Biocompatible copolymers containing multiple active agent molecules

Biocompatible polymers with site-specific coupling to antibodies or aptamers address the limitations of ADCs and aptamer-drug conjugates by increasing drug load and stability, ensuring efficient and targeted drug delivery.

JP7798315B2Active Publication Date: 2026-01-14CIS BIOPHARMA AG
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2020562711
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2018-05-10
Filing Date
2019-05-08
Publication Date
2026-01-14
Estimated Expiration
2039-05-08

AI Technical Summary

Technical Problem

Existing antibody-drug conjugates (ADCs) and aptamer-drug conjugates suffer from heterogeneity, low drug-to-antibody/aptamer ratios (DAR), instability, and rapid systemic clearance, limiting their efficacy in targeted drug delivery.

Method used

Development of biocompatible, hydrophilic, non-degradable polymers that are initially loaded with multiple active agent molecules, coupled site-specifically to antibodies or aptamers using enzymatic methods, ensuring high stability and target affinity while allowing for combination therapies.

Benefits of technology

The approach achieves homogeneous drug delivery with increased DAR, maintains target affinity, and facilitates renal clearance of the polymer, minimizing systemic side effects and enhancing therapeutic efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007798315000001
    Figure 0007798315000001
  • Figure 0007798315000002
    Figure 0007798315000002
  • Figure 0007798315000003
    Figure 0007798315000003
Patent Text Reader

Abstract

The present disclosure relates to the delivery of active agents, e.g., active pharmaceutical ingredients, using biocompatible copolymers containing side-chain-linked amino acids as delivery carriers, in which the active agents are bound to the alpha-amino and / or alpha-carboxyl groups directly or via linker molecules. The active agent-containing copolymers can be functionalized to include cell-type or tissue-type specific targeting moieties. The present disclosure also relates to pharmaceutical compositions comprising an effective amount of the copolymer containing multiple active agent molecules, as detailed above, and a carrier. Depending on the nature of the active agent, these compositions can be used to treat various cancers or other diseases / conditions.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 62 / 762,549, filed May 10, 2018, which is incorporated herein by reference in its entirety.

[0002] Sequence Listing Reference This application is filed with an electronic sequence listing. The sequence listing was created on May 6, 2019, is 2 KB in size, and is submitted as a file entitled "CIS-010 PCT_ST25.txt." The information in the electronic sequence listing is incorporated herein by reference in its entirety.

[0003] The present invention relates to the delivery of active agents, such as drug substances, using biocompatible copolymers as delivery carriers comprising side-chain linked amino acids in which the active agents are attached to alpha-amino and / or alpha-carboxyl groups either directly or via linker molecules. [Background technology]

[0004] Cancer is one of the major threats to human health, and given the fact that its likelihood is a function of age, the number of cases increases with the aging of the population. Berger, NA et al. (2006) Cancer in the Elderly, Transactions of the American Clinical and Climatological Association 117: 147-156; Yancik, R (2005) Cancer J. 11: 437-41. In recent years, there have been significant improvements in tumor therapy due to the use of tumor-specific agents such as monoclonal antibodies. These antibodies slow tumor growth by blocking growth signals such as the epidermal growth factor (EGFR) pathway (cetuximab, Erbitux®, Merck KGaA / panitumumab, Vectibix®, Amgen / trastuzumab, Herceptin®, Roche) or by targeting the vascular endothelial growth factor (VEGF) pathway to prevent new blood vessel formation (bevacizumab, Avastin®, Roche). Because these target antigens are typically overexpressed in tumor tissue, antibody therapy has fewer off-target effects than traditional cytotoxic agents, resulting in fewer side effects. Zhou, Q. (2017) Biomedicines 5(4); Reichert, JM (2017) MAbs 9: 167-181. The unique specificity of antibodies has also led to their use in combinatorial approaches aimed at targeting cytotoxic drugs to tumor cells. These so-called antibody-drug conjugates (ADCs) have proven superior to monotherapy with antibodies or cytotoxic agents. Although known since the 1960s, the concept of ADCs has only recently attracted the interest of the pharmaceutical industry with clinical developments, with over 60 ADCs undergoing clinical trials. Mullard, A (2013) Nat Rev Drug Discov 12: 329; Beck, A et al. (2017) Nat Rev Drug Discov 16: 315-337.

[0005] First-generation ADCs utilize free amino groups on antibodies to attach cytotoxic drugs and drug-linker constructs. With up to 80 free amino groups per antibody, these functionalizations result in highly heterogeneous ADC species due to differences in drug-to-antibody ratios (DARs) and affinities resulting from unintended binding of cytotoxic drugs to the antibody binding interface. Heterogeneity in terms of DAR can be limited to some extent by adjusting the stoichiometry of the drug and antibody used in the reaction. Regarding site specificity, heterogeneity was limited by the availability of chemistry in the 1980s, when the first clinical trials were conducted. It took another 20 years for the FDA to approve the first ADC. ADC development has increased significantly since then, with 30 ADCs entering the reactive group. This heterogeneity was also a major issue and regulatory concern for the first ADCs. Yao, H et al. (2016) Int J Mol Sci 17(2): 194. Additionally, the first ADCs were based on murine immunoglobulins, which are known to elicit significant immune responses. Due to these drawbacks, first-generation ADCs have not demonstrated significant improvement over conventional therapy, and as a result, the first FDA-approved ADC, gemtuzumab ozogamicin (Mylotarg®), was voluntarily withdrawn from the market by Pfizer in 2010. Beck, A et al. (2017) Nat Rev Drug Discov 16(5): 315-337; Beck, A et al. (2010) Discov Med 10(53): 329-39.

[0006] Second-generation ADCs alleviate these difficulties by targeting the free thiol groups of humanized antibodies. These free thiol groups were generated prior to the coupling reaction by mild reduction of the four interchain disulfide bridges in the hinge region of the antibody (e.g., with 1,4-dithiothreitol (DTT)). This strategy reduces the number of potential conjugation sites to eight, resulting in greater homogeneity of the ADC. Given the fact that interchain disulfide bonds play a critical role in antibody integrity, the increased homogeneity has often been offset by a detrimental effect on antibody stability. Although more specific linkers that preserve the integrity of disulfide bridges have been designed (e.g., as detailed in Shaunak, S. et al. (2006) Nat Chem Biol 2(6): 312-3 and Balan, S. et al. (2007) Bioconug Chem 18(1): 61-76), the resulting ADCs suffered from low DARs, typically around 3-4. Further increasing the drug load adversely affected antibody stability, resulting in rapid clearance from the bloodstream. In addition, antibody affinity for tumor cell-specific targets was adversely affected. Beck et al. (2017) Nat Rev Drug Discov 16(5): 315-337; Yao et al. (2016) Int J Mol Sci 17(2): 194.; Beck et al. (2010) Discov Med 10(53): 329-39. Because only a few cytotoxic entities were coupled to these antibodies, traditional cytotoxic agents such as doxorubicin proved ineffective in killing tumor cells. (Tolcher, AW (1999) J Clin Oncol 17(2): 478-478) Therefore, it was necessary to use a new class of cytotoxic agents with orders of magnitude higher cytotoxicity. Examples of these agents are microtubule inhibitors such as mertansine (DM1) or monomethylauristatin E (MMAE). (Beck et al. (2017)With such potent drug substances, it is crucial that the toxic payload of the ADC is released only at its target site. Otherwise, severe side effects may occur. The linker between the drug and the antibody therefore plays a major role. Recently marketed ADCs, such as trastuzumab emtansine (Kadcyla®, Roche) and brentuximab vedotin (Adcetris®, Tekada Pharmaceutical), as well as the Mersana concept (Mersana Therapeutics Inc., Cambridge, MA), use maleimide-based linkers known to react with cysteine-bearing proteins, particularly serum albumin. Alley, SC et al. (2008) Bioconjug Chem 19(3): 759-765. Shen, BQ et al. (2012) Nat Biotechnol 30(2): 184-9.

[0007] So-called third-generation ADCs use site-specific coupling of drugs to antibodies. A prominent example is Seattle Genetics' vadatuximab tailirine for acute myeloid leukemia (AML). This ADC contains engineered cysteines at position 239 of both heavy chains, allowing the coupling of a pyrrolobenzodiazepine (PBD) dimer capable of cross-linking DNA, thereby blocking cell division and causing cell death. This ADC has been successfully tested in a Phase I study and is currently undergoing Phase III clinical trials. Beck et al. (2017); Kennedy, DA et al. (2015) Cancer Res 75(15 Supp.), Abstract DDT02-04. Other examples of site-specific coupling of drugs to antibodies use smart tags, such as "aldehyde tags" (Redwood Biosciences, Catalent) or "sortase tags" (SMAC-Technology™, NBE Therapeutics; Stefan, N et al. (2017) Mol Cancer Ther 16(5): 879-892). The latter two approaches introduce engineered peptide tags into antibodies to serve as specific motifs for enzymatic coupling reactions. Third-generation ADCs have increased stability and represent more homogeneous products, but still deliver only a few toxic entities per antibody.

[0008] To circumvent this limitation, a novel approach using polymeric carriers was recently developed by Mersana Therapeutics. This concept is based on functionalizing a degradable carrier polymer (called "Fleximer") with several cytotoxic drug molecules. The drug-loaded polymer is then coupled to a monoclonal antibody via conventional linker chemistry. This allows the DAR to be increased to 12–15 drug molecules per antibody molecule, with the drug molecules distributed across 3–5 conjugated polymeric carriers. ("Non-clinical pharmacokinetics of XMT-1522, a HER2-targeting auristatin-based antibody-drug conjugate"; poster presentation at the American Association for Cancer Research (AACR) annual meeting in Washington, DC, 2017.) While this approach has many advantages, the resulting ADCs contain Fleximer polymers of various chain lengths and drug loadings. The molecular weight of the ADCs can be varied to some extent depending on the thiol-maleinimide linker chemistry used. Furthermore, Fleximer polymers contain biodegradable ester linkages, raising concerns about long-term storage and / or serum stability. Koitka, M et al. (2010) J Pharm Biomed Anal 51(3): 664-78; Li, B et al. (2005) Biochem Pharmacol 70(11: 1673-84.

[0009] In addition to antibodies, other target-specific drugs, including aptamers, have been described to block or activate aberrant pathways to treat metabolic diseases and cancer. Aptamers are small, single-stranded polynucleotides with defined three-dimensional structures formed by Watson-Crick base pairing. Due to their well-defined structures, they can bind with high affinity to specific targets, including isolated small molecules such as bacterial toxins or surface markers on cells. Mercier, MC et al. (2017) Cancers (Basel) 9(6): E69; Ruscito, A et al. (2016) Front Chem 4:14. Aptamers are much smaller than antibodies, easier to produce, and lack immunogenicity. Ray, P et al. (2013) Archivum Immunologiae et Therapiae Experimentalis 61(4): 255-271; Pei, X et al. (2014) Mol Clin Oncol 2(3): 341-348; Zhou, G et al. (2016) Oncotarget 7(12):13446-63. These were performed in an enrichment process involving repeated binding, washing, and amplification steps. 15Aptamers are typically generated from a pool of up to 10 random polynucleotides. After each cycle, the aptamer with the highest target affinity is selected for the next cycle. This results in the selection of molecules with binding affinities in the nano- and even sub-nanomolar range after 10–12 cycles. This process is also known as systematic evolution of ligands by exponential enrichment (SELEX). Zhou, G et al. (2016). Similar to antibodies, the first therapeutic aptamer approaches aimed to block disease-related pathways through interactions with key proteins, receptors, or metabolites. A notable example is Macugen® (Pegaptanib; EyeTech Pharmaceuticals, Pfizer), the first FDA-approved aptamer therapeutic, which was launched in 2004. Macugen® is a 27-nucleotide-long RNA aptamer used to treat age-related macular degeneration (AMD), a severe eye disease that can lead to blindness. AMD is characterized by abnormal blood vessel formation due to elevated levels of growth factors. Macugen® targets VEGF, a growth factor involved in angiogenesis 165This aptamer has a short half-life due to rapid renal clearance and degradation, so it was conjugated to a 40 kDa PEG polymer to increase its overall size. In addition, some nucleotides were substituted with 2'-fluoro-pyrimidine and 2'-O-methyl-purine to avoid degradation by nucleases. Biagi, C et al. (2014) Eur J Clin Pharmacol 70(12): 1505-12; Pozarowska, D et al. (2016) Cent Eur J Immunol 41(3): 311-316. In contrast to anti-VEGF antibodies (e.g., bevacizumab, Avastin®, Roche), Macugen® has not been used or approved for the treatment of cancer, likely due to poor function in systemic applications due to the compensation of bypass pathways (e.g., PDGF-B). Alvarez, RH et al. (2006) Mayo Clin Proc 81(9):1241-57. Following more recent improvements, several attempts have been made to use aptamers not only for targeting and blocking but also as carriers of cytotoxic drugs. Bagalkot and colleagues developed an aptamer-doxorubicin conjugate by exploiting the drug's ability to insert into DNA. However, this conjugate suffers from poor loading efficiency and rapid systemic clearance. Bagalkot, V et al. (2006) Angew Chem Int Ed 45(48): 8149-8152. In 2010, a different approach was developed based on docetaxel / cisplatin-loaded PLGA-PEG nanoparticles. These particles were guided to prostate cancer cells by functionalization with A10, an aptamer that targets tumor cell membrane proteins. This somewhat complex drug delivery system showed promising results, at least in in vitro experiments. Kolishetti, N et al. (2010) Proc Natl Acad Sci USA 107(42): 17939-17944.Aptamers have been further tested for the delivery of several nucleotide-based therapeutics, such as siRNA (short interfering RNA typically designed to suppress specific gene expression). Chu, TC et al. (2006) Nucleic Acids Res 34(10): e73. Despite the development of many different approaches utilizing the targeting capabilities of aptamers for tumor treatment, to date, aptamers suffer from insufficient loading capacity, serum instability, and rapid renal clearance, all of which limit their clinical application. None of these aptamer-drug conjugates or complexes have reached Phase III clinical trials or been introduced to the market. Zhou et al. (2016).

