Compositions and methods for TCR reprogramming using CD70-specific fusion proteins

Abstract

Provided herein are T cell receptor (TCR) fusion proteins (TFPs) that contain a CD70-binding domain, T cells engineered to express one or more TFPs, antibodies that specifically bind to CD70, and methods of their use for the treatment of diseases, including cancer.

Description

[Technical Field]

[0001] cross reference This application claims the benefit of U.S. Provisional Application No. 63 / 020,196, filed May 5, 2020, U.S. Provisional Application No. 63 / 129,718, filed December 23, 2020, U.S. Provisional Application No. 63 / 147,618, filed February 9, 2021, and U.S. Provisional Application No. 63 / 171,751, filed April 7, 2021, each of which is incorporated herein by reference in its entirety.

[0002] The present invention relates to novel therapeutic methods and methods for treating CD70-associated diseases and disorders. [Background technology]

[0003] Human cancers are originally composed of normal cells that undergo genetic or epigenetic transformation to become abnormal cancer cells. During this process, cancer cells begin to express proteins and other antigens that differ from those expressed by normal cells. These abnormal tumor antigens can be used by the body's innate immune system to specifically target and kill cancer cells. However, cancer cells employ various mechanisms to prevent immune cells, such as T and B lymphocytes, from successfully targeting them.

[0004] Most patients with advanced solid tumors are untreatable with standard treatments. Furthermore, conventional treatment options often have severe side effects. Numerous attempts have been made to engage a patient's immune system in rejecting cancer cells, an approach collectively known as cancer immunotherapy. However, several obstacles have made it extremely difficult to achieve clinical efficacy. Hundreds of so-called tumor antigens have been identified, but these are often autologous, potentially directing cancer immunotherapy toward healthy tissues, or are poorly immunogenic. Furthermore, cancer cells use multiple mechanisms to mask themselves or to resist the initiation and propagation of immune attack by cancer immunotherapy.

[0005] Human T cell therapy relies on enriched or engineered human T cells to target and kill cancer cells in patients. To enhance the ability of T cells to target and kill specific cancer cells, methods have been developed to engineer T cells to express constructs that direct T cells to specific target cancer cells. Chimeric antigen receptors (CARs) and engineered T cell receptors (TCRs) that contain binding domains that can interact with specific tumor antigens enable T cells to target and kill cancer cells that express specific tumor antigens.

[0006] In addition to the ability of CAR-expressing genetically modified T cells or engineered TCRs to recognize and destroy their respective target cells in vitro / ex vivo, successful treatment of patients with engineered T cells requires that the T cells be capable of potent activation, proliferation, persistence over time, effective tumor targeting, reduction, and, in the case of recurrent disease, an effective "memory" response. Furthermore, CAR therapies currently in development are associated with the release of high levels of pro-inflammatory cytokines, which are associated with dose-limiting toxicities. Summary of the Invention

[0007] There is a clear need to develop improved engineered T cells to act against a variety of human malignancies, including those that express CD70. Described herein are novel fusion proteins of TCR subunits, including CD3ε, CD3γ, and CD3δ, as well as novel fusion proteins of the TCR α and TCR β chains with binding domains specific for CD70, which have the potential to overcome the limitations of existing approaches.

[0008] Provided herein is a recombinant nucleic acid molecule comprising a sequence encoding a T cell receptor (TCR) fusion protein (TFP), the TFP comprising: (a) a TCR subunit comprising (i) at least a portion of the extracellular domain of the TCR, and (ii) the transmembrane domain of the TCR, (iii) the intracellular domain of the TCR, and (b) an antigen-binding domain that specifically binds to CD70, wherein the TCR subunit and the antigen-binding domain are operably linked.

[0009] In some embodiments, the TFP functionally interacts with the endogenous TCR complex when expressed in a T cell. In some embodiments, the intracellular domain of the TCR comprises a stimulatory domain derived from the intracellular signaling domain of CD3γ, CD3δ, or CD3ε.

[0010] In some embodiments, T cells expressing the TFP exhibit increased cytotoxicity against human cells expressing CD70 compared to T cells that do not contain the TFP. In some embodiments, the antigen binding domain is connected to the extracellular domain of the TCR by a linker sequence.

[0011] In some embodiments, the linker is 120 amino acids or less in length. In some embodiments, the linker sequence is (G4S) n wherein G is glycine, S is serine, and n is an integer from 1 to 10.

[0012] In some embodiments, n is an integer from 1 to 4. In some embodiments, at least two of the extracellular domain of the TCR, the transmembrane domain of the TCR, and the intracellular domain of the TCR are derived from the same TCR subunit.

[0013] In some embodiments, at least two of the extracellular domain of the TCR, the transmembrane domain of the TCR, and the intracellular domain of the TCR are derived from TCRα. In some embodiments, at least two of the extracellular domain of the TCR, the transmembrane domain of the TCR, and the intracellular domain of the TCR are derived from TCRβ.

[0014] In some embodiments, at least two of the extracellular domain of the TCR, the transmembrane domain of the TCR, and the intracellular domain of the TCR are derived from TCRγ. In some embodiments, at least two of the extracellular domain of the TCR, the transmembrane domain of the TCR, and the intracellular domain of the TCR are derived from TCR delta.

[0015] In some embodiments, at least two of the extracellular domain of the TCR, the transmembrane domain of the TCR, and the intracellular domain of the TCR are derived from CD3ε. In some embodiments, at least two of the extracellular domain of the TCR, the transmembrane domain of the TCR, and the intracellular domain of the TCR are derived from CD3δ.

[0016] In some embodiments, at least two of the extracellular domain of the TCR, the transmembrane domain of the TCR, and the intracellular domain of the TCR are derived from CD3γ. In some embodiments, all three of the extracellular domain of the TCR, the transmembrane domain of the TCR, and the intracellular domain of the TCR are derived from the same TCR subunit.

[0017] In some embodiments, the extracellular domain of the TCR, the transmembrane domain of the TCR, and the intracellular domain of the TCR are derived from CD3ε. In some embodiments, the extracellular domain of the TCR, the transmembrane domain of the TCR, and the intracellular domain of the TCR are derived from CD3δ.

[0018] In some embodiments, the extracellular domain of the TCR, the transmembrane domain of the TCR, and the intracellular domain of the TCR are derived from CD3γ. In some embodiments, the extracellular domain of the TCR, the transmembrane domain of the TCR, and the intracellular domain of the TCR comprise the constant domain of TCR alpha.

[0019] In some embodiments, the constant domain of the TCR alpha is murine. In some embodiments, the extracellular domain of the TCR, the transmembrane domain of the TCR, and the intracellular domain of the TCR comprise a constant domain of TCR β.

[0020] In some embodiments, the constant domain of the TCR β is murine. In some embodiments, the extracellular domain of the TCR, the transmembrane domain of the TCR, and the intracellular domain of the TCR comprise a constant domain of TCRγ.

[0021] In some embodiments, the extracellular domain of the TCR, the transmembrane domain of the TCR, and the intracellular domain of the TCR comprise a constant domain of TCR delta. In some embodiments, the antigen-binding domain is a Camelidae antibody or binding fragment thereof.

[0022] In some embodiments, the antigen-binding domain is a murine antibody or binding fragment thereof. In some embodiments, the antigen-binding domain is a human or humanized antibody or binding fragment thereof.

[0023] In some embodiments, the antigen binding domain is a single chain variable fragment (scFv) or a single domain antibody (sdAb) domain. In some embodiments, the antigen binding domain is a single domain antibody (sdAb).

[0024] In some embodiments, the sdAb is V HH is. In some embodiments, the antigen-binding domain binds to human CD70. D The binding occurs at a value of 100 nM or less or from about 0.001 nM to about 100 nM.

[0025] In some embodiments, the antigen binding domain does not compete with CD27 for binding to CD70, does not inhibit the interaction of CD70 with CD27, and / or does not bind to the same epitope on CD70 that CD27 binds.

[0026] In some embodiments, the antigen binding domain competes with CD27 for binding to CD70, inhibits the interaction of CD70 with CD27, and / or binds to the same epitope on CD70 that CD27 binds.

[0027] In some embodiments, the antigen-binding domain specifically binds to an epitope within the amino acid sequence HRDGIYMVHIQVTLAICSSTTAS (SEQ ID NO: 1230).

[0028] In some embodiments, the antigen-binding domain comprises an scFv having at least about 90% sequence identity to any one of SEQ ID NOs: 1207-1222, 1246, and 1247.

[0029] In some embodiments, the antigen binding domain comprises an sdAb domain having at least about 90% sequence identity to any one of the sequences in SEQ ID NOs: 1223-1227.

[0030] In some embodiments, the antigen binding domain comprises a variable domain comprising complementarity determining region 1 (CDR1), CDR2, and CDR3. In some embodiments, the antigen-binding domain comprises a variable domain having at least 90% sequence identity to any one of SEQ ID NOs: 603-620 and 622-688.

[0031] In some embodiments, (i) CDR1 comprises any one of the sequences set forth in SEQ ID NOs: 87 to 104 and 107 to 172, (ii) CDR2 comprises any one of the sequences set forth in SEQ ID NOs: 259 to 276 and 279 to 344, and (iii) CDR3 comprises any one of the sequences set forth in SEQ ID NOs: 431 to 448 and 451 to 516.

[0032] In some embodiments, the antigen binding domain comprises a variable domain having at least about 90% sequence identity to SEQ ID NO:618. In some embodiments, the variable domain has at least 95% sequence identity to SEQ ID NO:618.

[0033] In some embodiments, the variable domain comprises the sequence of SEQ ID NO:618. In some embodiments, CDR1 is SEQ ID NO: 102, CDR2 is SEQ ID NO: 274, and CDR3 is SEQ ID NO: 446.

[0034] In some embodiments, the antigen binding domain comprises an sdAb domain having at least about 90% sequence identity to any one of SEQ ID NOs: 1224-1227.

[0035] In some embodiments, the antigen-binding domain is a single-chain variable fragment (scFv). In some embodiments, the scFv comprises a heavy chain variable (V) having at least 90% sequence identity to any one of SEQ ID NOs: 783-835. H ) domain.

[0036] In some embodiments, the scFv comprises a heavy chain variable (V) having at least 95% sequence identity to any one of SEQ ID NOs: 783-835. H ) domain. In some embodiments, the scFv comprises a heavy chain variable (V) having the sequence of any one of SEQ ID NOs: 783-835. H ) domain.

[0037] In some embodiments, the scFv comprises a light chain variable (V) having at least 90% sequence identity to any one of SEQ ID NOs: 995-1047. L ) domain. In some embodiments, the scFv comprises a light chain variable (V) having at least 95% sequence identity to any one of SEQ ID NOs: 995-1047. L ) domain.

[0038] In some embodiments, the scFv comprises a light chain variable (V) having the sequence of any one of SEQ ID NOs: 995-1047. L ) domain. In some embodiments, the V H The domain comprises a heavy chain complementarity determining region 1 (CDRH1) having any one of the sequences set forth in SEQ ID NOs: 836 to 888, a CDRH2 having any one of the sequences set forth in SEQ ID NOs: 889 to 941, and a CDRH3 having any one of the sequences set forth in SEQ ID NOs: 942 to 994.

[0039] In some embodiments, the V L The domain comprises a light chain complementarity determining region 1 (CDRL1) having any one of the sequences set forth in SEQ ID NOs: 1048 to 1100, a CDRL2 having any one of the sequences set forth in SEQ ID NOs: 1101 to 1153, and a CDRL3 having any one of the sequences set forth in SEQ ID NOs: 1154 to 1206.

[0040] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1248. H Includes the domain. In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1248. H Includes the domain.

[0041] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1249. L Includes the domain. In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1249. L Includes the domain.

[0042] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1248. H Domain and V having at least 90% sequence identity to SEQ ID NO: 1249 L Includes the domain.

[0043] In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1248. H Domain and V of sequence SEQ ID NO: 1249 L Includes the domain. In some embodiments, the V of the sequence of SEQ ID NO: 1248 H The domain is connected via its C-terminus to the V L is operably linked to the N-terminus of the domain.

[0044] In some embodiments, the V of the sequence of SEQ ID NO: 1249 L The domain is connected via its C-terminus to the V H is operably linked to the N-terminus of the domain. In some embodiments, the scFv comprises the linker sequence of SEQ ID NO:1237.

[0045] In some embodiments, the V of the sequence of SEQ ID NO: 1248 H and V of the sequence of SEQ ID NO: 1249 L The domains are operably linked via a linker sequence of SEQ ID NO:1237.

[0046] In some embodiments, the scFv comprises a sequence having at least 90% sequence identity to SEQ ID NO:1207 or SEQ ID NO:1208. In some embodiments, the scFv comprises the sequence of SEQ ID NO:1207 or SEQ ID NO:1208.

[0047] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1250. H Includes the domain. In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1250. H Includes the domain.

[0048] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1251. L Includes the domain. In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1251. L Includes the domain.

[0049] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1250. H Domain and V having at least 90% sequence identity to SEQ ID NO: 1251 L Includes the domain.

[0050] In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1250. H Domain and V of sequence SEQ ID NO: 1251 L Includes the domain. In some embodiments, V of the sequence of SEQ ID NO: 1250 H The domain is connected via its C-terminus to the V L is operably linked to the N-terminus of the domain.

[0051] In some embodiments, the V of the sequence of SEQ ID NO: 1251 L The domain is connected via its C-terminus to the V His operably linked to the N-terminus of the domain. In some embodiments, the scFv comprises the linker sequence of SEQ ID NO:1237.

[0052] In some embodiments, V of the sequence of SEQ ID NO: 1250 H and V of the sequence of SEQ ID NO: 1251 L The domains are operably linked via a linker sequence of SEQ ID NO:1237.

[0053] In some embodiments, the scFv comprises a sequence having at least 90% sequence identity to SEQ ID NO:1209 or SEQ ID NO:1210. In some embodiments, the scFv comprises the sequence of SEQ ID NO:1209 or SEQ ID NO:1210.

[0054] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1252. H Includes the domain. In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1252. H Includes the domain.

[0055] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1253. L Includes the domain. In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1253. L Includes the domain.

[0056] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1252. H Domain and V having at least 90% sequence identity to SEQ ID NO: 1253 L Includes the domain.

[0057] In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1252. H Domain and V of sequence SEQ ID NO: 1253 LIncludes the domain. In some embodiments, the V of the sequence of SEQ ID NO: 1252 H The domain is connected via its C-terminus to the V L is operably linked to the N-terminus of the domain.

[0058] In some embodiments, V of the sequence of SEQ ID NO: 1253 L The domain is connected via its C-terminus to the V H is operably linked to the N-terminus of the domain. In some embodiments, the scFv comprises the linker sequence of SEQ ID NO:1237.

[0059] In some embodiments, the V of the sequence of SEQ ID NO: 1252 H and V of the sequence of SEQ ID NO: 1253 L The domains are operably linked via a linker sequence of SEQ ID NO:1237.

[0060] In some embodiments, the scFv comprises a sequence having at least 90% sequence identity to SEQ ID NO:1246 or SEQ ID NO:1247. In some embodiments, the scFv comprises the sequence of SEQ ID NO:1246 or SEQ ID NO:1247.

[0061] In some embodiments, the antigen binding domain specifically binds to a second epitope within the amino acid sequence ASRHHPTTLAVGICSPASRSISL (SEQ ID NO: 1231).

[0062] In some embodiments, the scFv comprises a CDRH1 of SEQ ID NO: 853, a CDRH2 of SEQ ID NO: 906, and a CDRH3 of SEQ ID NO: 959. H domain, and a V comprising CDRL1 of SEQ ID NO: 1065, CDRL2 of SEQ ID NO: 1118, and CDRL3 of SEQ ID NO: 1171. L Includes the domain.

[0063] In some embodiments, the scFv has a V sequence having at least 90% sequence identity to SEQ ID NO: 800. H Includes the domain. In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 800. H Includes the domain.

[0064] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1012. L Includes the domain. In some embodiments, the scFv comprises the V L Includes the domain.

[0065] In some embodiments, the scFv has a V sequence having at least 90% sequence identity to SEQ ID NO: 800. H Domain and V having at least 90% sequence identity to SEQ ID NO: 1012 L Includes the domain.

[0066] In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 800. H Domain and V of sequence SEQ ID NO: 1012 L Includes the domain. In some embodiments, the scFv comprises the linker sequence of SEQ ID NO:782.

[0067] In some embodiments, T cells expressing the TFP inhibit tumor growth when expressed in T cells. In some embodiments, T cells expressing the TFP have increased fratricide compared to a TFP with a different antigen-binding domain.

[0068] In some embodiments, T cells expressing the TFP have reduced fratricide compared to a TFP with a different antigen-binding domain. In some embodiments, the recombinant nucleic acid molecule encodes any one of the amino acid sequences selected from SEQ ID NOs: 1233, 1236, 1240, and 1264.

[0069] In one aspect, the present disclosure provides a recombinant nucleic acid molecule comprising a sequence encoding an antibody or fragment thereof that specifically binds to CD70. In some embodiments, the antibody or antibody fragment is a Camelidae antibody or binding fragment thereof.

[0070] In some embodiments, the antibody or antibody fragment is a murine, human, or humanized antibody or binding fragment thereof. In some embodiments, the antibody or antibody fragment is a single chain variable fragment (scFv) or a single domain antibody (sdAb) domain.

[0071] In some embodiments, the antibody or antibody fragment is a single domain antibody (sdAb). In some embodiments, the sdAb is V HH is.

[0072] In some embodiments, the antibody or antibody fragment binds to human CD70. D The binding occurs at a value of 100 nM or less or from about 0.001 nM to about 100 nM. In some embodiments, the antibody or antibody fragment does not compete with CD27 for binding to CD70, does not inhibit the interaction of CD70 with CD27, and / or does not bind to the same epitope on CD70 that CD27 binds.

[0073] In some embodiments, the antibody or antibody fragment competes with CD27 for binding to CD70, inhibits the interaction of CD70 with CD27, and / or binds to the same epitope on CD70 that CD27 binds.

[0074] In some embodiments, the antigen-binding domain specifically binds to an epitope within the amino acid sequence HRDGIYMVHIQVTLAICSSTTAS (SEQ ID NO: 1230).

[0075] In some embodiments, the antibody or antibody fragment comprises an scFv having at least about 90% sequence identity to any one of the sequences of SEQ ID NOs: 1207-1222, 1246, and 1247.

[0076] In some embodiments, the antibody or antibody fragment comprises an sdAb domain having at least about 90% sequence identity to any one of SEQ ID NOs: 1223-1227.

[0077] In some embodiments, the antibody or antibody fragment comprises a variable domain comprising CDR1, CDR2, and CDR3. In some embodiments, the antibody or antibody fragment comprises a variable domain having at least 90% sequence identity to any one of SEQ ID NOs: 603-620 and 622-688.

[0078] In some embodiments, (i) CDR1 comprises any one of the sequences set forth in SEQ ID NOs: 87 to 104 and 107 to 172, (ii) CDR2 comprises any one of the sequences set forth in SEQ ID NOs: 259 to 276 and 279 to 344, and (iii) CDR3 comprises any one of the sequences set forth in SEQ ID NOs: 431 to 448 and 451 to 516.

[0079] In some embodiments, the antibody or antibody fragment comprises a variable domain having at least 90% sequence identity to SEQ ID NO:618. In some embodiments, the variable domain has at least 95% sequence identity to SEQ ID NO:618.

[0080] In some embodiments, the variable domain comprises the sequence of SEQ ID NO:618. In some embodiments, CDR1 is SEQ ID NO: 102, CDR2 is SEQ ID NO: 274, and CDR3 is SEQ ID NO: 446.

[0081] In some embodiments, the antibody or antibody fragment comprises an sdAb domain having at least about 80% sequence identity to any one of SEQ ID NOs: 1224-1227.

[0082] In some embodiments, the antibody or antibody fragment is an scFv. In some embodiments, the scFv comprises a heavy chain variable (V) having at least 90% sequence identity to any one of SEQ ID NOs: 783-835. H ) domain.

[0083] In some embodiments, the scFv comprises a heavy chain variable (V) having at least 95% sequence identity to any one of SEQ ID NOs: 783-835. H ) domain. In some embodiments, the scFv comprises a heavy chain variable (V) having the sequence of any one of SEQ ID NOs: 783-835. H ) domain.

[0084] In some embodiments, the scFv comprises a light chain variable (V) having at least 90% sequence identity to any one of SEQ ID NOs: 995-1047. L ) domain. In some embodiments, the scFv comprises a light chain variable (V) having at least 95% sequence identity to any one of SEQ ID NOs: 995-1047. L ) domain.

[0085] In some embodiments, the scFv comprises a light chain variable (V) having the sequence of any one of SEQ ID NOs: 995-1047. L ) domain. In some embodiments, the V H The domains include CDRH1 having the sequence of any one of SEQ ID NOs: 836 to 888, CDRH2 having the sequence of any one of SEQ ID NOs: 889 to 941, and CDRH3 having the sequence of any one of SEQ ID NOs: 942 to 994.

[0086] In some embodiments, the VL The domains include CDRL1 having the sequence of any one of SEQ ID NOs: 1048 to 1100, CDRL2 having the sequence of any one of SEQ ID NOs: 1101 to 1153, and CDRL3 having the sequence of any one of SEQ ID NOs: 1154 to 1206.

[0087] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1248. H Includes the domain. In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1248. H Includes the domain.

[0088] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1249. L Includes the domain. In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1249. L Includes the domain.

[0089] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1248. H Domain and V having at least 90% sequence identity to SEQ ID NO: 1249 L Includes the domain.

[0090] In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1248. H Domain and V of sequence SEQ ID NO: 1249 L Includes the domain. In some embodiments, the V of the sequence of SEQ ID NO: 1248 H The domain is connected via its C-terminus to the V L is operably linked to the N-terminus of the domain.

[0091] In some embodiments, V of the sequence of SEQ ID NO: 1249 L The domain is connected via its C-terminus to the V His operably linked to the N-terminus of the domain. In some embodiments, the scFv comprises the linker sequence of SEQ ID NO:1237.

[0092] In some embodiments, the V of the sequence of SEQ ID NO: 1248 H and V of the sequence of SEQ ID NO: 1249 L The domains are operably linked via a linker sequence of SEQ ID NO:1237.

[0093] In some embodiments, the scFv comprises a sequence having at least 90% sequence identity to SEQ ID NO:1207 or SEQ ID NO:1208. In some embodiments, the scFv comprises the sequence of SEQ ID NO:1207 or SEQ ID NO:1208.

[0094] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1250. H Includes the domain. In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1250. H Includes the domain.

[0095] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1251. L Includes the domain. In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1251. L Includes the domain.

[0096] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1250. H Domain and V having at least 90% sequence identity to SEQ ID NO: 1251 L Includes the domain.

[0097] In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1250. H Domain and V of sequence SEQ ID NO: 1251 LIncludes the domain. In some embodiments, V of the sequence of SEQ ID NO: 1250 H The domain is connected via its C-terminus to the V L is operably linked to the N-terminus of the domain.

[0098] In some embodiments, the V of the sequence of SEQ ID NO: 1251 L The domain is connected via its C-terminus to the V H is operably linked to the N-terminus of the domain. A recombinant nucleic acid molecule as described herein, wherein the scFv comprises a linker sequence of SEQ ID NO: 1237.

[0099] In some embodiments, V of the sequence of SEQ ID NO: 1250 H and V of the sequence of SEQ ID NO: 1251 L The domains are operably linked via a linker sequence of SEQ ID NO:1237.

[0100] In some embodiments, the scFv comprises a sequence having at least 90% sequence identity to SEQ ID NO:1209 or SEQ ID NO:1210. In some embodiments, the scFv comprises the sequence of SEQ ID NO:1209 or SEQ ID NO:1210.

[0101] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1252. H Includes the domain. In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1252. H Includes the domain.

[0102] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1253. L Includes the domain. In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1253. L Includes the domain.

[0103] In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1252. H Domain and V having at least 90% sequence identity to SEQ ID NO: 1253 L Includes the domain.

[0104] In some embodiments, the scFv comprises the V of the sequence of SEQ ID NO: 1252. H Domain and V of sequence SEQ ID NO: 1253 L Includes the domain. In some embodiments, the V of the sequence of SEQ ID NO: 1252 H The domain is connected via its C-terminus to the V L is operably linked to the N-terminus of the domain.

[0105] In some embodiments, V of the sequence of SEQ ID NO: 1253 L The domain is connected via its C-terminus to the V H is operably linked to the N-terminus of the domain. In some embodiments, the scFv comprises the linker sequence of SEQ ID NO:1237.

[0106] In some embodiments, the V of the sequence of SEQ ID NO: 1252 H and V of the sequence of SEQ ID NO: 1253 L The domains are operably linked via a linker sequence of SEQ ID NO:1237.

[0107] In some embodiments, the scFv comprises a sequence having at least 90% sequence identity to SEQ ID NO:1246 or SEQ ID NO:1247. In some embodiments, the scFv comprises the sequence of SEQ ID NO:1246 or SEQ ID NO:1247.

[0108] In some embodiments, the antibody or antibody fragment specifically binds to a second epitope within the amino acid sequence ASRHHPTTLAVGICSPASRSISL (SEQ ID NO: 1231).

[0109] In some embodiments, the scFv comprises a CDRH1 of SEQ ID NO: 853, a CDRH2 of SEQ ID NO: 906, and a CDRH3 of SEQ ID NO: 959. H domain, and a V comprising CDRL1 of SEQ ID NO: 1065, CDRL2 of SEQ ID NO: 1118, and CDRL3 of SEQ ID NO: 1171. L Includes the domain.

[0110] In some embodiments, the scFv has a V sequence having at least 90% sequence identity to SEQ ID NO: 800. H Includes the domain. In some embodiments, the scFv has a V that has at least 90% sequence identity to SEQ ID NO: 1012. L Includes the domain.

[0111] In some embodiments, the scFv has a V sequence having at least 90% sequence identity to SEQ ID NO: 800. H Domain and V having at least 90% sequence identity to SEQ ID NO: 1012 L Includes the domain.

[0112] In some embodiments, the scFv comprises the linker sequence of SEQ ID NO:782. In some embodiments, the recombinant nucleic acid molecules described herein further comprise a sequence encoding a constant domain of a TCR.

[0113] In some embodiments, the antibody or antibody fragment is operably linked to a sequence encoding the constant domain of a TCR, thereby forming a TFP. In some embodiments, the constant domain of the TCR is a constant domain of TCR alpha or a portion thereof, a constant domain of TCR beta or a portion thereof, a constant domain of TCR alpha or a portion thereof and a constant domain of TCR beta or a portion thereof, a constant domain of TCR gamma or a portion thereof, a constant domain of TCR delta or a portion thereof, or a constant domain of TCR gamma or a portion thereof and a constant domain of TCR delta or a portion thereof.

[0114] In some embodiments, a recombinant nucleic acid molecule described herein further comprises a leader sequence. In some embodiments, the nucleic acid is selected from the group consisting of DNA and RNA.

[0115] In some embodiments, the nucleic acid is mRNA. In some embodiments, the nucleic acid is a circRNA. In some embodiments, the nucleic acid comprises nucleotide analogs.

[0116] In some embodiments, the nucleotide analog is selected from the group consisting of 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T-dimethylaminoethyloxyethyl (2'-O-DMAEOE), 2'-ON-methylacetamide (2'-O-NMA) modifications, locked nucleic acid (LNA), ethylene nucleic acid (ENA), peptide nucleic acid (PNA), 1',5'-anhydrohexitol nucleic acid (HNA), morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, and 2'-fluoro N3-P5'-phosphoramidites.

[0117] In some embodiments, a recombinant nucleic acid molecule described herein further comprises a promoter. In some embodiments, the nucleic acid is an in vitro transcribed nucleic acid.

[0118] In some embodiments, the nucleic acid further comprises a sequence encoding a poly(A) tail. In some embodiments, the nucleic acid further comprises a 3'UTR sequence.

[0119] In certain aspects, the disclosure provides polypeptides encoded by the recombinant nucleic acid molecules described herein. In certain aspects, the present disclosure provides vectors comprising recombinant nucleic acid molecules encoding the TFPs described herein.

[0120] In one aspect, the present disclosure provides a vector comprising a recombinant nucleic acid molecule encoding an antibody or antigen-binding fragment described herein. In some embodiments, the vectors described herein further comprise a sequence encoding an siRNA, shRNA, or miRNA for reducing endogenous CD70 levels.

[0121] In some embodiments, the vectors described herein further comprise a sequence encoding an inhibitory molecule, which comprises a first polypeptide comprising at least a portion of the inhibitory molecule, associated with a second polypeptide comprising a positive signal from an intracellular signaling domain.

[0122] In some embodiments, the vectors described herein further comprise a sequence encoding the constant domain of a TCR. In some embodiments, the constant domain of the TCR is a constant domain of TCR alpha or a portion thereof, a constant domain of TCR beta or a portion thereof, a constant domain of TCR alpha or a portion thereof and a constant domain of TCR beta or a portion thereof, a constant domain of TCR gamma or a portion thereof, a constant domain of TCR delta or a portion thereof, or a constant domain of TCR gamma or a portion thereof and a constant domain of TCR delta or a portion thereof.

[0123] In some embodiments, the vector is selected from the group consisting of DNA, RNA, a plasmid, a lentiviral vector, an adenoviral vector, a Rous Sarcoma Virus (RSV) vector, or a retroviral vector.

[0124] In some embodiments, the vectors described herein further comprise a promoter. In some embodiments, the vector is an in vitro transcription vector.

[0125] In some embodiments, the nucleic acid sequence of the vector further comprises a poly(A) tail. In some embodiments, the nucleic acid sequence of the vector further comprises a 3'UTR.

[0126] In one aspect, the disclosure provides a cell comprising a recombinant nucleic acid molecule described herein, a polypeptide described herein, or a vector described herein. In certain aspects, the present disclosure provides a cell comprising a recombinant nucleic acid molecule comprising a sequence encoding a T cell receptor (TCR) fusion protein (TFP), the TFP comprising (a) a TCR subunit comprising (i) at least a portion of the extracellular domain of the TCR, and (ii) the transmembrane domain of the TCR, (iii) the intracellular domain of the TCR, and (b) an antigen-binding domain that specifically binds to CD70, wherein the TCR subunit and the antigen-binding domain are operably linked.

[0127] In some embodiments, the cell is a T cell. In some embodiments, the T cells are human T cells. In some embodiments, the T cells are CD8 + or CD4 + T cells.

[0128] In some embodiments, the T cells are human αβ T cells. In some embodiments, the T cells are human γδ T cells. In some embodiments, the cells are human NKT cells.

[0129] In one aspect, the present disclosure provides a T cell comprising a recombinant nucleic acid molecule described herein, a polypeptide described herein, or a vector described herein. In certain aspects, the present disclosure provides a T cell comprising a recombinant nucleic acid molecule comprising a sequence encoding a T cell receptor (TCR) fusion protein (TFP), the TFP comprising (a) a TCR subunit comprising (i) at least a portion of the extracellular domain of the TCR, and (ii) the transmembrane domain of the TCR, (iii) the intracellular domain of the TCR, and (b) an antigen-binding domain that specifically binds to CD70, wherein the TCR subunit and the antigen-binding domain are operably linked.

