation into the BBD29_09525 gene coding region (SEQ ID No. 1) of Corynebacterium glutamicum CGMCC No. 21220 by allele substitution to construct a genetically engineered strain YPG-007 containing a point mutation (CT). During bacterial production, the wild-type BBD29_09525 gene or its mutant BBD29_09525 gene was introduced. C337TTo further verify that overexpression of BBD29_09525 can improve L-glutamic acid production, the foreign gene was integrated into the host chromosome or plasmid was detected in vitro, and the BBD29_09525 gene or BBD29_09525 gene was detected on the genome and on the plasmid, respectively. C337T We constructed engineered strains YPG-008, YPG-009, YPG-010, and YPG-011 that overexpress the gene. Experiments have shown that the BBD29_09525 gene and its mutants are involved in the biosynthesis of L-glutamic acid. By overexpressing or knocking out the BBD29_09525 gene or by introducing fixed point mutations (e.g., point mutations) into the BBD29_09525 gene coding region, we can control the amount of L-glutamic acid accumulated in microorganisms. Point mutations in the BBD29_09525 gene coding region or the BBD29_09525 mutant gene during bacterial production can be used to control the amount of L-glutamic acid accumulated in microorganisms. C337T Overexpression of the BBD29_09525 gene is advantageous in improving L-glutamic acid production and transformation efficiency, whereas knocking out or weakening the BBD29_09525 gene is disadvantageous in terms of L-glutamic acid accumulation. C337T Gene) to construct a genetically engineered strain for producing L-glutamic acid, which can promote the improvement of L-glutamic acid production, and cultivate a high-yield, high-quality strain suitable for industrial production, which has wide application value and important economic significance for the industrial production of L-glutamic acid. [Accession number]

[0179] Species name: Corynebacterium glutamicum, Strain number: YPGLU001, Accession number: CGMCC 21220

Claims

1. An L-glutamic acid-producing bacterium having an improved ability to produce L-glutamic acid, The bacterium is an L-glutamic acid-producing bacterium, characterized in that it contains a modified protein comprising the amino acid sequence of SEQ ID NO: 4, and the expression of the modified protein is enhanced.

2. The bacterium described in claim 1, characterized in that the gene encoding the modified protein comprises the nucleotide sequence shown in SEQ ID NO:

2.

3. The bacterium is selected from the group consisting of Corynebacterium acetacidophilum, Corynebacterium acetoglutamicum, Corynebacterium callunae, Corynebacterium glutamicum, Brevibacterium flavum, and Brevibacterium lactofermentum. The bacterium according to any one of claims 1 to 2, characterized in that the bacterium is any one of Brevibacterium lactofermentum, Corynebacterium ammoniagenes, Corynebacterium pekinense, Brevibacterium saccharolyticum, Brevibacterium roseum, and Brevibacterium thiogenitalis.

4. A bacterium described in any one of claims 1 to 2, characterized in that the bacterium is Corynebacterium glutamicum.

5. A nucleic acid characterized by encoding a protein comprising the amino acid sequence shown in SEQ ID NO:

4.

6. A protein characterized by comprising the amino acid sequence shown in SEQ ID NO:

4.

7. A recombinant vector characterized by comprising the nucleic acid described in claim 5.

8. A recombinant microorganism characterized by containing the nucleic acid described in claim 5.

9. A method for producing L-glutamic acid, comprising culturing the bacterium according to any one of claims 1 to 2 and recovering L-glutamic acid from the culture.

10. A1) a protein having an amino acid sequence of SEQ ID No. 4; A2) a fusion protein having the same function as A1), obtained by linking a tag to the N-terminus and / or C-terminus of A1); A protein characterized by being any one of the following:

11. B1) A nucleic acid encoding the protein according to claim 10; B2) a DNA molecule having the coding sequence shown in SEQ ID No. 2; B3) a DNA molecule containing a gene having the nucleotide sequence shown in SEQ ID No.

2.

12. C1) An expression cassette comprising the nucleic acid according to claim 11; C2) A recombinant vector comprising the nucleic acid of claim 11 or the expression cassette of C1); C3) A biological material characterized by being any one of a recombinant microorganism comprising the nucleic acid described in claim 11, a recombinant microorganism comprising the expression cassette described in C1), or a recombinant microorganism comprising the recombinant vector described in C2).

13. A method for improving L-glutamic acid production in a microorganism, comprising: E1) introducing into a microorganism a gene encoding a modified protein comprising an amino acid sequence of SEQ ID NO: 3 in which proline at position 113 of SEQ ID NO: 3 is substituted with serine; and E2) increasing the copy number of a gene encoding the modified protein in the microorganism, thereby enhancing expression of the modified protein in the microorganism.

14. The method of claim 13, wherein the modified protein has the amino acid sequence of SEQ ID No. 4.

Citation Information

Patent Citations

  • Alleles of the mqo gene from coryneform bacteria

    US20060166338A1