[0010] To overcome the above-mentioned drawbacks, increase the drug-to-antibody / aptamer ratio (DAR) while preserving the affinity of the antibody / aptamer for its corresponding target, we developed a new strategy that utilizes biocompatible, hydrophilic, non-degradable polymers as active agent carriers. The polymer is initially "loaded" with multiple active agent molecules. The active agent is introduced into the polymer during synthesis using an active agent-conjugated monomer (therapeutic monomer) or via post-synthesis functionalization. Typically, the active agent-containing polymer is subsequently coupled to a tumor-targeting moiety, such as a monoclonal antibody or aptamer. Due to their high hydrophilicity, the polymers can carry even highly hydrophobic cytotoxic drugs while maintaining the pharmacodynamic properties of the corresponding antibody / aptamer. A large number of active agent molecules (any desired number within limits) can be loaded onto the polymer molecule. The approach described in this disclosure has the advantage that only one coupling site is required to attach multiple active agent molecules to an antibody or aptamer molecule. By using a site-specific coupling method, such as an enzymatic coupling reaction, to a peptide tag at the C-terminus of the antibody heavy chain, the active agent-containing polymer is positioned far away from the antibody binding interface. This approach preserves maximum affinity for the target tissue and also yields a relatively homogeneous product. The selected linking strategy forms a stable peptide bond between the copolymer and the antibody / aptamer, ensuring high stability of the ADC in the bloodstream. Furthermore, coupling a fully functionalized and characterized active agent-containing copolymer to the antibody / aptamer in the final step aims to minimize conformational stress on sensitive binding proteins. Additionally, the selected copolymer design facilitates the coupling of two or more different active agents to the same molecule, enabling combination therapy. Once the active agent (also called a cytotoxic drug or toxic payload in the cancer context) is released into the target cells, e.g., tumor cells, and the targeting moiety (e.g., an antibody or aptamer) is degraded, the relatively small copolymer is believed to be removed from the body by renal clearance. [Prior art documents] [Non-patent literature]

[0011] [Non-Patent Document 1] Berger, NA et al. (2006) Cancer in the Elderly, Transactions of the American Clinical and Climatological Association 117: 147-156 [Non-patent document 2] Yancik, R (2005) Cancer J. 11: 437-41 [Non-patent document 3] Zhou, Q. (2017) Biomedicines 5(4); Reichert, JM (2017) MAbs 9: 167-181

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Non-licensed Document 7

Non-licensed literature 9

Non-licensed literature 10

Non-licensed Document 11

Non-licensed Document 12

Non-licensed Document 13

Non-licensed Document 14

Non-licensed Document 15

Non-licensed Document 16

Non-licensed Document 17

Non-licensed Document 18

Non-licensed Document 19

Non-licensed Document 20

Non-licensed Document 21

Non-licensed Document 22

Non-licensed Document 23

[0012] The present disclosure relates to copolymer molecules containing multiple activator molecules and methods for making the copolymers. The copolymers are made by polymerization of a reaction mixture containing: (1) one or more polymerizable principal monomers characterized by having at least one vinyl group and no amino acid residues; (2) one or more co-principal monomers of Formula I and / or II, where at least one of Y and Z is H; (3) an agent for controlling radical polymerization, preferably a RAFT agent; and (4) an initiator system that generates free radical species. The reaction mixture can optionally further contain one or more co-principal monomers of any of Formulas III-X. The latter polymerization results in a copolymer that can be functionalized with multiple activator molecules. Functionalization occurs at the free alpha-amino or alpha-carboxy groups of the co-principal monomer units.

[0013] [ka] In the formula, R is -H, -CH3, -CH2-CH3 or -(CH2)2-CH3; X is -NH(CH2)4-, -NH(CH2)3-, -O-C6H4-CH2-, -O-CH2-, -O-CH(CH3)-, -S-CH2- or -NH-C6H4-CH2-; and Y is H or -CO-C n H 2n+ 1 (where n=1 to 8), and Z is H (when A is -O-) or -C n H 2n+1 (wherein n=1 to 8), and A is —O— or —NH—.

[0014] [ka] wherein R is -H, -CH3, -CH2-CH3, or -(CH2)2-CH3, and Z is H (when A is O) or -C n H 2n+1 (wherein n=1 to 8), and A is —O— or —NH—.

[0015] Depending on the structure of the active agent, the active agent molecule can be directly or indirectly linked to the alpha-amino or alpha-carboxyl group of the main monomer of the copolymer through a linker structure.The latter linker should be stable during storage or in the bloodstream to avoid unintended release of the cytotoxic drug.The linker may be capable of being cleaved by specific intracellular enzymes, or may be "non-degradable" and only be destroyed in the harsh environment of lysosomes and peroxisomes.

[0016] Copolymer molecules containing multiple active agent molecules can be further functionalized with cell-type- or tissue-type-specific targeting moieties. Potential targeting moieties include, but are not limited to, monoclonal antibodies, antibody fragments, nanobodies (single-domain antibodies), DARPins (designed ankyrin repeat proteins), peptide hormones, proteins that bind to proteins expressed on tumor cell surfaces, DNA- or RNA-based aptamers, or small molecules capable of binding to cell surface receptors known to be overexpressed on tumor cells, such as folate or biotin. Covalent attachment of the targeting moiety is typically carried out in a site-specific manner, typically involving a reactive group on the copolymer head group (typically introduced by a RAFT agent). Suitable coupling strategies include enzyme-catalyzed reactions using peptide tags (e.g., sortase-mediated coupling), aldehyde tags, or transglutaminase tags, or the so-called "click" reaction between the copolymer and the targeting moiety. The latter process can be achieved by incorporating reactive non-standard (unnatural) amino acids into the targeting moiety during or after synthesis. Sortase-mediated coupling and transglutaminase-mediated coupling are preferred methods. In the former mechanism, the targeting moiety is modified to contain a sortase motif. Copolymer molecules carrying multiple active agent molecules can be targeted for sortase-mediated transpeptidation by introducing an oligo-glycine extension into the copolymer headgroup. This can be conveniently achieved during polymerization by replacing the conventional RAFT agent with a derivatized RAFT agent containing two to eight glycine residues. In the case of transglutaminase-mediated reactions, the copolymer headgroup introduced by an appropriate chain transfer agent can contain a peptide motif containing a reactive lysine (or glutamine) residue, or a non-peptide motif, e.g., a linker structure containing a terminal amino group. The latter headgroup modification can be used, inter alia, in combination with microbial transglutaminases, which are known to accept non-peptide motifs with high turnover rates.

[0017] In different embodiments, the enzymatic reactions presented herein can also be used to site-specifically modify cell- or tissue-type-specific targeting moieties using reactive groups, such as so-called "click-reactive" groups (such as azides for [3+2] cycloadditions or tetrazines for [4+2] cycloadditions), which can then be used to attach copolymers of the present disclosure that include the "counterparts" of the click reaction in the copolymer headgroup (e.g., alkynes in the case of [3+2] cycloadditions or strained alkenes in the case of [4+2] cycloadditions). It is intended that the above-mentioned reactive moieties of the click reaction are interchangeable.

[0018] In another embodiment, where the active agent is unstable, such as when it is a molecule containing a short-lived radioisotope, the copolymer prepared as described above is first functionalized with a cell- or tissue-type-specific targeting moiety using one of the methods described above, e.g., sortase-mediated or transglutaminase-mediated coupling. The targeting moiety copolymer conjugate is then loaded with an active agent prior to therapeutic use, whereby the active agent molecule is attached directly or indirectly via a linker structure to a free alpha-amino or carboxyl group of the copolymer.

[0019] Copolymers containing multiple activator molecules can also be made by two sequential polymerization reactions. For example, a first polymerization reaction is carried out in a first reaction mixture containing one or more polymerizable principal monomers that do not contain an amino acid group, a RAFT agent, and an initiator system that generates free radical species, and the polymerization results in a RAFT prepolymer. A second polymerization reaction is carried out in a second reaction mixture containing the RAFT prepolymer from the first polymerization reaction, one or more co-primary monomers of Formula I and / or II, and an initiator system that generates free radical species. The reaction can optionally include one or more co-primary monomers of any of Formulas III-X and / or one or more polymerizable principal monomers that do not contain an amino acid group.

[0020] In more specific embodiments, copolymers comprising multiple activator molecules are prepared by polymerization of a reaction mixture comprising: (1) one or more polymerizable principal monomers characterized by having at least one vinyl group and no amino acid residues; (2) one or more co-primary monomers of Formula I and / or Formula II, where at least one of Y and Z is H; (3) optionally, one or more co-primary monomers of Formulas III-X; (4) a RAFT agent comprising a monodisperse spacer (i.e., a spacer of uniform size) of 5 to 25 units; and (5) an initiator system that generates free radical species.

[0021] In a different embodiment, a copolymer comprising multiple active agent molecules is prepared by polymerization of a reaction mixture comprising: (1) one or more polymerizable principal monomers characterized by having at least one vinyl group and no amino acid residues; (2) one or more co-principal monomers of Formulae III-X; (3) optionally, one or more co-principal monomers of Formulae I and / or II; (4) an agent for inducing controlled radical polymerization, preferably a RAFT agent; and (5) an initiator system that generates free radical species.

[0022] [ka] wherein R is -H, -CH3, -CH2-CH3 or -(CH2)2-CH3; X is -NH(CH2)4-, -NH(CH2)3-, -O-C6H4-CH2-, -O-CH2-, -O-CH(CH3)-, -S-CH2- or -NH-C6H4-CH2-; and Z is H (when A is -O-) or -C n H 2n+1 (where n=1 to 8), payload refers to an active agent, L is a linker, and A is —O— or —NH—.

[0023] [ka] In the formula, R is -H, -CH3, -CH2-CH3 or -(CH2)2-CH3; X is -NH(CH2)4-, -NH(CH2)3-, -O-C6H4-CH2-, -O-CH2-, -O-CH(CH3)-, -S-CH2- or -NH-C6H4-CH2-; and Y is H or -CO-C n H 2n+1 (where n=1 to 8), payload refers to an active agent, and L is a linker.

[0024] [ka] wherein R is -H, -CH3, -CH2-CH3, or -(CH2)2-CH3; X is -NH(CH2)4-, -NH(CH2)3-, -O-C6H4-CH2-, -O-CH2-, -O-CH(CH3)-, -S-CH2-, or -NH-C6H4-CH2-; payload refers to an active agent; and L is a linker, wherein the linkers used to functionalize the alpha-amino and carboxy groups need not be identical.

[0025] [ka] wherein R is -H, -CH3, -CH2-CH3 or -(CH2)2-CH3; X is -NH(CH2)4-, -NH(CH2)3-, -O-C6H4-CH2-, -O-CH2-, -O-CH(CH3)-, -S-CH2- or -NH-C6H4-CH2-; and Z is H (when A is -O-) or -C n H 2n+1 (where n=1 to 8), payload refers to an active agent, L is a linker, and A is —O— or —NH—.

[0026] [ka] wherein R is -H, -CH3, -CH2-CH3, or -(CH2)2-CH3; X is -NH(CH2)4-, -NH(CH2)3-, -O-C6H4-CH2-, -O-CH2-, -O-CH(CH3)-, -S-CH2-, or -NH-C6H4-CH2-; payload refers to an active agent; and L is a linker.

[0027] [ka] wherein R is -H, -CH3, -CH2-CH3, or -(CH2)2-CH3; X is -NH(CH2)4-, -NH(CH2)3-, -O-C6H4-CH2-, -O-CH2-, -O-CH(CH3)-, -S-CH2-, or -NH-C6H4-CH2-; payload refers to an active agent; and L is a linker, wherein the linkers used to functionalize the alpha-amino and carboxy groups need not be identical.