[0130] In some embodiments, the T cells are human T cells. In some embodiments, the T cells are CD8 + or CD4 + T cells. In some embodiments, the T cells are human αβ T cells.

[0131] In some embodiments, the T cells are human γδ T cells. In some embodiments, the cells or T cells described herein further comprise a nucleic acid encoding an inhibitory molecule, which comprises a first polypeptide comprising at least a portion of the inhibitory molecule, in association with a second polypeptide comprising a positive signal from an intracellular signaling domain.

[0132] In some embodiments, the inhibitory molecule comprises a first polypeptide comprising at least a portion of PD-1 and a second polypeptide comprising a costimulatory domain and a primary signaling domain.

[0133] In some embodiments, the inhibitory molecule comprises the sequence of SEQ ID NO:1239 or SEQ ID NO:1244. In some embodiments, the sequence encoding the TFP and the nucleic acid encoding the inhibitory molecule are contained in a single nucleic acid molecule.

[0134] In some embodiments, the sequence encoding the TFP and the nucleic acid encoding the inhibitory molecule are contained in two separate nucleic acid molecules. In some embodiments, the cells or T cells described herein further comprise a second nucleic acid sequence encoding an interleukin-15 (IL-15) polypeptide or fragment thereof.

[0135] In some embodiments, the sequence encoding the TFP and the second nucleic acid sequence are comprised in a single nucleic acid molecule. In some embodiments, the sequence encoding the TFP and the second nucleic acid sequence are contained in two separate nucleic acid molecules.

[0136] In some embodiments, the TFP-encoding sequence and the second nucleic acid sequence are operably linked by a second linker. In some embodiments, the second linker comprises a protease cleavage site.

[0137] In some embodiments, the protease cleavage site is a 2A cleavage site. In some embodiments, the 2A cleavage site is a T2A cleavage site. In some embodiments, expression of IL-15 increases the persistence of the cells.

[0138] In some embodiments, the IL-15 polypeptide is secreted when expressed in the cell or T cell. In some embodiments, the IL-15 polypeptide comprises the sequence of SEQ ID NO:1242.

[0139] In some embodiments, the second nucleic acid sequence further encodes an IL-15 receptor (IL-15R) subunit or a fragment thereof. In some embodiments, the IL-15R subunit is IL-15Rα (IL-15Rα).

[0140] In some embodiments, IL-15 and IL-15Rα are operably linked by a third linker. In some embodiments, the third linker is not a cleavable linker.

[0141] In some embodiments, the third linker is (G4S) n wherein G is glycine, S is serine, and n is an integer from 1 to 10. In some embodiments, n is an integer from 1 to 4.

[0142] In some embodiments, n is 3. In some embodiments, the third linker comprises the sequence of SEQ ID NO:1243. In some embodiments, the second nucleic acid sequence encodes a fusion protein comprising the IL-15 polypeptide linked to the IL-15Rα subunit.

[0143] In some embodiments, the IL-15 polypeptide is linked to the N-terminus of the IL-15Rα subunit. In some embodiments, the fusion protein comprises amino acids 30-162 of IL-15.

[0144] In some embodiments, the fusion protein comprises amino acids 31-267 of IL-15Rα. In some embodiments, the fusion protein further comprises a sushi domain.

[0145] In some embodiments, the fusion protein comprises the sequence of SEQ ID NO:1244. In some embodiments, the fusion protein, when expressed in the cell or T cell, is expressed at the cell surface.

[0146] In some embodiments, the fusion protein is secreted when expressed in the cell or T cell. In some embodiments, the cell or T cell further comprises a third nucleic acid sequence encoding a PD-1 polypeptide.

[0147] In some embodiments, the PD-1 polypeptide is operably linked via its C-terminus to the N-terminus of the intracellular domain of a costimulatory polypeptide. In some embodiments, the third nucleic acid sequence is contained in the same nucleic acid molecule as the first and second nucleic acid sequences.

[0148] In some embodiments, the PD-1 polypeptide is linked to the intracellular domain of the costimulatory polypeptide via the transmembrane domain of PD-1. In some embodiments, the costimulatory polypeptide is selected from the group including OX40, CD2, CD27, CDS, ICAM-1, ICOS (CD278), 4-1BB (CD137), GITR, CD28, CD30, CD40, BAFFR, HVEM, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, CD226, FcγRI, FcγRII, and FcγRIII.

[0149] In some embodiments, the intracellular domain of the costimulatory polypeptide comprises at least a portion of CD28. In some embodiments, the extracellular and transmembrane domains of PD-1 are linked to the intracellular domain of CD28.

[0150] In some embodiments, the cell or T cell comprises a fusion protein comprising the extracellular and transmembrane domains of PD-1 linked to the intracellular domain of CD28 linked to IL-15Rα.

[0151] In some embodiments, the fusion protein comprises the sequence of SEQ ID NO:1254 or SEQ ID NO:1262. In some embodiments, the cell or T cell further comprises a second nucleic acid sequence encoding an interleukin-15 receptor alpha (IL-15Rα) polypeptide or a fragment thereof.

[0152] In some embodiments, the sequence encoding the TFP and the second nucleic acid sequence are comprised in a single nucleic acid molecule. In some embodiments, the sequence encoding the TFP and the second nucleic acid sequence are contained in two separate nucleic acid molecules.

[0153] In some embodiments, the TFP-encoding sequence and the second nucleic acid sequence are operably linked by a second linker. In some embodiments, the second linker comprises a protease cleavage site.

[0154] In some embodiments, the protease cleavage site is a 2A cleavage site. In some embodiments, the 2A cleavage site is a T2A cleavage site. In some embodiments, the second nucleic acid sequence further encodes PD-1 or a fragment thereof.

[0155] In some embodiments, the second nucleic acid sequence encodes the extracellular domain of PD-1. In some embodiments, the second nucleic acid sequence encodes the extracellular and transmembrane domains of PD-1.

[0156] In some embodiments, the second nucleic acid sequence further encodes CD28 or a fragment thereof. In some embodiments, the second nucleic acid sequence encodes the intracellular domain of CD28.

[0157] In some embodiments, the second nucleic acid sequence encodes a fusion protein comprising the extracellular and transmembrane domains of PD-1 linked to the intracellular domain of CD28 linked to IL-15Rα.

[0158] In some embodiments, the intracellular domain of CD28 is linked to the intracellular domain of IL-15Rα. In some embodiments, the second nucleic acid sequence comprises the sequence of SEQ ID NO:1245.

[0159] In some embodiments, the recombinant nucleic acid molecule further comprises a third nucleic acid sequence encoding an interleukin-15 (IL-15) polypeptide or a fragment thereof. In some embodiments, the IL-15 polypeptide or fragment thereof is secreted when expressed in the cell or T cell.

[0160] In some embodiments, the cells or T cells secrete IL-15 polypeptides in response to a T cell activator. In some embodiments, IL-15 signaling is increased in response to a T cell activator.

[0161] In some embodiments, the T cell activator comprises an anti-CD3 antibody or fragment thereof, an anti-CD28 antibody or fragment thereof, a cytokine, an antigen that binds to the antigen-binding domain of the TFP, or any combination thereof.

[0162] In some embodiments, the TFP functionally interacts with the endogenous TCR complex when expressed in a T cell. In some embodiments, the cell or T cell comprises a functional disruption of an endogenous TCR.

[0163] In some embodiments, the cells or T cells are allogeneic cells or T cells. In some embodiments, the cell or T cell comprises a functional disruption of the endogenous CD70 gene.

[0164] In some embodiments, the cell or T cell comprises a functional disruption of the endogenous CIITA gene. In some embodiments, the cells or T cells further comprise an antisense siRNA, shRNA, or miRNA to reduce endogenous CD70 levels.

[0165] In some embodiments, the cells or T cells further comprise an antisense siRNA, shRNA, or miRNA for reducing endogenous CIITA levels. In some embodiments, the cell or T cell further comprises a sequence encoding a fusion protein comprising an anti-CD70 antibody domain and an ER retention domain.

[0166] In some embodiments, the recombinant nucleic acid comprises a sequence encoding a fusion protein comprising an anti-CD70 antibody domain and an ER retention domain. In some embodiments, the sequence encoding the TFP and the sequence encoding the fusion protein comprising the anti-CD70 antibody domain and the ER retention domain are contained in the same operon.

[0167] In some embodiments, the ER retention domain is encoded by any one of SEQ ID NOs: 756-779. In some embodiments, the sequence encoding the fusion protein further comprises the transmembrane domain of CD8α between the anti-CD70 antibody domain and the ER retention domain.

[0168] In some embodiments, the sequence encoding the fusion protein further comprises a sequence encoding a CD8α signal peptide 5′ to the sequence encoding the anti-CD70 antibody domain.

[0169] In some embodiments, the antibody domain comprises a recombinant nucleic acid described herein. In some embodiments, the cells or T cells comprise cell surface-expressed CD70 bound to an anti-CD70 antibody.

[0170] In some embodiments, the anti-CD70 antibody is an antibody or antigen-binding fragment encoded by a recombinant nucleic acid described herein. In some embodiments, the anti-CD70 antibody has a higher affinity for CD70 than the antibody or antigen-binding fragment encoded by the recombinant nucleic acid described herein.

[0171] In some embodiments, the cell or T cell further comprises a heterologous sequence encoding an inhibitory molecule, which comprises a first polypeptide comprising at least a portion of the inhibitory molecule, associated with a second polypeptide comprising a positive signal from an intracellular signaling domain.

[0172] In some embodiments, the cell or T cell further comprises a heterologous sequence encoding a constant domain of a TCR. In some embodiments, the constant domain of the TCR is a constant domain of TCR alpha or a portion thereof, a constant domain of TCR beta or a portion thereof, a constant domain of TCR alpha or a portion thereof and a constant domain of TCR beta or a portion thereof, a constant domain of TCR gamma or a portion thereof, a constant domain of TCR delta or a portion thereof, or a constant domain of TCR gamma or a portion thereof and a constant domain of TCR delta or a portion thereof.

[0173] In some embodiments, the TCR alpha constant domain or the TCR beta constant domain is murine. In some embodiments, the cell or T cell comprises a recombinant nucleic acid molecule encoding any one of the amino acid sequences selected from SEQ ID NOs: 1233, 1236, 1240, and 1264.

[0174] In one aspect, the disclosure provides a pharmaceutical composition comprising a cell or T cell described herein and a pharmaceutically acceptable carrier. In one aspect, the disclosure provides a method of producing a cell or T cell described herein, the method comprising: (i) disrupting an endogenous CD70 gene, thereby producing a cell or T cell comprising a functional disruption of the endogenous CD70 gene; and (ii) transducing the cell or T cell comprising the functional disruption of the endogenous CD70 gene with a recombinant nucleic acid described herein, or a vector described herein.

[0175] In some embodiments, the disruption comprises transducing the cell or T cell with a nuclease protein or a nucleic acid sequence encoding a nuclease protein that targets the endogenous CD70 gene.

[0176] In some embodiments, the method further comprises destroying the endogenous TCR. In one aspect, the disclosure provides a method of producing a cell or T cell described herein, the method comprising transducing a cell or T cell comprising a disruption of the endogenous CD70 gene with a recombinant nucleic acid described herein, or a vector described herein.

[0177] In some embodiments, the cell or T cell further comprises disruption of the endogenous TCR. In one aspect, the disclosure provides a method of producing a cell or T cell described herein, the method comprising: (i) transducing a cell or T cell with a recombinant nucleic acid described herein, or a vector described herein, and (ii) contacting the cell or T cell with an anti-CD70 antibody that binds to CD70 on the surface of the cell.

[0178] In some embodiments, the anti-CD70 antibody is an antibody or antigen-binding fragment encoded by a recombinant nucleic acid described herein. In some embodiments, the anti-CD70 antibody has a higher affinity for CD70 than the antibody or antigen-binding fragment encoded by the recombinant nucleic acid described herein.

[0179] In some embodiments, the contacting occurs before transduction. In some embodiments, the contacting occurs up to one day before transduction. In some embodiments, the contacting occurs after transduction.

[0180] In some embodiments, the contacting occurs up to 5 days after transduction. In some embodiments, the methods described herein further comprise passaging the cells in medium that does not contain anti-CD70 antibody four or more days after transduction.

[0181] In some embodiments, the subculturing comprises subculturing the cells in medium that does not contain an anti-CD70 antibody 7 days or more after transduction. In certain aspects, the present disclosure provides a method of treating cancer in a subject in need thereof, the method comprising administering to the subject an effective amount of a pharmaceutical composition described herein.

[0182] In certain aspects, the present disclosure provides methods of treating cancer in a subject in need thereof, the method comprising administering to the subject a pharmaceutical composition comprising: (a) a cell or T cell described herein; and (b) a pharmaceutically acceptable carrier.

[0183] In some embodiments, the cancer is a cancer associated with elevated expression of CD70. In some embodiments, the methods described herein further comprise administering to the subject an agent that increases the level of CD70 in the cancer cells.

[0184] In some embodiments, the agent that increases the level of CD70 is a hypomethylating agent. In some embodiments, the hypomethylating agent is 5-azacytidine or decitabine.

[0185] In some embodiments, the disease or condition is selected from the group consisting of T-cell lymphoma, diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), Epstein-Barr virus (EBV), and leukemia. + Cancer and / or human papillomavirus (HPV) + Cancer

[0186] In some embodiments, the disease or condition is selected from the group consisting of kidney cancer, renal cell carcinoma, lung cancer, pancreatic cancer, ovarian cancer, esophageal cancer, nasopharyngeal cancer, mesothelioma, glioblastoma, thymic cancer, breast cancer, head and neck cancer, and gastric cancer.

[0187] In some embodiments, the subject is a human. In one aspect, the present disclosure provides a method of producing a cell or T cell described herein, the method comprising: (i) disrupting an endogenous CIITA gene, thereby producing a cell or T cell comprising a functional disruption of the endogenous CIITA gene; and (ii) transducing the cell or T cell comprising a functional disruption of the endogenous CIITA gene with a recombinant nucleic acid described herein or a vector described herein.

[0188] In some embodiments, the disruption comprises transducing the cell or T cell with a nuclease protein or a nucleic acid sequence encoding a nuclease protein that targets the endogenous CIITA gene.

[0189] In some embodiments, the method further comprises destroying the endogenous TCR. In one aspect, the disclosure provides a method of producing a cell or T cell described herein, the method comprising transducing a cell or T cell comprising a disruption of the endogenous CIITA gene with a recombinant nucleic acid described herein, or a vector described herein.

[0190] In some embodiments, the cell or T cell further comprises disruption of the endogenous TCR. In certain aspects, the disclosure provides methods of producing a cell or T cell described herein, the method comprising transducing a cell or T cell with a recombinant nucleic acid described herein or a vector described herein and a sequence encoding a fusion protein comprising an anti-CD70 antibody domain and an ER retention domain.

[0191] In some embodiments, the recombinant nucleic acid or vector and the sequence encoding the fusion protein comprising the anti-CD70 antibody domain and the ER retention domain are co-transfected.

[0192] In some embodiments, the recombinant nucleic acid or vector comprises a sequence encoding a fusion protein comprising an anti-CD70 antibody domain and an ER retention domain. In some embodiments, the sequence encoding the TFP and the sequence encoding the fusion protein comprising the anti-CD70 antibody domain and the ER retention domain are contained in the same operon.

[0193] In some embodiments, the recombinant nucleic acid or vector is transfected before or after a sequence encoding a fusion protein comprising an anti-CD70 antibody domain and an ER retention domain.

[0194] In some embodiments, the ER retention domain is encoded by any one of SEQ ID NOs: 756-779. In some embodiments, the sequence encoding the fusion protein comprising the anti-CD70 antibody domain and the ER retention domain further comprises the transmembrane domain of CD8α between the anti-CD70 antibody domain and the ER retention domain.

[0195] In some embodiments, the sequence encoding the fusion protein comprising the anti-CD70 antibody domain and the ER retention domain further comprises a sequence encoding a CD8α signal peptide 5′ to the sequence encoding the anti-CD70 antibody domain.

[0196] In some embodiments, the antibody domain comprises an anti-CD70 antibody described herein. Incorporation by Reference All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0197] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which: [Brief explanation of the drawings]

[0198] [Figure 1] 1 is a graphical representation of an ELISA assay detecting binding of the indicated anti-CD70 VHHs and scFvs to CHO-CD70 cells (high CD70 expression), JVM3 cells (medium to low CD70 expression), wild-type CHO cells (negative control), and HL60 cells (negative control). [Figure 2] 1 shows the results of an octet binding assay to measure the affinity of each of the indicated anti-CD70 VHHs and scFvs for CD70. [Figure 3] Shown are the results of an epitope binning assay to identify binning for each of the anti-CD70 VHHs and scFvs indicated and for CD27. [Figure 4] 1 is a schematic representation of the competition assay described in Example 2. [Figure 5] FIG. 5 is a graphical representation of the competition assay shown in FIG. 4 to assess competition of the indicated anti-CD70 VHHs and scFvs with CD27 for binding to CD70. [Figure 6A] 1 is a graphical representation of flow cytometry data detecting cell surface TFP expression by staining with anti-VHH antibodies and CD70-Fc tag in TFP-transduced T cells with the indicated binders or untransduced control T cells. Detection with anti-VHH antibodies and CD70-Fc tag is shown. [Figure 6B] 1 is a graphical representation of flow cytometry data detecting cell surface TFP expression by staining with anti-VHH antibodies in TFP-transduced T cells with the indicated binders or untransduced control T cells. Detection with anti-VHH antibodies is shown. [Figure 6C]1 is a graphical representation of flow cytometry data detecting cell surface TFP expression by staining with CD70-Fc tag in TFP-transduced T cells with the indicated binders or untransduced control T cells. Detection by CD70-Fc tag is shown. [Figure 7A] 1 is a graphical representation of flow cytometry data detecting CD4+ and CD8+ positivity in TFP-transduced T cells with the indicated binders or untransduced control T cells. Total T cells are shown. [Figure 7B] 1 is a graphical representation of flow cytometry data detecting CD4+ and CD8+ positivity in TFP-transduced or untransduced control T cells with the indicated binders. TFP+ T cells are shown. [Figure 7C] 1 is a graphical representation of flow cytometry data detecting CD4+ and CD8+ positivity in TFP-transduced T cells with the indicated binders or untransduced control T cells. TFP-T cells are shown. [Figure 8A] 1 is a graphical representation of flow cytometry data detecting the memory state of T cells by staining for cell surface expression of CD45RA and CCR7 in TFP-transduced T cells with the indicated binders or untransduced control T cells. Total CD4+ T cells are shown. [Figure 8B] 1 is a graphical representation of flow cytometry data detecting the memory state of T cells by staining for cell surface expression of CD45RA and CCR7 in TFP-transduced T cells with the indicated binders or untransduced control T cells. TFP-CD4+ T cells are shown. [Figure 8C] 1 is a graphical representation of flow cytometry data detecting the memory state of T cells by staining for cell surface expression of CD45RA and CCR7 in TFP-transduced T cells with the indicated binders or untransduced control T cells. TFP+CD4+ T cells are shown. [Figure 8D]1 is a graphical representation of flow cytometry data detecting the memory state of T cells by staining for cell surface expression of CD45RA and CCR7 in TFP-transduced T cells with the indicated binders or untransduced control T cells. CD8+ T cells are shown. [Figure 8E] 1 is a graphical representation of flow cytometry data detecting the memory state of T cells by staining for cell surface expression of CD45RA and CCR7 in TFP-transduced T cells with the indicated binders or untransduced control T cells. TFP-CD8+ T cells are shown. [Figure 8F] 1 is a graphical representation of flow cytometry data detecting the memory state of T cells by staining for cell surface expression of CD45RA and CCR7 in TFP-transduced T cells with the indicated binders or untransduced control T cells. TFP+CD8+ T cells are shown. [Figure 9A] 1 is a graphical representation of flow cytometry data detecting cell surface expression of CD45RA and CD27 in TFP-transduced T cells with the indicated binders or untransduced control T cells. TFP-T cells are shown. [Figure 9B] 1 is a graphical representation of flow cytometry data detecting cell surface expression of CD45RA and CD27 in TFP-transduced T cells with the indicated binders or untransduced control T cells. TFP-T cells are shown. [Figure 9C] 1 is a graphical representation of flow cytometry data detecting cell surface expression of CD45RA and CD27 in TFP-transduced T cells with the indicated binders or untransduced control T cells. TFP+ T cells are shown. [Figure 9D] 1 is a graphical representation of flow cytometry data detecting cell surface expression of CD45RA and CD27 in TFP-transduced T cells with the indicated binders or untransduced control T cells. TFP+ T cells are shown. [Figure 10]1 is a series of graphs showing the proliferation of TFP-transduced T cells with the indicated binders from three donors or untransduced control T cells when cultured with CHO-WT or THP-1 cells at effector:target cell ratios of 9:1, 3:1, and 1:1 for 24 hours. [Figure 11] 1 is a series of graphs showing the cytotoxicity of TFP-transduced T cells with the indicated binders from three donors or untransduced control T cells cultured with CHO-WT or THP-1 cells at effector:target cell ratios of 9:1, 3:1, and 1:1 for 24 hours. [Figure 12A]

[0023] Figure 1 is a series of graphs showing cytokine secretion when TFP-transduced T cells with the indicated binders or untransduced control T cells from three donors were cultured with CHO-WT or THP-1 cells at effector:target cell ratios of 9:1, 3:1, and 1:1 for 24 hours. IFN-γ, TNF-α, and IL-2 are shown. [Figure 12B]

[0023] Figure 1 is a series of graphs showing cytokine secretion when TFP-transduced T cells with the indicated binders or untransduced control T cells from three donors were cultured with CHO-WT or THP-1 cells at effector:target cell ratios of 9:1, 3:1, and 1:1 for 24 hours. GM-CSF is shown. [Figure 13]

[0023] Figure 10 provides a series of graphs showing proliferation and survival after 10 days of expansion of T cells transduced with the indicated TFPs and untransduced controls produced in the presence and absence of anti-CD70 antibodies according to the methods described in Example 9. [Figure 14] 10 is a graph showing the transduction efficiency of cells transduced with the indicated TFP in the presence and absence of anti-CD70 antibody according to the methods described in Example 9. [Figure 15] 10 provides a series of graphs showing the percentage of CD4+ and CD8+ T cells when TFP+ T cells are generated in the presence and absence of anti-CD70 antibody according to the methods described in Example 9. [Figure 16](A) and (B) are a series of graphs showing the memory phenotype of T cells when TFP+ T cells are generated in the presence and absence of anti-CD70 antibody according to the method described in Example 9. (A) shows CD4+ T cells, and (B) shows CD8+ T cells. [Figure 17] 10 provides a series of graphs showing the percentage of CCR7+ CD4+ and CD8+ T cells when TFP+ T cells were generated in the presence and absence of anti-CD70 antibody according to the methods described in Example 9. [Figure 18] 10 provides a series of graphs showing the percentage of CCR69+ CD4+ and CD8+ T cells when TFP+ T cells were generated in the presence and absence of anti-CD70 antibody according to the methods described in Example 9. [Figure 19A] 1 is a series of graphs showing the percentage of CD27+ and CD70+ T cells when TFP+ T cells are generated in the presence and absence of anti-CD70 antibody according to the methods described in Example 9. CD4+ T cells are shown. [Figure 19B]

[0023] Figure 1 is a series of graphs showing the percentage of CD27+ and CD70+ T cells when TFP+ T cells were generated in the presence and absence of anti-CD70 antibody according to the methods described in Example 9. CD8+ T cells are shown. [Figure 20] 10 is a series of plots showing RNAseq in TFP+ T cells generated in the presence and absence of anti-CD70 antibody according to the methods described in Example 9. [Figure 21] 1 is a series of graphs showing the cytotoxicity of TFP+ T cells generated in the presence and absence of anti-CD70 antibodies according to the methods described in Example 9. Cells are cultured with CD70-negative K562 cells, CD70-positive THP-1 AML cells, or CD70-positive RCC786-O cells engineered to overexpress firefly luciferase at target:effector ratios of 1:1, 3:1, or 9:1, and cell lysis is measured by luciferase activity of live cells. [Figure 22A]

[0023] Figure 1 is a series of graphs showing cytokines expressed by the indicated TFP+ T cells when cultured for 24 hours with CD70-negative K562 cells, CD70-positive THP-1 AML cells, or CD70-positive RCC786-O cells at target:effector ratios of 1:1, 3:1, or 9:1. TFP+ T cells were generated in the presence and absence of anti-CD70 antibody according to the methods described in Example 9. GM-CSF levels at 24 hours are shown. [Figure 22B]

[0023] Figure 1 is a series of graphs showing cytokines expressed by the indicated TFP+ T cells when cultured for 72 hours with CD70-negative K562 cells, CD70-positive THP-1 AML cells, or CD70-positive RCC786-O cells at target:effector ratios of 1:1, 3:1, or 9:1. TFP+ T cells were generated in the presence and absence of anti-CD70 antibody according to the methods described in Example 9. GM-CSF levels at 72 hours are shown. [Figure 22C]

[0023] Figure 1 is a series of graphs showing cytokines expressed by the indicated TFP+ T cells when cultured for 24 hours with CD70-negative K562 cells, CD70-positive THP-1 AML cells, or CD70-positive RCC786-O cells at target:effector ratios of 1:1, 3:1, or 9:1. TFP+ T cells were generated in the presence and absence of anti-CD70 antibody according to the methods described in Example 9. IFN-γ levels at 24 hours are shown. [Figure 22D]

[0023] Figure 1 is a series of graphs showing cytokines expressed by the indicated TFP+ T cells when cultured for 72 hours with CD70-negative K562 cells, CD70-positive THP-1 AML cells, or CD70-positive RCC786-O cells at target:effector ratios of 1:1, 3:1, or 9:1. TFP+ T cells were generated in the presence and absence of anti-CD70 antibody according to the methods described in Example 9. IFN-γ levels at 72 hours are shown. [Figure 22E]

[0023] Figure 1 is a series of graphs showing cytokines expressed by the indicated TFP+ T cells when cultured for 24 hours with CD70-negative K562 cells, CD70-positive THP-1 AML cells, or CD70-positive RCC786-O cells at target:effector ratios of 1:1, 3:1, or 9:1. TFP+ T cells were generated in the presence and absence of anti-CD70 antibody according to the methods described in Example 9. IL-2 levels at 24 hours are shown. [Figure 22F]

[0023] Figure 1 is a series of graphs showing cytokines expressed by the indicated TFP+ T cells when cultured for 72 hours with CD70-negative K562 cells, CD70-positive THP-1 AML cells, or CD70-positive RCC786-O cells at target:effector ratios of 1:1, 3:1, or 9:1. TFP+ T cells were generated in the presence and absence of anti-CD70 antibody according to the methods described in Example 9. IL-2 levels at 72 hours are shown. [Figure 22G]

[0023] Figure 1 is a series of graphs showing cytokines expressed by the indicated TFP+ T cells when cultured for 24 hours with CD70-negative K562 cells, CD70-positive THP-1 AML cells, or CD70-positive RCC786-O cells at target:effector ratios of 1:1, 3:1, or 9:1. TFP+ T cells were generated in the presence and absence of anti-CD70 antibody according to the methods described in Example 9. TNF-α levels at 24 hours are shown. [Figure 22H]

[0023] Figure 1 is a series of graphs showing cytokines expressed by the indicated TFP+ T cells when cultured for 72 hours with CD70-negative K562 cells, CD70-positive THP-1 AML cells, or CD70-positive RCC786-O cells at target:effector ratios of 1:1, 3:1, or 9:1. TFP+ T cells were generated in the presence and absence of anti-CD70 antibody according to the method described in Example 9. TNF-α levels at 72 hours are shown. [Figure 23A] 10 is a series of graphs showing the percentage of TFP+CD70+ and CD70- cells 7 days after CRISPR editing to knock out CD70. [Figure 23B] 10 is a series of graphs showing the percentage of TFP+CD70+ and CD70- cells 9 days after CRISPR editing to knock out CD70. [Figure 24] 10 shows graphs and plots demonstrating the transduction efficiency of cells transduced with the indicated TFPs according to the methods described in Example 10 in non-edited and CD70 CRISPR-edited cells. [Figure 25] 10 provides a series of graphs showing the percentage of CD4+ and CD8+ T cells in non-edited and CD70 CRISPR-edited cells when TFP+ T cells were generated according to the methods described in Example 10. [Figure 26]

[0023] Figure 10 is a series of plots showing the percentage of CD27+ and CD70+ T cells in non-edited and CD70 CRISPR-edited cells when TFP+ T cells were generated according to the methods described in Example 10. [Figure 27] (A) and (B) are a series of graphs showing the memory phenotype of T cells in non-edited and CD70 CRISPR-edited cells when TFP+ T cells were generated according to the methods described in Example 10. (A) shows CD4+ T cells, and (B) shows CD8+ T cells. [Figure 28] 10 provides a series of graphs showing the percentage of CCR69+ CD4+ and CD8+ T cells in non-edited and CD70 CRISPR-edited cells when TFP+ T cells were generated according to the methods described in Example 10. [Figure 29]

[0023] Figure 1 is a series of graphs showing detection of 70-001 TFP expression in wild-type and CD3ε knockout Jurkat cells with CD70-biotin / SA-PE and anti-VHH-AF488 by flow cytometry. TRuC was generated using VIN70069 virus (IU titer 6.5E7). [Figure 30] 1 is a series of plots showing the percentage of VHH + and CD69 + Jurkat cells (wild-type or CD3ε knockout) transduced with 70-001TFP when cultured for 16 hours with CD70-negative K562 cells, CD70-positive THP-1 AML cells, CD70-positive JVM3 cells, or a no-target cell control at a 1:1 ratio in the presence or absence of 5 μM 41D12 anti-CD70 antibody. [Figure 31] FIG. 31 is a graphical representation of the flow plot data shown in FIG. 30. [Figure 32] 1 is a series of plots showing the percentage of VHH + and CD69 + CD3ε knockout Jurkat cells transduced with 70-001TFP when cultured for 16 hours with CD70-negative K562 cells, CD70-positive THP-1 AML cells, CD70-positive JVM3 cells, or a no-target cell control at a 1:1 ratio in the presence or absence of anti-CD70 antibody (5 μM 1F6-hFc or 70-001-hFc or 10 μM 41D12). [Figure 33] FIG. 33 is a graphical representation of the flow plot data shown in FIG. 32. [Figure 34] FIG. 12 is a schematic diagram of the ELISA assay used to measure the ability of CD27 to block CD70 binding as measured by ELISA as described in Example 12. [Figure 35] Figure 1 shows an octet titration to measure the affinity of anti-CD70 scFv antibodies 1885 (B08), 1985 (A11), and 1867 (C10) to CD70. A group of scFvs was discovered by panning a naive fully human scFv library, and a subset of these were converted to TRuC and characterized here. [Figure 36] Shown are the results of an epitope binning assay to identify each of the anti-CD70 VHHs and scFvs shown and their binning against CD27. [Figure 37A] Figure 1 shows the results of epitope mapping analysis.Figure 2 shows graphs showing the results of epitope mapping of the indicated VHH antibodies. [Figure 37B] Figure 1 shows the results of epitope mapping analysis.Figure 2 shows graphs depicting the results of epitope mapping of the indicated scFv antibodies. [Figure 37C] Figure 37 shows the results of epitope mapping analysis. Figure 38 is a schematic diagram summarizing the epitope binning and epitope mapping data from Figures 36, 37A, and 37B. [Figure 38]1 is a series of plots showing flow cytometry data detecting CD69 expression and transduction efficiency as measured by CD3 expression in CD3ε knockout Jurkat cells transduced with TFP with the indicated scFv binders or untransduced control T cells. [Figure 39A] 1 is a series of plots showing flow cytometry data detecting CD3 and CD69 expression in CD3ε knockout Jurkat cells transduced with TFP with the indicated scFv binders after 24 hours of co-culture with K562, THP-1, ACHN, or 786-O target cells at a 1:1 ratio. The vLvH-oriented scFv binders are shown. [Figure 39B] 1 is a series of plots showing flow cytometry data detecting CD3 and CD69 expression in CD3ε knockout Jurkat cells transduced with TFP with the indicated scFv binders after 24 hours of co-culture at a 1:1 ratio with K562, THP-1, ACHN cells, or 786-O target cells. ScFv binders in the vHvL orientation are shown. [Figure 40] Figure 1 shows the production of cytokines TNF-α, GM-CSF, and IL-2 by CD3ε knockout Jurkat cells transduced with TFP bearing the indicated scFv binders after 24 hours of coculture at a 1:1 ratio with K562, THP-1, ACHN, or 786-O target cells. CD70 TFP T cells were cocultured with CD70 K562 cells or CD70 TFP, ACHN, or 786-O cells. [Figure 41] Graph showing proliferation of T cells transduced with CD70 TFP, 70-001 CD70 TFP, or TC-110 with the indicated scFv binders. [Figure 42] 1 is a graph showing the transduction efficiency of cells transduced with the indicated TFP constructs, as described in Example 16. [Figure 43]A series of plots are provided showing the percentage of CD4+ and CD8+ T cells in T cell populations transduced with the indicated TFPs or untransduced control T cells, as described in Example 16. Some CD70 TRuCs exhibit CD4 / CD8 ratios similar to NT and TC-110. [Figure 44] 1 is a graph showing the percentage of TFP-transduced or untransduced control CD69+ T cells with the indicated binders, as described in Example 16. [Figure 45] FIG. 12 is a graph showing memory phenotypes identified by flow cytometry detecting cell surface expression of CD45RA and CD27 in TFP-transduced T cells with the indicated binders or untransduced control T cells, as described in Example 16. [Figure 46] 46 is a table summarizing the data shown in FIGS. 42-45. [Figure 47] 1 is a series of plots showing detection of CD70 surface expression in THP-1, ACHN, and 786-O cell lines. [Figure 48] 1 is a series of graphs showing the cytotoxicity of TFP-transduced T cells with the indicated binders from one representative donor or untransduced control T cells cultured with THP-1, ACHN, 786-O, or K562 cells at 3:1, 1:1, or 1:3 ratios for 24 hours. [Figure 49A]

[0023] Figure 1 is a series of graphs showing cytokine production when TFP-transduced T cells with the indicated binders or untransduced control T cells from one representative donor were cultured with THP-1, ACHN, 786-O, or K562 cells at a 3:1, 1:1, or 1:3 ratio for 24 hours. IFN-γ was measured. [Figure 49B]

[0023] Figure 1 is a series of graphs showing cytokine production when TFP-transduced T cells with the indicated binders from one representative donor or untransduced control T cells were cultured with THP-1, ACHN, 786-O, or K562 cells at a 3:1, 1:1, or 1:3 ratio for 24 hours. IL-2 was measured. [Figure 49C]

[0023] Figure 1 is a series of graphs showing cytokine production when TFP-transduced T cells with the indicated binders from one representative donor or untransduced control T cells were cultured with THP-1, ACHN, 786-O, or K562 cells at a 3:1, 1:1, or 1:3 ratio for 24 hours. TNF-α was measured. [Figure 49D]

[0023] Figure 1 is a series of graphs showing cytokine production when TFP-transduced T cells with the indicated binders or untransduced control T cells from one representative donor were cultured with THP-1, ACHN, 786-O, or K562 cells at a 3:1, 1:1, or 1:3 ratio for 24 hours. GM-CSF was measured. [Figure 50] Graph showing proliferation of T cells from three donors transduced with CD70 TFP with the indicated scFv or humanized VHH binders, or 70-001 CD70 TFP (P3E8), TC-110, or an untransduced control. [Figure 51] 1 is a series of plots showing cell surface CD70 expression and transduction efficiency as determined by detection of VHH expression in T cells from three donors transduced with CD70 TFP with the indicated scFv or humanized VHH binders, or 70-001 CD70 TFP (P3E8), TC-110, or an untransduced control. [Figure 52] 1 is a series of plots showing flow cytometry data detecting CD4+ and CD8+ positivity in T cells from three donors transduced with CD70 TFP with the indicated scFv or humanized VHH binders, or 70-001 CD70 TFP (P3E8), TC-110, or an untransduced control. [Figure 53] 1 is a series of plots showing memory phenotypes identified by flow cytometry detecting cell surface expression of CD45RA and CD27 in T cells from two donors transduced with CD70 TFP with the indicated scFv or humanized VHH binders, or 70-001 CD70 TFP (P3E8), TC-110, or untransduced controls. [Figure 54] 1 is a series of plots showing flow cytometry data detecting cell surface expression of CD69 in T cells from three donors transduced with CD70 TFP with the indicated scFv or humanized VHH binders, or 70-001 CD70 TFP (P3E8), TC-110, or an untransduced control. [Figure 55] 1 is a series of graphs showing the cytotoxicity of TFP-transduced T cells with the indicated binders from one representative donor or untransduced control T cells cultured with THP-1, ACHN, 786-O, or K562 cells at 3:1, 1:1, or 1:3 ratios for 24 hours. [Figure 56] Figure 1 is a series of graphs showing cytokine production when TFP-transduced T cells with the indicated binders from one representative donor or untransduced control T cells were cultured with THP-1, ACHN, 786-O, or K562 cells at a 3:1, 1:1, or 1:3 ratio for 24 hours. IFN-γ, IL-2, TNF-α, and GM-CSF were measured. [Figure 57] FIG. 1 is a series of graphs showing proliferation of T cells from three donors transduced with CD70 TFP with the indicated scFv or humanized VHH binders, or with 70-001 CD70 TFP (P3E8), C10 TFP, or an untransduced control. [Figure 58] 1 is a series of plots showing transduction efficiency determined by detection of VHH expression in T cells from one representative donor transduced with CD70 TFP with the indicated humanized VHH binders, 70-001 CD70 TFP (P3E8), or untransduced controls. [Figure 59] FIG. 1 is a series of plots showing flow cytometry data detecting CD4+ and CD8+ positivity in T cells from one representative donor transduced with CD70 TFP with the indicated humanized VHH binders, 70-001 CD70 TFP (P3E8), or untransduced controls. [Figure 60A]

[0023] Figure 1 is a series of plots showing memory phenotypes identified by flow cytometry detecting cell surface expression of CD45RA and CD27 in T cells from one representative donor transduced with CD70 TFP with the indicated humanized VHH binders, 70-001 CD70 TFP (P3E8), and untransduced controls. Total CD3+ T cells are shown. [Figure 60B]

[0023] Figure 1 is a series of plots showing memory phenotypes identified by flow cytometry detecting cell surface expression of CD45RA and CD27 in T cells from one representative donor transduced with CD70 TFP, 70-001 CD70 TFP (P3E8), and untransduced controls with the indicated humanized VHH binders. CD4+ T cells are shown. [Figure 60C]

[0023] Figure 1 is a series of plots showing memory phenotypes identified by flow cytometry detecting cell surface expression of CD45RA and CD27 in T cells from one representative donor transduced with CD70 TFP, 70-001 CD70 TFP (P3E8) with the indicated humanized VHH binders, and untransduced controls. CD8+ T cells are shown. [Figure 61] 1 is a series of graphs showing the cytotoxicity of TFP-transduced T cells with the indicated binders, generated in the presence or absence of the indicated 41D12 antibody, or untransduced control T cells, from one representative donor, cultured with THP-1, ACHN, 786-O, MOLM14, or K562 cells at 3:1, 1:1, or 1:3 ratios for 24 hours. [Figure 62A]

[0023] Figure 1 is a series of graphs showing cytokine production by TFP-transduced T cells with the indicated binders, generated in the presence or absence of the indicated 41D12 antibody, or untransduced control T cells from one representative donor, when cultured with THP-1, ACHN, 786-O, MOLM13, or K562 cells at a 3:1, 1:1, or 1:3 ratio for 24 hours. IFN-γ was measured. [Figure 62B]

[0023] Figure 1 is a series of graphs showing cytokine production by TFP-transduced T cells with the indicated binders, generated in the presence or absence of the indicated 41D12 antibody, or untransduced control T cells from one representative donor, when cultured with THP-1, ACHN, 786-O, MOLM13, or K562 cells at a 3:1, 1:1, or 1:3 ratio for 24 hours. GM-CSF was measured. [Figure 62C]

[0023] Figure 1 is a series of graphs showing cytokine production by TFP-transduced T cells with the indicated binders, generated in the presence or absence of the indicated 41D12 antibody, or untransduced control T cells from one representative donor, when cultured with THP-1, ACHN, 786-O, MOLM13, or K562 cells at a 3:1, 1:1, or 1:3 ratio for 24 hours. IL-2 was measured. [Figure 62D]

[0023] Figure 1 is a series of graphs showing cytokine production by TFP-transduced T cells with the indicated binders, generated in the presence or absence of the indicated 41D12 antibody, or untransduced control T cells from one representative donor, when cultured with THP-1, ACHN, 786-O, MOLM13, or K562 cells at a 3:1, 1:1, or 1:3 ratio for 24 hours. TNF-α was measured. [Figure 63] Graph showing proliferation of T cells transduced with C10 CD70 TFP with or without PD-1-CD28 fusion protein or membrane-bound IL-15, or untransduced controls. [Figure 64] 1 is a series of plots showing transduction efficiency (as determined by detection of VHH expression), cell surface PD-1 expression, and cell surface IL15Rα expression of T cells transduced with C10 CD70 TFP with or without PD-1-CD28 fusion protein or membrane-bound IL-15, or untransduced controls. [Figure 65]1 is a series of plots showing flow cytometry data detecting CD4+ positivity in T cells transduced with C10 CD70 TFP with or without PD-1-CD28 fusion protein or membrane-bound IL-15, or untransduced controls. [Figure 66] 1 is a series of plots showing memory phenotypes identified by flow cytometry detecting cell surface expression of CD45RA and CD27 in T cells transduced with C10 CD70 TFP with or without PD-1-CD28 fusion protein or membrane-bound IL-15, or untransduced controls. [Figure 67] 1 is a series of graphs showing proliferation of T cells from two donors transduced with CD70 TFP with the indicated human scFv binders or untransduced controls. [Figure 68A]

[0023] Figure 1 is a series of plots showing CD8 positivity and transduction efficiency as determined by detection of scFv expression in T cells from two representative donors transduced with CD70 TFP with the indicated human scFv binders or untransduced controls. T cells from donor R017 are shown. [Figure 68B]

[0023] Figure 1 is a series of plots showing CD8 positivity and transduction efficiency as determined by detection of scFv expression in T cells from two representative donors transduced with CD70 TFP with the indicated human scFv binders or untransduced controls. T cells from donor R022 are shown. [Figure 69A]

[0023] Figure 1 is a series of plots showing flow cytometry data detecting cell surface expression of CD70 in T cells from two donors transduced with CD70 TFP with the indicated human scFv binders or an untransduced control. T cells from donor R017 are shown. [Figure 69B]

[0023] Figure 1 is a series of plots showing flow cytometry data detecting cell surface expression of CD70 in T cells from two donors transduced with CD70 TFP with the indicated human scFv binders or untransduced controls. T cells from donor R022 are shown. [Figure 70A]

[0023] Figure 1 is a series of plots showing memory phenotypes identified by flow cytometry detecting cell surface expression of CD45RA and CD27 in T cells from two donors transduced with CD70 TFP with the indicated human scFv binders or untransduced controls. CD8+ T cells from donor R017 are shown. [Figure 70B]

[0023] Figure 1 is a series of plots showing memory phenotypes identified by flow cytometry detecting cell surface expression of CD45RA and CD27 in T cells from two donors transduced with CD70 TFP with the indicated human scFv binders or untransduced controls. CD4+ T cells from donor R017 are shown. [Figure 70C]

[0023] Figure 1 is a series of plots showing memory phenotypes identified by flow cytometry detecting cell surface expression of CD45RA and CD27 in T cells from two donors transduced with CD70 TFP with the indicated human scFv binders or untransduced controls. CD8+ T cells from donor R022 are shown. [Figure 70D]

[0023] Figure 1 is a series of plots showing memory phenotypes identified by flow cytometry detecting cell surface expression of CD45RA and CD27 in T cells from two donors transduced with CD70 TFP with the indicated human scFv binders or untransduced controls. CD4+ T cells from donor R022 are shown. [Figure 71A]

[0023] Figure 1 is a series of graphs showing the cytotoxicity of T cells from two donors transduced with TFP with the indicated binders or untransduced control T cells when cultured with THP-1, ACHN, 786-O, or K562 cells at a 3:1, 1:1, or 1:3 ratio for 24 hours. T cells from donor R017 are shown. [Figure 71B]

[0023] Figure 1 is a series of graphs showing the cytotoxicity of T cells from two donors transduced with TFP with the indicated binders or untransduced control T cells when cultured with THP-1, ACHN, 786-O, or K562 cells at a 3:1, 1:1, or 1:3 ratio for 24 hours. T cells from donor R022 are shown. [Figure 72A] 1 is a series of graphs showing tumor volume in mice in a mouse model of renal cell carcinoma treated with CD70 TFP+ T cells generated in the presence and absence of anti-CD70 antibody according to the methods described in Example 21. Tumor volume after initial treatment is shown. [Figure 72B] 1 is a series of graphs showing tumor volume in mice treated with CD70 TFP+ T cells generated in the presence and absence of anti-CD70 antibody according to the methods described in Example 21 in a mouse model of renal cell carcinoma. Tumor volume after re-treatment is shown. [Figure 73A] Figure 2 shows tumor growth in mice administered CD70 TFP+ T cells generated in the presence and absence of anti-CD70 antibodies according to the method described in Example 21 in a mouse model of systemic human Burkitt lymphoma. Tumor growth was determined by luminescence. A graph of tumor growth in all groups in a single plot is shown. [Figure 73B] 2 shows tumor growth in mice administered CD70 TFP+ T cells generated in the presence and absence of anti-CD70 antibodies according to the methods described in Example 21 in a mouse model of systemic human Burkitt lymphoma. Tumor growth was determined by luminescence. Separate plots are shown for each group. [Figure 73C]

[0033] Figure 2 shows tumor growth in mice administered CD70 TFP T cells generated in the presence and absence of anti-CD70 antibodies according to the methods described in Example 21 in a mouse model of systemic human Burkitt lymphoma. Tumor growth was determined by luminescence. Images of luminescence for each subject are shown. [Figure 74A]2 shows tumor growth in mice administered CD70 TFP+ T cells generated in the presence and absence of anti-CD70 antibodies according to the method described in Example 21 in a mouse model of systemic human acute myeloid leukemia. Tumor growth is determined by luminescence. A graph of tumor growth in all groups in a single plot is shown. [Figure 74B] Figure 2 shows tumor growth in mice treated with CD70 TFP+ T cells generated in the presence and absence of anti-CD70 antibodies according to the method described in Example 21 in a mouse model of systemic human acute myeloid leukemia. Tumor growth is determined by luminescence. Separate plots are shown for each group at 1e7 doses of TFP+ T cells. [Figure 75] FIG. 2 is a graph showing tumor volume in mice treated with CD70 TFP+ T cells generated in the presence and absence of anti-CD70 antibody according to the method described in Example 21 in a mouse model of renal cell carcinoma (ACHN). DETAILED DESCRIPTION OF THE INVENTION

[0199] The present disclosure provides a recombinant nucleic acid molecule comprising a sequence encoding a T cell receptor (TCR) fusion protein (TFP), wherein the TFP comprises (a) a TCR subunit comprising (i) at least a portion of the extracellular domain of the TCR, and (ii) the transmembrane domain of the TCR, (iii) the intracellular domain of the TCR, and (b) an antigen-binding domain that specifically binds to CD70, wherein the TCR subunit and the antigen-binding domain are operably linked, or a vector comprising the recombinant nucleic acid molecule. Also disclosed herein are recombinant nucleic acid molecules comprising a sequence encoding an antibody or fragment thereof that specifically binds to CD70. Also disclosed herein are cells, e.g., T cells, comprising a recombinant nucleic acid comprising a sequence encoding a TFP described herein. The cells may further comprise a nucleic acid encoding an inhibitory molecule comprising a first polypeptide comprising at least a portion of an inhibitory molecule (e.g., PD-1) associated with a second polypeptide comprising a positive signal from an intracellular signaling domain (e.g., a costimulatory domain and a primary signaling domain), and / or a nucleic acid encoding an interleukin-15 (IL-15) polypeptide or fragment thereof, an IL-15 receptor (IL-15R) subunit or fragment thereof, or a combination thereof. Also disclosed herein are pharmaceutical compositions comprising the cells described herein and a pharmaceutically acceptable carrier, methods of treating cancer in a subject by administering to the subject a pharmaceutical composition described herein, and methods of producing the cells described herein.

[0200] definition Unless otherwise defined, all technical terms, notations, and other scientific terms used herein are intended to have the meaning commonly understood by one of ordinary skill in the art to which this invention belongs. In some cases, for clarity and / or ready reference, terms having a commonly understood meaning are defined herein, but the inclusion of such definitions herein should not necessarily be construed as representing a deviation from what is commonly understood in the art. The techniques and procedures described or referenced herein are generally well understood and commonly employed by those of ordinary skill in the art using conventional methods, such as the widely used molecular cloning methods described in Sambrook et al., Molecular Cloning: A Laboratory Manual 4th ed. (2012) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Where appropriate, procedures involving the use of commercially available kits and reagents are generally performed according to manufacturer-defined protocols and conditions unless otherwise noted.

[0201] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Terms such as "including," "e.g.," and the like are intended to convey an open-ended inclusion unless expressly stated otherwise.

[0202] As used herein, the term "comprise" or variations thereof, such as "comprises" or "comprising," should be interpreted to indicate the inclusion of any listed integer (e.g., feature, element, attribute, property, method / process step, or limitation) or group of integers (e.g., feature, element, attribute, property, method / process step, or limitation), but should not be interpreted to indicate the exclusion of any other integer or group of integers. Thus, as used herein, the term "comprise" is inclusive and does not exclude further, unrecited integers or method / process steps.

[0203] In any of the embodiments of the compositions and methods provided herein, "comprising" may be replaced with "consisting essentially of" or "consisting of." The phrase "consisting essentially of" is used herein to require specific integer(s) or steps and those that do not materially affect the characteristics or functionality of the claimed invention. As used herein, the term "consisting" is used to indicate the presence of only the listed integers (e.g., features, elements, attributes, properties, method / process steps, or limitations) or group of integers (e.g., features, elements, attributes, properties, method / process steps, or limitations).

[0204] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The term "about" denotes and encompasses the indicated value as well as a range above and below that value. In certain embodiments, the term "about" denotes ±10%, ±5%, or ±1% of the specified value. In certain embodiments, where applicable, the term "about" denotes the specified value(s) ±1 standard deviation of that value(s).

[0205] As used herein, the term "antibody" refers to a protein or polypeptide sequence derived from an immunoglobulin molecule that specifically binds to an antigen. Antibodies may be intact immunoglobulins or fragments thereof, of polyclonal or monoclonal origin, and may be derived from natural or recombinant sources.

[0206] The term "antigen-binding domain" refers to a portion of an antibody that can specifically bind to an antigen or epitope. An example of an antigen-binding domain is the V H -V LAnother example of an antigen-binding domain is an antigen-binding domain formed by diversification of a specific loop from the tenth fibronectin type III domain of Adnectins.

[0207] The term "antibody fragment" or "antibody binding domain" refers to at least a portion of an antibody, or a recombinant variant thereof, that comprises the antigen-binding domain, i.e., the antigen-determining variable region of an intact antibody, sufficient to confer recognition and specific binding to the antibody fragment's target, e.g., an antigen and its distinct epitope. Examples of antibody fragments include Fab, Fab', F(ab'), and Fv fragments, single-chain (sc)Fv ("scFv") antibody fragments, linear antibodies, single-domain antibodies (abbreviated as "sdAb") (V). L or V H Camelidae V HH These include, but are not limited to, multispecific antibodies formed from antibody domains, as well as antibody fragments.

[0208] The term "scFv" refers to a fusion protein comprising at least one antibody fragment comprising a light chain variable region and at least one antibody fragment comprising a heavy chain variable region, wherein the light and heavy chain variable regions are contiguously linked via a short flexible polypeptide linker and can be expressed as a single polypeptide chain, and the scFv retains the specificity of the intact antibody from which it is derived.

[0209] The "heavy chain variable region" or "V" for an antibody H (or "V" in the case of single domain antibodies, e.g., nanobodies) HH ") refers to a fragment of a heavy chain comprising three CDRs interposed between flanking stretches known as framework regions, which are generally more highly conserved than the CDRs and form a scaffold supporting the CDRs.

[0210] Unless otherwise specified, as used herein, scFv is a V L and V HThe variable regions of V may be in any order, for example, with respect to the N-terminus and C-terminus of the polypeptide, i.e., the scFv may have L -Linker-V H Even if it includes V H -Linker-V L may include:

[0211] The portion of the TFP composition of the present invention comprising an antibody or antibody fragment thereof can exist in various forms in which the antigen-binding domain is expressed as part of a continuous polypeptide chain, such as, for example, a single-domain antibody fragment (sdAb) or a heavy-chain antibody HCAb, or a single-chain antibody (scFv) derived from a murine, humanized, or human antibody (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, NY; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426). In one embodiment, the antigen-binding domain of the TFP composition of the present disclosure comprises an antibody fragment. In a further embodiment, the TFP comprises an antibody fragment comprising an scFv or sdAb.

[0212] The term "antibody heavy chain" refers to the larger of the two types of polypeptide chains contained in antibody molecules in their naturally occurring conformation, which usually determines the class to which the antibody belongs.

[0213] The term "antibody light chain" refers to the smaller of the two types of polypeptide chains contained in antibody molecules in their naturally occurring conformation. Kappa and lambda light chains refer to the two major antibody light chain isotypes.

[0214] The term "recombinant antibody" refers to an antibody produced using recombinant DNA techniques, e.g., an antibody expressed in a bacteriophage or yeast expression system. The term shall also be taken to mean an antibody produced by synthesis of a DNA molecule encoding the antibody and expressing the antibody protein, or an amino acid sequence specifying the antibody, where the DNA or amino acid sequence is obtained using recombinant DNA or amino acid sequence techniques available and well known in the art.

[0215] The term "antigen" or "Ag" refers to a molecule capable of being specifically bound by an antibody or otherwise eliciting an immune response, which may include either antibody production or activation of specific immunologically competent cells, or both.

[0216] Those skilled in the art will understand that any macromolecule can serve as an antigen, including virtually any protein or peptide. Furthermore, antigens can be derived from recombinant or genomic DNA. Those skilled in the art will understand that any DNA containing a nucleotide sequence or partial nucleotide sequence encoding a protein that elicits an immune response will thus encode an "antigen," as the term is used herein. Furthermore, those skilled in the art will understand that an antigen need not be entirely encoded by the full-length nucleotide sequence of a gene. It will be readily apparent that the present disclosure includes, but is not limited to, the use of partial nucleotide sequences of multiple genes, with these nucleotide sequences arranged in various combinations to encode a polypeptide that elicits a desired immune response. It will also be readily apparent that an antigen need not be encoded by a "gene" at all. It will be readily apparent that antigens can be natural or synthetic, can be derived from biological samples, and can be macromolecules other than polypeptides. Such biological samples can include, but are not limited to, tissue samples, tumor samples, cells, or fluids of other biological components.

[0217] "CD70" is a cytokine belonging to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF27 / CD27, a surface antigen on activated but not resting T and B lymphocytes. CD70 induces the proliferation of costimulated T cells, promotes the generation of cytolytic T cells, and contributes to T cell activation. CD70 has also been reported to be involved in the activation of B cells, the cytotoxic function of natural killer cells, and the regulation of immunoglobulin synthesis.

[0218] "Class II major histocompatibility complex transactivator" or "CIITA" encodes a protein with an acidic transcriptional activation domain, four LRRs (leucine-rich repeats), and a GTP-binding domain. The protein is located in the nucleus and functions as a positive regulator of class II major histocompatibility complex gene transcription, and is referred to as the "master regulator" of the expression of these genes. The protein also binds GTP and uses GTP binding to promote its own transport into the nucleus. Once inside the nucleus, it does not bind to DNA but acts like a coactivator using its intrinsic acetyltransferase (AT) activity.

[0219] The term "anti-tumor effect" refers to a biological effect that can be manifested by various means, including, but not limited to, a reduction in tumor volume, a reduction in tumor cell number, a reduction in the number of metastases, an increase in life expectancy, a reduction in tumor cell proliferation, a decrease in tumor cell survival rate, or an improvement in various physiological symptoms associated with a cancerous condition. An "anti-tumor effect" can also be manifested by the ability of the peptides, polynucleotides, cells, and antibodies of the present invention to prevent the development of tumors at the initial stage.

[0220] "Humanized" forms of non-human antibodies are chimeric antibodies that contain minimal sequence derived from a non-human antibody. Humanized antibodies are generally human antibodies (recipient antibodies) in which residues from one or more CDRs have been replaced with residues from one or more CDRs of a non-human antibody (donor antibody). The donor antibody can be any suitable non-human antibody, e.g., a mouse, rat, rabbit, chicken, or non-human primate antibody, that has the desired specificity, affinity, or biological effect. In some cases, selected framework region residues of the recipient antibody are replaced with corresponding framework region residues from the donor antibody. Humanized antibodies may also contain residues that are not found in either the recipient antibody or the donor antibody. Such modifications can further improve antibody function. For further details, see Jones et al., Nature, 1986, 321:522-525, Riechmann et al., Nature, 1988, 332:323-329, and Presta, Curr. Op. Struct. Biol., 1992, 2:593-596, each of which is incorporated by reference in its entirety.

[0221] A "human antibody" is one that has an amino acid sequence corresponding to that of an antibody produced by a human or human cell, or that is derived from a non-human source that utilizes the human antibody repertoire or a human antibody coding sequence (e.g., obtained from a human source or designed de novo). Human antibody strictly excludes humanized antibodies.

[0222] "Affinity" refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen or epitope). Unless otherwise specified, "affinity" as used herein refers to the intrinsic binding affinity, which reflects a 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen or epitope). The affinity of a molecule X for its partner Y is determined by the dissociation equilibrium constant (K D) The kinetic components that contribute to the dissociation equilibrium constant are described in more detail below. Affinity can be measured by common methods known in the art, including those described herein, such as surface plasmon resonance (SPR) technology (e.g., BIACORE®) or biolayer interferometry (e.g., FORTEBIO®).

[0223] With respect to the binding of an antibody or fragment thereof to a target molecule, "binds," "specific binding," "specifically binds," "specific," "selectively binds," and "selective" to a particular antigen (e.g., a polypeptide target) or epitope of a particular antigen refer to binding that is clearly distinct from a nonspecific or nonselective interaction (e.g., with a non-target molecule). Specific binding can be measured, for example, by measuring binding to the target molecule and comparing it to binding to the non-target molecule. Specific binding can also be measured by competition with a control molecule that mimics the epitope recognized on the target molecule. Specific binding is then indicated if binding of the antibody to the target molecule is competitively inhibited by the control molecule.

[0224] The term "autologous" refers to any material that originates from the same individual into which it is later reintroduced. The term "allogeneic" refers to any material derived from a different animal of the same species or from a different patient than the individual into whom the material is introduced. Two or more individuals are said to be allogeneic to one another if their genes are not identical at one or more loci. In some embodiments, allogeneic material derived from individuals of the same species may be sufficiently genetically different to interact antigenically.

[0225] The term "xenogeneic" refers to a graft derived from an animal of a different species. The term "treating" (and variations thereof, such as "treat" or "treatment") refers to clinical intervention in an attempt to alter the natural course of a disease or condition in a subject in need thereof. Treatment can be performed both prophylactically and during clinical pathology. Desirable effects of treatment include prevention of disease onset or recurrence, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, prevention of metastasis, reduction in the rate of disease progression, amelioration or palliation of the condition, and remission or improved prognosis.

[0226] As used herein, a "therapeutically effective amount" is an amount of a composition or its active ingredient sufficient to confer a beneficial effect or reduce otherwise harmful, undesirable events on an individual to whom the composition is administered. A "therapeutically effective dose," as used herein, refers to a dose administered to produce one or more desired or desirable (e.g., beneficial) effects, where such administration occurs one or more times over a specified period of time. The exact dose will depend on the purpose of the treatment and can be ascertained by one of ordinary skill in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); and Pickar, Dosage Calculations (1999)).

[0227] As used herein, "T cell receptor (TCR) fusion protein" or "TFP" includes recombinant polypeptides derived from various polypeptides that comprise the TCR, which is generally capable of i) binding to a surface antigen on a target cell, and ii) interacting with other polypeptide components of the intact TCR complex, typically when co-located within or on the surface of the T cell. A "TFP T cell" is a T cell that has been transduced according to the methods disclosed herein to express TFP, e.g., incorporated into a native TCR. In some embodiments, the T cell is a CD4 T cell. + T cells, CD8 + T cells, or CD4 + / CD8+ In some embodiments, the TFP T cells are NK cells or regulatory T cells.