[0028] [ka] wherein R is -H, -CH3, -CH2-CH3 or -(CH2)2-CH3; X is -NH(CH2)4-, -NH(CH2)3-, -O-C6H4-CH2-, -O-CH2-, -O-CH(CH3)-, -S-CH2- or -NH-C6H4-CH2-; and Z is H (when A is -O-) or -C n H 2n+1 (wherein n=1 to 8), L is a linker, J is H or a radioactive iodine nucleus, and A is —O— or —NH—.

[0029] [ka] wherein R is -H, -CH3, -CH2-CH3, or -(CH2)2-CH3, X is -NH(CH2)4-, -NH(CH2)3-, -O-CH4-CH2-, -O-CH2-, -O-CH(CH3)-, -S-CH2-, or -NH-CH4-CH2-, and J is H or a radioactive iodine nucleus. Payload refers to the active agent, and L is a linker, where the linkers used to functionalize the alpha-amino and carboxy groups need not be identical.

[0030] In more specific embodiments, copolymers comprising multiple activator molecules are prepared by polymerization of a reaction mixture comprising: (1) one or more polymerizable principal monomers characterized by having at least one vinyl group and no amino acid residues; (2) one or more co-principal monomers of Formulae III-X; (3) optionally, one or more co-principal monomers of Formula I and / or Formula II, where at least one of Y and Z is H; (4) a RAFT agent comprising a monodisperse spacer of 5 to 25 units; and (5) an initiator system that generates free radical species.

[0031] Copolymers containing multiple activator molecules can also be made by two sequential polymerization reactions. For example, a first polymerization reaction is carried out in a first reaction mixture containing one or more polymerizable principal monomers that do not contain an amino acid group, a RAFT agent, and an initiator system that generates free radical species, and the polymerization results in a RAFT prepolymer. A second polymerization reaction is carried out in a second reaction mixture containing the RAFT prepolymer from the first polymerization reaction, one or more co-primary monomers of Formulas III-X, and an initiator system that generates free radical species. The reactions can optionally include one or more co-primary monomers of Formula I and / or Formula II, and / or one or more polymerizable principal monomers that do not contain an amino acid group.

[0032] The latter copolymer molecule containing multiple active agent molecules can be further functionalized with cell-type or tissue-type specific targeting moieties as described in the first embodiment.

[0033] The parenthetical term "kind of" is included to clarify that expressions such as "one or more polymerizable co-primary monomers" do not refer to one or more molecules of a monomer, but rather to a quantity of one or more chemically distinct monomers of the formula(s) in question.

[0034] In any of the copolymers described above containing multiple activator molecules, the total amount of monomers of any of Formulas I to X is preferably in the range of 1% (mol) to 49.9% (mol) of all monomers contained in the copolymer. More specifically, the total amount of monomers of Formulas I to X is in the range of 1% (mol) to 35% (mol) of all monomers contained in the copolymer. Even more preferably, the total amount of monomers of Formulas I to X is in the range of 1% (mol) to 20% (mol) of all monomers contained in the copolymer. Most preferably, the total amount of monomers of Formulas I to X is in the range of 5% (mol) to 15% (mol) of all monomers contained in the copolymer.

[0035] In any of the above-described copolymers containing multiple active agent molecules, the copolymer has an average molecular weight of 5,000 to 100,000 daltons. More preferably, the copolymer has an average molecular weight of 6,000 to 60,000 daltons. Most preferably, the copolymer has an average molecular weight of 6,000 to 20,000 daltons.

[0036] In any of the above-described copolymers comprising a plurality of active agent molecules, at least 80% (w) of the copolymer molecules have an average molecular weight of 5,000 to 100,000 daltons. More preferably, at least 80% (w) of the copolymer molecules have an average molecular weight of 6,000 to 60,000 daltons. Most preferably, at least 80% (w) of the copolymer molecules have an average molecular weight of 6,000 to 20,000 daltons.

[0037] As discussed above, the polymerization mixture for preparing any of the copolymers described above containing multiple active agent molecules can contain a RAFT agent bearing a reactive group that can be used to functionalize the copolymer with cell- or tissue-type-specific targeting moieties. The latter reactive group can be a thiol, aldehyde, alkyne, azide, amine, carboxyl, ester, diazirine, phenyl azide, thioester, diazo, Staudinger-reactive phosphinoester (or phosphinothioester), hydrazine, oxime, acrylate for aza-Michael ligation, or a motif that can be used in enzymatic coupling reactions. The motif can be an oligo-glycine containing 2 to 8 amino acids (this peptide motif allows for sortase-mediated coupling reactions), a transglutaminase-reactive substrate, an aldehyde tag, or an autocatalytic intein sequence.

[0038] In other specific embodiments, the RAFT agent is deactivated once polymerization and / or functionalization is complete, where elimination of the RAFT group is carried out by thermal treatment, reaction with a suitable amine (aminolysis), or a new reaction with an initiator molecule in the presence of a phosphorus oxoacid or with an excess of initiator without a phosphorus oxoacid.

[0039] In any of the copolymers described above containing multiple active agent molecules, the active agent can be a microtubule inhibitor, an intercalating agent, an alkylating agent, an antimetabolite, a hormone or hormone receptor modulator, a tyrosine kinase inhibitor, a polynucleotide-based drug capable of interfering with a gene or the corresponding messenger RNA, a protein-based bacterial toxin, an enzyme suitable for prodrug therapy (ADEPT concept), or a radioisotope. The active agent can also be a small molecule fluorophore, a protein / peptide-based fluorophore, a near-infrared (NIR) fluorescent probe, a bioluminescent probe, an imaging agent, or a tracer molecule including a radioisotope.

[0040] The present disclosure also relates to pharmaceutical compositions comprising an effective amount of the copolymer containing multiple active agent molecules as detailed above, and a carrier. Depending on the nature of the active agent, these compositions can be used to treat various cancers or other diseases / conditions.

[0041] The present disclosure also encompasses methods of treating different types of cancer or other diseases and conditions, comprising administering a pharmaceutical composition comprising an effective amount of a copolymer comprising a plurality of active agent molecules (also referred to herein as "active moieties") of the present disclosure. Also within the scope of the present disclosure is the use of a pharmaceutical composition comprising an effective amount of a copolymer comprising a plurality of active agent molecules of the present disclosure to treat cancer or another disease or condition in a subject, comprising administering to the subject an effective amount of a copolymer comprising a plurality of active agent molecules. The present invention provides, for example, the following items. (Item 1) (a)(1) one or more polymerizable principal monomers, characterized in that the monomers have at least one vinyl group and are free of amino acid residues; (2) one or more co-principal monomers of formula I or II, wherein at least one of Y and Z is H; (3) optionally, one or more co-primary monomers of any of formulae III-X; (4) a drug that controls radical polymerization; (5) polymerizing the reaction mixture comprising an initiator system that generates free radical species, wherein the polymerization produces a copolymer; (b) optionally functionalizing the copolymer with a cell-type-specific or tissue-type-specific targeting moiety; and (c) coupling an active agent to said copolymer after step (a) or, optionally, step (b). A copolymer comprising multiple active agent molecules made by: (Item 2) 2. The copolymer comprising a plurality of active agent molecules according to claim 1, wherein the copolymer has an average molecular weight of 5,000 daltons to 100,000 daltons. (Item 3) 2. A copolymer comprising a plurality of active agent molecules according to item 1, wherein at least 80% (w) of the copolymer molecules have an average molecular weight of 5,000 to 100,000 daltons. (Item 4) 4. The copolymer comprising a plurality of activator molecules according to any one of items 1 to 3, wherein the agent that controls the radical polymerization is a RAFT agent. (Item 5) the copolymer is made by two sequential polymerization reactions; a first polymerization reaction is carried out in a first reaction mixture comprising one or more polymerizable primary monomers that do not contain an amino acid group, a RAFT agent that controls copolymerization, and an initiator system that generates free radical species, said polymerization resulting in a RAFT prepolymer; a second polymerization reaction is carried out in a second reaction mixture comprising the RAFT prepolymer of the first polymerization reaction, one or more co-primary monomers of Formula I and / or II, optionally one or more co-primary monomers of Formulae III-X, optionally one or more polymerizable primary monomers that do not contain an amino acid group, and an initiator system that generates free radical species; Item 4. A copolymer comprising a plurality of active agent molecules. (Item 6) 5. A copolymer comprising multiple active agent molecules according to item 4, wherein the RAFT agent comprises a monodisperse spacer of 5 to 25 units. (Item 7) 5. The copolymer comprising a plurality of active agent molecules according to item 4, wherein the RAFT agent comprises a reactive group used to functionalize the copolymer with a cell-type-specific or tissue-type-specific targeting moiety. (Item 8) 8. A copolymer comprising a plurality of activator molecules according to item 7, wherein the reactive group is a thiol, aldehyde, alkyne, azide, tetrazine, strained alkene, amine, carboxyl, ester, diazirine, phenyl azide, thioester, diazo, Staudinger-reactive phosphinoester (or phosphinothioester), hydrazine, oxime, acrylate for performing aza-Michael ligation, or a motif that can be used in enzymatic coupling reactions. (Item 9) 9. The copolymer comprising a plurality of active agent molecules according to item 8, wherein the motif comprises 2 to 8 amino acid units and is an oligo-glycine, a transglutaminase-reactive substrate, an aldehyde tag, or an autocatalytic intein sequence that allows a sortase-mediated coupling reaction. (Item 10) 10. A copolymer comprising a plurality of activator molecules according to any one of items 4 to 9, wherein the RAFT group of the RAFT agent is eliminated after copolymerization or functionalization of the copolymer. (Item 11) (a) one or more polymerizable principal monomers, characterized in that the monomers have at least one vinyl group and do not contain amino acid residues; (b) one or more co-primary monomers of formula III-X; (c) optionally one or more co-principal monomers of Formula I and / or Formula II; and (d) an agent for controlling radical polymerization. (e) optionally functionalizing the copolymer with a cell-type-specific or tissue-type-specific targeting moiety; (f) an initiator system that generates free radical species; A copolymer comprising a plurality of active agent molecules made by polymerization of a reaction mixture comprising: (Item 12) 12. The copolymer comprising a plurality of active agent molecules according to claim 11, wherein the copolymer has an average molecular weight of 5,000 Daltons to 100,000 Daltons. (Item 13) 13. The copolymer comprising a plurality of activator molecules according to item 11 or 12, wherein the agent controlling the radical polymerization is a RAFT agent. (Item 14) 14. The copolymer comprising a plurality of active agent molecules according to item 13, wherein the RAFT agent comprises a reactive group used to functionalize the copolymer with a cell-type-specific or tissue-type-specific targeting moiety. (Item 15) 15. A copolymer comprising a plurality of activator molecules according to item 14, wherein the reactive group is a thiol, aldehyde, alkyne, azide, tetrazine, strained alkene, amine, carboxyl, ester, diazirine, phenyl azide, thioester, diazo, Staudinger-reactive phosphinoester (or phosphinothioester), hydrazine, oxime, acrylate for performing aza-Michael ligation, or a motif that can be used in enzymatic coupling reactions. (Item 16) 16. The copolymer comprising a plurality of active agent molecules according to item 15, wherein the motif comprises 2 to 8 amino acid units and is an oligo-glycine, a transglutaminase-reactive substrate, an aldehyde tag, or an autocatalytic intein sequence that allows a sortase-mediated coupling reaction. (Item 17) 17. A copolymer comprising a plurality of activator molecules according to any of items 13 to 16, wherein the RAFT group of the RAFT agent is eliminated after copolymerization or functionalization of the copolymer. (Item 18) 18. A pharmaceutical composition comprising an effective amount of a copolymer comprising a plurality of active agent molecules according to any one of items 1 to 17, and a pharmaceutically acceptable carrier or excipient. (Item 19) 20. Use of the pharmaceutical composition according to item 18 for treating cancer or another disease or condition in a subject, comprising administering the pharmaceutical composition to the subject. DETAILED DESCRIPTION OF THE INVENTION

[0042] Unless otherwise defined, all terms have their ordinary meaning in the relevant art. The following terms are defined and have the following meanings:

[0043] As used herein, "pharmaceutically acceptable carrier or excipient" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration, e.g., sterile pyrogen-free water. Suitable carriers are described in Remington's Pharmaceutical Sciences (Mack Publishing Co., Easton, PA, 19th ed. 1995), a standard reference text in this field, which is incorporated herein by reference. Non-limiting examples of materials which can serve as pharmaceutically acceptable carriers include sugars such as lactose, glucose, and sucrose; cyclodextrins such as alpha-, beta-, and gamma-cyclodextrin; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository wax; peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and dairy oil. Oils such as corn oil; glycols such as propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; and phosphate buffer solutions, as well as other non-toxic, compatible lubricants such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring, and perfuming agents, preservatives, and antioxidants can also be present in the compositions, according to the discretion of the formulator. Emulsifiers / surfactants such as cremophor EL and solutol HS15, lecithin, and phospholipids such as phosphatidylcholine are also included. Liposomes can also be used. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the compositions is contemplated.Supplementary active compounds can also be incorporated into the compositions.