[0228] As used herein, "T cell receptor" and "T cell receptor complex" are used interchangeably and generally refer to molecules found on the surface of T cells that are involved in antigen recognition. The TCR comprises a heterodimer consisting of TCRα and TCRβ chains in 95% of T cells, while 5% of T cells have a TCR consisting of TCRγ and TCRδ chains. The TCR further comprises one or more of CD3ε, CD3γ, and CD3δ. In some embodiments, the TCR comprises CD3ε. In some embodiments, the TCR comprises CD3γ. In some embodiments, the TCR comprises CD3δ. In some embodiments, the TCR comprises CD3ζ. Binding of the TCR to an antigen, e.g., antigen and MHC, activates the T cell through a series of biochemical events mediated by associated enzymes, co-receptors, and specialized accessory molecules. In some embodiments, the constant domain of human TCRα has the sequence of SEQ ID NO: 711. In some embodiments, the constant domain of human TCR alpha has an IgC domain having the sequence of SEQ ID NO: 712, a transmembrane domain having the sequence of SEQ ID NO: 713, and an intracellular domain having the sequence of S-S. In some embodiments, the constant domain of mouse TCR alpha has the sequence of SEQ ID NO: 1267. In some embodiments, the constant domain of human TCR beta has the sequence of SEQ ID NO: 715. In some embodiments, the constant domain of human TCR beta has an IgC domain having the sequence of SEQ ID NO: 716, a transmembrane domain having the sequence of SEQ ID NO: 717, and an intracellular domain having the sequence of SEQ ID NO: 719. In some embodiments, the constant domain of mouse TCR beta has the sequence of SEQ ID NO: 1268. In some embodiments, the constant domain of TCR delta has the sequence of SEQ ID NO: 725. In some embodiments, the constant domain of TCR delta has an IgC domain having the sequence of SEQ ID NO: 726, a transmembrane domain having the sequence of SEQ ID NO: 727, and an intracellular domain having the sequence of L. In some embodiments, the constant domain of TCR gamma has the sequence of SEQ ID NO: 721.In some embodiments, the constant domain of TCRγ has an IgC domain having the sequence of SEQ ID NO: 722, a transmembrane domain having the sequence of SEQ ID NO: 723, and an intracellular domain having the sequence of SEQ ID NO: 724. In some embodiments, CD3ε has the sequence of SEQ ID NO: 694. In some embodiments, CD3ε has an extracellular domain having the sequence of SEQ ID NO: 696, a transmembrane domain having the sequence of SEQ ID NO: 697, and an intracellular domain, e.g., an intracellular signaling domain, having the sequence of SEQ ID NO: 698. In some embodiments, CD3δ has the sequence of SEQ ID NO: 704. In some embodiments, CD3δ has an extracellular domain having the sequence of SEQ ID NO: 706, a transmembrane domain having the sequence of SEQ ID NO: 707, and an intracellular domain, e.g., an intracellular signaling domain, having the sequence of SEQ ID NO: 708. In some embodiments, CD3γ has the sequence of SEQ ID NO: 699. In some embodiments, CD3γ has an extracellular domain having the sequence of SEQ ID NO: 701, a transmembrane domain having the sequence of SEQ ID NO: 702, and an intracellular domain, e.g., an intracellular signaling domain, having the sequence of SEQ ID NO: 703.

[0229] The term "subject" as used herein means a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, camels, goats, rabbits, and sheep. In certain embodiments, the subject is a human. A "patient" is a subject suffering from or at risk of developing a disease, disorder, or condition, or a subject in need of the compositions and methods provided herein. In some embodiments, the subject has cancer, e.g., a cancer described herein.

[0230] As used herein, "preventing" refers to arresting a disease or condition, e.g., tumor formation, in a patient. For example, if an individual at risk of developing a tumor or other form of cancer is treated with a method of the invention and does not subsequently develop a tumor or other form of cancer, the disease has been prevented in that individual, at least for some period of time.

[0231] The term "package insert" is used to refer to instructions customarily included in commercial packages (e.g., kits) of therapeutic or diagnostic agents that contain information about the indications, uses, dosages, administration, concomitant therapies, contraindications, and / or warnings concerning the use of such therapeutic or diagnostic agent.

[0232] As used herein, the term "cytotoxic agent" refers to a substance that inhibits or prevents the function of cells and / or causes cell death or destruction. "Chemotherapeutic agent" refers to a chemical compound useful in the treatment of cancer. Chemotherapeutic agents include "antihormonal agents" or "endocrine therapy agents" that act to regulate, reduce, block, or inhibit the effects of hormones that can promote cancer growth.

[0233] The term "tumor" refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues. The terms "cancer," "cancerous," "cell proliferative disorder," "proliferative disorder," and "tumor" are not mutually exclusive as referred to herein. The terms "cell proliferative disorder" and "proliferative disorder" refer to disorders associated with some degree of abnormal cell proliferation. In some embodiments, the cell proliferative disorder is cancer. In some aspects, the tumor is a solid tumor. In some aspects, the tumor is a hematological malignancy.

[0234] The term "cancer" refers to a disease characterized by the rapid and uncontrolled growth of abnormal cells. Cancer cells can spread locally or to other parts of the body via the bloodstream and lymphatic system. Examples of various cancers are described herein and include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, carcinoma, etc.

[0235] The term "pharmaceutical composition" refers to a preparation in which the biological activity of the active ingredient contained therein is in a form such that it is effective in treating a subject, and which does not contain additional ingredients that are unacceptably toxic to the subject in the amounts provided in the pharmaceutical composition.

[0236] The terms "modulate" and "modulation" refer to decreasing or inhibiting, or activating or increasing, the recited variable. The terms "enhance" and "activate" refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater increase in the recited variable.

[0237] The terms "reduce" and "inhibit" refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater decrease in the recited variable.

[0238] The term "agonize" refers to the activation of receptor signaling to induce a biological response associated with receptor activation. An "agonist" is an entity that binds to and agonizes a receptor.

[0239] The term "antagonize" refers to the inhibition of receptor signaling to inhibit a biological response associated with receptor activation. An "antagonist" is an entity that binds to and antagonizes a receptor.

[0240] The term "effector T cells" refers to T helper (i.e., CD4 + ) cells and cytotoxicity (i.e., CD8 + ) T cells. CD4 + Effector T cells contribute to the development of several immunological processes, including the maturation of B cells into plasma cells and memory B cells, and the activation of cytotoxic T cells and macrophages.+ Effector T cells destroy virus-infected cells and tumor cells. For more information on effector T cells, see Seder and Ahmed, Nature Immunol., 2003, 4:835-842, which is incorporated by reference in its entirety.

[0241] The term "regulatory T cells" includes cells that regulate immune tolerance, for example, by suppressing effector T cells. In some embodiments, regulatory T cells are CD4 + CD25 + Foxp3 + In some embodiments, regulatory T cells have a CD8 + CD25 + For more information on CD70-expressing regulatory T cells, see Nocentini et al., Br. J. Pharmacol., 2012, 165:2089-2099, which is incorporated by reference in its entirety.

[0242] The term "dendritic cell" refers to professional antigen-presenting cells that are capable of activating naive T cells and stimulating the proliferation and differentiation of B cells. The phrase "disease associated with CD70 expression" includes, but is not limited to, diseases associated with CD70 expression or conditions associated with cells expressing CD70, including, for example, proliferative diseases such as cancer or malignant tumors or precancerous conditions. In one embodiment, the disease is cancer.

[0243] In some cases, the cancer is T-cell lymphoma, diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), Epstein-Barr virus (EBV) + Cancer or human papillomavirus (HPV) + Optionally, the cancer is kidney cancer, renal cell carcinoma, lung cancer, pancreatic cancer, ovarian cancer, esophageal cancer, nasopharyngeal cancer, mesothelioma, glioblastoma, thymic cancer, breast cancer, head and neck cancer, or gastric cancer.

[0244] In some cases, the cancer is selected from the group consisting of acute lymphocytic cancer, acute myeloid leukemia, alveolar rhabdomyosarcoma, bladder cancer (e.g., bladder carcinoma), bone cancer, brain cancer (e.g., medulloblastoma), breast cancer, anal cancer, anal canal cancer, or anorectal cancer, eye cancer, intrahepatic bile duct cancer, joint cancer, cervical cancer, gallbladder cancer, or pleural cancer, nose cancer, nasal cavity cancer, or middle ear cancer, oral cancer, vulvar cancer, chronic lymphocytic leukemia (CLL), chronic myeloid cancer, colon cancer, esophageal cancer, cervical cancer, fibrosarcoma, gastrointestinal carcinoid tumor, head and neck cancer (e.g., head and neck squamous cell carcinoma), glioblastoma, Hodgkin's lymphoma, hypopharyngeal cancer, kidney cancer, The cancer may be ovarian cancer, pancreatic cancer, peritoneal, omental, mesenteric, pharyngeal cancer, RCC, ccRCC, rectal cancer, renal cancer, skin cancer, small intestine cancer, soft tissue cancer, solid tumor, stomach cancer, testicular cancer, thyroid cancer, or ureteral cancer.

[0245] The term "conservative sequence modification" refers to an amino acid modification that does not significantly affect or alter the binding characteristics of an antibody or antibody fragment containing that amino acid sequence. Such conservative modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced into the antibodies or antibody fragments of the present invention by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. A conservative amino acid substitution is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residues within the TFPs of the invention can be replaced with other amino acid residues from the same side chain family, and the altered TFPs can be tested using the functional assays described herein.

[0246] The term "stimulation" refers to a primary response induced by the binding of a stimulatory domain or molecule (e.g., a TCR / CD3 complex) to its cognate ligand, thereby mediating a signal transduction event, such as, but not limited to, signal transduction through the TCR / CD3 complex. Stimulation can mediate, for example, altered expression of certain molecules and / or rearrangements of cytoskeletal structure.

[0247] The term "stimulatory molecule" or "stimulatory domain" refers to a molecule or portion thereof expressed by a T cell that provides primary cytoplasmic signaling sequence(s) that upregulates at least some aspect of the T cell's signaling pathway, stimulating primary activation of the TCR complex. In one embodiment, the primary signal is initiated, for example, by binding of the TCR / CD3 complex to a peptide-loaded MHC molecule, which leads to mediation of a T cell response, including, but not limited to, proliferation, activation, differentiation, etc. The stimulatory primary cytoplasmic signaling sequence (also referred to as a "primary signaling domain") may contain a signaling motif known as an immunoreceptor tyrosine-based activation motif, or "ITAM." Examples of ITAMs containing primary cytoplasmic signaling sequences of particular use in the present invention include, but are not limited to, those derived from TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD278 (also known as "ICOS"), and CD66d.

[0248] The term "antigen-presenting cell" or "APC" refers to immune system cells such as accessory cells (e.g., B cells, dendritic cells, etc.) that present foreign antigens complexed with major histocompatibility complexes (MHC) on their surface. T cells recognize these complexes using their T cell receptors (TCRs). APCs process antigens and present them to T cells.

[0249] As used herein, the term "intracellular signaling domain" refers to the intracellular portion of a molecule. The intracellular signaling domain generates a signal that promotes immune effector function in a TFP-containing cell, e.g., a TFP-expressing T cell. For example, examples of immune effector function in TFP-expressing T cells include T helper cell activity, including cytolytic activity and cytokine secretion. In embodiments, the intracellular signaling domain can comprise a primary intracellular signaling domain. Exemplary primary intracellular signaling domains include those derived from molecules involved in primary stimulation or antigen-dependent stimulation. In embodiments, the intracellular signaling domain can comprise a costimulatory intracellular domain. Exemplary costimulatory intracellular signaling domains include those derived from molecules involved in costimulatory signals or antigen-independent stimulation.

[0250] The primary intracellular signaling domain can comprise an ITAM ("immunoreceptor tyrosine-based activation motif"). Examples of primary cytoplasmic signaling sequences containing ITAMs include, but are not limited to, those derived from CD3zeta, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD66d, DAP10, and DAP12.

[0251] The term "costimulatory molecule" refers to a cognate binding partner on a T cell that specifically binds to a costimulatory ligand and thereby mediates a costimulatory response by the T cell, such as, but not limited to, proliferation. Costimulatory molecules are cell surface molecules other than antigen receptors or their ligands that are required for an efficient immune response. Costimulatory molecules include, but are not limited to, MHC class 1 molecules, BTLA and Toll ligand receptors, as well as DAP10, DAP12, CD30, LIGHT, OX40, CD2, CD27, CD28, CDS, ICAM-1, LFA-1 (CD11a / CD18), and 4-1BB (CD137). A costimulatory intracellular signaling domain may be the intracellular portion of a costimulatory molecule. Costimulatory molecules can be represented by the following protein families: TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocyte activation molecules (SLAM proteins), and activating NK cell receptors. Examples of such molecules include ligands that specifically bind to CD27, CD28, 4-1BB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, lymphocyte function-associated antigen 1 (LFA-1), CD2, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, B7-H3, and CD83. The intracellular signaling domain can comprise the entire intracellular portion or entire native intracellular signaling domain of the molecule from which it is derived, or a functional fragment thereof. The term "4-1BB" refers to a member of the TNFR superfamily of amino acid sequences given as GenBank Accession No. AAA62478.2, or equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape, etc., and the "4-1BB costimulatory domain" is defined as amino acid residues 214-255 of GenBank Accession No. AAA62478.2, or equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape, etc.

[0252] The term "encoding" refers to the inherent property of a particular sequence of nucleotides within a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in biological processes having either a defined nucleotide sequence (e.g., rRNA, tRNA, and mRNA) or a defined amino acid sequence and the biological properties resulting therefrom. Thus, a gene, cDNA, or RNA encodes a protein when transcription and translation of the mRNA corresponding to that gene produces that protein in a cell or other biological system. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and is usually shown in a sequence listing, and the non-coding strand, which is used as a template for transcription of the gene or cDNA, can be considered to encode the protein or other product of that gene or cDNA.

[0253] Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. A reference to a nucleotide sequence encoding a protein or RNA may also include introns, to the extent that the nucleotide sequence encoding the protein may, in some versions, contain one or more introns.

[0254] The term "endogenous" refers to any material that is derived from or produced within an organism, cell, tissue, or system. The term "exogenous" refers to any material introduced from or produced outside an organism, cell, tissue, or system.

[0255] The term "expression" refers to the transcription and / or translation of a particular nucleotide sequence driven by a promoter. The term "functional disruption" refers to a physical or biochemical change to a particular (e.g., target) nucleic acid (e.g., a gene, an RNA transcript of a protein encoded thereby) that prevents its normal expression and / or action in a cell. In one embodiment, functional disruption refers to a genetic modification by gene editing. In one embodiment, functional disruption prevents expression of a target gene (e.g., an endogenous gene).

[0256] The term "transfer vector" refers to a composition that contains an isolated nucleic acid and can be used to deliver the isolated nucleic acid to the interior of a cell. Many vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "transfer vector" includes self-replicating plasmids or viruses. The term is also intended to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as polylysine compounds, liposomes, etc. Examples of viral transfer vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, etc.

[0257] The term "expression vector" refers to a vector containing a recombinant polynucleotide comprising expression control sequences operably linked to a nucleotide sequence to be expressed. An expression vector contains sufficient cis elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.

[0258] The term "lentivirus" refers to a genus in the Retroviridae family. Lentiviruses are unique among retroviruses in their ability to infect non-dividing cells. Lentiviruses are one of the most efficient gene delivery vectors because they can deliver large amounts of genetic information into the DNA of host cells. HIV, SIV, and FIV are all examples of lentiviruses.

[0259] The term "lentiviral vector" particularly refers to a vector derived from at least a portion of a lentiviral genome, including, for example, the self-inactivating lentiviral vector described in Milone et al., Mol. Ther. 17(8):1453-1464 (2009). Other examples of lentiviral vectors that may be used clinically include, but are not limited to, Oxford BioMedica's LENTIVECTOR™ gene delivery technology, Lentigen Technology's LENTIMAX™ vector system, and the like. Non-clinical lentiviral vectors are also available and known to those skilled in the art.

[0260] The term "circular RNA" or "circRNA" refers to a class of single-stranded RNAs with a continuous structure that lacks terminal motifs necessary for enhanced stability and interaction with various cellular proteins. CircRNAs are 3-5' covalently closed RNA circles, and circRNAs exhibit neither caps nor poly(A) tails. Because circRNAs lack the free ends required for exonuclease-mediated degradation, they are resistant to several mechanisms of RNA turnover and have an extended lifespan compared to their linear mRNA counterparts. Therefore, circularization can stabilize mRNAs, which generally have short half-lives, potentially improving their overall efficacy in various applications. CircRNAs are generated by the process of splicing, and circularization occurs primarily using conventional splice sites at annotated exon boundaries (Starke et al., 2015; Szabo et al., 2015). For circularization, splice sites are used in reverse. The downstream splice donor is “backspliced” to the upstream splice acceptor (for reviews, see Jeck and Sharpless, 2014 ; Barrett and Salzman, 2016 ; Szabo and Salzman, 2016 ; Holdt et al., 2018 ).

[0261] Three general methods for RNA circularization have been reported: chemical methods using cyanogen bromide or similar condensing agents, enzymatic methods using RNA or DNA ligases, and ribozyme methods using self-splicing introns. In a preferred embodiment, precursor RNA is synthesized by run-off transcription and then heated in the presence of magnesium ions and GTP to promote circularization. RNA generated in this manner can efficiently transfect various cell types. In one embodiment, the template contains sequences of TFP, CAR, and TCR, or a combination thereof.

[0262] In some exemplary embodiments, a ribozyme method is used that utilizes a permuted Group I catalytic intron. This method is more suitable for circularizing long RNAs and requires GTP and Mg as cofactors. 2+ This permuted intron-exon (PIE) splicing method consists of a fused partial exon flanked by half-intron sequences. In vitro, these constructs undergo the double transesterification reaction characteristic of Group I catalytic introns, but because the exon is fused, it is excised as a circle with a covalent 5'-3' linkage.

[0263] The term "homologous" or "identity" refers to the identity of subunit sequences between two polymer molecules, e.g., between two nucleic acid molecules such as two DNA molecules or two RNA molecules, or between two polypeptide molecules. Two molecules are homologous or identical at a position if both subunit portions are occupied by the same monomer subunit, e.g., if each position in two DNA molecules is occupied by adenine, they are homologous or identical at that position. The homology between two sequences is a linear function of the number of matching or homologous positions; for example, if half of the positions in two sequences (e.g., 5 positions in a polymer 10 subunits in length) are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 out of 10) are matched or homologous, the two sequences are 90% homologous.

[0264] The term "isolated" means altered or removed from the natural state. For example, a nucleic acid or peptide that is naturally present in a living animal is not "isolated," but the same nucleic acid or peptide that has been partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated nucleic acid or protein can exist in substantially purified form, or it can exist in a non-native environment, such as, for example, a host cell.

[0265] Within the present invention, the following abbreviations for commonly occurring nucleobases are used: "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

[0266] The term "operably linked" or "transcriptional control" refers to a functional linkage between a regulatory sequence and a heterologous nucleic acid sequence, resulting in expression of the latter. For example, a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed into a functional relationship with the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if it affects the transcription or expression of the coding sequence. Operably linked DNA sequences can be contiguous with each other and, for example, in the same reading frame, as necessary to link two protein coding regions.

[0267] The term "parenteral" administration of an immunogenic composition includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im), or intrasternal injection, intratumoral, or infusion techniques.

[0268] The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence implicitly encompasses not only the sequence explicitly indicated, but also conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences. In particular, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).

[0269] The terms "peptide," "polypeptide," and "protein" are used interchangeably and refer to a compound consisting of a sequence of amino acids covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can comprise a protein or peptide sequence. Polypeptide includes any peptide or protein containing two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, commonly referred to in the art as peptides, oligopeptides, and oligomers, and to longer chains, which are commonly referred to in the art as proteins and come in many forms. "Polypeptide" includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, and the like. Polypeptides include natural peptides, recombinant peptides, or combinations thereof.

[0270] The term "promoter" refers to a DNA sequence recognized by the transcriptional machinery of a cell or introduced synthetic machinery capable of initiating the specific transcription of a polynucleotide sequence. The term "promoter / regulatory sequence" refers to a nucleic acid sequence that can be used to express a gene product operably linked to the promoter / regulatory sequence. In some instances, this sequence may be a core promoter sequence, and in other instances, this sequence may also include an enhancer sequence and other regulatory elements required for expression of the gene product. The promoter / regulatory sequence may, for example, be one that expresses the gene product in a tissue-specific manner.

[0271] The term "constitutive" promoter refers to a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes the production of that gene product in a cell under almost all physiological conditions of the cell.

[0272] The term "inducible" promoter refers to a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be produced in a cell substantially only when an inducer corresponding to the promoter is present in that cell.

[0273] The term "tissue-specific" promoter refers to a nucleotide sequence that, when operably linked to a polynucleotide encoded or specified by a gene, causes a gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.

[0274] The terms "linker" and "flexible polypeptide linker" as used in the context of scFvs refer to a peptide linker consisting of amino acids such as glycine and / or serine residues, used alone or in combination to link the variable heavy and variable light chain regions. In one embodiment, the flexible polypeptide linker is a Gly / Ser linker, having the amino acid sequence (Gly-Gly-Gly-Ser).n where n is a positive integer equal to or greater than 1. For example, n=1, n=2, n=3, n=4, n=5, n=6, n=7, n=8, n=9, and n=10. In one embodiment, the flexible polypeptide linker includes, but is not limited to, (Gly4Ser)4 or (Gly4Ser)3. In another embodiment, the linker includes multiple repeats of (Gly2Ser), (GlySer), or (Gly3Ser). Also included within the scope of the present invention are linkers described in WO2012 / 138475 (incorporated herein by reference). In some examples, the linker sequence is (G4S) n In some examples, the linker sequence comprises (G4S) n In this case, n=1 to 3.

[0275] As used herein, a 5' cap (also referred to as an RNA cap, RNA 7-methylguanosine cap, or RNA m7G cap) is a modified guanine nucleotide added to the "front" or 5' end of eukaryotic messenger RNA immediately after transcription initiation. The 5' cap consists of a terminal group attached to the first transcribed nucleotide. Its presence is essential for ribosome recognition and protection from RNases. Cap addition is coupled to transcription, occurring cotranscriptionally so that each affects the other. Immediately after transcription initiation, the 5' end of the synthesized mRNA is bound by a cap-synthesizing complex associated with RNA polymerase. This enzyme complex catalyzes the chemical reactions required for mRNA capping. Synthesis proceeds as a multistep biochemical reaction. The capping moiety can be modified to modulate mRNA function, such as its stability or translation efficiency.

[0276] As used herein, "in vitro transcribed RNA" refers to RNA, preferably mRNA, synthesized in vitro. Generally, the in vitro transcribed RNA is produced from an in vitro transcription vector. The in vitro transcription vector contains a template used to produce the in vitro transcribed RNA.

[0277] As used herein, "poly(A)" refers to a series of adenosines added to mRNA by polyadenylation. In preferred embodiments of constructs for transient expression, the poly(A) is 50-5000, preferably greater than 64, more preferably greater than 100, and most preferably greater than 300 or 400. The poly(A) sequence can be chemically or enzymatically modified to regulate mRNA function, such as localization, stability, or translation efficiency.

[0278] As used herein, "polyadenylation" refers to the covalent attachment of a polyadenylyl moiety or its modified variants to a messenger RNA molecule. In eukaryotes, most messenger RNA (mRNA) molecules are polyadenylated at the 3' end. The 3' poly(A) tail is a long sequence of adenine nucleotides (often several hundred) added to pre-mRNA through the action of the enzyme polyadenylate polymerase. In higher eukaryotes, the poly(A) tail is added to transcripts that contain a specific sequence, i.e., a polyadenylation signal. The poly(A) tail and its associated proteins help protect mRNA from exonuclease degradation. Polyadenylation is also important for transcription termination, mRNA removal from the nucleus, and transcription. Polyadenylation occurs in the nucleus immediately after transcription of DNA into RNA, but can also occur later in the cytoplasm. After transcription is terminated, the mRNA strand is cleaved through the action of an endonuclease complex associated with RNA polymerase. The cleavage site is usually characterized by the presence of the base sequence AAUAAA (SEQ ID NO: 689) near the cleavage site. After the mRNA is cleaved, an adenosine residue is added to the free 3' end of the cleavage site.

[0279] As used herein, "transient" refers to expression of an unfused transgene for hours, days, or weeks, where the period of expression is shorter than that for expression when the gene is fused to the genome or contained within a stable plasmid replicon in the host cell.

[0280] The term "signal transduction pathway" refers to the biochemical relationships between various signaling molecules involved in transmitting a signal from one part of a cell to another part of the cell. The expression "cell surface receptor" includes molecules and complexes of molecules that are capable of receiving a signal and transmitting the signal across the cell membrane.

[0281] The term "substantially purified" cells refers to cells that are essentially free of other cell types. Substantially purified cells also refer to cells that have been separated from other cell types with which they are normally associated in their naturally occurring state. In some instances, a population of substantially purified cells refers to a homogenous population of cells. In other instances, the term simply refers to cells that have been separated from the cells with which they are naturally associated in their native state. In some embodiments, the cells are cultured in vitro. In other embodiments, the cells are not cultured in vitro.

[0282] As used herein, the term "therapeutic" means treatment. A therapeutic effect is achieved by the reduction, suppression, amelioration, or eradication of a disease state.

[0283] As used herein, the term "prophylaxis" means prevention or protective treatment against a disease or condition. Within the context of the present invention, "tumor antigen" or "hyperproliferative disease antigen" or "antigen associated with a hyperproliferative disease" refers to an antigen common to a particular hyperproliferative disease. In certain embodiments, the hyperproliferative disease antigen of the present invention is derived from cancers including, but not limited to, primary or metastatic melanoma, thymoma, lymphoma, sarcoma, mesothelioma, renal cell carcinoma, stomach cancer, breast cancer, lung cancer, gastric cancer, ovarian cancer, NHL, leukemia, uterine cancer, prostate cancer, colon cancer, cervical cancer, bladder cancer, kidney cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, brain cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, endometrial cancer, and stomach cancer.

[0284] In some examples, the disease is acute lymphocytic cancer, acute myeloid leukemia, alveolar rhabdomyosarcoma, bladder cancer (e.g., bladder carcinoma), bone cancer, brain cancer (e.g., medulloblastoma), breast cancer, anal cancer, anal canal cancer, or anorectal cancer, eye cancer, intrahepatic bile duct cancer, joint cancer, cervical cancer, gallbladder cancer, or pleural cancer, nasal cancer, nasal cavity cancer, or middle ear cancer, oral cancer, vulvar cancer, chronic lymphocytic leukemia (CLL), chronic myeloid cancer, colon cancer, esophageal cancer, cervical cancer, fibrosarcoma, gastrointestinal carcinoid tumor, head and neck cancer (e.g., head and neck squamous cell carcinoma), glioblastoma, Hodgkin's lymphoma, hypopharyngeal cancer, kidney cancer, The cancer is selected from the group consisting of: thyroid cancer, ...

[0285] In some cases, the disease is T-cell lymphoma, diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), Epstein-Barr virus (EBV) + Cancer or human papillomavirus (HPV) + In some cases, the cancer is selected from the group consisting of kidney cancer, renal cell carcinoma, lung cancer, pancreatic cancer, ovarian cancer, esophageal cancer, nasopharyngeal carcinoma, mesothelioma, glioblastoma, thymic carcinoma, breast cancer, head and neck cancer, or gastric cancer.

[0286] The terms "transfected" or "transformed" or "transduced" refer to the process by which exogenous nucleic acid is transferred or introduced into a host cell. A "transfected" or "transformed" or "transduced" cell is one that has been transfected, transformed, or transduced with exogenous nucleic acid. Such cells include the primary subject cell and its progeny.

[0287] The term "specifically binds" refers to an antibody, antibody fragment, or specific ligand that recognizes and binds to its cognate binding partner (e.g., CD70) contained in a sample, but does not necessarily recognize or bind to substantially other molecules in the sample.

[0288] Ranges: Throughout this disclosure, various aspects of the present disclosure may be presented in a range format. Descriptions in range format should be understood to be merely for convenience and shorthand, and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, descriptions of ranges should be construed as including not only individual numerical values ​​within that range, but also all possible subranges specifically disclosed. For example, recitation of a range such as 1 to 6 should be construed as including specifically disclosed subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numbers within that range, e.g., 1, 2, 2.7, 3, 4, 5, 5.3, and 6. As another example, a range such as 95-99% identity includes 95%, 96%, 97%, 98%, or 99% identity, and includes sub-ranges such as 96-99%, 96-98%, 96-97%, 97-99%, 97-98%, and 98-99% identity, regardless of the breadth of the range.

[0289] "Programmed cell death protein 1," also known as PD-1, CD279 (cluster of differentiation 279), PDCD1, PD1, SLEB2, hPD-1, hSLE1, and programmed cell death 1, refers to a protein on the surface of cells that regulates the immune system's response to the body's own cells by downregulating the immune system and promoting self-tolerance by suppressing T cell inflammatory activity. This prevents autoimmune diseases, but it can also prevent the immune system from killing cancer cells. PD-1 is an immune checkpoint that prevents autoimmunity through two mechanisms: first, it promotes apoptosis (programmed cell death) of antigen-specific T cells in lymph nodes; and second, it reduces apoptosis of regulatory T cells (anti-inflammatory, suppressor T cells). PD-1 is a cell surface receptor belonging to the immunoglobulin superfamily and is expressed on T cells and pro-B cells. PD-1 binds to two ligands, PD-L1 and PD-L2. As used herein, PD-1 includes any recombinant or naturally occurring form of PD-1 or a variant or homolog thereof that has or maintains PD-1 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity). In some embodiments, the variant or homolog has at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 contiguous amino acid portion) compared to naturally occurring PD-1. In some embodiments, the PD-1 is substantially identical to the protein identified by UniProt reference number Q15116, or a variant or homolog having substantial identity thereto. The human and mouse amino acid and nucleic acid sequences of PD-1 can be found in public databases such as GenBank, UniProt, Swiss-Prot, etc. For example, the mouse and human PD-1 sequences correspond to UniProt accession numbers Q02242 and Q15116, respectively, and have the following sequences: Human PD-1 (UniProt accession number Q15116) MQIPQAPWPVVWAVLQLGWRPGWFLDSPDRPWNPPTFSPALLVVTEGDNATFTCSFSNTSESFVLNWYRMSPSNQTDKLAAFPEDRSQPGQDCRFRVTQLPNGRDFHMSVVRARRNDSGTYLCGAISLAPKAQIKESLRAELRVTERRAEVPTAHPSPSPRPAGQFQTLVVGVVGGLLGSLVLLVWVLAVICSRAARGTIGARRTGQPLKEDPSAVPVFSVDYGELDFQWREKTPEPPVPCVPEQTEYATIVFPSGMGTSSPARRGSADGPRSAQPLRPEDGHCSWPL (SEQ ID NO: 1228).