[0044] The term "subject," as used herein, refers to a mammalian subject. Preferably, the subject is a human subject.

[0045] The term "active moiety" refers to a copolymer comprising multiple active agent molecules of the present disclosure (which copolymer may be further functionalized with a cell-type-specific or tissue-type-specific targeting moiety).

[0046] The term "cell-type or tissue-type specific targeting moiety" in the context of the present disclosure refers to a molecule that binds to a surface marker of a particular type of cell or cell of a particular tissue with binding activity, thereby making it useful for delivering a cargo active agent to the cell. This can be a monoclonal antibody, a single domain, a variable fragment of an antibody chain, a single-chain antibody, a DARPin (designed ankyrin repeat protein), a DNA- or RNA-based aptamer, a peptide-based aptamer, a peptide or protein capable of binding a cell surface marker, a hormone, or a small molecule capable of binding a cell surface marker.

[0047] A "tracing molecule" is defined as a molecule capable of producing a readout signal for diagnostic or scientific applications. It can be a small molecule fluorophore, a protein / peptide-based fluorophore, a near-infrared (NIR) fluorescent probe, a bioluminescent probe, an imaging agent, or a radioisotope.

[0048] An "effective amount" of an active moiety of the present disclosure refers to that amount of the active moiety that, when administered once or several times during treatment, confers a therapeutic effect on the treated subject at a reasonable benefit / risk ratio applicable to any medical treatment. The therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective (i.e., the subject gives an indication of or feels an effect). An effective amount of the active moiety of the present disclosure is preferably an amount of the active moiety containing the active agent in an amount ranging from about 0.01 mg / kg to about 50 mg / kg of body weight of the subject, more preferably from about 0.1 to about 30 mg / kg of body weight. The effective dose will also vary depending on the route of administration and the possibility of co-use with other drugs. However, it will be understood that the total amount of the active moiety and pharmaceutical compositions of the present disclosure to be used daily will be determined within the scope of the attending physician's reasonable medical judgment. The specific effective dose level for any particular patient depends on various factors, including the disorder to be treated and the severity of the disorder; the activity of the specific active agent used; the specific composition used; the age, weight, general health, sex and diet of the patient; the time of administration, route of administration and excretion rate of the specific active moiety used; the duration of treatment; the drug used in combination with or simultaneously with the specific active moiety used; and similar factors well known in medical technology.It should be noted that when used in the context of prevention or prevention, the "effective amount" of the active moiety of the present disclosure is intended to be the amount of the active moiety that gives the treated subject desired preventive effect when administered once or several times during treatment.

[0049] The term "active agent" refers to a therapeutically active substance that is conjugated to the copolymer of the present disclosure. In the context of cancer therapy, the active agent is typically a cytotoxic substance / molecule. Exemplary cytotoxic substances / molecules include microtubule inhibitors such as monomethyl auristatin E (MMAE) or emtansine (DM1), intercalating drugs, e.g., doxorubicin, alkylating agents such as cyclophosphamide (CP), antimetabolites such as 5-fluorouracil (5-FU), hormones or hormone receptor modulators such as tamoxifen citrate, tyrosine kinase inhibitors such as afatinib or bosutinib, peptide-based toxins, e.g., α-amanitin, immune checkpoint inhibitors such as nivolumab® or pembrolizumab®, antibody-directed enzymes, and the like. These include polynucleotide-based drugs capable of interfering with enzymes, gene(s) or their corresponding messenger RNA (siRNA, microRNA or antisense RNA) suitable for prodrug therapy (ADEPT), as well as radioisotopes such as, but not limited to, fluoro-18, copper-64, gallium-68, zirconium-89, indium-111, iodine-123 (diagnostic applications), or strontium-89, yttrium-90, iodine-131, samarium-153, lutetium-177, radium-223 and actinium-225 (therapeutic applications).

[0050] The radioisotope is either coupled to the comonomer before polymerization or to the copolymer after polymerization. Chelating agents can be used to immobilize the radioisotope, either covalently coupled to the comonomer before polymerization or to the copolymer after polymerization. Chelating agents include, but are not limited to, (1,4,7,10)-tetraazacyclododecane-1,4,7,10-tetraacetic acid [DOTA], 2,2',2"-(10-(2,6-dioxotetrahydro-2H-pyran-3-yl)-1,4,7,10-tetraazacyclododecane-1,4,7-triyl)triacetic acid [DOTA-GA], 1,4,7-triazacyclononane-N,N',N"-triacetic acid [NOTA], 1,4,8,11-tetraazacyclotetradecane-1,4,8,11-tetraacetic acid [TETA], and diethylene-triamine-pentaacetic anhydride [DTPA].

[0051] The term "active agent" in the context of the present disclosure further encompasses substances that can overcome tumor cell resistance, for example, by inhibiting anti-apoptotic factors such as Bcl-2 or by targeting cellular efflux pumps (such as the MDR-1 transporter), or anti-inflammatory substances, including corticosteroids, glucocorticoids and non-steroidal anti-inflammatory drugs (e.g., prostaglandins), that are useful in reducing inflammation-related therapeutic side effects.

[0052] "Monomer" means a low molecular weight compound that can be polymerized. For co-principal monomers or major monomers of Formula I or II, low molecular weight typically means a molecular weight of less than 800 Daltons. For co-principal monomers of Formulas III-X, low molecular weight typically means a molecular weight of less than 1500 Daltons. When referred to in the context of a copolymer, the term "monomer" refers to the smallest building block of the copolymer.

[0053] The terms "RAFT agent" and "RAFT process" refer to conventional free radical polymerization of monomers in the presence of a suitable chain transfer agent (CTA). Commonly used RAFT agents include thiocarbonylthio compounds such as dithioesters, dithiocarbamates, trithiocarbonates, and xanthan gums, which mediate polymerization via a reversible chain transfer process. Chiefari, J. et al. (1998) Macromolecules 31(16): 5559-62.

[0054] The term "prepolymer" refers to a short polymer containing a RAFT agent at its head and 10-25 units of a hydrophilic principal monomer, such as dimethylacrylamide. Such prepolymers represent a water-soluble macro-RAFT agent that is used in a second polymerization reaction to synthesize a copolymer of the principal and co-principal monomers in an aqueous environment.

[0055] The terms "substrate, motif, or tag" or "reactive substrate, motif, or tag" are used interchangeably to refer to chemical structures that can participate in enzyme-catalyzed reactions. These chemical structures may be recognized by the active center of an enzyme and form an intermediate covalent or electrostatic enzyme-substrate complex before the enzyme-catalyzed reaction occurs. In the context of the present disclosure, these reactions are often used to mediate the covalent attachment of the copolymers of the present disclosure to tumor cell- or tissue-specific targeting moieties. Typical substrates, motifs, and tags are defined sequences of amino acids or peptides, reactive functional groups such as amino, thiol, or carboxyl groups, or unsaturated carbon bonds in the flexible spacer region of the copolymer head group.

[0056] The term "antibody drug conjugate," or "ADC," refers to a combination of an antibody that targets a cell- or tissue-type-specific antigen (including tumor antigens) and a drug molecule or multiple drug molecules, where the drug molecule is covalently attached to the antibody. In the context of the present disclosure, ADC refers to a conjugate of a cell- or tissue-type-specific antigen-targeting antibody and a copolymer comprising multiple active agent molecules of the present disclosure. As discussed, the copolymers of the present disclosure carry multiple active agent molecules, or a combination of different active agent molecules, bound via a linker or directly to the alpha-amino and alpha-carboxy groups of the co-primary monomers.

[0057] The term "aptamer" is defined as follows: An aptamer is an oligonucleotide or peptide molecule that binds to a specific target molecule. Aptamers are typically created by selecting from a large random sequence pool in an iterative enrichment process to identify aptamer sequences with the highest target affinity. This process is also known as "SELEX (synthetic evolution by exoneration)." More specifically, aptamers can be classified as DNA, RNA, xenonucleic acid (XNA) (a synthetic alternative to natural nucleic acids with different sugar backbones), or peptide aptamers. Aptamers consist of (usually short) chains of oligonucleotides or sequences of amino acids. Here, the oligonucleotide sequence can be formed from a single type of nucleotide, e.g., DNA, or a combination of different nucleotide types, e.g., DNA, RNA, and / or specially designed so-called "locked-nucleotides" with a ribose moiety modified with an external bridge connecting the 2' oxygen and 4' carbon. Aptamer of the present disclosure also refers to peptide aptamers consisting of one (or more) short peptide domains.

[0058] The term "aptamer drug conjugate" refers to a combination of an aptamer and an active agent molecule or different active agent molecules. In the context of the present disclosure, the active agent molecule is attached to the copolymer either before or after coupling of the copolymer and the aptamer.

[0059] The term "enhanced permeability and retention (EPR) effect" is used to describe abnormal molecular and fluid transport dynamics in tumor tissue, particularly for macromolecular drugs. Molecules of a certain size (typically liposomes, nanoparticles, and macromolecular drugs) tend to accumulate in tumor tissue at higher levels than in normal tissue. A common explanation for this phenomenon is that tumor cells must stimulate the production of blood vessels in order to rapidly proliferate. Newly formed tumor blood vessels are usually abnormal in morphology and structure, allowing high molecular weight molecules to penetrate. Furthermore, tumor tissue usually lacks effective lymphatic drainage, so once molecules enter tumor tissue, they are not effectively removed from this tissue.

[0060] The term "side-chain-linked amino acid" in the context of a co-primary monomer means that the amino acid is covalently linked through its side chain (e.g., via an ester or amide linkage) to a moiety that includes an acryloyl group. Monomers of Formulas I-X include side-chain-linked amino acids.

[0061] The terms "major monomer" and "co-major monomer" are used primarily to facilitate the description of the present invention. Major monomer refers to a monomer that does not contain an amino acid, and co-major monomer refers to a monomer that contains an amino acid.

[0062] Copolymers containing the latter major and minor monomers are also commonly referred to as "Cellophil copolymers," with the term "Cellophil" serving to indicate the presence in the copolymer of a monomer containing a side-chain-linked amino acid (which may be further functionalized, e.g., as in Formulas III-X). Side-chain-linked amino acids include lysine (K), tyrosine (Y), serine (S), threonine (T), cysteine ​​(C), 4-hydroxyproline (HO-P), ornithine (ORN), and 4-amino-phenylalanine (HOX). The amino acids may be L- or D-forms or racemic mixtures. A single type of side-chain-linked amino acid or multiple types of side-chain-linked amino acids may be present in the copolymer. For example, a copolymer may contain both acryloyl-L-lysine (AK) and acryloyl-L-threonine (AT). For clarity, all monomers described by Formulas I-X contain a side-chain-linked amino acid (functionalized or non-functionalized). The amino acid-containing copolymers of the present disclosure are characterized in that they comprise one or more polymerizable principal monomers having at least one vinyl group but no amino acid residues, one or more co-principal monomers according to any of Formulas I through X (including co-principal monomers shown in two or more of the latter formulas).

[0063] Preferably, the co-major monomer is present in the polymerization mixture in an amount of 1% (mol) to 49.9% (mol) of all monomers contained in the copolymer, more preferably 1% (mol) to 35% (mol), even more preferably 1% (mol) to 20% (mol), and most preferably 5% (mol) to 15% (mol) of all monomers contained in the copolymer.

[0064] The synthesis of monomers containing side-chain linked amino acids has been previously described. Zbaida, D et al. (1987) Reactive Polymers, Ion Exchangers, Sorbents 6(2-3): 241-253. Such monomers can be prepared by reacting an amino acid copper complex of lysine, tyrosine, serine, threonine, cysteine, ornithine, 4-amino-phenylalanine, or 4-hydroxyproline with either acryloyl chloride, methacryloyl chloride, ethylacryloyl chloride, or propylacryloyl chloride, followed by treatment with a stream of hydrogen sulfide gas or an acidic solution of sodium sulfide to yield the unprotected monomer. Protocols are disclosed in the Examples.

[0065] In certain embodiments, the primary monomer is a derivative of acrylamide, including dimethyl-acrylamide, N-isobutyl-acrylamide, N-tert.butyl-acrylamide, N-hydroxyethyl-acrylamide, N-(2-hydroxypropyl)-acrylamide, N-(3-hydroxypropyl)-acrylamide, N-(3-hydroxypropyl)-methacrylamide, N-(2-hydroxypropyl)-methacrylamide, N-(3-aminopropyl)-acrylamide hydrochloride, or N-(3-aminopropyl)-methacrylamide hydrochloride.

[0066] In other particular embodiments, the primary monomer is a derivative of acrylic acid, including 2-hydroxyethyl methacrylate, 2-hydroxypropyl acrylate, 3-hydroxypropyl acrylate, 2-hydroxy-1-methylethyl acrylate, 2-aminoethyl acrylate hydrochloride, 3-hydroxypropyl methacrylate, 2-hydroxy-1-methylethyl methacrylate, 2-hydroxyethyl methacrylate, 2-hydroxypropyl methacrylate, and 2-aminoethyl methacrylate hydrochloride.

[0067] Copolymers containing one or more co-primary monomers of Formulas I-X and one or more primary monomers are typically prepared by radical polymerization reactions. It is important that the copolymers of the present disclosure have a narrow size distribution, as precise control of drug loading is required in various therapies, particularly cancer therapy. If not carefully controlled, overdosing or insufficient dosing may occur. To obtain copolymers with a narrow size distribution, the number of free radicals in the polymerization process must be controlled. This can be achieved by using polymerization techniques including atom transfer radical polymerization (ATRP), nitroxide-mediated polymerization (NMP), or reversible addition-fragmentation-chain transfer polymerization (RAFT polymerization). RAFT is the most preferred technique for the copolymers described herein because it is compatible with a wide range of monomers, particularly acrylic acid, and can be easily performed in aqueous systems. Furthermore, RAFT polymerization can be used to synthesize block copolymers. Additionally, RAFT groups can be used to add reactive moieties to the head groups of polymers (e.g., for conjugation with antibodies or aptamers). RAFT technology was invented by researchers at the Commonwealth Scientific and Industrial Research Organization (CSIRO) (Chiefari et al., 1998). Control of chain size distribution is achieved through chain transfer reactions from growing polymer chains to chain transfer agents. The so-called RAFT agent forms intermediates that can be fragmented into propagating chain radicals (referred to as R groups) and stabilizing moieties (referred to as Z groups). As a result, the number of radicals is limited, and all growing polymer chains have similar propagation potential, resulting in copolymers with narrow size distributions. Typical polydispersity indices (PDIs) obtained by RAFT polymerization [defined as Mw / Mn, where Mw is the weight-average molar mass of the polymer and Mn is the number-average molar mass of the polymer] range from 1.05 to 1.4. Suitable RAFT agents are thiocarbonylthio compounds.Thiocarbonylthio compounds can be divided into four main classes: dithiobenzoates, trithiocarbonates, dithiocarbamates and xanthates.

[0068] Thus, a typical polymerization mixture of the present disclosure includes major and co-major monomers, a RAFT agent, and a radical initiator. The mixture is then poured into a suitable container or mold, where polymerization is induced. The initiator can be a thermal initiator (e.g., VA-044, which is destabilized at high temperatures to generate reactive radicals), a redox initiator, or a photoinitiator. Preferred redox initiators for polymerization in aqueous solution are peroxides, such as ammonium or potassium persulfate, in combination with sodium thiosulfate, or azo-type compounds, such as 2,2'-azobis[2-(2-imidazolin-2-yl)propane]dihydrochloride or 4,4'-azobis(4-cyanovaleric acid). For polymerization reactions in non-aqueous solvents, azo-type initiators / catalysts such as azobis(isobutyronitrile (AIBN), 1,1'-azobis(cyclohexane-1-carbonitrile), 2,2'-azobis(4-methoxy-2,4-dimethylvaleronitrile) are preferred. Polymer-modified azo-type initiators such as (polydimethylsiloxane, polyethylene glycol) can also be utilized. The above initiators are usually destabilized at high temperatures, resulting in the formation of reactive radicals.

[0069] Alternatively, the monomers can be photopolymerized in a container or mold that is transparent to radiation of a wavelength capable of initiating polymerization of the vinyl or acrylic monomer. Suitable photoinitiator compounds can be Type I, such as α-aminoalkylphenones, or Type II, such as benzophenones. Photosensitizers that allow the use of longer wavelengths can also be utilized. Depending on the initiator compound used, polymerization can be initiated by heat, radiation, or the addition of a catalyst.

[0070] In some embodiments of the present disclosure, prior to polymerization of copolymers (containing mixtures of major and co-major monomers), it is useful to synthesize macro-RAFT or prepolymers composed of 10-25 monomer units of hydrophilic major monomers. This can enhance the hydrophilicity of the often hydrophobic RAFT agent, facilitating the polymerization reaction in an aqueous environment.

[0071] In other embodiments, the RAFT agent itself is chemically modified by the incorporation of a water-soluble, monodisperse polyethylene glycol (PEG) spacer of 5-25 units. The modified RAFT agent exhibits improved water solubility and enables the synthesis of hydrophilic amino acid-containing copolymers in a single polymerization step.

[0072] RAFT agents are known to be unstable in the presence of amines, contributing to the strong odor of the resulting copolymers, and should therefore usually be deactivated once the polymerization and functionalization process is complete. Preferred methods for RAFT group deactivation in this disclosure are reaction with a nucleophile, thermal elimination, or a second reaction with a proton donating agent or an initiator in combination with an excess of functionalization initiator.

[0073] Because the copolymers of the present disclosure are intended for use in drug delivery to patients, it is generally preferred to purify the copolymers after polymerization. This step removes potentially harmful components, including residual initiator, monomer, or catalyst. Preferred methods for purifying the copolymers of the present invention are dialysis, tangential flow filtration, and capillary ultrafiltration.

[0074] It is noted that determining useful parameter values ​​does not require excessive effort, due both to the limited number of parameters and to the known preferred ranges of some parametric values. The level of co-major monomer in the amino acid-containing copolymer is preferably 1% (mol) to 49.9% (mol), more preferably 1% (mol) to 35% (mol), even more preferably 1% (mol) to 20% (mol), and most preferably 5% (mol) to 15% (mol) of all monomers present in the polymerization mixture. The average molecular weight of the amino acid-containing copolymer (excluding the therapeutic payload) is generally 5,000 to 100,000 daltons, preferably 6,000 to 60,000 Da, and most preferably 6,000 to 20,000 Da.

[0075] Once copolymerization and purification are complete, the copolymers of the invention, comprising the co-principal monomers of Formula I and / or II, are ready to be functionalized with an active agent molecule and / or a cell-type-specific or tissue-type-specific targeting moiety (e.g., an antibody). This functionalization results in the establishment of a covalent bond between the copolymer and the active agent molecule and / or targeting moiety. In the case of certain active agents, e.g., certain radioisotopes, a chelator is covalently attached to the copolymer, and the active agent is retained by the chelator.

[0076] In certain embodiments, the active agent (here, a cytotoxic drug or molecule used in cancer therapy) is a microtubule inhibitor such as monomethyl auristatin E (MMAE) or emtansine (DM1); an intercalating drug, e.g., doxorubicin; an alkylating agent, such as cyclophosphamide (CP); an antimetabolite, such as 5-fluorouracil (5-FU); a hormone or a hormone receptor modulator, such as tamoxifen citrate; a tyrosine kinase inhibitor, such as afatinib or bosutinib; a peptide-based toxin, e.g., α-amanitin; an immune checkpoint inhibitor, such as nivolumab® or pembrolizumab®. cross-link inhibitors; enzymes suitable for antibody-directed enzyme prodrug therapy (ADEPT); polynucleotide-based drugs capable of interfering with a gene(s) or its corresponding messenger RNA, siRNA, microRNA, or antisense RNA; or radioisotopes such as, but not limited to, fluoro-18, copper-64, gallium-68, zirconium-89, indium-111, iodine-123 (diagnostic uses), or strontium-89, yttrium-90, iodine-131, samarium-153, lutetium-177, radium-223, and actinium-225 (therapeutic uses).

[0077] In yet other specific embodiments, the active agent is a combination of a cytotoxic drug and a drug that can overcome tumor cell resistance, for example, by inhibiting anti-apoptotic factors such as Bcl-2 or by targeting cellular efflux pumps (such as the MDR-1 transporter).

[0078] The foregoing active agents are non-limiting examples of drugs and drug classes that are compatible with the copolymers of the present disclosure, and one of skill in the art can use variations or derivatives of the disclosed drugs and drug classes without going beyond the scope of the present disclosure.

[0079] Depending on the structure of the active agent, the active agent can be coupled directly to the alpha-amino or alpha-carboxyl group of the copolymer's main monomer, or it can be coupled to the copolymer via a linker structure. Such linkers can serve as a simple spacer between the active agent and the copolymer, act as modifiers of the copolymer's pharmacokinetics, or contain elements that enable or facilitate the release of the active agent in target cells. The linker should be stable in the bloodstream during and after storage to avoid unintended release of the active agent. Release of the active agent from the copolymer should occur only within the target cells. Therefore, useful linkers (focusing on cancer therapy) should be sensitive to intracellular factors such as caspases or cathepsins, glucuronidase (GUSB) (β-glucuronide-based linkers), acidic pH (found in tumor tissue or cell organelles [lysosomes]), or a reducing environment (responding to increased intracellular glutathione levels). Another possibility is the use of non-degradable linkers of the diamine or thioether type, which are not targeted by specific enzymes and are degraded only in the harsh environment of lysosomes or peroxisomes. The latter linker type is preferred, as it is associated with maximum serum stability and reduced non-specific toxicity.

[0080] In other embodiments, copolymers are not functionalized with an active agent or active agent-linker conjugate after synthesis, but are directly synthesized as active agent-containing copolymers by incorporation of co-primary monomers of Formulae III-X. The active agent loading is determined by the molar amounts of the principal monomer, co-primary monomers of Formulae III-X, and co-primary monomers of Formulae I and II present during polymerization. This approach is particularly useful for designing copolymers containing different combinations of active agents, as it allows the active agent to be incorporated both during and after synthesis by functionalization of the co-primary monomers of Formulae I and II. When the active agent is a short-half-life radioisotope, e.g., iodine-123, conjugation to the co-primary monomers of Formulae IX and X (when J is H) can be performed after polymerization.

[0081] As also discussed above, copolymers containing multiple active agents can be further functionalized with cell- or tissue-type-specific targeting moieties. This functionalization step is typically performed after the active agent is coupled to the copolymer; however, in special circumstances, such as in the case of active agents with short half-lives, such as certain radioisotopes, it may be necessary to first prepare a conjugate of the copolymer (comprising the co-primary monomers of Formulas I, II, IX, and / or X) with the targeting moiety. The active agent can then be loaded into the copolymer shortly before administration to a subject. Potential targeting moieties include, but are not limited to, monoclonal antibodies, including immune checkpoint inhibitors, antibody fragments, nanobodies (single-domain antibodies), DARPins, peptide hormones, non-antibody proteins capable of binding to cell surface receptors, DNA / RNA-based aptamers, and small molecules capable of binding to cell surface receptors (e.g., folate or biotin in the context of tumors). Covalent attachment of the targeting moiety to the copolymer should be performed in a site-specific manner to obtain a homogeneous product and preserve the binding affinity of the targeting moiety. Suitable coupling strategies presented in the present disclosure are enzyme-catalyzed reactions using peptide tags (e.g., sortase-mediated coupling), aldehyde tags, or transglutaminase tags, or the so-called "click" reaction between the copolymer and the targeting moiety. The latter process can be achieved by incorporating a reactive non-standard (unnatural) amino acid into the proteinaceous targeting moiety, e.g., an antibody, during synthesis (e.g., by codon extension techniques using a reprogrammed stop codon recognized by the tRNA of the unnatural amino acid). Of the above methods, sortase-mediated coupling is the preferred method for site-directed coupling of the copolymer to the targeting moiety. Sortase refers to a group of prokaryotic enzymes that modify surface proteins by recognizing and cleaving carboxyl-terminal sorting signals.In the Staphylococcus aureus enzyme, the recognition signal consists of the motif LPXTG (Leu-Pro-any-Thr-Gly), whereas in the Staphylococcus pyogenes enzyme, the motif is LPXTA (Leu-Pro-any-Thr-Ala). The signal sequence is preceded by a highly hydrophobic transmembrane sequence and a cluster of basic residues, such as arginine. Cleavage occurs between the Thr and Gly / Ala residues of the signal sequence, with transient binding of a Thr residue to the active site Cys residue of the sortase, followed by transpeptidation, covalently linking the protein to cell wall components (e.g., the peptidoglycan layer of Gram-positive bacteria). Cozzi, R. et al. (2011) FASEB J 25(6): 1874-86. This enzyme mechanism can be adapted to achieve peptide or protein fusion and has recently been used to prepare ADCs. European Patent Application No. 20130159484 (EP2777714); Beerli, RR et al. (2015) PloS One 10(7): e0131177. In the disclosed approach, a monoclonal antibody was genetically modified to contain a sortase motif at the C-terminus of its heavy and light chains, and a cytotoxic drug was modified to contain an oligo-glycine extension. The sortase-catalyzed reaction added the modified drug molecule to the C-terminus of the antibody chain with high efficiency, resulting in a homogeneous ADC.