[0290] Mouse PD-1 (UniProt accession number Q02242) MWVRQVPWSFTWAVLQLSWQSGWLLEVPNGPWRSLTFYPAWLTVSEGANATFTCSLSNWSEDLMLNWNRLSPSNQTEKQAAFCNGLSQPVQDARFQIIQLPNRHDFHMNILDTRRNDSGIYLCGAISLHPKAKIEESPGAELVVTERILETSTRYPSPSPKPEGRFQGMVIGIMSALVGIPVLLLLAWALAVFCSTSMSEARGAGSKDDTLKEEPSAAPVPSVAYEELDFQGREKTPELPTACVHTEYATIVFTEGLGASAMGRRGSADGLQGPRPPRHEDGHCSWPL (SEQ ID NO: 1229) "Programmed death-ligand 1 (PD-L1)," also known as cluster of differentiation 274, CD274, B7 homolog 1, B7-H, B7-H1, B7H1, PDCD1L1, PDCD1LG1, PDL1, hPD-L1, and CD274 molecules, refers to a 40 kDa type 1 transmembrane protein. In some embodiments, PD-L1 may play a key role in suppressing the adaptive arm of the immune system during certain events, such as pregnancy, tissue allografts, autoimmune diseases, and other pathologies, such as hepatitis. Normally, the adaptive immune system responds to antigens associated with immune system activation by exogenous or endogenous danger signals. Antigen-specific CD8+ T cells and / or CD4 + Clonal expansion of helper cells is propagated. Binding of PD-L1 to the inhibitory checkpoint molecule PD-1 transmits an inhibitory signal based on its interaction with phosphatases (SHP-1 or SHP-2) via an immunoreceptor tyrosine-dependent switch motif (ITSM) motif. This reduces the proliferation of antigen-specific T cells in lymph nodes, while simultaneously reducing the apoptosis of regulatory T cells (anti-inflammatory, suppressor T cells), further mediated by downregulation of the gene Bcl-2. As used herein, PD-L1 includes recombinant or naturally occurring forms of PD-L1 or any of its variants or homologs that have or maintain PD-L1 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity). In some aspects, the variant or homologue shares at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 contiguous amino acid portion) compared to naturally occurring PD-L1. In some embodiments, the PD-L1 is substantially identical to the protein identified by UniProt reference number Q9NZQ7, or a variant or homologue sharing substantial identity thereto.

[0291] Within the present invention, the terms "PD-1 ligand," "PD-L1," and "PD-L2" refer to proteins to which PD-1 has binding affinity. In some embodiments, the PD-1 protein, or a binding fragment thereof (e.g., the extracellular domain of the PD-1 protein), is characterized by its ability to bind to the natural ligands of human PD-1, i.e., human PD-L1 (also known as CD274, UniProt Accession No. Q9NZQ7) and / or human PD-L2 (also known as CD273, UniProt Accession No. Q9BQ51), with the same (i.e., equal), higher, or lower (i.e., decreased) affinity compared to the native PD-1 protein.

[0292] As used herein, the term "fusion protein" refers to a protein composed of polypeptide portions derived from different sources. It may therefore also be understood as a chimeric protein. Among the PD-1 fusion proteins described herein, the term "fusion protein" is used synonymously with the term "switch receptor." Fusion proteins are typically proteins created by joining two or more genes (or preferably cDNAs) that originally encode separate proteins. Translation of this fusion gene (or fusion cDNA) preferably results in a single polypeptide possessing functional properties derived from each of the original proteins. Recombinant fusion proteins are artificially created by recombinant DNA technology for use in biological research or therapy. Further details regarding the production of the fusion proteins of the present invention are described herein.

[0293] As used herein, the terms "PD-1 fusion protein," "PD-1 switch receptor," or "PD-1 switch molecule" refer to a PD-1 fusion protein described herein that receives an inhibitory signal by binding to PD-L1 or PD-L2 and converts (i.e., "switches") that signal into an activating signal via the costimulatory domain of the fusion protein.

[0294] As used herein, the term "IL-15," also known as interleukin-15 and IL15, refers to a pleiotropic cytokine that plays an important role in the maintenance and homeostatic proliferation of various immune cells. In some embodiments, IL-15 plays an important role in the development of the NK lineage and the survival, proliferation, and function of NK cells. In some embodiments, IL-15 contributes to enhanced anti-tumor immunity. In some embodiments, IL-15 is involved in lymphocyte homeostasis. In some embodiments, IL-15 plays multiple roles in peripheral innate and adaptive immune cell function. In some embodiments, IL-15 plays an important role in inducing central memory T cell subsets and enhancing cytolytic effectors upon trans-presentation by antigen-presenting cells. In some embodiments, IL-15 supports T cell survival by reducing activation-induced cell death (AICD). In some embodiments, human IL-15 precursor protein has two known isoforms based on the length of its signal peptide: for example, IL-15 (also referred to as IL-15-S48AA or IL-15LSP for "long signal peptide") has a 48-amino acid signal peptide and propeptide, whereas IL-15-S21AA or IL-15SSP (for "short signal peptide"), which are expressed from alternatively spliced ​​mRNA, have a 21-amino acid signal peptide and propeptide. In some embodiments, IL-15SSP is not secreted but is stored intracellularly in the cytoplasm. As used herein, IL-15 includes recombinant or naturally occurring forms of IL-15 or any of its variants or homologs that have or maintain IL-15 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity).In some aspects, the variant or homolog has at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 contiguous amino acid portion) compared to naturally occurring IL-15. In some embodiments, the IL-15 is substantially identical to the protein identified by UniProt reference number P40933, or a variant or homolog having substantial identity thereto.

[0295] In some embodiments, the IL-15 signal peptide comprises amino acids 1-29 of the IL-15 protein sequence. In some embodiments, the IL-15 signal peptide comprises the sequence of SEQ ID NO: 1246. In some embodiments, the IL-15 comprises amino acids 30-162 of the IL-15 protein sequence. In some embodiments, the IL-15 comprises any one of the sequences set forth in Table 11, or a fragment thereof. In some embodiments, the IL-15 comprises the sequence of SEQ ID NO: 1242.

[0296] The term "interleukin-15 receptor" or "IL-15R" refers to a type I cytokine receptor to which IL-15 binds and signals. In some embodiments, IL-15R is composed of three subunits: the IL-15 receptor alpha chain ("IL-15Rα" or CD215), the IL-2 receptor beta chain ("IL-2Rβ" or CD122), and the IL-2 receptor gamma / common gamma chain ("IL-2Rγ / γc" or CD132). For example, in some embodiments, the human IL-15Rα precursor protein has a 30-amino acid signal peptide, a 175-amino acid extracellular domain, a 23-amino acid single transmembrane stretch, and a 39-amino acid cytoplasmic (or intracellular) domain, containing N-linked and O-linked glycosylation sites. In some embodiments, IL-15Rα contains a Sushi domain (amino acids 31-95) that is essential for IL-15 binding. In some embodiments, IL-15Rα exists as a soluble form (sIL-15Rα). In some embodiments, sIL-15Rα is constitutively generated from the transmembrane receptor through a defined proteolytic cleavage, a process that can be enhanced by certain chemicals, such as PMA. In some embodiments, human sIL-15Rα, which is approximately 42 kDa in size, may extend the half-life of IL-15 or promote IL-15 binding and IL-15 signaling through the IL-2Rβ / γc heterodimer. Although IL-15R shares a subunit with IL-2R that contains a cytoplasmic motif required for signaling, in some embodiments, IL-15 signaling has distinct biological effects in vivo, apart from many overlapping biological activities with IL-2 signaling, due to the unique IL-15Rα subunit, the availability and concentration of IL-15, and the kinetics and affinity of IL-15-IL-15Rα binding. In some embodiments, IL-15 specifically binds to IL-15Rα with high affinity and then associates with a complex composed of IL-2Rβ and IL-2Rγ / γc subunits expressed on the same cell ("cis-presentation") or on different cells ("trans-presentation").In some embodiments, the interaction between IL-15 and IL-15Rα is independent of the complex composed of IL-2Rβ and IL-2Rγ / γc subunits. In some embodiments, binding of IL-15 to the IL-2Rβ / γc heterodimeric receptor induces JAK1 activation, which phosphorylates STAT3 via the β chain, and JAK3 activation, which phosphorylates STAT5 via the γ chain. In some embodiments, the IL-15 / IL-15R interaction is mediated by memory CD8. + In some embodiments, the IL-15 / IL-15R interaction also regulates the development, maintenance, proliferation and activity of NK cells.

[0297] As used herein, "IL-15Rα," also known as CD215, IL-15 receptor subunit alpha, IL-15R-α, IL-15RA, and interleukin-15 receptor subunit alpha, includes recombinant or naturally occurring forms of IL-15Rα or any variant or homolog thereof that has or maintains IL-15Rα activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity). In some aspects, the variant or homolog has at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 contiguous amino acid portion) compared to naturally occurring IL-15Rα. In some embodiments, the IL-15Rα is substantially identical to the protein identified by UniProt reference number Q13261, or a variant or homolog having substantial identity thereto.

[0298] As used herein, "IL-2Rβ," also known as CD122, IL-2 receptor subunit β, IL-2R subunit β, IL-2RB, P70-75, IMD63, and interleukin-2 receptor subunit β, includes recombinant or naturally occurring forms of IL-2Rβ or any variant or homolog thereof that has or maintains IL-2Rβ activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity). In some aspects, the variant or homolog has at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 contiguous amino acid portion) compared to naturally occurring IL-2Rβ. In some embodiments, the IL-2Rβ is substantially identical to the protein identified by UniProt reference number P14784, or a variant or homolog having substantial identity thereto.

[0299] As used herein, "IL-2 receptor gamma / common gamma chain," also known as IL-2Rγ / γc, IL2RG, CIDX, IL-2RG, IMD4, P64, SCIDX, SCIDX1, interleukin-2 receptor subunit gamma, or CD132, includes recombinant or naturally occurring forms of IL-2Rγ / γc or any variant or homolog thereof that has or maintains IL-2Rγ / γc activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity). In some aspects, the variant or homolog has at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 contiguous amino acid portion) compared to naturally occurring IL-2Rγ / γc. In some embodiments, the IL-2Rγ / γc is substantially identical to the protein identified by UniProt reference number P31785, or a variant or homolog having substantial identity thereto.

[0300] In some embodiments, the cytoplasmic (or intracellular) domain of IL-15Rα comprises amino acids 229-267 of the IL-15Rα protein. In some embodiments, the cytoplasmic (or intracellular) domain of IL-15Rα comprises the sequence of SEQ ID NO: 1248. In some embodiments, the Sushi domain of IL-15Rα comprises amino acids 31-95 of the IL-15Rα protein. In some embodiments, the Sushi domain of IL-15Rα comprises the sequence of SEQ ID NO: 1250. In some embodiments, IL-15Rα comprises the transmembrane domain and the cytoplasmic (intracellular) domain of the IL-15Rα protein. In some embodiments, IL-15Rα comprises amino acids 96-267 of the IL-15Rα protein. In some embodiments, IL-15Rα comprises the sequence of SEQ ID NO: 1251. In some embodiments, sIL-15Rα comprises amino acids 21-205 of the IL-15Rα protein. In some embodiments, sIL-15Rα comprises the sequence of SEQ ID NO:1249.

[0301] CD70 binding domain CD70 is a trimeric type II transmembrane protein of the tumor necrosis factor (TNF) ligand superfamily. CD70 can regulate the activation, proliferation, and differentiation of T cells and B cells and play a role in maintaining the body's immune response. CD70 binds to its ligand, CD27, a member of the TNF receptor superfamily (TNFRSF), and subsequently induces T cell costimulation and B cell activation. Upon binding to CD27, CD70 induces intracellular signaling and CD27 cleavage.

[0302] CD70 is expressed on highly activated T and B cells, thymic epithelial cells, and some dendritic cells. Costimulation of immune cells through CD27 ligation, which activates the costimulatory CD27 / CD70 pathway, can promote proliferation or apoptosis. CD70 is involved in the pathogenesis of cancer. For example, CD70 can increase the frequency and activation of regulatory T cells (e.g., Tregs) in the tumor microenvironment. In some hematologic malignancies (e.g., AML and MCL), CD70 is co-overexpressed with CD27, which can trigger self-signaling and provide survival / proliferation signals. Soluble CD27 is elevated in many AML patients and may be associated with poor prognosis. Cleaved CD27 remains bound to CD70. CD70 expression may correlate with cancer "stemness" in AML and may worsen patient outcomes.

[0303] Under physiological conditions, CD70 expression is limited to transient expression on highly activated T and B cells, thymic epithelial cells, and some dendritic cells, but is upregulated in AML, DLBCL, RCC, MPM, and many other cancer types. For example, CD70 is highly expressed in 38%-68% of cases of clear cell renal carcinoma, 30%-60% of cases of papillary cell renal carcinoma, and in primary tumors where CD70 is expressed. High CD70 expression can also be found in metastases. The elevated expression levels of CD70 on various cancer cell types make it a promising target for tumor and blood immunotherapy. Targeting CD70 can be used to treat patients with CD70-expressing cancers.

[0304] T cell receptor (TCR) fusion protein (TFP) The present disclosure encompasses recombinant nucleic acid constructs encoding TFPs and variants thereof, wherein the TFP comprises a binding domain, e.g., an antigen-binding domain, e.g., an antibody or antibody fragment, ligand, or ligand-binding protein, that specifically binds to CD70, e.g., human CD70, wherein the sequence of the binding domain is adjacent to and in the same reading frame as a nucleic acid sequence encoding a TCR subunit or portion thereof. The TFPs provided herein are capable of associating with one or more endogenous (or alternatively, one or more exogenous, or a combination of endogenous and exogenous) TCR subunits to form a functional TCR complex. The TFPs that specifically bind to CD70 described herein may be referred to as anti-CD70 TFPs or CD70.TFPs.

[0305] The present disclosure also encompasses binding domains that are not components of anti-CD70 TFP, e.g., anti-CD70 antibodies or fragments thereof described herein. In some embodiments, the binding domain consists solely of an anti-CD70 antibody described herein and is not fused to another polypeptide. In some embodiments, an anti-CD70 antibody or fragment thereof described herein is a component of a fusion protein other than TFP, e.g., a CAR or other fusion protein.

[0306] The binding domains provided herein can be antigen-binding domains. The antigen-binding domains can be anti-CD70 binding domains. The binding domains provided herein can be any domain that binds to CD70, including, but not limited to, monoclonal antibodies, polyclonal antibodies, recombinant antibodies, human antibodies, humanized antibodies, and functional fragments thereof, and can be single-domain antibodies, e.g., heavy chain variable domains (V H ), light chain variable domain (V L ), and the variable domain of camelid-derived nanobody (V HH), as well as alternative scaffolds that function as antigen-binding domains, such as, but not limited to, recombinant fibronectin domains, anticalins, DARPINs, etc. Similarly, natural or synthetic ligands that specifically recognize and bind to CD70 can be used as antigen-binding domains for the TFP. In some instances, the antigen-binding domain can be derived from the same species as the TFP in which it is used. For example, for human use, the antigen-binding domain of the TFP can comprise human or humanized residues relative to the antigen-binding domain of an antibody or antibody fragment.

[0307] In one embodiment, the antigen-binding domain is a fragment, such as a single chain variable fragment (scFv). HH In one embodiment, the antigen-binding domain is an Fv, Fab, (Fab')2, or a bifunctional (e.g., bispecific) hybrid antibody. In one embodiment, the antibodies and fragments thereof disclosed herein bind to wild-type or affinity-improved CD70 protein.

[0308] A humanized antibody or antibody fragment may retain the same antigen specificity as the original antibody, e.g., in the present disclosure, the ability to bind to human CD70. In some embodiments, the humanized antibody or antibody fragment may have improved affinity and / or specificity of binding to CD70.

[0309] In one embodiment, the antigen-binding domain comprises a humanized or human antibody or antibody fragment, or a camelid antibody or antibody fragment, or a murine antibody or antibody fragment. The antigen-binding domain of the TFP can comprise one or more (e.g., all three) of light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of a humanized or human anti-CD70 binding domain described herein, and / or one or more (e.g., all three) of heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) of a humanized or human anti-CD70 binding domain described herein, e.g., a humanized or human anti-CD70 binding domain comprising one or more, e.g., all three LC CDRs and one or more, e.g., all three HC CDRs. The antigen-binding domain of TFP may comprise one or more (e.g., all three) of heavy chain complementarity-determining region 1 (HC CDR1), heavy chain complementarity-determining region 2 (HC CDR2), and heavy chain complementarity-determining region 3 (HC CDR3) of a humanized or human anti-CD70 binding domain described herein. For example, the antigen-binding domain of TFP may comprise one of HC CDR1, HC CDR2, and HC CDR3. In another example, the antigen-binding domain of TFP may have two variable heavy chain regions, each comprising HC CDR1, HC CDR2, and HC CDR3 described herein. The antigen-binding domain of TFP may comprise a humanized or human light chain variable region described herein and / or a humanized or human heavy chain variable region described herein. The antigen-binding domain of TFP may comprise at least two of the humanized heavy chain variable regions described herein, e.g., the humanized or human heavy chain variable regions described herein. The antigen-binding domain of the TFP can be an scFv comprising a light chain and a heavy chain of the amino acid sequences provided herein. The antigen-binding domain of the TFP can be a single domain antibody, e.g., a V comprising a heavy chain variable region. HH The antigen-binding domain of the TFP (e.g., scFv or V HHThe TFP may comprise a light chain variable region comprising an amino acid sequence having at least one, two, or three modifications (e.g., substitutions) and up to 30, 20, or 10 modifications (e.g., substitutions) of the amino acid sequence of a light chain variable region provided herein, or a sequence having 95-99% identity to an amino acid sequence provided herein, and / or a heavy chain variable region comprising an amino acid sequence having at least one, two, or three modifications (e.g., substitutions) and up to 30, 20, or 10 modifications (e.g., substitutions) of the amino acid sequence of a heavy chain variable region provided herein, or a sequence having 95-99% identity to an amino acid sequence provided herein. In one embodiment, the antigen-binding domain of the TFP is an scFv, and the light chain variable region comprising the amino acid sequence described herein is linked to the heavy chain variable region comprising the amino acid sequence described herein via a linker, e.g., a linker described herein. In one embodiment, the antigen-binding domain of the TFP comprises (Gly4-Ser) n linker, where n is 1, 2, 3, 4, 5, or 6, preferably 3 or 4. The light chain variable region and heavy chain variable region of the scFv can be, for example, in any of the following orientations: light chain variable region-linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region. In some examples, the linker sequence comprises a long linker (LL) sequence. In some examples, the long linker sequence is (G4S) n In some examples, the linker sequence comprises a short linker (SL) sequence. In some examples, the short linker sequence comprises (G4S) n In this case, n=1 to 3.

[0310] In some embodiments, non-human antibodies are humanized, where certain sequences or regions of the antibody are modified to make them more similar to antibodies or fragments thereof that are naturally produced in humans, hi one embodiment, the antigen-binding domain is humanized.

[0311] Humanized antibodies can be prepared by a variety of techniques, including CDR-grafting (see, e.g., European Patent No. EP 239,400, International Publication No. WO 91 / 09967, and U.S. Patent Nos. 5,225,539, 5,530,101, and 5,585,089, each of which is incorporated herein by reference in its entirety), veneering, or resurfacing (see, e.g., European Patent Nos. EP 592,106 and EP 519,596; Padlan, 1991, Molecular Immunology, 28(4 / 5):489-498; Studnicka et al., 1994, Protein Engineering, 7(6):805-814; and Roguska et al., 1995, Protein Engineering, 7(6):805-814). al., 1994, PNAS, 91:969-973, each of which is incorporated herein by reference in its entirety), chain shuffling (see, e.g., U.S. Pat. No. 5,565,332, incorporated herein by reference in its entirety), as well as techniques described in, for example, U.S. Patent Application Publication No. US2005 / 0042664, U.S. Patent Application Publication No. US2005 / 0048617, U.S. Pat. No. 6,407,213, U.S. Pat. No. 5,766,886, International Publication No. WO9317105, Tan et al., J. Immunol., 169:1119-25 (2002), Caldas et al., Protein Eng., 13(5):353-60 (2000), Morea et al. al.,Methods,20(3):267-79(2000), Baca et al.,J.Biol.Chem.,272(16):10678-84(1997),Roguska et al.,Protein Eng.,9(10):895-904(1996),Couto et al.,Cancer Res.,55(23 Supp):5973s-5977s(1995), Couto et al., Cancer Res.,55(8):1717-22(1995), Sandhu JS,Gene,150(2):409-10(1994), and Pedersen et al. The antibodies can be produced using a variety of techniques known in the art, including, but not limited to, those disclosed in Wang et al., J. Mol. Biol., 235(3):959-73 (1994).Often, framework residues in the framework regions are substituted with the corresponding residue from the CDR donor antibody to alter, e.g., improve, antigen binding. These framework substitutions are identified by methods well known in the art, such as identifying framework residues important for antigen binding and sequence comparison by modeling the interactions of the CDR and framework residues, and identifying framework residues that are distinct at particular positions (see, e.g., Queen et al., U.S. Pat. No. 5,585,089, and Riechmann et al., 1988, Nature, 332:323, which are incorporated herein by reference in their entireties).

[0312] A humanized antibody or antibody fragment has one or more amino acid residues remaining from it that are of non-human origin. These non-human amino acid residues are often referred to as "import" residues, and they are typically taken from an "import" variable domain. The humanized antibodies or antibody fragments provided herein comprise one or more CDR and framework regions from a non-human immunoglobulin molecule, with the amino acid residues comprising the framework being entirely or predominantly of human germline origin. Numerous techniques for humanizing antibodies or antibody fragments are known in the art, including the methods of Winter and coworkers (Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Nature, 332:323-327 (1988)). This can essentially be accomplished by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody, i.e., CDR grafting, according to the principles of the American Institute of Molecular Biology (AIMO), J. Immunol., 239:1534-1536 (1988) (EP 239,400, PCT Publication No. WO 91 / 09967, and U.S. Pat. Nos. 4,816,567, 6,331,415, 5,225,539, 5,530,101, 5,585,089, and 6,548,640, the contents of which are incorporated herein by reference in their entireties). In such humanized antibodies and antibody fragments, the substitution of corresponding sequences from non-human species is significantly less than in intact human variable domains. Humanized antibodies are often human antibodies in which some CDR residues and possibly some framework (FR) residues are substituted by residues from analogous sites in rodent antibodies. Humanization of antibodies and antibody fragments can also be achieved by veneering or resurfacing (EP 592,106; EP 519,596; Padlan, 1991, Molecular Immunology, 28(4 / 5):489-498; Studnicka et al., Protein Engineering, 7(6):805-814 (1994); and Roguska et al., PNAS, 91:969-973 (1994)), or chain shuffling (U.S. Pat. No. 5,565,332).the contents of which are incorporated herein by reference in their entirety.

[0313] The selection of human variable domains for both the light and heavy chains used to generate the humanized antibody reduces antigenicity. According to the so-called "best fit" method, the sequence of the variable domain of the rodent antibody is screened against the entire library of known human variable domain sequences. The human sequence that is closest to that of the rodent is then accepted as the human framework (FR) for the humanized antibody (Sims et al., J. Immunol., 151:2296 (1993); Chothia et al., J. Mol. Biol., 196:901 (1987), the contents of which are incorporated herein by reference in their entirety). Another method uses a specific framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework may be used for several different humanized antibodies (see, e.g., Nicholson et al. Mol. Immun. 34(16-17):1157-1165 (1997); Carter et al., Proc. Natl. Acad. Sci. USA, 89:4285 (1992); Presta et al., J. Immunol., 151:2623 (1993), the contents of which are incorporated herein by reference in their entireties). In some embodiments, the framework regions, e.g., all four framework regions of the heavy chain variable region, are derived from the VH4-4-59 germline sequence. In one embodiment, the framework regions may contain, e.g., one, two, three, four, or five modifications, e.g., substitutions, from the corresponding amino acids in the murine sequence. In one embodiment, the framework regions, e.g., all four framework regions of the light chain variable region, are derived from the VK3-1.25 germline sequence. In one embodiment, the framework regions may contain, e.g., one, two, three, four, or five modifications, e.g., substitutions, from an amino acid in the corresponding murine sequence.

[0314] In some embodiments, portions of the TFP compositions of the present disclosure, including antibody fragments, are humanized while retaining high affinity for the target antigen and other beneficial biological properties. According to one embodiment of the present disclosure, humanized antibodies and antibody fragments are prepared by a process of analysis of parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are publicly available and familiar to those skilled in the art. Computer programs are available that illustrate and display predicted three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the potential role of the residues in the functionality of the candidate immunoglobulin sequence, e.g., analysis of residues that affect the candidate immunoglobulin's ability to bind a target antigen. In this way, FR residues can be selected and combined from the recipient and import sequences to achieve desired antibody or antibody fragment properties, e.g., increased affinity for the target antigen. In general, the CDR residues are directly and most substantially involved in influencing antigen binding.

[0315] In one embodiment, the antigen-binding domain (e.g., an anti-CD70 binding domain) is characterized by a particular functional feature or property of an antibody or antibody fragment. For example, in one embodiment, the portion of the TFP composition of the present disclosure comprising the antigen-binding domain specifically binds to human CD70. In one embodiment, the present disclosure relates to an antigen-binding domain comprising an antibody or antibody fragment, wherein the antigen-binding domain specifically binds to the CD70 protein or a fragment thereof, and the antibody or antibody fragment comprises a variable light chain and / or a variable heavy chain comprising an amino acid sequence provided herein. In certain embodiments, the antigen-binding domain (e.g., an scFv or sdAb) is adjacent to and in the same reading frame as a leader sequence.

[0316] Also provided herein are methods for obtaining antibody antigen-binding domains specific for a target antigen (e.g., CD70, or any target antigen described elsewhere herein for targets of fusion moiety binding domains), the methods comprising: Hthe V domain via the addition, deletion, substitution, or insertion of one or more amino acids within the amino acid sequence of the V domain; H V, an amino acid sequence variant of the domain H prepare a domain and optionally, the V thus prepared H A domain can be one or more V L In combination with the domain, the V H Domain or V H / V L to identify a particular binding member or antibody antigen-binding domain specific for a target antigen of interest (e.g., CD70) that optionally has one or more desired properties.

[0317] In some instances, V HH Domains and scFvs can be prepared according to methods known in the art (see, e.g., Bird et al., (1988) Science 242:423-426 and Huston et al., (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). scFv molecules comprise the V H and V L The scFv molecules can be produced by linking the variable regions using a flexible polypeptide linker. The scFv molecules contain linkers of optimized length and / or amino acid composition (e.g., Ser-Gly linkers). The length of the linker can greatly affect how the variable regions of the scFv fold and interact. Indeed, when short polypeptide linkers are used (e.g., 5-10 amino acids), intrachain folding is prevented. Interchain folding may also be necessary to bring the two variable regions together to form a functional epitope-binding site. In some instances, the linker sequence comprises a long linker (LL) sequence. In some instances, the long linker sequence is a (G4S) n In some examples, the linker sequence comprises a short linker (SL) sequence. In some examples, the short linker sequence comprises (G4S) nwhere n=1-3. For examples of linker orientations and sizes, see, e.g., Hollinger et al. 1993 Proc Natl Acad. Sci. USA 90:6444-6448, U.S. Patent No. 7,695,936, U.S. Patent Application Publication Nos. 20050100543 and 20050175606, and PCT Publication Nos. WO2006 / 020258 and WO2007 / 024715, all of which are incorporated herein by reference.

[0318] scFv is a nucleotide sequence of the V L and V H A linker of about 10, 11, 12, 13, 14, 15, or more than 15 residues can be included between the regions. The linker sequence can include any naturally occurring amino acid. In some embodiments, the linker sequence includes the amino acids glycine and serine. In other embodiments, the linker sequence is (GS) n In some embodiments, the linker may be (G4S)4 or (G4S)3, where n is a positive integer greater than or equal to 1. Variation in the length of the linker may maintain or improve activity, resulting in superior efficacy in activity studies. In some examples, the linker sequence comprises a long linker (LL) sequence. In some examples, the long linker sequence may be (G4S) n In some examples, the linker sequence comprises a short linker (SL) sequence. In some examples, the short linker sequence comprises (G4S) n In this case, n=1 to 3.

[0319] The antigen-binding domain described herein may be a camelid antibody or binding fragment thereof. The antigen-binding domain may be a murine antibody or binding fragment thereof. The antigen-binding domain may be a human or humanized antibody or binding fragment thereof. The antigen-binding domain may be a single chain variable fragment (scFv) or a single domain antibody (sdAb) domain. The antigen-binding domain may be a single domain antibody (sdAb). The sdAb may be a VHH It could be.

[0320] The antigen-binding domain has a K for human CD70 of at most about 100, 98, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 40, 30, 20, 10, 0.5, 0.2, 0.1, 0.05, 0.01, 0.005, 0.001 nM or lower. D In some cases, the K D The value can be about 0.001 nM to about 100 nM, about 0.01 nM to about 10 nM, about 0.1 nM to about 10 nM, or about 0.1 nM to about 100 nM. The antigen-binding domain may not compete with CD27 for binding to CD70, may not inhibit the interaction of CD70 with CD27, and / or may not bind to the same epitope on CD70 as CD27. The antigen-binding domain may compete with CD27 for binding to CD70, may inhibit the interaction of CD70 with CD27, and / or may bind to the same epitope on CD70 as CD27.

[0321] The antigen-binding domain comprises a variable domain comprising complementarity determining region 1 (CDR1), CDR2, and CDR3. The CDR1, CDR2, and CDR3 of the antigen-binding domain may be selected from the group consisting of: (i) a CDR1 comprising the sequence X1X2FX3IX4RGX5; CDR2 containing the sequence of AIX6TSGX7ATX8YA, and CNMEX 11 X 12 X 13 YRX 14 CDR3 comprising the sequence YW, (ii) X 15 X 16 X 17 X 18 X 19 YX 20 X 21 X 22 CDR1 comprising the sequence X 23 CX 24 X 25 SX26 X 27 X 28 X 29 X 30 CDR2 comprising the sequence of KYA, and CX 31 AAX 32 PX 33 DDCSVX 34 GX 35 CDR3 containing the sequence YGLNYW, (iii)X 36 CDR1 containing the sequence of TFDAYAIG, CDR2 comprising the sequence ICLSPSDGSTYYA, and CAX 37 CDR3 containing the sequence PSWCSLKADFGSW, (iv) CDR1 comprising the sequence SIIRDNVMA; AIINX 38 GGSX 39 CDR2 containing the sequence of the NVD, and CNVYYRX 40 CDR3 containing the sequence of LW, (v) CDR1 comprising the sequence of SIFSIARMN or FTLDYYAIA; CDR2 comprising the sequence AILNRAGRTDYA, and CDR3 comprising the sequence CNLQTISYHDFW, and (vi) CDR1 comprising the sequence of SIFSATRME; CDR2 comprising the sequence AIVTSGGRTNYA, and CDR3 containing the sequence CKFERYDYVNYW, Here, X1~X 39 is any naturally occurring amino acid.

[0322] Optionally, X4 is a non-polar amino acid, X5 is a polar amino acid, X6 is a non-polar amino acid, and X 11 is a polar amino acid, and X 12 is a nonpolar amino acid, and X 16 is a polar amino acid, and X 18 is a negatively charged amino acid, and X 21is a nonpolar amino acid, and X 24 is a nonpolar amino acid, and X 25 is a polar amino acid, and X 29 is a non-polar amino acid, and / or X 39 is a nonpolar amino acid.

[0323] In some cases, CDR1 comprises the sequence of X1X2FX3IX4RGX5, where X1 is S or G, X2 is I or T, X3 is D or G, X4 is V or A, and X5 is S or N; CDR2 comprises the sequence of AIX6TSGX7ATX8YA, where X8 is I or V, X9 is G or D, and X 10 is N or D, and CDR3 is CNMEX 11 X 12 X 13 YRX 14 YW, where X 11 is S or T, and X 12 is F, V, or L, and X 13 is R or S, and X 14 is N or H.