[0082] By modifying the head groups of the disclosed copolymers with oligo-glycine extensions, the copolymers themselves become targets for sortase-catalyzed reactions. Because the copolymers can be loaded with multiple active agents, this approach results in ADCs in which many active agent molecules are linked to a small number of defined (non-canonical) sites on the antibody (2-4 C-terminal sortase tags per antibody molecule). This results in an increased DAR, and thereby increased ADC potency. The oligo-glycine extensions of the copolymers can be introduced at the beginning of polymerization using newly developed RAFT agents containing 2-8 glycine residues. When this functionalized RAFT agent is used, only one sortase motif is present on each copolymer molecule.

[0083] Another preferred enzymatic coupling method utilizes transglutaminase-catalyzed reactions, also known as protein glutamine gamma-glutamyltransferase, which typically crosslinks proteins by transferring the γ-carboxyamide group of a glutamine residue in one protein to the ε-amino group of a lysine residue in the same or another protein. Over the past 20 years, these enzymes have been used in diverse fields such as the food industry as "meat glue" (Martins IM et al. (2014), Appl. Microbiol. Biotechnol. 98: 6957-64?), tissue engineering (Ehrbar M. et al. (2007) Bio-macromolecules, 8(10):3000-7), modification of therapeutic proteins (Mero A. et al. (2011) J Control Release, 154(1):27-34) or gene delivery (Trentin D. et al. (2005) J Control Release, 102(1):263-75).

[0084] In this context, microbial transglutaminases (MTg) are a preferred class of enzymes because, in contrast to endogenous human transglutaminases, they are calcium- and nucleotide-independent enzymes. Compared to the four domains of human transglutaminases, microbial transglutaminases consist of a single domain and have a molecular weight approximately half that of human transglutaminases. Furthermore, MTg operates over a wide range of pH values, buffers, and temperatures, and has a fairly large list of potential substrates. (Kieliszek M et al. (2014) Rev Folia Microbiol. 59: 241-50; Martins IM. et al. (2014)

[0085] Similar to the sortase-mediated coupling strategy, the transglutaminase motif is introduced into the head group of the disclosed copolymer by modification with a RAFT agent, ensuring that only one transglutaminase motif is introduced per polymer chain. Suitable motifs include, but are not limited to, small peptides such as FKGG (Ehrbar M. et al. (2007)) as a potential lysine acceptor sequence, LQSP or TQGA (Caporale A. et al. (2015) Biotechnol J. 10(1):154-61) as a glutamine acceptor sequence [in which reactive lysine residues in cancer cell-specific targeting moieties are used], or monodisperse PEG spacers 5-25 units long containing a terminal amino group as a potential glutamine acceptor sequence. From an economic perspective, amino-PEG spacers are the most preferred motif for the disclosed copolymers, as they can be introduced without solid-phase synthesis and complex protection strategies.

[0086] A variation on this strategy utilizes transglutaminase for site-directed attachment of a click-reactive group (e.g., azide or tetrazine) to a targeting moiety, such as a monoclonal antibody, and this antibody-linked reactive group is then used to react with a click-reactive group (alkyne or strained alkene) on the "opposite" side of the polymer head group of a copolymer of the present disclosure. It is intended that the above-mentioned reactive moieties of the copolymer / antibody are interchangeable.

[0087] Other methods can be used to link targeting moieties to copolymers. Targeting antibodies or other polypeptides can be post-translationally modified, for example, by converting the hydroxyl functional groups of amino acid side chains to reactive aldehydes. In the case of polynucleotide-based targeting moieties, such as aptamers, coupling to the copolymers of the present disclosure can be achieved by reaction with reactive functional groups (e.g., amines, thiols, aldehydes) incorporated into the aptamers during solid-phase synthesis. Other site-directed coupling techniques known in the art can be used to couple copolymers to targeting moieties.

[0088] Pharmaceutical Composition Pharmaceutical compositions of the present disclosure comprise an effective amount of an active moiety of the present disclosure formulated together with one or more pharmaceutically acceptable carriers or excipients.

[0089] The pharmaceutical compositions of the present disclosure may be administered parenterally via inhalation spray, topical, rectal, nasal, buccal, vaginal, or implanted reservoir, and preferably by injection (or infusion). The pharmaceutical compositions of the present disclosure may contain any conventional non-toxic, pharmaceutically acceptable carrier, adjuvant, or vehicle. In some cases, the pH of the formulation may be adjusted with pharmaceutically acceptable acids, bases, or buffers to enhance the stability of the formulated active ingredient or its delivery form. As used herein, the term parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intra-articular, intra-arterial, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques.

[0090] Injectable preparations, for example, sterile injectable aqueous or oily suspensions, can be formulated according to known techniques using suitable dispersing or wetting agents and suspending agents. Sterile injectable preparations may also be sterile injectable solutions, suspensions, or emulsions in non-toxic parenterally acceptable diluents or solvents. Acceptable vehicles and solvents that can be used include water, Ringer's solution, USP, and isotonic sodium chloride solution. Solubilizing excipients include water-soluble organic solvents such as polyethylene glycol 300, polyethylene glycol 400, ethanol, propylene glycol, glycerin, N-methyl-2-pyrrolidone, dimethylacetamide, and dimethyl sulfoxide; Cremophor EL, Cremophor RH40, Cremophor RH60, Solutol HS15, d-α-tocopherol polyethylene glycol 1000 succinate, polysorbate 20, polysorbate 80, sorbitan monooleate, poloxamer 407, Labrafil M-1944CS, Labrafil Nonionic surfactants such as M-2125CS, Labrasol, Gellucire 44 / 14, Softigen 767, and mono- and di-fatty acid esters of PEG 300, 400, and 1750; castor oil, corn oil, cottonseed oil, olive oil, peanut oil, peppermint oil, safflower oil, sesame oil, soybean oil, hydrogenated vegetable oil, hydrogenated soybean oil, coconut oil, and palm kernel oil Water-insoluble lipids include medium-chain triglycerides of glycerol (glycerol oil), various cyclodextrins such as α-cyclodextrin, β-cyclodextrin, hydroxypropyl-β-cyclodextrin (e.g., Kleptose), and sulfobutylether-β-cyclodextrin (e.g., Captisol); and phospholipids such as lecithin, hydrogenated soy phosphatidylcholine, distearoylphosphatidylglycerol, L-α-dimyristoylphosphatidylcholine, and L-α-dimyristoyl-phosphatidylglycerol. Strickley (2004) Pharm. Res. 21: 201-30.

[0091] Injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter, or by incorporating sterilizing agents into sterile solid compositions which can then be dissolved or dispersed in sterile water or other sterile injectable medium before use (or by sterilizing the solid compositions by irradiation).

[0092] To prolong the effect of an active agent, it is often desirable to slow the absorption of the active agent from subcutaneous or intramuscular injection. Delayed absorption of parenterally administered active moieties can be achieved by dissolving or suspending the active moiety in an oil vehicle. Injectable depot forms are prepared by microencapsulating the active moiety in biodegradable polymers such as polylactide-polyglycolide. The rate of active agent release can be controlled depending on the ratio of active moiety to polymer and the nature of the particular polymer used. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations can also be prepared by entrapping the active moiety in liposomes or microemulsions that are compatible with body tissues.

[0093] Compositions for rectal or vaginal administration are preferably suppositories and can be prepared by mixing the active moiety of the present disclosure with a suitable non-irritating excipient or carrier such as cocoa butter, polyethylene glycol or a suppository wax, which is solid at ambient temperature but liquid at body temperature and therefore will melt in the rectum or vaginal cavity to release the active moiety (and thereby the active agent).

[0094] The dosage forms for topical or transdermal administration of the active ingredient of the present disclosure include ointments, pastes, creams, lotions, gels, powders, liquids, sprays, inhalants, or patches. The active ingredient is mixed under sterile conditions with a pharmaceutically acceptable carrier and, if necessary, any preservatives or buffers. Ophthalmic preparations, ear drops, eye ointments, powders, and liquids are also considered to be within the scope of the present disclosure.

[0095] The ointments, pastes, creams and gels may contain, in addition to the active ingredients of the present disclosure, excipients such as animal and vegetable fats, oils, waxes, paraffins, starches, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonite, silicic acid, talc and zinc oxide, or mixtures thereof.

[0096] Powders and sprays can contain, in addition to the active ingredient of this disclosure, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicate and polyamide powder, or mixtures of these substances. Sprays can additionally contain conventional propellants.

[0097] Transdermal patches can be prepared by dissolving or dispensing the active ingredient in a suitable medium. Absorption enhancers can also be used to increase the flux of the active ingredient across the skin. The rate can be controlled by either providing a rate-controlling membrane or by dispersing the active ingredient in a polymer matrix or gel.

[0098] In pulmonary delivery, the pharmaceutical composition of the present disclosure is formulated and administered to patients by direct administration in solid or liquid particle form, for example, by inhalation into the respiratory system.The solid or liquid particle form of the active ingredient prepared for the implementation of the present disclosure comprises particles of respirable size, i.e., particles small enough to pass through the oral cavity and larynx upon inhalation and reach the bronchi and alveoli of the lungs.The delivery of aerosolized therapeutic agents, particularly aerosolized antibiotics, is known in the art (see, for example, U.S. Patent No. 5,767,068, U.S. Patent No. 5,508,269 and WO98 / 43650).A discussion of pulmonary delivery of antibiotics can also be found in U.S. Patent No. 6,014,969.

[0099] The total daily dose of the active moieties of the present disclosure administered to a human subject or patient in single or divided doses preferably contains 0.01 to 50 mg / kg body weight of active agent, or more preferably 0.1 to 30 mg / kg body weight of active agent. Single dose compositions may contain such amounts or submultiples thereof to make up the daily dose. Generally, treatment regimens according to the present disclosure involve administering about 1 mg to 5000 mg of active agent (contained in the active ingredients of the present disclosure) per day to a human subject in need of such treatment, in single or divided doses. Doses for mammals can be extrapolated based on the latter human dose.

[0100] The active moieties of the present disclosure can be administered, for example, by intravenous, intraarterial, subdermal, intraperitoneal, intramuscular, or subcutaneous injection, or by buccal, nasal, transmucosal, topical, ointment formulation, or inhalation, in a daily dose containing about 0.01 to about 50 mg of active agent per kg body weight. Alternatively, dosages (based on a daily dose of about 1 mg to 5000 mg of active agent) can be administered every 4 to 120 hours, or according to the requirements of the particular active moiety. The methods herein contemplate administering an effective amount of the active moiety (in a pharmaceutical composition) to achieve the desired or described effect. Typically, pharmaceutical compositions of the present disclosure are administered about 1 to about 6 times per day, or alternatively, as a continuous infusion. Such administration can be used for chronic or acute treatment. The amount of active moiety that can be combined with pharmaceutically acceptable excipients or carriers to produce a single dosage form will vary depending on the host treated and the particular mode of administration. Typical compositions contain from about 5% to about 95% active ingredient (w / w). Alternatively, such preparations may contain from about 20% to about 80% active ingredient. The specific dosage and treatment regimen for any particular patient will depend on a variety of factors, including the activity of the particular active ingredient employed, age, body weight, general health, sex, diet, time of administration, excretion rate, drug combination, severity and course of the disease, condition, or symptom, the patient's disposition to the disease, condition, or symptom, and the judgment of the treating physician.

[0101] All references cited in this application, including publications, patents, and patent applications, are considered to be incorporated in their entirety.

[0102] The recitation of ranges of values ​​herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within that range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually set forth herein. Unless otherwise stated, all exact values ​​provided herein represent the corresponding approximation (e.g., all exact exemplary values ​​provided with respect to a particular factor or measure can, where appropriate, be considered to also provide the corresponding approximation, modified by "about").

[0103] Any description herein of any aspect or embodiment of the invention using language such as reference to a single or multiple elements is intended to provide support for similar aspects or embodiments of the present disclosure that "consist," "consist essentially of," or "substantially include" that particular single or multiple elements, unless otherwise stated or clearly contradicted by context (e.g., a composition described herein as comprising a particular element should be understood to also describe a composition consisting of that element, unless otherwise stated or clearly contradicted by context).

[0104] This invention includes all modifications and equivalents of the subject matter recited in the embodiments or claims presented herein to the maximum extent permitted by applicable law.