[0324] In some cases, CDR1 is 15 X 16 X 17 X 18 X 19 YX 20 X 21 X 22 where X 15 is F, L, or R, and X 16 is T, S, or N, and X 17 is L, F, or R, and X 18 is D or E, and X 19 are R, H, Y, K, N, and X 20 is S, A, or T, and X 21 is I, V, or M, and X 22 is G or N, and CDR2 is X 23 CX 24 X 25 SX 26 X 27 X28 X 29 X 30 KYA, where X 23 is S, A, T, or L, and X 24 is I or V, and X 25 is S or T, and X 26 is S, K, or N, and X 17 is G or S, and X 28 is G or D, and X 29 is I, L, or V, and X 30 is P, T, I, or V, and CDR3 is CX 31 AAX 32 PX 33 DDCSVX 34 GX 35 YGLNYW, where X 31 is G, T, or A, and X 32 is T, G, or D, and X 33 is D, P, A or K, and X 34 is P, A, or H, and X 35 is H or Y.

[0325] In some cases, CDR1 is 36 TFDAYAIG, where X 36 is F or H, CDR2 comprises the sequence ICLSPSDGSTYYA, and CDR3 comprises the sequence CAX 37 PSWCSLKADFGSW, where X 37 is T or A, or CDR1 comprises the sequence SIIRDNVMA and CDR2 comprises the sequence AIINX 38 GGSX 39 NVD sequence, where X 38 is T or I, and X 39 is A or G, and CDR3 is CNVYYRX 40 LW, where X 40 is D or G.

[0326] The antigen-binding domain may comprise a variable domain having at least 60%, 65%, 70%, 75%, 80%, 855, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 603 to 620 or 622 to 688. The variable domain may have at least 60%, 65%, 70%, 75%, 80%, 855, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 603 to 620 or 622 to 688. The variable domain may comprise the sequence of SEQ ID NO: 605. The variable domain may comprise the sequence of SEQ ID NO: 611. The variable domain may comprise the sequence of SEQ ID NO: 613. The variable domain may comprise the sequence of SEQ ID NO: 620. The variable domain may comprise the sequence of SEQ ID NO: 618. The variable domain may comprise the sequence of SEQ ID NO: 603. The variable domain may comprise the sequence of SEQ ID NO: 615. The variable domain may comprise the sequence of SEQ ID NO: 608. The variable domain may comprise the sequence of SEQ ID NO: 610.

[0327] The antigen-binding domain may comprise a CDR1 comprising the sequence of any one of SEQ ID NOs: 87 to 104 or 107 to 172, a CDR2 comprising the sequence of any one of SEQ ID NOs: 259 to 276 or 279 to 344, and a CDR3 comprising the sequence of any one of SEQ ID NOs: 431 to 448 or 451 to 516. The CDR1 may be SEQ ID NO: 89, the CDR2 may be SEQ ID NO: 261, and the CDR3 may be SEQ ID NO: 433. The CDR1 may be SEQ ID NO: 95, the CDR2 may be SEQ ID NO: 267, and the CDR3 may be SEQ ID NO: 439. The CDR1 may be SEQ ID NO: 97, the CDR2 may be SEQ ID NO: 269, and the CDR3 may be SEQ ID NO: 441. The CDR1 may be SEQ ID NO: 104, the CDR2 may be SEQ ID NO: 276, and the CDR3 may be SEQ ID NO: 448. The CDR1 can be SEQ ID NO: 102, CDR2 can be SEQ ID NO: 274, and CDR3 can be SEQ ID NO: 446. The CDR1 can be SEQ ID NO: 87, CDR2 can be SEQ ID NO: 259, and CDR3 can be SEQ ID NO: 431. The CDR1 can be SEQ ID NO: 99, CDR2 can be SEQ ID NO: 271, and CDR3 can be SEQ ID NO: 443. The CDR1 can be SEQ ID NO: 92, CDR2 can be SEQ ID NO: 264, and CDR3 can be SEQ ID NO: 436. The CDR1 can be SEQ ID NO: 94, CDR2 can be SEQ ID NO: 266, and CDR3 can be SEQ ID NO: 439.

[0328] The antigen-binding domain may comprise a variable domain having at least 60%, 65%, 70%, 75%, 80%, 855, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 621. The variable domain may have at least 60%, 65%, 70%, 75%, 80%, 855, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 621. The variable domain may comprise the sequence of SEQ ID NO: 621. The CDR1 may be SEQ ID NO: 105, CDR2 may be SEQ ID NO: 227 and CDR3 may be SEQ ID NO: 449.

[0329] In some cases, the antigen-binding domain is a single-chain variable fragment (scFv). The scFv comprises a heavy chain variable (V) fragment having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 783-835. H The scFv may comprise a heavy chain variable (V) domain having at least 95% sequence identity to any one of SEQ ID NOs: 783 to 835. H The scFv may comprise a heavy chain variable (V) domain having any one of the sequences set forth in SEQ ID NOs: 783 to 835. H ) domain.

[0330] The scFv has a light chain variable (V) having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOs: 995 to 1047. L The scFv may comprise a light chain variable (V) domain having at least 95% sequence identity to any one of SEQ ID NOs: 995 to 1047. L The scFv may comprise a light chain variable (V) domain having any one of the sequences set forth in SEQ ID NOs: 995 to 1047. L ) domain. H The domain may comprise a heavy chain complementarity determining region 1 (CDRH1) having any one of the sequences set forth in SEQ ID NOs: 836 to 888, a CDRH2 having any one of the sequences set forth in SEQ ID NOs: 889 to 941, and a CDRH3 having any one of the sequences set forth in SEQ ID NOs: 942 to 994. L The domain may include a light chain complementarity determining region 1 (CDRL1) having the sequence of any one of SEQ ID NOs: 1048 to 1100, a CDRL2 having the sequence of any one of SEQ ID NOs: 1101 to 1153, and a CDRL3 having the sequence of any one of SEQ ID NOs: 1154 to 1206.

[0331] The scFv has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 800. H The scFv may comprise a V domain having at least 95% sequence identity to SEQ ID NO: 800. H The scFv may comprise a V domain having the sequence of SEQ ID NO: 800. H The scFv may comprise a V domain having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 1012. L The scFv may comprise a V domain having at least 95% sequence identity to SEQ ID NO: 1012. L The scFv may comprise a V domain having the sequence of SEQ ID NO: 1012. L The V H The domain may comprise a CDRH1 having the sequence of SEQ ID NO: 853, a CDRH2 having the sequence of SEQ ID NO: 906, and a CDRH3 having the sequence of SEQ ID NO: 959. L The domain may comprise a CDRL1 having the sequence of SEQ ID NO:1065, a CDRL2 having the sequence of SEQ ID NO:1118, and a CDRL3 having the sequence of SEQ ID NO:1171.

[0332] The scFv has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 783. H The scFv may comprise a V domain having at least 95% sequence identity to SEQ ID NO: 783. H The scFv may comprise a V domain having the sequence of SEQ ID NO: 783. H The scFv may comprise a V domain having at least 90% sequence identity to SEQ ID NO:995. L The scFv may comprise a V domain having at least 95% sequence identity to SEQ ID NO:995. L The scFv may comprise a V domain having the sequence of SEQ ID NO: 995. LThe V H The domain may comprise a CDRH1 having the sequence of SEQ ID NO: 836, a CDRH2 having the sequence of SEQ ID NO: 889, and a CDRH3 having the sequence of SEQ ID NO: 942. L The domain may comprise a CDRL1 having the sequence of SEQ ID NO:1048, a CDRL2 having the sequence of SEQ ID NO:1101, and a CDRL3 having the sequence of SEQ ID NO:1154.

[0333] The scFv has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 784. H The scFv may comprise a V domain having at least 95% sequence identity to SEQ ID NO: 784. H The scFv may comprise a V domain having the sequence of SEQ ID NO: 784. H The scFv may comprise a V domain having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO:996. L The scFv may comprise a V domain having at least 95% sequence identity to SEQ ID NO:996. L The scFv may comprise a V domain having the sequence of SEQ ID NO: 996. L The V H The domain may comprise a CDRH1 having the sequence of SEQ ID NO: 837, a CDRH2 having the sequence of SEQ ID NO: 890, and a CDRH3 having the sequence of SEQ ID NO: 943. L The domain may comprise a CDRL1 having the sequence of SEQ ID NO:1049, a CDRL2 having the sequence of SEQ ID NO:1102, and a CDRL3 having the sequence of SEQ ID NO:1155.

[0334] The scFv may comprise a linker sequence. The linker sequence may comprise the sequence of SEQ ID NO: 782. Stability and Mutation The stability of an anti-CD70 binding domain, e.g., an scFv or sdAb molecule (e.g., a soluble scFv or sdAb), can be assessed with respect to the biophysical properties (e.g., thermal stability) of a conventional control scFv molecule or a full-length antibody. In one embodiment, the humanized or human scFv has a thermal stability that is about 0.1, about 0.25, about 0.5, about 0.75, about 1, about 1.25, about 1.5, about 1.75, about 2, about 2.5, about 3, about 3.5, about 4, about 4.5, about 5, about 5.5, about 6, about 6.5, about 7, about 7.5, about 8, about 8.5, about 9, about 9.5, about 10°C, about 11°C, about 12°C, about 13°C, about 14°C, or about 15°C higher than the parent scFv in the described assay.

[0335] The improved thermal stability of the anti-CD70 binding domain, e.g., scFv, can then be carried over to the entire anti-CD70 TFP construct, leading to improved therapeutic properties of the anti-CD70 TFP construct. The thermal stability of the anti-CD70 binding domain, e.g., scFv, can be improved by at least about 2°C or 3°C compared to a conventional antibody. In one embodiment, the anti-CD70 binding domain, e.g., scFv, has a 1°C improvement in thermal stability compared to a conventional antibody. In another embodiment, the anti-CD70 binding domain, e.g., scFv, has a 2°C improvement in thermal stability compared to a conventional antibody. In another embodiment, the scFv has a 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, or 15°C improvement in thermal stability compared to a conventional antibody. Comparisons can be made, for example, between scFv molecules disclosed herein and the scFv V H and V L The thermal stability can be measured using methods known in the art. For example, in one embodiment, TM can be measured. Methods for measuring TM and other methods for measuring protein stability are described below.

[0336] Mutations in an antigen-binding domain, such as an scFv or sdAb (arranged via humanization or mutagenesis of a soluble scFv or sdAb), alter the stability of the antigen-binding domain, improving the overall stability of the antigen-binding domain and the anti-CD70 TFP construct. The stability of a humanized antigen-binding domain can be compared to a murine antigen-binding domain using measurements such as TM, temperature denaturation, and temperature aggregation. In one embodiment, the antigen-binding domain, e.g., an scFv or sdAb, can contain at least one mutation resulting from the humanization process, such that the mutated antigen-binding domain confers improved stability to the anti-CD70 TFP construct. In another embodiment, the anti-CD70 binding domain, e.g., an scFv or sdAb, contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations resulting from the humanization process, such that the mutated antigen-binding domain confers improved stability to the anti-CD70 TFP construct.

[0337] In one embodiment, the antigen-binding domain of the TFP comprises an amino acid sequence that is homologous to the amino acid sequence of an antigen-binding domain described herein, and the antigen-binding domain retains the desired functional properties of the anti-CD70 antibody fragments described herein. In one particular embodiment, the TFP composition of the invention comprises an antibody fragment. In a further embodiment, the antibody fragment comprises an scFv or sdAb.

[0338] In various embodiments, the antigen-binding domain of the TFP comprises one or both variable regions (e.g., V H and / or V L ), e.g., by modifying one or more amino acids within one or more CDR regions and / or one or more framework regions. In one particular embodiment, the TFP composition of the present disclosure comprises an antibody fragment. In a further embodiment, the antibody fragment comprises an scFv or an sdAb.

[0339] Those skilled in the art will understand that the antibodies or antibody fragments of the present disclosure may be further modified so that they differ in amino acid sequence (e.g., from wild-type) but do not alter the desired activity. For example, additional nucleotide substitutions may be made to the protein, resulting in amino acid substitutions at "non-essential" amino acid residues. For example, a non-essential amino acid residue in the molecule may be replaced with another amino acid residue from the same side chain family. In another embodiment, a series of amino acids may be replaced with a structurally similar series that differs in the order and / or composition of the side chain family members; for example, conservative substitutions may be made in which amino acid residues are replaced with amino acid residues having similar side chains.

[0340] Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

[0341] Percent identity in two or more nucleic acid or polypeptide sequences refers to two or more sequences that are the same. Two sequences are "substantially identical" when they have a specified percentage of identical amino acid residues or nucleotides when compared and aligned over a comparison window for maximum correspondence, or a designated region as measured using one of the sequence comparison algorithms below, or by manual alignment and visual inspection (e.g., 60% identity over a specified region, or, if not specified, over the entire sequence; optionally, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity). Optionally, the identity exists over a region that is at least about 50 nucleotides (or 10 amino acids) in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200, or more amino acids) in length.

[0342] For sequence comparison, one sequence usually serves as a reference sequence, and test sequence is compared to it.When using sequence comparison algorithm, test sequence and reference sequence are input into computer, and subsequence coordinates are designated as necessary, and parameters of sequence algorithm program are designated.Default program parameters can be used, or other parameters can be designated.The sequence comparison algorithm then calculates the sequence identity percentage of the test sequence and the reference sequence based on the program parameters.The method of aligning sequences for comparison is well known in the art. Optimal alignment of sequences for comparison can be achieved, for example, by the local homology algorithm of Smith and Waterman (1970) Adv. Appl. Math. 2:482c, the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443, the similarity search algorithm of Pearson and Lipman (1988) Proc. Nat'l. Acad. Sci. USA 85:2444, computer implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection (see, e.g., Brent et al. (2003) Current Protocols in Molecular Biology). Two examples of algorithms that are suitable for measuring percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., (1977) Nuc. Acids Res. 25:3389-3402, and Altschul et al., (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analyses is publicly available from the National Center for Biotechnology Information.Algorithm parameters for determining nucleotide sequence identity using nucleotide BLAST may use scoring parameters with match / mismatch scores of 1, -2, and gap costs linear. The length of the sequence from which the alignment begins, or the word size of the BLAST algorithm, may be set to 28 for sequence alignments. Algorithm parameters for determining peptide sequence identity using protein BLAST may use scoring parameters from the BLOSUM62 matrix to assign scores for aligning pairs of residues and determine an overall alignment score, and the gap cost may have an existence penalty of 11 and an extension penalty of 1. A matrix adjustment method to correct for the amino acid composition of the sequences may be a conditional compositional score matrix adjustment. The length of the sequence from which the alignment begins, or the word size of the BLAST algorithm, may be set to 6 for sequence alignments.

[0343] In one aspect, the present disclosure provides a method for producing a starting antibody or fragment (e.g., scFv or V) that produces a functionally equivalent molecule. HH For example, modifications of the amino acid sequence of a binding domain contained in a TFP, such as an scFv or V HH V H or V L is the anti-CD70 binding domain, e.g., scFv or V HH Departure V H or V LModifications may be made to retain at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity of the framework regions. The present disclosure contemplates modifications of the entire TFP construct, e.g., modification of one or more amino acid sequences of various domains of the TFP construct to produce functionally equivalent molecules. The TFP construct may be modified to retain at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the starting TFP construct.

[0344] In some embodiments, the CD70 binder comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more sequence identity to any one of the sequences set forth in Tables 5, 7, 8, and 9. In some embodiments, the CD70 binder comprises any one of the sequences set forth in Tables 5, 7, 8, and 9.

[0345] Extracellular domain The extracellular domain can be derived from either natural or recombinant sources. If the origin is natural, the domain can be from any protein, particularly other than a membrane-bound or transmembrane protein. In one aspect, the extracellular domain can be associated with the transmembrane domain. Extracellular domains of particular use in the present disclosure can include, for example, at least the extracellular region(s) of the α, β, γ, or δ chain of the T cell receptor, or CD3ε, CD3γ, or CD3δ, or in another embodiment, CD28, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154. In some examples, the extracellular domain of the TCR comprises the extracellular domain of a protein selected from the group consisting of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, a TCR delta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, a CD3 delta TCR subunit, functional fragments thereof, and amino acid sequences thereof having at least one but not more than 20 modifications, or a portion thereof.

[0346] In some embodiments, the extracellular domain of the TCR comprises the extracellular domain or a portion thereof of a TCR alpha chain, a TCR beta chain, a TCR delta chain, or a TCR gamma chain, hi some embodiments, the extracellular domain of the TCR comprises the IgC domain of a TCR alpha chain, a TCR beta chain, a TCR delta chain, or a TCR gamma chain.

[0347] In some embodiments, the extracellular domain is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 1 4, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more consecutive amino acid residues thereof, or at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more consecutive amino acid residues. In some embodiments, the extracellular domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more sequence identity to a sequence encoding the extracellular domain of a TCR alpha chain, a TCR beta chain, a TCR delta chain, or a TCR gamma chain.In some embodiments, the extracellular domain comprises a sequence encoding the extracellular domain of a TCR alpha chain, a TCR beta chain, a TCR delta chain, or a TCR gamma chain, with at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acids deleted at its N-terminus or C-terminus or at both the N- and C-terminus.

[0348] In some embodiments, the extracellular domain is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 1 5, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or or more consecutive amino acid residues thereof, or at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more consecutive amino acid residues. In some embodiments, the extracellular domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more sequence identity to a sequence encoding an IgC domain of TCR alpha, TCR beta, TCR delta, or TCR gamma. In some embodiments, the extracellular domain comprises a sequence encoding an IgC domain of TCR alpha, TCR beta, TCR delta, or TCR gamma, with at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acid deletions at the N-terminus or C-terminus, or at both the N- and C-terminus.

[0349] In some embodiments, the extracellular domain is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 1 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more consecutive amino acid residues or at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 , 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more consecutive amino acid residues. In some embodiments, the extracellular domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more sequence identity to a sequence encoding the extracellular domain of a CD3ε TCR subunit, a CD3γ TCR subunit, or a CD3δ TCR subunit.In some embodiments, the extracellular domain comprises a sequence encoding the extracellular domain of a CD3ε TCR subunit, a CD3γ TCR subunit, or a CD3δ TCR subunit, with at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acids deleted at its N-terminus or C-terminus or at both the N- and C-terminus.

[0350] Transmembrane domain Generally, a TFP sequence comprises an extracellular domain and a transmembrane domain encoded by a single genomic sequence. In another embodiment, a TFP can be engineered to contain a transmembrane domain that is heterologous to the extracellular domain of the TFP. A transmembrane domain may comprise one or more additional amino acids adjacent to the transmembrane region, for example, one or more amino acids associated with the extracellular region of the protein from which the transmembrane is derived (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more amino acids of the extracellular region) and / or one or more additional amino acids associated with the intracellular region of the protein from which the transmembrane protein is derived (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more amino acids of the intracellular region). In some cases, the transmembrane domain may comprise at least 30, 35, 40, 45, 50, 55, 60, or more amino acids of the extracellular region. In some cases, the transmembrane domain may comprise at least 30, 35, 40, 45, 50, 55, 60, or more amino acids of the intracellular region. In one embodiment, the transmembrane domain is associated with one of the other domains of the TFP used. In some instances, the transmembrane domain may be modified by selection or amino acid substitution so that such domain does not bind to the transmembrane domain of the same or a different surface membrane protein, e.g., to minimize interaction with other members of a receptor complex. In one embodiment, the transmembrane domain is capable of homodimerizing with another TFP on the surface of a TFP-T cell. In a different embodiment, the amino acid sequence of the transmembrane domain may be modified or substituted to minimize interaction with the binding domain of a natural binding partner present on the same TFP.

[0351] The transmembrane domain can be derived from either natural or recombinant sources. If the origin is natural, the domain can be from any membrane-bound or transmembrane protein. In one embodiment, the transmembrane domain is capable of signaling to the intracellular domain(s) whenever the TFP is bound to a target. In some examples, the TCR fusion subunit comprises a transmembrane domain comprising a transmembrane domain of a protein selected from the group consisting of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, a TCR delta chain, a TCR zeta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, a CD3 delta TCR subunit, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD28, CD37, CD64, CD80, CD86, CD134, CD137, CD154, functional fragments thereof, and amino acid sequences thereof having at least one but not more than 20 modifications.

[0352] In some embodiments, the transmembrane domain comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more consecutive amino acid residues of the transmembrane domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, a TCR delta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, or a CD3 delta TCR subunit, or comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more consecutive amino acid residues thereof. In some embodiments, the transmembrane domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more sequence identity to a sequence encoding the transmembrane domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, a TCR delta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, or a CD3 delta TCR subunit. In some embodiments, the transmembrane domain comprises a sequence encoding the transmembrane domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, a TCR delta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, or a CD3 delta TCR subunit, with a deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more amino acids at the N-terminus or C-terminus, or at both the N- and C-terminus.

[0353] In some examples, the transmembrane domain can be attached to the extracellular region of the TFP, e.g., the antigen-binding domain of the TFP, via a hinge, e.g., a hinge derived from a human protein. For example, in one embodiment, the hinge can be a human immunoglobulin (Ig) hinge, e.g., an IgG4 hinge, or a CD8a hinge.

[0354] Linker Optionally, a short oligo- or polypeptide linker, 2-10 amino acids in length, may form the linkage between the binding element of the TFP and the TCR extracellular domain. A glycine-serine doublet provides a particularly suitable linker. In some cases, the linker may be at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or longer in length. For example, in one embodiment, the linker comprises the amino acid sequence GGGGSGGGGS (SEQ ID NO: 690) or the sequence (GGGGS (SEQ ID NO: 1232)). x wherein X is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more. In some embodiments, X is 2. In some embodiments, X is 4. In some embodiments, the linker is encoded by the nucleotide sequence of GGTGGCGGAGGTTCTGGAGGTGGAGGTTCC (SEQ ID NO: 691).

[0355] Cytoplasmic domain The cytoplasmic domain of the TFP can include an intracellular domain. In some embodiments, the intracellular domain is derived from CD3γ, CD3δ, CD3ε, TCRα, TCRβ, TCRγ, or TCRδ. In some embodiments, when the TFP includes a CD3γ, δ, or ε polypeptide, the intracellular domain includes a signaling domain. TCRα, TCRβ, TCRγ, and TCRδ subunits generally have short (e.g., 1-19 amino acids in length) intracellular domains and generally lack a signaling domain. The intracellular signaling domain is generally involved in activating at least one normal effector function of an immune cell into which the TFP has been introduced. Although the intracellular domains of TCRα, TCRβ, TCRγ, and TCRδ do not have a signaling domain, they can recruit proteins having a primary intracellular signaling domain, e.g., CD3ζ, as described herein, that functions as an intracellular signaling domain. The term "effector function" refers to a specialized function of a cell. The effector function of a T cell can be, for example, helper activity, including cytolytic activity or cytokine secretion. Thus, the term "intracellular signaling domain" refers to the portion of a protein that transmits the effector function signal and instructs the cell to perform a specialized function. Typically, the entire intracellular signaling domain can be used, although in many cases it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such a truncated portion can be used in place of the intact chain, so long as it transmits the effector function signal. The term intracellular signaling domain, therefore, is intended to include any truncated portion of the intracellular signaling domain sufficient to transmit the effector function signal.

[0356] Examples of intracellular domains for use in the TFPs of the present disclosure include the cytoplasmic sequences of T cell receptors (TCRs) and co-receptors that can act together to initiate signal transduction following antigen receptor binding, as well as any derivatives or variants of these sequences and any recombinant sequences with the same function.

[0357] In some embodiments, the intracellular domain comprises the intracellular domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, a TCR delta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, or a CD3 delta TCR subunit.

[0358] In some embodiments, the intracellular domain comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 or more contiguous amino acid residues of, or comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 or more contiguous amino acid residues of, the intracellular domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, or a TCR delta chain. In some embodiments, the intracellular domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more sequence identity to a sequence encoding the intracellular domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, or a TCR delta chain. In some embodiments, the transmembrane domain comprises a sequence encoding the intracellular domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, or a TCR delta chain, with at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more amino acids deleted at its N-terminus or C-terminus or at both the N- and C-terminus.

[0359] In some embodiments, the intracellular domain is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 1 61, or 62 or more consecutive amino acid residues, or at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, or 62 or more consecutive amino acid residues. In some embodiments, the intracellular domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more sequence identity to a sequence encoding the intracellular domain of a CD3ε, CD3γ, or CD3δ TCR subunit. In some embodiments, the intracellular domain comprises a sequence encoding the intracellular domain of a CD3ε, CD3γ, or CD3δ TCR subunit, with at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acid deletions at the N-terminus or C-terminus or both the N- and C-terminus.

[0360] It is known that signals generated solely through the TCR are insufficient for the full activation of naive T cells, and that secondary and / or costimulatory signals are required. Thus, activation of naive T cells can be said to be mediated by two distinct classes of cytoplasmic signaling sequences: those that initiate antigen-dependent primary activation via the TCR (primary intracellular signaling domains) and those that act in an antigen-independent manner to provide secondary or costimulatory signals (secondary cytoplasmic domains, e.g., costimulatory domains).

[0361] The primary signaling domain regulates the primary activation of the TCR complex in either a stimulatory or inhibitory manner. Primary intracellular signaling domains that act in a stimulatory manner may contain signaling motifs known as immunoreceptor tyrosine-based activation motifs (ITAMs).

[0362] Examples of ITAMs comprising primary intracellular signaling domains of particular use in the present disclosure include those of CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and Cd66d. In one embodiment, a TFP of the present disclosure comprises an intracellular signaling domain, e.g., a primary signaling domain of CD3ε, CD3δ, or CD3γ. In one embodiment, the primary signaling domain comprises a modified ITAM domain, e.g., a mutated ITAM domain having altered (e.g., increased or decreased) activity compared to the native ITAM domain. In one embodiment, the primary signaling domain comprises a modified ITAM-containing primary intracellular signaling domain, e.g., an optimized and / or truncated ITAM-containing primary intracellular signaling domain. In an embodiment, the primary signaling domain comprises one, two, three, four, or more ITAM motifs.

[0363] The intracellular signaling domain of the TFP can comprise the signaling domain of CD3, e.g., CD3ε, CD3δ, CD3γ, or CD3ζ, by itself or in combination with any other desired intracellular signaling domain(s) useful in connection with the TFPs of the present disclosure. For example, the intracellular signaling domain of the TFP can comprise a CD3ε chain portion and a costimulatory signaling domain. The costimulatory signaling domain refers to the portion of the TFP that contains the intracellular domain of a costimulatory molecule. A costimulatory molecule is a cell surface molecule other than an antigen receptor or its ligand that is required for efficient lymphocyte response to an antigen. Examples of such molecules include CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD1, ICOS, lymphocyte function-associated antigen 1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83. For example, CD27 costimulation has been shown to improve the proliferation, effector function, and survival of human TFP-T cells in vitro, and enhances the persistence and antitumor activity of human T cells in vivo (Song et al., Blood. 2012;119(3):696-706).

[0364] In some embodiments, the extracellular, transmembrane, and intracellular domains of the TFP are derived from TCR alpha, TCR beta, TCR gamma, or TCR delta, and the extracellular, transmembrane, and intracellular domains comprise the constant domains of TCR alpha, TCR beta, TCR gamma, or TCR delta. The TFP may comprise the full-length constant domain of a TCR alpha, TCR beta, TCR gamma, or TCR delta chain. The TFP may comprise a fragment (e.g., a functional fragment) of the full-length constant domain of a TCR alpha, TCR beta, TCR gamma, or TCR delta chain.

[0365] The TCR α chain, TCR β chain, TCR γ chain, or TCR δ chain described herein can be derived from various species. The TCR chain can be a mouse or human TCR chain. For example, the TFP can include the constant domain of a mouse TCR α chain, a mouse TCR β chain, a human TCR γ chain, or a human TCR δ chain.

[0366] The intracellular signaling sequences within the cytoplasmic portion of a TFP of the present disclosure may be linked to each other in a random or specific order. Optionally, a short oligo- or polypeptide linker, e.g., 2-10 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids) in length, can form the linkage between the intracellular signaling sequences.

[0367] In one embodiment, a glycine-serine doublet may be used as a suitable linker. In one embodiment, a single amino acid, such as alanine or glycine, may be used as a suitable linker.

[0368] In one aspect, the TFP-expressing cells described herein can further comprise a second TFP, e.g., a second TFP comprising a different antigen-binding domain, e.g., directed against the same target (e.g., CD70) or a different target (e.g., MSLN, CD19, or MUC16). In one embodiment, when the TFP-expressing cells comprise two or more different TFPs, the antigen-binding domains of the different TFPs can be such that the antigen-binding domains do not interact with each other. For example, a cell expressing a first and a second TFP can have the antigen-binding domain of the first TFP, e.g., as a fragment, e.g., an scFv, that does not associate with the antigen-binding domain of the second TFP, e.g., the antigen-binding domain of the second TFP is a V HH is.

[0369] In another aspect, the TFP-expressing cells described herein can further express another agent, e.g., an agent that enhances the activity of the engineered T cells. For example, in one embodiment, the agent can be an agent that inhibits an inhibitory molecule. An inhibitory molecule, e.g., PD1, can, in some embodiments, attenuate the ability of the engineered T cells to mount an immune effector response. Examples of inhibitory molecules include PD1, PD-L1, CTLA4, TIM3, LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, and TGFRβ. In one embodiment, the agent that inhibits the inhibitory molecule comprises a first polypeptide, e.g., an inhibitory molecule, associated with a second polypeptide that provides a positive signal to the cell, e.g., an intracellular signaling domain described herein. In one embodiment, the agent comprises a first polypeptide, e.g., of an inhibitory molecule such as PD1, LAG3, CTLA4, CD160, BTLA, LAIR1, TIM3, 2B4, and TIGIT, or a fragment of any of these (e.g., at least a portion of the extracellular domain of any of these), and a second polypeptide that is an intracellular signaling domain described herein (e.g., comprising a costimulatory domain (e.g., 4-1BB, CD27, or CD28, e.g., as described herein) and / or a primary signaling domain (e.g., a CD3ζ signaling domain as described herein). In one embodiment, the agent comprises two polypeptides. In one embodiment, the agent comprises a first polypeptide of PD1 or a fragment thereof (e.g., at least a portion of the extracellular domain of PD1) and a second polypeptide of an intracellular signaling domain described herein (e.g., a CD28 signaling domain described herein and / or a CD3ζ signaling domain described herein). PD1 is an inhibitory member of the CD28 family of receptors, which also includes CD28, CTLA-4, ICOS, and BTLA. PD-1 is expressed on activated B cells, T cells, and myeloid cells (Agata et al., 1996, Int. Immunol 8:765-75).Two ligands for PD1, PD-L1 and PD-L2, have been shown to downregulate T cell activation upon binding to PD1 (Freeman et al., 2000 J. Exp. Med. 192:1027-34; Latchman et al., 2001 Nat. Immunol. 2:261-8; Carter et al., 2002 Eur. J. Immunol. 32:634-43). PD-L1 is abundant in human cancers (Dong et al., 2003 J. Mol. Med. 81:281-7; Blank et al., 2005 Cancer Immunol. Immunother. 54:307-314; Konishi et al., 2004 Clin. Cancer Res. 10:5094). Immune suppression can be reversed by inhibiting the local interaction between PD1 and PD-L1.