[0105] The present disclosure, having therefore been generally described, will be more readily understood by reference to the following examples, which are provided by way of illustration and are not intended to limit the invention. [Example]

[0106] Note: In the examples relating to the synthesis of side-chain linked amino acids, the names are given first in IUPAC nomenclature, followed by the abbreviated names. Table 1 shows the correspondence. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5]

[0107] Example 1 Copper complex-mediated synthesis of (S)-6-acrylamido-2-aminohexanoic acid monomer L-lysine (14.62 g, 100 mmol) was dissolved in 150 mL of deionized water and heated to approximately 80 °C. Copper carbonate (16.6 g, 75 mmol) was added in small portions over 30 minutes. The reaction was stirred for an additional 30 minutes. The hot, deep blue suspension was filtered through silica gel. The filter was washed with a small amount of water. The next day, the combined filtrate containing the lysine-copper complex was cooled in an ice bath, and 100 mL of tetrahydrofuran (THF) was added. A solution of acryloyl chloride (8.9 mL, 110 mmol) in methyl tert-butyl ether (TBME) was added dropwise over 1 hour. The pH was initially maintained at 8-10 by the parallel dropwise addition of 10% sodium hydroxide solution. After adding half of the acryloyl chloride solution, the product began to precipitate. When most of the acryloyl chloride had been added, the addition of sodium hydroxide was slowed to lower the pH to approximately 6, and the reaction mixture was allowed to reach room temperature. The blue suspension was stirred for an additional 2 hours and then filtered. The solid material retained on the filter was washed with water and acetone and then dried. The yield was 6.5 g of acryloyl-L-lysine copper complex.

[0108] Acryloyl-L-lysine copper complex (29.5 g) was suspended in 300 mL of deionized water and cooled in an ice bath. H2S gas was bubbled through the suspension until copper sulfide precipitation was complete. 3 grams of activated carbon was added to the suspension. The suspension was briefly heated to 100 °C. After cooling to room temperature, 500 mL of acetone was added to the suspension, which was then filtered through silica gel. The clear filtrate was placed on a rotary evaporator. After evaporation of the solvent, the solid product was recrystallized in 200 mL of 50% aqueous acetone. A white powder was obtained with a yield of 17.76 g (70%). The structure of this compound was verified by NMR and LC-MS spectroscopy.

[0109] Example 2 Synthesis of (2S)-3-(acryloyloxy)-2-aminopropanoic acid A solution of L-serine (5 g, 47.6 mmol) in water (50 mL) was heated to 80° C., and solid copper carbonate (5.79 g, 26.2 mmol) was added. The solution was stirred for 10 minutes. The undissolved residue was then collected by filtration and washed with water (30 mL). The combined filtrate was cooled in an ice bath, and KOH (27.1 mL, 47.6 mmol) was slowly added. To this solution was added dropwise a mixture of acryloyl chloride (4.52 mL, 59.5 mmol) in acetone (30 mL). The reaction mixture was then incubated overnight at 4° C. under stirring. The solid formed was isolated, washed with water (50 mL) / methanol (50 mL) / ethyl tert-butyl ether (50 mL) (MTBE), and finally dried under reduced pressure to give O-acryloyl-L-serine-Cu. 2+ The complex (3.8 g, 10.01 mmol, 42.1% yield) was obtained. Subsequently, the copper in the complex was removed by a procedure similar to that described in Example 1. A yield of 1.43 g (45%) of acryloyl-L-serine was obtained as a white powder. The identity of this compound was verified by NMR and LC-MS spectroscopy.

[0110] Example 3 Synthesis of (2S)-3-(acryloyloxy)-2-aminobutanoic acid A reaction vessel containing 6 mL of trifluoroacetic acid (TFA) was cooled in an ice bath. Solid L-threonine (2.00 g, 16.79 mmol) was then added, and the mixture was stirred for 5 minutes. Trifluoromethanesulfonic acid (0.18 mL, 2.0 mmol) was added, followed by acryloyl chloride (2.5 mL, 32.9 mmol), and the reaction mixture was incubated at room temperature for 2 hours. After the reaction was complete, the product was precipitated with methyl tert-butyl ether (MTBE). After isolation of the solid, the product was washed with MTBE and acetone. Finally, O-acryloyl-L-threonine hydrochloride was dried under reduced pressure to give a white powder (32% yield). The structure of this compound was verified by NMR and LC-MS spectroscopy.

[0111] Example 4 Synthesis of (S)-3-(4-(acryloyloxy)phenyl)-2-aminopropanoic acid O-Acryloyl-L-tyrosine-Cu 2+ The synthesis of the complex was carried out according to the procedure described in Example 1. Copper was removed from the complex by the following procedure: 73.15 g (140 mmol) of O-acryloyl-L-tyrosine-Cu 2+ The complex was dissolved in 220 mL of 2N HCl in a crushing dish. The mixture was homogenized using a Polytron® PT3000 instrument. The mixture was then filtered, and the residue was washed twice with 50 mL of 2N HCl. The solid compound was then dried over NaOH under reduced pressure at 40°C to obtain O-acryloyl-L-tyrosine hydrochloride (46.96 g, 63% yield).

[0112] Example 5 Synthesis of (S)-2-(4-acrylamidophenyl)-2-aminoacetic acid Boc-4-amino-L-phenylalanine (2.50 g, 8.9 mmol, Anaspec, Fremont, CA) was dissolved in 25 mL of chloroform. Triethylamine (2.47 mL, 17.8 mmol) was added to the solution, and the mixture was cooled to -15 °C. Subsequently, acryloyl chloride (0.79 mL, 9.8 mmol) in chloroform was added dropwise to the mixture with stirring. After the addition of acryloyl chloride was complete, the reaction mixture was stirred for an additional 3 h. The reaction mixture was then passed through a glass filter, and the protected (S)-2-(4-acrylamidophenyl)-2-aminoacetic acid was purified by column chromatography, and the residual solvent was evaporated. The resulting (S)-2-(4-acrylamidophenyl)-2-((tert-butoxycarbonyl)amino)acetic acid (500 mg, 1.5 mmol) was dissolved in 5 mL of dichloromethane (DCM). Trifluoroacetic acid (TFA) (800 μL, 10.38 mmol) was added, and the solution was stirred at room temperature for 1 h. The solvent was then removed under reduced pressure, 5 mL of DCM was added, and the solvent was again removed under reduced pressure. This procedure was repeated several times. Finally, the product was dissolved in 3 mL of DCM and precipitated with methyl tert-butyl ether (MTBE). The solid was collected on a glass filter and dried under vacuum to give pure acryloyl-4-amino-L-phenylalanine in 15% yield. The structure of this compound was verified by NMR.

[0113] Example 6 Synthesis of (2S)-4-(acryloyloxy)pyrrolidine-2-carboxylic acid and (R)-3-(acryloylthio)-2-aminopropanoic acid The synthesis of these compounds was carried out as described in Example 1. For (2S)-4-(acryloyloxy)pyrrolidine-2-carboxylic acid and (R)-3-(acryloylthio)-2-aminopropanoic acid, the starting materials were 4-hydroxy-L-proline and L-cysteine, respectively.

[0114] Example 7 Synthesis of (S)-6-acrylamido-2-(3-(4-hydroxyphenyl)propanamido)hexanoic acid (AK-phenol) To a solution of AK (538 mg, 2.69 mmol) and TEA (443 μL, 3.18 mmol) in DMF (9 mL) was added Bolton-Hunter reagent (643 mg, 2.44 mmol). The reaction mixture was stirred at room temperature overnight. The reaction mixture was then filtered, and the volatiles were removed under a stream of N2. The residue was purified by SiO2 column chromatography. The structure was verified by NMR spectroscopy.

[0115] Example 8 Synthesis of methacrylic / ethylacrylic / propylacrylic derivatives of amino acids The synthesis of methacryl / ethylacryl / propylacryl derivatives was carried out using the corresponding acid chloride, eg methacryloyl chloride, under the conditions described in Examples 1-7.

[0116] Example 9 Synthesis of fluorescein-modified co-primary monomer AK-fluorescein-V1 In a 20 mL reaction vessel, a solution of acryloyl-L-lysine [see Example 1] (150 mg, 0.749 mmol), fluorescein isothiocyanate (FITC, 321 mg, 0.824 mmol), and triethylamine (0.114 mL, 0.824 mmol) was prepared in DMF. The reaction was incubated overnight at room temperature in the dark under constant stirring. The solution was then filtered through a 0.4 μm filter to remove potential particulates. Residual solvent was then removed by rotary evaporation at 30 °C under vacuum. The structure was verified by NMR and LC-MS (yield 98%, purity >95%). The synthesized monomer was then tested for copolymerization with dimethylacrylamide (DMA) [90 / 10 mol / mol] using DMF as the solvent and AIBN as the initiator. The polymerization reaction was carried out at 65° C. for 6 hours, and the resulting copolymer was analyzed by gel permeation chromatography (GPC) using the protocol presented in Example 13.

[0117] Example 10 Synthesis of fluorescein-modified co-primary monomer AK-fluorescein-V2 The reaction was carried out using fluorescein-NHS as the starting material according to the synthesis protocol presented in Example 9, but with a 10 mol % excess of AK, which was removed by precipitation after the reaction.

[0118] The structure was verified by NMR and LC-MS (yield 85%, purity >93%). The synthesized monomer was then tested for copolymerization with dimethylacrylamide (DMA) [90 / 10 mol / mol] using DMF as the solvent and AIBN as the initiator. The polymerization reaction was carried out at 65 °C for 6 h, and the resulting copolymer was analyzed by GPC using the protocol presented in Example 13.

[0119] Example 11 Synthesis of doxorubicin (DOX)-modified co-lead monomer (AK-DOX-V1) with a non-cleavable linker To a solution of DOX·HCl (200 mg, 345 μmol, 1.00 equiv.) and EtN (50 μL, 348 μmol, 1.01 equiv.) in DMF, succinic anhydride (36.2 mg, 362 μmol, 1.05 equiv.) was added. The mixture was stirred at room temperature under an inert atmosphere for 30 minutes, and then NHS (43.7 mg, 379 μmol, 1.10 equiv.) was added, followed by EDC·HCl (69.4 mg, 362 μmol, 1.05 equiv.). The resulting mixture was stirred at room temperature overnight, and then AK (69.0 mg, 345 μmol, 1.00 equiv.) was added, followed by EtN (53 μL, 379 μmol, 1.10 equiv.). The reaction mixture was again stirred at room temperature overnight. The volatiles were evaporated under a stream of N2 and the residue was purified by SiO2 column chromatography to give the desired product (228 mg, 276 μmol, 80%).

[0120] Example 12 Synthesis of doxorubicin-modified co-lead monomer (AK-DOX-V2) bearing a cathepsin B-sensitive linker A solution of DOX·HCl (86 mg, 149 μmol, 1.10 equiv.), MC-Val-Cit-PABO-PNP (100 mg, 136 μmol, 1.00 equiv.), and N,N-diisopropylethylamine (DIPEA) (26 μL, 149 μmol, 1.10 equiv.) in N-methyl-2-pyrrolidone (NMP) was stirred at room temperature for 2 h. To the resulting mixture, AK (28.5 mg, 142 μmol, 1.05 equiv.) was added, followed by DIPEA (26 μL, 149 μmol, 1.10 equiv.). The reaction mixture was stirred overnight at room temperature. The volatiles were evaporated under a stream of N2, and the residue was purified by chromatography on SiO2 to give the desired product (109 mg, 81 μmol, 60%).

[0121] Example 13 BOC-G n -General procedure for the synthesis of Cellophil Step 1: Synthesis of RAFT-NHS intermediate: To a solution of 2-[[(ethylthio)thioxomethyl]thio]-2-methyl-propanoic acid (22.85 g, 102 mmol, 1.0 equiv.), synthesized as described by Tucker et al. (ACS Macro Letters (2017) 6(4): 452-457), and 1-hydroxypyrrolidinine-2,5-dione (12.89 g, 112 mmol, 1.1 equiv.) in CHCl was added EDC·HCl (21.48 g, 112 mmol, 1.1 equiv.) at 0 °C. The reaction mixture was stirred at room temperature for 16 h. The reaction mixture was then partially evaporated (to approximately half the total volume) under a stream of N and diluted with AcOEt and double-distilled water (ddH2O). The biphasic solution was transferred to a separatory funnel, and after extraction, the organic phase was washed successively with ddH2O, saturated aqueous NaHCO3 (3x), ddH2O (2x), and brine. The organic phase was dried (Na2SO4), and all volatiles were removed under reduced pressure. The residue was triturated with n-hexane, and the resulting yellow suspension was filtered. The cake was washed with n-hexane. The yellow solid was dried under reduced pressure, and the resulting intermediate (RAFT-NHS) was used without further purification (31.8 g, 99.0 mmol, 97%). All analytical data were consistent with literature values. Yang et al. (2012) Macromolecular Rapid Communications 33(22): 1921-6.