[0370] In one embodiment, the agent comprises the extracellular domain (ECD) of an inhibitory molecule, for example, Programmed Death 1 (PD1), which can be fused to a transmembrane domain and optionally an intracellular signaling domain, such as 41BB and CD3ζ (also referred to herein as PD1 TFP). In one embodiment, the PD1 TFP improves T cell persistence when used in combination with an anti-CD70 TFP described herein. In one embodiment, the TFP is a PD1 TFP comprising the extracellular domain of PD-1. Alternatively, provided is a TFP comprising an antibody or antibody fragment, for example, an scFv that specifically binds to Programmed Death Ligand 1 (PD-L1) or Programmed Death Ligand 2 (PD-L2).

[0371] In another aspect, the disclosure provides a population of TFP-expressing T cells, e.g., TFP-T cells. In some embodiments, the population of TFP-expressing T cells comprises a mixture of cells expressing different TFPs. For example, in one embodiment, the population of TFP-T cells can include a first cell expressing a TFP having an anti-CD70 binding domain described herein and a second cell expressing a TFP having a binding domain that specifically targets a different antigen, e.g., a binding domain described herein that differs from the anti-CD70 binding domain in the TFP expressed by the first cell. As another example, the population of TFP-expressing cells can include a first cell expressing a TFP comprising a first binding domain, e.g., a binding domain described herein, and a second cell expressing a TFP comprising an antigen-binding domain against a target other than the binding domain of the first cell (e.g., another tumor-associated antigen).

[0372] In another aspect, the disclosure provides a population of cells, wherein at least one cell in the population expresses a TFP having a domain described herein, and a second cell expressing another agent, e.g., an agent that enhances the activity of the engineered T cells. For example, in one embodiment, the agent can be an agent that inhibits an inhibitory molecule. The inhibitory molecule, for example, can, in some embodiments, attenuate the ability of the engineered T cells to mount an immune effector response. Examples of inhibitory molecules include PD1, PD-L1, PD-L2, CTLA4, TIM3, LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, and TGFRβ. In one embodiment, the agent that inhibits the inhibitory molecule comprises a first polypeptide, e.g., an inhibitory molecule, associated with a second polypeptide that provides a positive signal to the cell, e.g., an intracellular signaling domain described herein. In some embodiments, the agent is a cytokine. In some embodiments, the cytokine is IL-15. In some embodiments, IL-15 increases the persistence of the T cells described herein.

[0373] Recombinant nucleic acid encoding TFP Disclosed herein, in some embodiments, are recombinant nucleic acids encoding the TFPs disclosed herein.

[0374] In some examples, the recombinant nucleic acid further comprises a leader sequence. In some examples, the recombinant nucleic acid further comprises a promoter sequence. In some examples, the recombinant nucleic acid further comprises a sequence encoding a poly(A) tail. In some examples, the recombinant nucleic acid further comprises a 3'UTR sequence. In some examples, the nucleic acid is an isolated nucleic acid or a non-naturally occurring nucleic acid. Non-naturally occurring nucleic acids are well known to those of skill in the art. In some examples, the nucleic acid is an in vitro transcribed nucleic acid.

[0375] Disclosed herein are methods for producing in vitro transcribed RNA encoding TFP. The disclosure also includes TFP-encoding RNA constructs that can be directly transfected into cells. Methods for generating mRNA for use in transfection can include in vitro transcription (IVT) of a template with specifically designed primers, followed by poly(A) addition to produce a construct containing 3' and 5' untranslated sequences ("UTRs"), a 5' cap and / or internal ribosome entry site (IRES), the nucleic acid to be expressed, and a poly(A) tail, typically 50-2000 bases in length. RNA produced in this manner can efficiently transfect a variety of cell types. In one embodiment, the template contains the sequence of the TFP.

[0376] In one aspect, the anti-CD70 TFP is encoded by messenger RNA (mRNA). In one aspect, mRNA encoding the anti-CD70 TFP is introduced into T cells to generate TFP-T cells. In one embodiment, the in vitro transcribed RNA TFP can be introduced into cells as a form of transient transfection. The RNA is produced by in vitro transcription using a template generated by polymerase chain reaction (PCR). DNA of interest from any source can be directly converted into a template for in vitro mRNA synthesis by PCR using appropriate primers and RNA polymerase. The source of the DNA can be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequence, or any other suitable DNA source. The desired template for in vitro transcription is a TFP of the present disclosure. In one embodiment, the DNA used for PCR contains an open reading frame. The DNA can be derived from a natural DNA sequence from the genome of an organism. In one embodiment, the nucleic acid may include part or all of the 5' and / or 3' untranslated region (UTR). The nucleic acid may include exons and introns. In one embodiment, the DNA used for PCR is a human nucleic acid sequence. In another embodiment, the DNA used for PCR is a human nucleic acid sequence including the 5' and 3' UTR. The DNA may alternatively be an artificial DNA sequence that is not normally expressed in naturally occurring organisms. An exemplary artificial DNA sequence is one that includes portions of genes that are linked together to form an open reading frame that encodes a fusion protein. The portions of DNA that are linked together may be from a single organism or from multiple organisms.

[0377] PCR is used to generate templates for in vitro transcription of mRNA for transfection. Methods for performing PCR are well known in the art. Primers for PCR are designed to have a region substantially complementary to a region of DNA used as a template for PCR. As used herein, "substantially complementary" refers to a nucleotide sequence in which most or all of the bases in the primer sequence are complementary, or in which one or more bases are non-complementary or mismatched. A substantially complementary sequence is capable of annealing or hybridizing with a target DNA under the annealing conditions used for PCR. The primers can be designed to be substantially complementary to any portion of the DNA template. For example, the primers can be designed to amplify a portion of a nucleic acid normally transcribed in cells (open reading frame), including the 5' and 3' UTRs. The primers can also be designed to amplify a portion of a nucleic acid encoding a specific domain of interest. In one embodiment, the primers are designed to amplify the coding region of a human cDNA, including all or part of the 5' and 3' UTRs. Primers useful for PCR can be produced by synthetic methods well known in the art. A "forward primer" is a primer that contains a region of nucleotides that are substantially complementary to the nucleotides on a DNA template upstream of the DNA sequence to be amplified. "Upstream" is used herein to refer to the 5' position relative to the DNA sequence to be amplified relative to the coding strand. A "reverse primer" is a primer that contains a region of nucleotides that are substantially complementary to the double-stranded DNA template downstream of the DNA sequence to be amplified. "Downstream" is used herein to refer to the 3' position relative to the DNA sequence to be amplified relative to the coding strand.

[0378] Any DNA polymerase useful in PCR can be used in the methods disclosed herein. Such reagents and polymerases are commercially available from several sources. Chemical structures capable of promoting stability and / or translation efficiency can also be used. The RNA preferably has 5' and 3' UTRs. In one embodiment, the 5' UTR is 1 to 3,000 nucleotides long. The length of the 5' and 3' UTR sequences added to the coding region can be varied by different methods, including, but not limited to, designing primers for PCR that anneal to different regions of the UTR. Using this approach, one skilled in the art can vary the length of the 5' and 3' UTRs that can be used to achieve optimal translation efficiency following transfection of the transcribed RNA.

[0379] The 5' and 3' UTRs may be naturally occurring endogenous 5' and 3' UTRs for the nucleic acid of interest. Alternatively, a UTR sequence that is not endogenous to the nucleic acid of interest can be added by incorporating the UTR sequence into the forward and reverse primers or by any other modification of the template. The use of a UTR sequence that is not endogenous to the nucleic acid of interest may be useful for altering the stability and / or translation efficiency of the RNA. For example, it is known that an AU-rich region in the 3' UTR sequence can weaken the stability of mRNA. Therefore, the 3' UTR can be selected or designed to enhance the stability of the transcribed RNA based on the properties of UTRs known in the art.

[0380] In one embodiment, the 5'UTR can contain the Kozak sequence of the endogenous nucleic acid. Alternatively, if a 5'UTR that is not endogenous to the nucleic acid of interest is added by PCR as described above, the consensus Kozak sequence can be redesigned by adding the 5'UTR sequence. While the Kozak sequence can increase the translation efficiency of some RNA transcripts, it does not appear to be necessary for all RNAs to enable efficient translation. In another embodiment, the 5'UTR can be the 5'UTR of an RNA virus whose RNA genome is stable in cells. In another embodiment, various nucleotide analogs can be used in the 3' or 5'UTR to prevent exonuclease degradation of the mRNA.

[0381] To enable RNA synthesis from a DNA template without the need for gene cloning, a transcription promoter should be attached to the DNA template upstream of the sequence to be transcribed.When a sequence that functions as a promoter for RNA polymerase is added to the 5' end of the forward primer, the promoter of the RNA polymerase is incorporated into the PCR product upstream of the open reading frame to be transcribed.In one preferred embodiment, the promoter is the T7 polymerase promoter described elsewhere herein.Other useful promoters include, but are not limited to, T3 and SP6 RNA polymerase promoters.Consensus nucleotide sequences for T7, T3, and SP6 promoters are known in the art.

[0382] In a preferred embodiment, the mRNA has both a 5'-end cap and a 3' poly(A) tail, which determine ribosome binding, transcription initiation, and stability of the mRNA within the cell. On a circular DNA template, such as plasmid DNA, RNA polymerase produces long concatemeric products that are not suitable for expression in eukaryotic cells. Transcription of plasmid DNA linearized at the end of the 3' UTR produces mRNA of normal size, but even if this is posttranscriptionally polyadenylated, it is ineffective for eukaryotic transfection.

[0383] On a linear DNA template, phage T7 RNA polymerase can extend the 3' end of the transcript beyond the last base of the template (Schenborn and Mierendorf, Nuc Acids Res., 13:6223-36 (1985); Nacheva and Berzal-Herranz, Eur. J. Biochem., 270:1485-65 (2003)).

[0384] The traditional method for integrating a polyA / T stretch into a DNA template is molecular cloning. However, because polyA / T sequences integrated into plasmid DNA cause plasmid instability, plasmid DNA templates derived from bacterial cells are often highly contaminated with deletions and other abnormalities. This makes cloning methods not only laborious and time-consuming, but also often unreliable. Therefore, a method that allows the construction of DNA templates with a polyA / T 3' stretch without cloning is highly desirable.

[0385] The poly(A) / T segment of the transcription DNA template can be generated during PCR using a reverse primer containing a poly(T) tail, e.g., a 100T tail (which can range in size from 50 to 5000T), or after PCR by any other method, including, but not limited to, DNA ligation or in vitro recombination. The poly(A) tail also provides stability to RNAs, reducing their degradation. Generally, the length of the poly(A) tail positively correlates with the stability of the transcribed RNA. In one embodiment, the poly(A) tail is 100 to 5000 adenosines.

[0386] The poly(A) tail of an RNA can be further extended after in vitro transcription using a poly(A) polymerase, such as Escherichia coli poly(A) polymerase (E-PAP). In one embodiment, increasing the length of the poly(A) tail from 100 nucleotides to 300-400 nucleotides results in an approximately two-fold increase in the translation efficiency of the RNA. Furthermore, attachment of different chemical groups to the 3' end can increase mRNA stability. Such attachments can include modified / artificial nucleotides, aptamers, and other compounds. For example, poly(A) polymerase can be used to incorporate an ATP analog into the poly(A) tail. The ATP analog can further enhance the stability of the RNA.

[0387] Adding a 5'-capping also provides stability to RNA molecules. In a preferred embodiment, the RNA produced by the methods disclosed herein includes a 5'-cap. The 5'-cap can be provided using techniques known in the art and described herein (Cougot, et al., Trends in Biochem. Sci., 29:436-444 (2001); Stepinski, et al., RNA, 7:1468-95 (2001); Elango, et al., Biochim. Biophys. Res. Commun., 330:958-966 (2005)).

[0388] The RNA produced by the methods disclosed herein can also contain an internal ribosome entry site (IRES) sequence. The IRES sequence can be any viral, chromosomal, or artificially designed sequence that initiates cap-independent ribosome binding to mRNA and promotes translation initiation. Any solute suitable for cell electroporation can be included, including factors that promote cell permeability and viability, such as sugars, peptides, lipids, proteins, antioxidants, and detergents.

[0389] RNA can be introduced into target cells using any of several different methods, including, but not limited to, commercially available methods such as electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Mass.), or Gene Pulser II (BioRad, Denver, Colo.), Multiporator (Eppendort, Hamburg, Germany), cationic liposome-mediated transfection using lipofection, polymer encapsulation, peptide-mediated transfection, or biolistic particle delivery systems, e.g., "gene guns" (see, e.g., Nishikawa, et al., Hum Gene Ther., 12(8):861-70 (2001)).

[0390] For more information regarding the generation and use of TFP T cells, see U.S. Patent Nos. 10,442,849, 10,358,473, 10,358,474, and 10,208,285, each of which is incorporated herein by reference.

[0391] Recombinant nucleic acids encoding TFP and TCR constant domains In some embodiments, the CD70 TFP described herein can further comprise a sequence encoding a TCR constant domain, where the TCR constant domain is a TCR alpha constant domain, a TCR beta constant domain, a TCR alpha and a TCR beta constant domain, a TCR gamma constant domain, a TCR delta constant domain, or a TCR gamma and a TCR delta constant domain. The TCR subunit and the antibody can be operably linked. When expressed in a T cell, the TFP can functionally integrate into a TCR complex (e.g., an endogenous TCR complex).

[0392] The constant domain may comprise a constant domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, or a TCR delta chain. The constant domain may comprise a full-length constant domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, or a TCR delta chain. The constant domain may comprise a fragment (e.g., a functional fragment) of a full-length constant domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, or a TCR delta chain. For example, the constant domain may comprise at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, or more amino acid residues of a constant domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, or a TCR delta chain. The sequence encoding the constant domain of the TCR may further encode the transmembrane domain and / or intracellular region of the TCR α chain, TCR β chain, TCR γ chain, or TCR δ chain. The sequence encoding the constant domain of the TCR may encode the full-length constant region of the TCR α chain, TCR β chain, TCR γ chain, or TCR δ chain. The constant region of the TCR chain may comprise the constant domain, the transmembrane domain, and the intracellular region. The constant region of the TCR may also exclude the transmembrane domain and the intracellular region of the TCR α chain, TCR β chain, TCR γ chain, or TCR δ chain.

[0393] The TCR α, TCR β, TCR γ, or TCR δ chains described herein can be derived from various species. The TCR chains can be mouse or human TCR chains. For example, the constant domains can include the constant domains of mouse or human TCR α, TCR β, TCR γ, or TCR δ chains.

[0394] The murine TCR alpha constant domain can comprise positions 2-137 of SEQ ID NO: 1267. The murine TCR alpha constant domain can comprise truncations, additions, or substitutions of the constant domain sequences described herein. For example, the constant domain can comprise a truncated form of the constant domain described herein having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, or more amino acid residues from positions 2-137 of SEQ ID NO: 1267. For example, the constant domain can comprise a sequence having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more additional amino acid residues from positions 2 to 137 of SEQ ID NO: 1267. For example, the constant domain can comprise a sequence having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more amino acid substitutions from positions 2 to 137 of SEQ ID NO: 1267. The constant domain can comprise the sequence of positions 2 to 137 of SEQ ID NO: 1267 or a fragment thereof. The constant domain may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modifications, mutations or deletions of the sequence from positions 2 to 137 of SEQ ID NO: 1267. The constant domain may comprise up to 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 modifications, mutations or deletions of the sequence from positions 2 to 137 of SEQ ID NO: 1267. The constant domain may comprise a sequence having at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity to the sequence from positions 2 to 137 of SEQ ID NO: 1267.

[0395] The murine TCR β constant domain can comprise positions 2-173 of SEQ ID NO: 1268. The murine TCR β constant domain can comprise truncations, additions, or substitutions of the constant domain sequences described herein. For example, the constant domain can comprise a truncated form of the constant domain described herein having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, or more amino acid residues from positions 2-173 of SEQ ID NO: 1268. For example, the constant domain can comprise a sequence having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more additional amino acid residues from positions 2 to 173 of SEQ ID NO: 1268. For example, the constant domain can comprise a sequence having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more amino acid substitutions from positions 2 to 173 of SEQ ID NO: 1268. The constant domain can comprise the sequence of positions 22 to 173 of SEQ ID NO: 1268 or a fragment thereof. The constant domain may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modifications, mutations or deletions of the sequence from positions 2 to 173 of SEQ ID NO: 1268. The constant domain may comprise up to 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 modifications, mutations or deletions of the sequence from positions 2 to 173 of SEQ ID NO: 1268. The constant domain may comprise a sequence having at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity to the sequence from positions 2 to 173 of SEQ ID NO: 1268.

[0396] The TCRγ constant domain can comprise the amino acid sequence of SEQ ID NO:721, a functional fragment thereof, and at least one but not more than 20 modifications thereof. Optionally, the sequence encoding the TCRγ constant domain further encodes the TCRγ variable domain, and thus encodes the complete TCRγ domain. The complete TCRγ domain can be γ9 or γ4. The complete TCRγ domain can comprise SEQ ID NO:1269, a functional fragment thereof, and at least one but not more than 20 modifications thereof.

[0397] The TCRδ constant domain may comprise SEQ ID NO: 725, a functional fragment thereof, or the amino acid sequence thereof with at least one but not more than 20 modifications. Optionally, the sequence encoding the TCRδ constant domain further encodes the TCRδ variable domain and therefore encodes the complete TCRδ domain. The complete TCRδ domain may be δ2 or δ1. The complete TCRδ constant domain may comprise SEQ ID NO: 1270, a functional fragment thereof, or the amino acid sequence thereof with at least one but not more than 20 modifications.

[0398] In some examples, the sequence encoding the constant domain of the TCR may further encode a second antigen-binding domain or ligand-binding domain operably linked to the sequence encoding the constant domain of the TCR.

[0399] In some embodiments, the constant domains of TCR alpha and / or TCR beta are co-expressed with TFP in cells in which TRAC or TRBCs are inactivated, hi some embodiments, the constant domains of TCR gamma and / or TCR delta are co-expressed with TFP in cells in which TRAC or TRBCs are inactivated.

[0400] Switch molecules In some examples, the engineered T cells further comprise a nucleic acid encoding an inhibitory molecule, which comprises a first polypeptide comprising at least a portion of the inhibitory molecule and is associated with a second polypeptide comprising a positive signal from an intracellular signaling domain. In some examples, the inhibitory molecule comprises a first polypeptide comprising at least a portion of PD-1 and a second polypeptide comprising a costimulatory domain and a primary signaling domain. In some embodiments, T cells expressing a TFP described herein and a PD-1 switch molecule described herein can inhibit tumor growth when expressed in a T cell.

[0401] Disclosed herein, in some embodiments, is a recombinant nucleic acid molecule comprising a first sequence encoding a TFP described herein and a second nucleic acid sequence encoding an agent that can enhance the activity of an engineered T cell that expresses a TFP described herein. In some embodiments, the second nucleic acid sequence is comprised in a separate nucleic acid molecule. In some embodiments, the second nucleic acid sequence is comprised in the same nucleic acid molecule as the recombinant nucleic acid molecule. For example, in one embodiment, the agent that can enhance the activity of the engineered T cell can be a PD-1 polypeptide. In these embodiments, the PD-1 polypeptide can be operably linked to the N-terminus of the intracellular domain of a costimulatory polypeptide via the C-terminus of the PD-1 polypeptide. For example, in another embodiment, the agent that can enhance the activity of the engineered T cell can be an anti-PD-1 antibody, or an antigen-binding fragment thereof. In this embodiment, the anti-PD-1 antibody, or antigen-binding fragment thereof, can be operably linked to the N-terminus of the intracellular domain of a costimulatory polypeptide via the C-terminus of the anti-PD-1 antibody, or antigen-binding fragment thereof. In some embodiments, the PD-1 polypeptide or anti-PD-1 antibody is linked to the intracellular domain of the costimulatory polypeptide via the transmembrane domain of PD-1. In some embodiments, the costimulatory polypeptide is selected from the group consisting of OX40, CD2, CD27, CD5, ICAM-1, ICOS (CD278), 4-1BB (CD137), GITR, CD28, CD30, CD40, IL-15Ra, IL12R, IL18R, IL21R, BAFFR, HVEM, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, CD226, FcγRI, FcγRII, and FcγRIII. In some embodiments, the costimulatory peptide is CD28.

[0402] Disclosed herein, in some embodiments, is a recombinant nucleic acid molecule comprising a sequence encoding a TFP described herein, wherein the recombinant nucleic acid molecule further comprises an agent capable of enhancing the activity of an engineered T cell expressing a TFP described herein. In another aspect, the TFP-expressing cells described herein can further express another agent, e.g., an agent that enhances the activity of an engineered T cell. For example, in one embodiment, the agent can be an agent that inhibits an inhibitory molecule. Inhibitory molecules, e.g., PD-1, can, in some embodiments, attenuate the ability of an engineered T cell to mount an immune effector response. Examples of inhibitory molecules include PD-1, PD-L1, CTLA4, TIM3, LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, and 2B4. In one embodiment, the agent that inhibits an inhibitory molecule comprises a first polypeptide, e.g., an inhibitory molecule, associated with a second polypeptide that provides a positive signal to the cell, e.g., an intracellular signaling domain described herein. In one embodiment, the agent comprises a first polypeptide, e.g., of an inhibitory molecule such as PD-1, LAG3, CTLA4, CD160, BTLA, LAIR1, TIM3, 2B4, and TIGIT, or a fragment of any of these (e.g., at least a portion of the extracellular domain of any of these), and a second polypeptide that is an intracellular signaling domain described herein (e.g., a costimulatory domain (e.g., 4-1BB, CD27, or CD28, e.g., as described herein) and / or a primary signaling domain (e.g., a CD3ζ signaling domain described herein). In some embodiments, the agent comprises a first polypeptide of PD-1 or a fragment thereof (e.g., at least a portion of the extracellular domain of PD-1) and a second polypeptide of an intracellular signaling domain described herein (e.g., a CD28 signaling domain described herein and / or a CD3ζ signaling domain described herein). In some embodiments, the recombinant nucleic acid molecules described herein further comprise a sequence encoding PD-1 or a fragment thereof. In some embodiments, the recombinant nucleic acid molecules described herein further comprise a sequence encoding the extracellular domain of PD-1.In some embodiments, a recombinant nucleic acid molecule described herein comprises a sequence encoding the extracellular and transmembrane domains of PD-1. In some embodiments, a recombinant nucleic acid molecule described herein may further comprise a sequence encoding CD28 or a fragment thereof. In some embodiments, a recombinant nucleic acid molecule described herein comprises a sequence encoding the intracellular domain of CD28. In some embodiments, a recombinant nucleic acid molecule described herein comprises a sequence encoding a fusion protein comprising the extracellular and transmembrane domains of PD-1 linked to the intracellular domain of CD28 linked to the intracellular domain. In some embodiments, the agent comprises the extracellular and transmembrane domains of PD-1 fused to the intracellular signaling domain of CD28. In some embodiments, the agent comprises SEQ ID NO: 1239. PD1 is an inhibitory member of the CD28 family of receptors, which also includes CD28, CTLA-4, ICOS, and BTLA. PD-1 is expressed on activated B cells, T cells, and myeloid cells (Agata et al., 1996, Int. Immunol 8:765-75). Two ligands for PD1, PD-L1 and PD-L2, have been shown to downregulate T cell activation upon binding to PD1 (Freeman et al., 2000 J. Exp. Med. 192:1027-34; Latchman et al., 2001 Nat. Immunol. 2:261-8; Carter et al., 2002 Eur. J. Immunol. 32:634-43). PD-L1 is abundant in human cancers (Dong et al., 2003 J. Mol. Med. 81:281-7; Blank et al., 2005 Cancer Immunol. Immunother. 54:307-314; Konishi et al., 2004 Clin. Cancer Res. 10:5094). Immune suppression can be reversed by inhibiting the local interaction between PD1 and PD-L1.

[0403] In one embodiment, the agent comprises the extracellular domain (ECD) of an inhibitory molecule, e.g., PD-1, which can be fused to a transmembrane domain and optionally an intracellular signaling domain, e.g., 41BB and CD3ζ (also referred to herein as PD-1 TFP). In one embodiment, the PD-1 TFP improves T cell persistence when used in combination with an anti-TAA TFP described herein. In one embodiment, the TFP is a PD-1 TFP comprising the extracellular domain of PD-1. Alternatively, provided is a TFP comprising an antibody or antibody fragment, e.g., an scFv, that specifically binds to programmed death-ligand 1 (PD-L1) or programmed death-ligand 2 (PD-L2).

[0404] In one aspect, the disclosure provides a population of cells, wherein at least one cell in the population expresses a TFP having a domain described herein, and a second cell expressing another agent, e.g., an agent that enhances the activity of the engineered T cell. For example, in one embodiment, the agent can be an agent that inhibits an inhibitory molecule. An inhibitory molecule, for example, can, in some embodiments, attenuate the ability of the engineered T cell to mount an immune effector response. Examples of inhibitory molecules include PD-1, PD-L1, PD-L2, CTLA4, TIM3, LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, and 2B4. In one embodiment, the agent that inhibits an inhibitory molecule comprises a first polypeptide, e.g., an inhibitory molecule, associated with a second polypeptide that provides a positive signal to the cell, e.g., an intracellular signaling domain described herein.

[0405] Recombinant nucleic acid encoding a switch molecule Disclosed herein is a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding a T cell receptor (TCR) fusion protein (TFP) described herein and a second nucleic acid sequence encoding a switch molecule described herein. In some embodiments, the recombinant nucleic acid molecule comprises a first nucleic acid sequence encoding the T cell receptor (TCR) fusion protein (TFP) and a second nucleic acid sequence encoding an inhibitory molecule comprising a first polypeptide comprising at least a portion of an inhibitory molecule associated with a second polypeptide comprising a positive signal from an intracellular signaling domain. In some embodiments, the recombinant nucleic acid molecule comprises a first nucleic acid sequence encoding the T cell receptor (TCR) fusion protein (TFP) and a second nucleic acid sequence encoding an inhibitory molecule comprising a first polypeptide comprising at least a portion of PD-1 and a second polypeptide comprising a costimulatory domain and a primary signaling domain. In some embodiments, T cells expressing a TFP described herein and a PD-1 switch molecule described herein can inhibit tumor growth when expressed in T cells.

[0406] IL-15 and IL-15 receptor alpha polypeptides In some aspects, the TFP-expressing cells described herein may further express another agent, e.g., an agent that can extend the lifespan or enhance the activity of the TFP-expressing cells described herein. In some embodiments, the agent is a cytokine, e.g., a pleiotropic cytokine, that plays an important role in the maintenance and homeostatic proliferation of immune cells. In some embodiments, local secretion of pleiotropic cytokines in the tumor microenvironment (TME) may contribute to enhanced anti-tumor immunity. In some embodiments, the agent activates cytokine signaling. In some embodiments, the agent activates interleukin-15 (IL-15) signaling. In some embodiments, the agent comprises interleukin-15 (IL-15) and / or interleukin-15 receptor (IL-15R). In some embodiments, the IL-15R is the IL-15Rα (IL-15Rα) subunit.

[0407] The present disclosure encompasses recombinant nucleic acid molecules encoding interleukin-15 (IL-15) polypeptides or fragments thereof. In some embodiments, the IL-15 polypeptides or fragments thereof include IL-15 polypeptides 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 1 9, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84 , 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122 In some embodiments, the IL-15 polypeptide or fragment thereof comprises 2, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or more consecutive amino acid residues. In some embodiments, the IL-15 polypeptide or fragment thereof comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more sequence identity to a sequence encoding IL-15. In some embodiments, the IL-15 polypeptide or fragment thereof comprises a sequence encoding IL-15 with at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acid deletions at its N-terminus or C-terminus or at both the N- and C-terminus.

[0408] In some embodiments, the IL-15 polypeptide or fragment thereof may comprise an IL-15 signal peptide. In some embodiments, the IL-15 polypeptide or fragment thereof may comprise amino acids 1-29 of IL-15. In some embodiments, the IL-15 polypeptide or fragment thereof may comprise amino acids 1-29 of SEQ ID NO: 1245. In some embodiments, the IL-15 polypeptide or fragment thereof may comprise the sequence of SEQ ID NO: 1246. In some embodiments, the IL-15 polypeptide or fragment thereof may comprise amino acids 30-162 of IL-15. In some embodiments, the IL-15 polypeptide or fragment thereof may comprise amino acids 30-162 of SEQ ID NO: 1245. In some embodiments, the IL-15 polypeptide or fragment thereof may comprise any one of the sequences set forth in Table 11 or a fragment thereof. In some embodiments, the IL-15 polypeptide or fragment thereof may comprise the sequence of SEQ ID NO: 1242. In some embodiments, the IL-15 polypeptide or fragment thereof may comprise amino acids 1-162 of SEQ ID NO: 1245. In some embodiments, the IL-15 polypeptide or fragment thereof may comprise the sequence of SEQ ID NO: 1246 and the sequence of SEQ ID NO: 1242. In some embodiments, the IL-15 polypeptide is secreted when expressed in a cell, e.g., a T cell.

[0409] The present disclosure further encompasses recombinant nucleic acid molecules encoding interleukin-15 receptor (IL-15R) subunit polypeptides or fragments thereof. For example, the IL-15R subunits can be the IL-15 receptor alpha chain ("IL-15Rα" or CD215), the IL-2 receptor beta chain ("IL-2Rβ" or CD122), and the IL-2 receptor gamma / common gamma chain ("IL-2Rγ / γc" or CD132). In some embodiments, the IL-15R subunit is IL-15Rα or a fragment thereof.In some embodiments, the IL-15Rα polypeptide or fragment thereof comprises one of the following: , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250 or more consecutive amino acid residues.In some embodiments, the IL-15Rα polypeptide or fragment thereof comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more sequence identity to a sequence encoding IL-15Rα. In some embodiments, the IL-15Rα polypeptide or fragment thereof comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 20, and sequences encoding IL-15Rα having 6, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more amino acid deletions at its N-terminus or C-terminus, or at both the N- and C-terminus.

[0410] In some embodiments, the IL-15Rα polypeptide or fragment thereof may include an IL-15Rα signal peptide. In some embodiments, the IL-15Rα polypeptide or fragment thereof may include amino acids 1-30 of IL-15Rα. In some embodiments, the IL-15Rα polypeptide or fragment thereof may include amino acids 1-30 of SEQ ID NO: 1247. In some embodiments, the IL-15Rα polypeptide or fragment thereof does not include an IL-15Rα signal peptide. In some embodiments, the IL-15Rα polypeptide or fragment thereof does not include amino acids 1-30 of IL-15Rα. In some embodiments, the IL-15Rα polypeptide or fragment thereof does not include amino acids 1-30 of SEQ ID NO: 1247.

[0411] In some embodiments, the IL-15Rα polypeptide or fragment thereof may comprise the Sushi domain of IL-15Rα. In some embodiments, the IL-15Rα polypeptide or fragment thereof may comprise amino acids 31-95 of IL-15Rα. In some embodiments, the IL-15Rα polypeptide or fragment thereof may comprise amino acids 31-95 of SEQ ID NO: 1247. In some embodiments, the IL-15Rα polypeptide or fragment thereof may comprise the sequence of SEQ ID NO: 1250.

[0412] In some embodiments, the IL-15Rα polypeptide or fragment thereof may comprise the intracellular domain of IL-15Rα. In some embodiments, the IL-15Rα polypeptide or fragment thereof may comprise amino acids 229-267 of IL-15Rα. In some embodiments, the IL-15Rα polypeptide or fragment thereof may comprise amino acids 229-267 of the sequence of SEQ ID NO: 1247. In some embodiments, the IL-15Rα polypeptide or fragment thereof may comprise the sequence of SEQ ID NO: 1248.

[0413] In some embodiments, the IL-15Rα polypeptide or fragment thereof may comprise the sushi domain, transmembrane domain, and intracellular domain of IL-15Rα. In some embodiments, the IL-15Rα polypeptide or fragment thereof may comprise amino acids 31-267 of IL-15Rα. In some embodiments, the IL-15Rα polypeptide or fragment thereof may comprise amino acids 31-267 of SEQ ID NO: 1247. In some embodiments, the IL-15Rα polypeptide or fragment thereof may comprise the sequence of SEQ ID NO: 1250. In some embodiments, the IL-15Rα polypeptide or fragment thereof may comprise the sequence of SEQ ID NO: 1251. In some embodiments, the IL-15Rα polypeptide or fragment thereof may comprise amino acids 96-267 of SEQ ID NO: 1247. In some embodiments, the IL-15Rα polypeptide or fragment thereof may comprise the sequence of SEQ ID NO: 1250 and the sequence of SEQ ID NO: 1251.

[0414] In some embodiments, the IL-15Rα polypeptide or fragment thereof can be soluble IL-15Rα (sIL-15Rα). In some embodiments, the IL-15Rα polypeptide or fragment thereof can comprise amino acids 21-205 of IL-15Rα. In some embodiments, the IL-15Rα polypeptide or fragment thereof can comprise amino acids 21-205 of the sequence of SEQ ID NO: 1247. In some embodiments, the IL-15Rα polypeptide or fragment thereof can comprise the sequence of SEQ ID NO: 1249.

[0415] The present disclosure encompasses recombinant nucleic acid molecules encoding fusion proteins comprising an IL-15 polypeptide linked to an IL-15R subunit. In some embodiments, the IL-15 and IL-15R subunit are operably linked by a linker. In some embodiments, the IL-15R subunit is IL-15Rα (IL-15Rα). For example, the IL-15 polypeptide can be linked to the N-terminus of the IL-15Rα subunit. For example, the IL-15 polypeptide can be linked to the C-terminus of the IL-15Rα subunit. In some embodiments, the IL-15 and IL-15Rα are operably linked by a linker. In some embodiments, the linker is not a cleavable linker. For example, the linker is a (G4S) n where G is glycine, S is serine, and n is an integer between 1 and 10. In some embodiments, n is an integer between 1 and 4. In some embodiments, n is 3. In some embodiments, the linker comprises the sequence of SEQ ID NO: 1243.

[0416] In some embodiments, the fusion protein may comprise amino acids 30-162 of IL-15. In some embodiments, the fusion protein may comprise amino acids 30-162 of the sequence of SEQ ID NO: 1245. In some embodiments, the fusion protein may comprise any one of the sequences set forth in Table 11, or fragments thereof. In some embodiments, the fusion protein may comprise the sequence of SEQ ID NO: 1242. In some embodiments, the fusion protein does not comprise the IL-15 signal peptide. In some embodiments, the fusion protein does not comprise amino acids 1-29 of IL-15. In some embodiments, the fusion protein does not comprise amino acids 1-29 of the sequence of SEQ ID NO: 1245. In some embodiments, the fusion protein does not comprise the sequence of SEQ ID NO: 1246.

[0417] In some embodiments, the fusion protein may comprise a Sushi domain. In some embodiments, the fusion protein may comprise amino acids 31-95 of IL-15Rα. In some embodiments, the fusion protein may comprise amino acids 31-95 of the sequence of SEQ ID NO: 1247. In some embodiments, the fusion protein may comprise the sequence of SEQ ID NO: 1250.

[0418] In some embodiments, the fusion protein may comprise the intracellular domain of IL-15Rα. In some embodiments, the fusion protein may comprise amino acids 229-267 of IL-15Rα. In some embodiments, the fusion protein may comprise amino acids 229-267 of the sequence of SEQ ID NO: 1247. In some embodiments, the fusion protein may comprise the sequence of SEQ ID NO: 1248.

[0419] In some embodiments, the fusion protein may comprise soluble IL-15Rα (sIL-15Rα). In some embodiments, the fusion protein may comprise amino acids 21-205 of IL-15Rα. In some embodiments, the fusion protein may comprise amino acids 21-205 of the sequence of SEQ ID NO: 1247. In some embodiments, the fusion protein may comprise the sequence of SEQ ID NO: 1249.

[0420] In some embodiments, the fusion protein may comprise the transmembrane and intracellular domains of IL-15Rα. In some embodiments, the fusion protein may comprise amino acids 96-267 of IL-15Rα. In some embodiments, the fusion protein may comprise amino acids 96-267 of the sequence of SEQ ID NO: 1247. In some embodiments, the fusion protein may comprise the sequence of SEQ ID NO: 1251.

[0421] In some embodiments, the fusion protein may comprise the Sushi domain, transmembrane domain, and intracellular domain of IL-15Rα. In some embodiments, the fusion protein may comprise amino acids 31-267 of IL-15Rα. In some embodiments, the fusion protein may comprise amino acids 31-267 of the sequence of SEQ ID NO: 1247. In some embodiments, the fusion protein may comprise the sequence of SEQ ID NO: 1250 and the sequence of SEQ ID NO: 1251.

[0422] In some embodiments, the fusion protein further comprises an epitope tag. The epitope tags described herein may be peptide epitope tags or protein epitope tags. Examples of peptide epitope tags include, but are not limited to, 6xHis (also known as His tag or hexahistidine tag), FLAG (e.g., 3xFLAG), HA, Myc, and V5. Examples of protein epitope tags include, but are not limited to, green fluorescent protein (GFP), glutathione-S-transferase (GST), β-galactosidase (β-GAL), luciferase, maltose-binding protein (MBP), red fluorescent protein (RFP), and vesicular stomatitis virus glycoprotein (VSV-G). In some embodiments, the fusion protein further comprises a FLAG tag. In some embodiments, the fusion protein further comprises a 3xFLAG tag. In some embodiments, the fusion protein further comprises the sequence of SEQ ID NO: 1255.

[0423] Flag x 3 DYKDDDDKDYKDDDDKDYKDDDDK (SEQ ID NO: 1255) In some embodiments, the fusion protein is expressed on the cell surface when expressed in T cells, hi some embodiments, the fusion protein is secreted when expressed in T cells.

[0424] In some aspects, cells expressing TFP, an IL-15 peptide or fragment thereof, an IL-15Rα polypeptide or fragment thereof, and / or a fusion protein comprising an IL-15 polypeptide and an IL-15Rα polypeptide described herein can further express another agent capable of enhancing the activity of an engineered T cell expressing TFP. For example, in one embodiment, the agent capable of enhancing the activity of the engineered T cell can be a PD-1 polypeptide. In these embodiments, the PD-1 polypeptide can be operably linked to the N-terminus of the intracellular domain of a costimulatory polypeptide via the C-terminus of the PD-1 polypeptide. For example, in another embodiment, the agent capable of enhancing the activity of the engineered T cell expressing TFP can be an anti-PD-1 antibody, or antigen-binding fragment thereof. In this embodiment, the anti-PD-1 antibody, or antigen-binding fragment thereof, can be operably linked to the N-terminus of the intracellular domain of a costimulatory polypeptide via the C-terminus of the anti-PD-1 antibody, or antigen-binding fragment thereof. In some embodiments, the PD-1 polypeptide or anti-PD-1 antibody is linked to the intracellular domain of the costimulatory polypeptide via the transmembrane domain of PD-1. In some embodiments, the costimulatory polypeptide is selected from the group consisting of OX40, CD2, CD27, CDS, ICAM-1, ICOS (CD278), 4-1BB (CD137), GITR, CD28, CD30, CD40, BAFFR, HVEM, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, CD226, FcγRI, FcγRII, and FcγRIII. In some embodiments, the costimulatory polypeptide is CD28.

[0425] In some aspects, an agent capable of enhancing the activity of the engineered T cells expressing TFP can be linked to an IL-15Rα polypeptide or fragment thereof. For example, the agent can be an agent capable of inhibiting an inhibitory molecule that can reduce the ability of TFP-expressing T cells to mount an immune effector response. In some embodiments, the agent that inhibits the inhibitory molecule comprises a first polypeptide, e.g., an inhibitory molecule, associated with a second polypeptide that provides a positive signal to the cell, e.g., an intracellular signaling domain described herein. In one embodiment, the agent may comprise a first polypeptide, e.g., that of an inhibitory molecule such as PD-1, LAG3, CTLA4, CD160, BTLA, LAIR1, TIM3, 2B4, and TIGIT, or a fragment of any of these (e.g., at least a portion of the extracellular domain of any of these), and a second polypeptide that is an intracellular signaling domain described herein (e.g., a costimulatory domain (e.g., 4-1BB, CD27, or CD28 described herein)) and / or a primary signaling domain (e.g., IL-15Rα described herein). In some embodiments, the agent may be PD-1 or a fragment thereof. For example, the agent may comprise the extracellular domain of PD-1. In some embodiments, the agent may comprise the extracellular domain and transmembrane domain of PD-1. In some embodiments, the agent may further comprise CD28 or a fragment thereof. In some embodiments, the agent may comprise the intracellular domain of CD28. In some embodiments, the agent may comprise a fusion protein comprising the extracellular and transmembrane domains of PD-1 linked to the intracellular domain of CD28 linked to IL-15Rα, hi some embodiments, the intracellular domain of CD28 is linked to the intracellular domain of IL-15Rα.

[0426] In some embodiments, the PD-1 or fragment thereof may comprise any one of the sequences set forth in Table 10 or a fragment thereof. In some embodiments, the PD-1 or fragment thereof may comprise the sequence of SEQ ID NO: 1256. In some embodiments, the PD-1 or fragment thereof may comprise the sequence of SEQ ID NO: 1257. In some embodiments, the PD-1 or fragment thereof may comprise the sequence of SEQ ID NO: 1258. In some embodiments, the PD-1 or fragment thereof may comprise the sequence of SEQ ID NO: 1259. In some embodiments, the PD-1 transmembrane domain may comprise the sequence of SEQ ID NO: 1239. In some embodiments, the CD28 intracellular domain may comprise the sequence of SEQ ID NO: 1260. In some embodiments, the IL-15Rα intracellular domain comprises amino acids 229-267 of IL-15Rα. In some embodiments, the IL-15Rα intracellular domain comprises amino acids 229-267 of the sequence of SEQ ID NO: 1247. In some embodiments, the fusion protein comprises the sequence of SEQ ID NO: 1248.

[0427] In some aspects, an agent capable of enhancing the activity of the engineered T cell expressing TFP can be linked to a fusion protein comprising an IL-15 polypeptide and an IL-15Rα polypeptide. In some embodiments, the agent can be PD-1 or a fragment thereof. For example, the agent can include the extracellular domain of PD-1. In some embodiments, the agent can include the extracellular domain and transmembrane domain of PD-1. In some embodiments, the agent can further include CD28 or a fragment thereof. In some embodiments, the agent can include the intracellular domain of CD28. In some embodiments, the agent can include a fusion protein comprising the extracellular domain and transmembrane domain of PD-1 linked to the intracellular domain of CD28 linked to a fusion protein comprising an IL-15 polypeptide and an IL-15Rα polypeptide. In some embodiments, the intracellular domain of CD28 is linked to the intracellular domain of IL-15Rα. In some embodiments, the intracellular domain of IL-15Rα is linked to the IL-15 polypeptide by a linker described herein. In some embodiments, the linker comprises a cleavage site. The cleavage site can be a self-cleaving peptide, such as a T2A, P2A, E2A, or F2A cleavage site. In some embodiments, the cleavage site can comprise the sequence of SEQ ID NO: 1261 (P2A:GSGATNFSLLKQAGDVEENPG).

[0428] In some embodiments, the fusion protein may comprise PD-1 or a fragment thereof comprising any one of the sequences set forth in Table 10 or a fragment thereof. In some embodiments, the fusion protein may comprise PD-1 or a fragment thereof comprising the sequence of SEQ ID NO: 1256. In some embodiments, the fusion protein may comprise PD-1 or a fragment thereof comprising the sequence of SEQ ID NO: 1257. In some embodiments, the fusion protein may comprise PD-1 or a fragment thereof comprising the sequence of SEQ ID NO: 1258. In some embodiments, the fusion protein may comprise PD-1 or a fragment thereof comprising the sequence of SEQ ID NO: 1259. In some embodiments, the fusion protein may comprise PD-1 or a fragment thereof comprising the transmembrane domain of PD-1 comprising the sequence of SEQ ID NO: 1239. In some embodiments, the fusion protein may comprise CD28 or a fragment comprising the intracellular domain of CD28 comprising the sequence of SEQ ID NO: 1260. In some embodiments, the intracellular domain of IL-15Rα comprises amino acids 229-267 of IL-15Rα. In some embodiments, the intracellular domain of IL-15Rα comprises amino acids 229-267 of the sequence of SEQ ID NO: 1247. In some embodiments, the fusion protein comprises the sequence of SEQ ID NO: 1248. In some embodiments, the IL-15 polypeptide comprises an IL-15 signal peptide. In some embodiments, the IL-15 polypeptide comprises amino acids 1-29 of IL-15. In some embodiments, the IL-15 polypeptide comprises amino acids 1-29 of the sequence of SEQ ID NO: 1245. In some embodiments, the IL-15 polypeptide comprises the sequence of SEQ ID NO: 1246. In some embodiments, the IL-15 polypeptide comprises amino acids 30-162 of IL-15. In some embodiments, the IL-15 polypeptide comprises amino acids 30-162 of the sequence of SEQ ID NO: 1245. In some embodiments, the IL-15 polypeptide comprises the sequence of SEQ ID NO: 1242.

[0429] Disclosed herein, in some embodiments, is a polypeptide encoded by any of the recombinant nucleic acid molecules described herein. Recombinant nucleic acids encoding IL-15 and / or IL-15Rα Disclosed herein is a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding a T cell receptor (TCR) fusion protein (TFP) described herein and a second nucleic acid sequence encoding an interleukin-15 (IL-15) polypeptide or fragment thereof. Disclosed herein is a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding a T cell receptor (TCR) fusion protein (TFP) and a second nucleic acid sequence encoding an interleukin-15 receptor alpha (IL-15Rα) polypeptide or fragment thereof. Also disclosed herein is a recombinant nucleic acid molecule that is a first nucleic acid sequence encoding a T cell receptor (TCR) fusion protein (TFP) and a second nucleic acid sequence encoding a fusion protein comprising an IL-15 polypeptide or fragment thereof linked to an IL-15Rα polypeptide or fragment thereof. Also disclosed herein are recombinant nucleic acid molecules that are a first nucleic acid sequence encoding a T cell receptor (TCR) fusion protein (TFP) and a second nucleic acid sequence encoding a fusion protein, including a fusion protein comprising an IL-15Rα polypeptide or a fragment thereof linked to PD-1 or a fragment thereof and / or to CD28 or a fragment thereof.

[0430] Disclosed herein are recombinant nucleic acid molecules comprising a first nucleic acid sequence encoding a TFP described herein and a second nucleic acid sequence encoding an IL-15 polypeptide or a fragment thereof. Any recombinant nucleic acid molecule comprising a nucleic acid sequence encoding a TFP described herein further comprises a second nucleic acid sequence encoding an IL-15 polypeptide or a fragment thereof. Also disclosed herein are recombinant nucleic acid molecules comprising a first nucleic acid sequence encoding a TFP described herein and a second nucleic acid sequence encoding an IL-15Rα polypeptide or a fragment thereof. Any recombinant nucleic acid molecule comprising a nucleic acid sequence encoding a TFP described herein further comprises a second nucleic acid sequence encoding an IL-15Rα polypeptide or a fragment thereof.

[0431] Disclosed herein, in some embodiments, is a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding a TFP described herein and a second nucleic acid sequence encoding an IL-15 polypeptide or fragment thereof, wherein the first nucleic acid sequence and the second nucleic acid sequence are comprised in two separate nucleic acid molecules. Disclosed herein, in some embodiments, is a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding a TFP described herein and a second nucleic acid sequence encoding an IL-15 polypeptide or fragment thereof, wherein the first nucleic acid sequence and the second nucleic acid sequence are comprised in a single nucleic acid molecule. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are operably linked by a first linker. Also disclosed herein, in some embodiments, is a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding a TFP described herein and a second nucleic acid sequence encoding an IL-15Rα polypeptide or fragment thereof, wherein the first nucleic acid sequence and the second nucleic acid sequence are comprised in two separate nucleic acid molecules. Also disclosed herein, in some embodiments, is a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding a TFP described herein and a second nucleic acid sequence encoding an IL-15Rα polypeptide or fragment thereof, wherein the first nucleic acid sequence and the second nucleic acid sequence are comprised in a single nucleic acid molecule. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are operably linked by a first linker. For example, the first linker can be a cleavable linker. In some embodiments, the first linker can comprise a protease cleavage site. The cleavage site can be a self-cleaving peptide, e.g., a 2A cleavage site, e.g., a T2A, P2A, E2A, or F2A cleavage site. In some embodiments, the protease cleavage site is a T2A cleavage site. The cleavage site, when expressed, can comprise the sequence of SEQ ID NO: 1238. In some embodiments, the first linker, when expressed, comprises the sequence of SEQ ID NO: 1238.

[0432] In some embodiments, the nucleic acid sequence encoding the IL-15 polypeptide, or a fragment thereof, may comprise a sequence encoding an IL-15 signal peptide. In some embodiments, the IL-15 signal peptide, when expressed, comprises amino acids 1-29 of SEQ ID NO: 1245. In some embodiments, the IL-15 signal peptide, when expressed, comprises the sequence of SEQ ID NO: 1246. In some embodiments, the nucleic acid sequence encoding the IL-15 polypeptide, or a fragment thereof, may comprise a sequence encoding amino acids 30-162 of SEQ ID NO: 1245. In some embodiments, the nucleic acid sequence encoding the IL-15 polypeptide, or a fragment thereof, may comprise a sequence encoding any one of the sequences set forth in Table 11 or a fragment thereof. In some embodiments, the nucleic acid sequence encoding the IL-15 polypeptide, or a fragment thereof, may comprise a sequence encoding the sequence of SEQ ID NO: 1242. In some embodiments, the nucleic acid sequence encoding the IL-15 polypeptide, or a fragment thereof, may comprise a sequence encoding amino acids 1-162 of SEQ ID NO: 1245. In some embodiments, the nucleic acid sequence encoding the IL-15 polypeptide, or fragment thereof, may comprise a sequence encoding the sequence of SEQ ID NO: 1246 and the sequence of SEQ ID NO: 1242. In some embodiments, the IL-15 polypeptide, or fragment thereof, is secreted when expressed in T cells. In some embodiments, the IL-15 polypeptide, when expressed, comprises the sequence of SEQ ID NO: 1242.

[0433] Disclosed herein, in some embodiments, is a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding a TFP described herein and a second nucleic acid sequence encoding an IL-15 polypeptide or fragment thereof and an IL-15R subunit or fragment thereof, wherein the first nucleic acid sequence and the second nucleic acid sequence are contained in two separate nucleic acid molecules. Disclosed herein, in some embodiments, is a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding a TFP described herein and a second nucleic acid sequence encoding an IL-15 polypeptide or fragment thereof and an IL-15R subunit or fragment thereof, wherein the first nucleic acid sequence and the second nucleic acid sequence are contained in a single nucleic acid molecule. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are operably linked by a first linker described herein. The IL-15R subunit can be IL-15Rα (IL-15Rα), IL-2Rβ (IL-2β), or IL-2Rγ / common γ chain (IL-2Rγ / γc). In some embodiments, the IL-15R subunit is IL-15Rα (IL-15Rα). In some embodiments, the IL-15 and IL-15R subunit are operably linked by a second linker. In some embodiments, the IL-15 and IL-15Rα are operably linked by a second linker. In some embodiments, the second linker is not a cleavable linker. For example, the second linker is (G4S) n where G is glycine, S is serine, and n is an integer between 1 and 10. In some embodiments, n is an integer between 1 and 4. In some embodiments, n is 3. In some embodiments, the second linker comprises the sequence of SEQ ID NO: 1243.

[0434] In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding the intracellular domain of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding amino acids 229-267 of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding amino acids 229-267 of SEQ ID NO: 1247. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding the sequence of SEQ ID NO: 1248.

[0435] In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding the Sushi domain of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding amino acids 31-95 of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding amino acids 31-95 of SEQ ID NO: 1247. In some embodiments, the nucleic acid sequence encoding the IL-15α polypeptide or fragment thereof may comprise a sequence encoding the sequence of SEQ ID NO: 1250.

[0436] In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding the transmembrane and intracellular domains of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding amino acids 96-267 of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding amino acids 96-267 of SEQ ID NO: 1247. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding the sequence of SEQ ID NO: 1251.

[0437] In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding the sushi domain, transmembrane domain, and intracellular domain of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding amino acids 31-267 of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding amino acids 31-267 of SEQ ID NO: 1247. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding the sequence of SEQ ID NO: 1250 and the sequence of SEQ ID NO: 1251.

[0438] In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding soluble IL-15Rα (sIL-15Rα). In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding amino acids 21-205 of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or fragment thereof may comprise a sequence encoding amino acids 21-205 of SEQ ID NO: 1247. In some embodiments, the nucleic acid sequence encoding the IL-15α polypeptide or fragment thereof may comprise a sequence encoding the sequence of SEQ ID NO: 1249.

[0439] Disclosed herein, in some embodiments, is a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding a TFP described herein and a second nucleic acid sequence encoding a fusion protein comprising an IL-15 polypeptide linked to an IL-15Rα subunit, wherein the first nucleic acid sequence and the second nucleic acid sequence are contained in two separate nucleic acid molecules. Disclosed herein, in some embodiments, is a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding a TFP described herein and a second nucleic acid sequence encoding a fusion protein comprising an IL-15 polypeptide linked to an IL-15Rα subunit, wherein the first nucleic acid sequence and the second nucleic acid sequence are contained in a single nucleic acid molecule. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are operably linked by a first linker described herein. For example, the IL-15 polypeptide can be linked to the N-terminus of the IL-15Rα subunit. For example, the IL-15 polypeptide can be linked to the C-terminus of the IL-15Rα subunit.

[0440] In some embodiments, the nucleic acid sequence encoding the fusion protein can comprise a sequence encoding amino acids 1-29 of IL-15. In some embodiments, the nucleic acid sequence encoding the fusion protein can comprise a sequence encoding amino acids 1-29 of SEQ ID NO: 1245. In some embodiments, the nucleic acid sequence encoding the fusion protein can comprise a sequence encoding the sequence of SEQ ID NO: 1246. In some embodiments, the nucleic acid sequence encoding the fusion protein can comprise a sequence encoding amino acids 30-162 of IL-15. In some embodiments, the nucleic acid sequence encoding the fusion protein can comprise a sequence encoding amino acids 30-162 of SEQ ID NO: 1245. In some embodiments, the nucleic acid sequence encoding the fusion protein can comprise a sequence encoding any one of the sequences set forth in Table 11 or a fragment thereof. In some embodiments, the nucleic acid sequence encoding the fusion protein can comprise a sequence encoding the sequence of SEQ ID NO: 1242. In some embodiments, the nucleic acid sequence encoding the fusion protein can comprise a sequence encoding amino acids 1-162 of IL-15. In some embodiments, the nucleic acid sequence encoding the fusion protein can comprise a sequence encoding amino acids 1-162 of SEQ ID NO: 1245. In some embodiments, the nucleic acid sequence encoding the fusion protein can include a sequence encoding the sequence of SEQ ID NO:1246 and a sequence encoding the sequence of SEQ ID NO:1242.

[0441] In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise a sequence encoding the intracellular domain of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise a sequence encoding amino acids 229-267 of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise a sequence encoding amino acids 229-267 of SEQ ID NO: 1247. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise a sequence encoding the sequence of SEQ ID NO: 1248.

[0442] In some embodiments, the nucleic acid sequence encoding the fusion protein may further comprise a sequence encoding the Sushi domain of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise a sequence encoding amino acids 31-95 of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise a sequence encoding amino acids 31-95 of SEQ ID NO: 1247. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise a sequence encoding the sequence of SEQ ID NO: 1250.

[0443] In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise a sequence encoding the transmembrane and intracellular domains of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise a sequence encoding amino acids 96-267 of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise a sequence encoding amino acids 96-267 of SEQ ID NO: 1247. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise a sequence encoding the sequence of SEQ ID NO: 1251.

[0444] In some e...

Claims

1. 1. A recombinant nucleic acid molecule comprising a sequence encoding a T cell receptor (TCR) fusion protein (TFP), said TFP comprising: (a) (i) to (iii) below: (i) at least a portion of the extracellular domain of a TCR; (ii) the transmembrane domain of a TCR, and (iii) the intracellular domain of the TCR a TCR subunit comprising: (b) an antigen-binding domain that specifically binds to CD70 Including; the TCR subunit and the antigen-binding domain are operably linked; the TFP, when expressed in a T cell, functionally interacts with an endogenous TCR complex; the recombinant nucleic acid molecule, wherein the antigen-binding domain that specifically binds to CD70 is a single-chain variable fragment (scFv) comprising the following (i) and (ii): (i) a heavy chain variable (VH) domain comprising a heavy chain complementarity determining region 1 (CDRH1) having the sequence of SEQ ID NO: 853, a CDRH2 having the sequence of SEQ ID NO: 906, and a CDRH3 having the sequence of SEQ ID NO: 959; (ii) a light chain variable (V L ) domain comprising a light chain complementarity determining region 1 (CDRL1) having the sequence of SEQ ID NO:1065, a CDRL2 having the sequence of SEQ ID NO:1118, and a CDRL3 having the sequence of SEQ ID NO:1171.

2. The recombinant nucleic acid molecule of claim 1, wherein at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are derived from the same TCR subunit, and the same TCR subunit is TCRα, TCRβ, TCRγ, TCRδ, CD3ε, CD3δ, or CD3γ.

3. 3. The recombinant nucleic acid molecule of claim 1 or 2, wherein the intracellular domain of the TCR comprises a stimulatory domain derived from the intracellular signaling domain of CD3γ, CD3δ, or CD3ε.

4. The antigen-binding domain is connected to the extracellular domain of the TCR by a linker, or the antigen-binding domain is (G ４ S) ｎ wherein G is glycine, S is serine, and n is an integer from 1 to 10.

5. (a) The antigen-binding domain binds to human CD70. Ｄ binds at a value of 100 nM or less or between 0.001 nM and 100 nM; (b) the antigen-binding domain competes with CD27 for binding to CD70, inhibits the interaction of CD70 with CD27, and / or binds to the same epitope on CD70 as CD27; (c) the antigen-binding domain specifically binds to an epitope within the amino acid sequence HRDGIYMVHIQVTLAICSSTTAS (SEQ ID NO: 1230); and / or (d) the antigen-binding domain specifically binds to a second epitope within the amino acid sequence ASRHHPTTLAVGICSPASRSISL (SEQ ID NO: 1231); A recombinant nucleic acid molecule according to any one of claims 1 to 4. Claim 6: The scFv has at least 90%, 95%, or 100% sequence identity to SEQ ID NO:

800. Ｈ domain, and V having at least 90%, 95%, or 100% sequence identity to SEQ ID NO: 1012 Ｌ A recombinant nucleic acid molecule according to any one of claims 1 to 5, comprising a domain.

7. The scFv, (i) the V of the sequence of SEQ ID NO: 1012 via its C-terminus Ｌ V of the sequence of SEQ ID NO: 800 operably linked to the N-terminus of the domain Ｈ domain; or (ii) the V of sequence SEQ ID NO: 800 via its C-terminus Ｈ V of the sequence of SEQ ID NO: 1012 operably linked to the N-terminus of the domain Ｌ domain The recombinant nucleic acid molecule according to any one of claims 1 to 6, comprising:

8. A recombinant nucleic acid molecule described in any one of claims 1 to 7, wherein the recombinant nucleic acid molecule further comprises a sequence encoding a TCR constant domain.

9. A recombinant nucleic acid molecule as described in claim 8, wherein the TCR constant domain is a TCRα constant domain or a portion thereof, a TCRβ constant domain or a portion thereof, a TCRα constant domain or a portion thereof and a TCRβ constant domain or a portion thereof, a TCRγ constant domain or a portion thereof, a TCRδ constant domain or a portion thereof, or a TCRγ constant domain or a portion thereof and a TCRδ constant domain or a portion thereof.

10. 10. The recombinant nucleic acid molecule of claim 1, wherein the scFv comprises a linker sequence having the sequence of SEQ ID NO: 1237 or a linker sequence having the sequence of SEQ ID NO:

782.

11. (a) T cells expressing TFP exhibit increased cytotoxicity against human cells expressing CD70 compared to T cells that do not contain TFP; (b) T cells expressing TFP inhibit tumor growth; and / or (c) T cells expressing TFP have reduced fratricide compared to TFP that does not specifically bind CD70; A recombinant nucleic acid molecule according to any one of claims 1 to 10.

12. 12. The recombinant nucleic acid molecule of any one of claims 1 to 11, wherein the recombinant nucleic acid molecule comprises a sequence encoding an amino acid sequence having at least 90%, 95%, 98%, 99%, or more sequence identity to any one of the amino acid sequences selected from SEQ ID NOs: 1236, 1240, and 1264.

13. The recombinant nucleic acid molecule of any one of claims 1 to 12, further comprising a promoter, a leader sequence, a sequence encoding a poly(A) tail, and / or a 3'UTR sequence.

14. A recombinant nucleic acid molecule described in any one of claims 1 to 13, wherein the recombinant nucleic acid molecule is a vector.

15. A cell comprising a recombinant nucleic acid molecule according to any one of claims 1 to 14.

16. The cell of claim 15, wherein the cell is a T cell and / or the cell comprises a functional disruption of the endogenous CD70 gene or a functional disruption of the endogenous CIITA gene.

17. A pharmaceutical composition comprising the cells of claim 15 or 16 and a pharmaceutically acceptable carrier for use in treating cancer in a subject in need thereof.

Images