[0122] Step 2: Synthesis of RAFT-EDA-BOC intermediate: To a solution of the RAFT-NHS starting material (1.22 g, 3.61 mmol, 1.0 equiv.) in CHCl was added dropwise a solution of t-butyl-(2-aminoethyl)carbamate (0.81 g, 5.0 mmol, 1.4 equiv.) and EtN (1.0 mL, 7.2 mmol, 2.0 equiv.) in CHCl at −10° C. The reaction mixture was stirred at room temperature for 12 h. The organic mixture was washed successively with a saturated aqueous solution of NHCl (2×), a saturated aqueous solution of NaHCO (2×), and brine. The organic phase was dried (NaSO), and all volatiles were removed under reduced pressure. The residue was recrystallized from a mixture of n-heptane and EtO. The yellow crystals were filtered, washed with n-heptane, and dried under reduced pressure to give the following intermediate (RAFT-EDA-BOC, 1.26 g, 3.44 mmol, 95%), the structure of which was verified by MS and NMR spectroscopy.

[0123] Step 3: Synthesis of RAFT-EDA-OTf intermediate: A cold solution of RAFT-EDA-BOC (1.25 g, 3.41 mmol, 1.0 equiv) in TFA was stirred for 60 min. The reaction mixture was then treated with MeOH and CH2Cl2. l2 The mixture was diluted with HCl (1 / 2) and the volatiles were partially removed (2 / 3 of the total volume) under a stream of N. The resulting RAFT-EDA-OTf was isolated as a yellow oil (2.00 g, 3.29 mmol, 96%) and used in the next step without further purification. The structure of the resulting compound was verified by MS and NMR spectroscopy.

[0124] Step 4: BOC-G n Synthesis of -RAFT intermediates: A solution of BOC-G3 (697 mg, 2.41 mmol, 1.0 equiv.), 1-hydroxybenzotriazole hydrate (HOBt hydrate) (92.0 mg, 600 μmol, 0.25 equiv.), and EDC·HCl (485 mg, 2.53 mmol, 1.05 equiv.) in CHCl was stirred at 0 °C for 30 min under an inert atmosphere (N). To this solution, a solution of RAFT-EDA-OTf (917 mg, 2.41 mmol, 1.0 equiv.) in CHCl and DIPEA (2.13 mL, 12.5 mmol, 5.2 equiv.) were added dropwise in succession. The reaction mixture was stirred at 0 °C for 1 h and then at room temperature overnight. The reaction mixture was diluted with CHCl, and the organic mixture was washed successively with saturated NHCl solution (3x), saturated NaHCO solution, ddH2O, and brine. The organic phase was collected, dried (Na2SO4), and the volatiles were partially removed (2 / 3 of the total volume) under reduced pressure. EtOAc was added to the resulting solution. The resulting cloudy solution was then stored in the refrigerator overnight to give a yellow suspension, which was filtered and the cake washed with cold EtOAc. The yellow solid was dried under reduced pressure to give the BOC-G3-RAFT agent (396 mg, 736 μmol, 31%). The structure of the resulting compound was verified by MS and NMR spectroscopy.

[0125] Step 5: BOC-G n Synthesis of -DMA-RAFT prepolymer To a solution of DMA (192 μL, 1.86 mmol, 10 equiv.) in dioxane, BOC-G3-RAFT agent (100 mg, 186 μmol, 1.0 equiv.) and AIBN (6.1 mg, 37 μmol, 0.20 equiv.) were added sequentially. The reaction mixture was stirred at 60 °C for 6 h. The reaction product was then precipitated in n-hexane. The pale yellow suspension was filtered, and the resulting cake was washed with n-hexane and finally dissolved in acetone. Volatiles were then removed under reduced pressure to yield the BOC-G3-DMA-RAFT prepolymer as a yellow oil (280 mg, 186 μmol, 99%). The structure of the resulting compound was verified by MS and NMR spectroscopy.

[0126] Step 6 (if necessary): G nSynthesis of -DMA-RAFT prepolymer A solution of BOC-G3-DMA-RAFT prepolymer in dioxane is treated with a solution of HCl (4 M) in dioxane for 2 h. Volatiles are removed under a stream of N2 at room temperature. The residue is used without further purification. The structure of the resulting compound is verified by MS and NMR spectroscopy.

[0127] Step 7: BOC-G n -Synthesis of Cellophil To a solution of DMA (1.23 mL, 11.9 mmol, 70 equiv.) and AK (272 mg, 1.36 mmol, 8 equiv.) in ddHO, BOC-G3-DMA prepolymer (221 mg, 170 μmol, 1.0 equiv.) and VA044 (27.5 mg, 85 μmol, 0.4 equiv.) were added sequentially. The reaction mixture was stirred at 55°C for 4 hours. The reaction mixture was diluted with ddHO and dioxane. To this solution, phosphinic acid (50 wt%, 93 μL, 850 μmol, 5 equiv.), TEA (118 μL, 850 μmol, 5 equiv.), and VA044 (27.5 mg, 85 μmol, 0.5 equiv.) were added sequentially. The reaction mixture was stirred at 100°C for 4 hours. The resulting mixture was then dialyzed against ddH2O (MWCO 3.5 kDa), and the concentrate was freeze-dried to obtain BOC-G3-Cellophil as a white powder (1.20 g, 120 μmol, 71% in two steps). The structure of the resulting compound was verified by NMR spectroscopy and GPC using the following protocol: A 3.33 mg / mL stock solution of the copolymer was prepared in elution buffer (deionized water containing 0.05% (w / v) NaN3) and filtered through a 0.45 μm syringe filter. Subsequently, 0.4 mL of the stock solution was injected into the port of the GPC instrument (1260 Infinity LC-System, Agilent, Santa Clara, CA). Chromatography was performed with the elution buffer at a constant flow rate of 0.5 mL / min. Copolymer samples were separated on a Supurema 3 column system (precolumn, 1000 Å, 30 Å; particle size 5 μm; PSS, Mainz, Germany) installed in an external column oven at 55 °C. The copolymers were analyzed by RI (refractive index) and UV detection. A calibration curve (10 points) was established using a pullulan standard. The molecular weights of the characterized copolymers were estimated by reference to this standard.

[0128] The synthesis of the pentaglycine derivative (BOC-G5-Cellophil) was accomplished according to the above protocol with the slight modification of using BOC-G5-Na salt as the starting material. BOC-G5-Na salt was obtained from pentaglycine and synthesized according to Wang, T.-P. et al. (2012) Bioconjugate Chemistry 23(12): 2417-2433. Other oligoglycine-functionalized Cellophil copolymers can be produced using similar protocols.

[0129] Example 14 BOC-G n -PEG x -Synthesis of Cellophil BOC-G3-PEG 11 The synthesis of -Cellophil was accomplished according to the general procedure described above (Example 13: Steps 1-4 and 7). Step 2 used BOC-PEG as the starting material. 11 -CH2CH2-NH2 to form RAFT-PEG 11 -BOC, step 3 was carried out using HCl in EtOAc.

[0130] PEG 23 Derivative (BOC-G3-PEG 23 -Cellophil) was synthesized using BOC-PEG as the starting material. 23 This was achieved by following the protocol described above with the slight modification of using -CH2CH2-NH2. Other oligoglycine- and PEG-functionalized Cellophil copolymers can be produced by similar protocols.

[0131] Example 15 BOC-G n -Cellophil-(fluorescein)8 or BOC-G n -PEG x Synthesis of -Cellophil-(fluorescein) 8 BOC-G3-Cellophil (1.0 equiv.) or BOC-G3-PEG in an aqueous solution of NaHCO3 (0.1 N)11 To a solution of 1.0 equiv. of FITC (preparation see Example 13, Step 7) was slowly added a solution of FITC (16 equiv.) in DMSO. The resulting reaction mixture was stirred at room temperature for 16 h and then dialyzed (MWCO 3.5 kDa) against an aqueous solution of NaHCO3 (0.1 N) and then ddH2O. The concentrate was freeze-dried to give a dark orange powder (yield: 80-92%). The structure of this compound was verified by NMR and GPC. Triglycine and Triglycine-(PEG) 23 The synthesis of derivatives was achieved using the same protocol.

[0132] Example 16 H2N-G n -Cellophil-(fluorescein)8 or H2N-G n -PEG x Synthesis of -Cellophil-(fluorescein) 8 BOC-G3-Cellophil-(fluorescein)8 (1.0 equiv.) or BOC-G3-PEG in EtOH 11 To a solution of -Cellophil-(fluorescein)8 (1.0 equiv.) was added a solution of HCl (approximately 1.25 N) in EtOH. The resulting reaction mixture was stirred at room temperature for 2 h and dialyzed (MWCO 3.5 kDa) against water (2x). The concentrate was freeze-dried to yield a dark orange (static) powder (99%). The structure of this compound was verified by NMR and GPC.

[0133] Example 17 Synthesis of cathepsin B-sensitive doxorubicin-containing cellophils. Step 1 Preparation of H-Lys(Alloc)-OH A solution of L-lysine hydrochloride (1.0 equiv.) and basic copper(II) carbonate (1.1 equiv.) in HO (100 mL) was refluxed for 30 minutes. The solid formed during reflux was removed by hot filtration. The filtrate was cooled to 0°C and adjusted to pH 9 by the addition of solid sodium bicarbonate (3.1 equiv.). Allyl chloroformate (1.5 equiv.) was added dropwise over 1 hour while the solution was stirred at 0°C. During this addition, the reaction mixture was maintained at pH 9 by the addition of solid sodium bicarbonate. The reaction mixture was warmed to room temperature and stirred overnight. The blue solid product formed during the reaction was collected by filtration in quantitative yield. The solid copper salt of Lys(Alloc) was suspended in HO (250 mL) and 2 equivalents of thioacetamide (2.0 equivalents) were added. The alkaline suspension was stirred at 50 °C for 3 h, during which time the solid slowly dissolved. The solution was then acidified to pH 2 with 2 M HCl and boiled for 5 min. The precipitated CuS was removed by filtration. The filtrate was concentrated under vacuum to approximately 60 mL, at which point the hydrochloride salt of Lys(Alloc) precipitated as a white solid (79%), which was collected by filtration.

[0134] Step 2 Preparation of FMOC-Val-Lys(Alloc)-OH A vigorously stirred solution of FMOC-Val-OSu (1.0 equiv.) in dioxane (30 mL) at room temperature was combined with a solution of Lys(Alloc)-OH (1.1 equiv.) and NaHCO (2.1 equiv.) in water (30 mL). The temperature was maintained below 25°C using a cold water bath for the first 30 minutes. The mixture was continued to stir at room temperature for 14 hours. The mixture was diluted with water (50 mL) and then acidified to pH 3 with 15% citric acid. The resulting suspension was extracted with ethyl acetate (3 x 100 mL), and the combined organic layers were washed with water and brine, dried, and evaporated to give an off-white solid. The solid was dissolved in THF, followed by the addition of methyl tert-butyl ether (MTBE), which gave a pure white solid (80%) after filtration.

[0135] Step 3 Preparation of FMOC-Val-Lys(Alloc)-PABOH A stirred solution of FMOC-Val-Lys(Alloc)-OH (1.0 equiv.) and PABOH (1.1 equiv.) in THF (15 mL) was treated with EEDQ (1.1 equiv.) after 16 h. The mixture was evaporated to dryness at 30 °C, and the residue was recrystallized from MTBE to give a deep yellow product (84%).

[0136] Step 4: Preparation of H-Val-Lys(Alloc)-PABOH FMOC-Val-Lys(Alloc)-PABOH (1.0 equiv.) in CHCl (35 mL) was treated with diethylamine (50 mL) at room temperature. The mixture was briefly sonicated and stirred at room temperature for 4 hours. The solvent was evaporated, and the residue was flushed with CHCl and chromatographed on silica to give the product as a colorless foam (69%).

[0137] Step 5: Preparation of MC-Val-Lys(Alloc)-PABOH H-Val-Lys(Alloc)-PABOH (1.1 equivalents) and DIEA (1.1 equivalents) in CHCl (5 ml) were treated with MC-NHS (1.1 equivalents) in CHCl (2 ml) at room temperature. The mixture was stirred at room temperature overnight. Ethyl acetate (60 ml) was added, and the mixture was washed with water and brine, dried, and evaporated to give the desired product (96%).

[0138] Step 6: Preparation of MC-Val-Lys(Alloc)-PABO-PNP A stirred solution of MC-Val-Lys(Alloc)-PABOH (1.0 equiv.) in THF (15 mL) was treated with PNP chloroformate (1.2 equiv.) and dry pyridine (1.5 equiv.). The reaction was stirred overnight until HPLC analysis showed no extractives were present in the mixture. The mixture was diluted with EtOAc (50 mL) and acidified with citric acid (50 mL, 10% in HO). The organic phase was washed with water (50 mL) and brine (25 mL), dried over sodium sulfate, and the solvent was evaporated to give a pale yellow solid. The solid was purified by flash chromatography on silica gel (20:1 DCM / MeOH) to give the pure compound as a yellowish solid (58%).

[0139] Step 7: Preparation of MC-Val-Lys(Alloc)-PABC-DOX MC-Val-Lys(Alloc)-PABO-PNP (1.0 equiv.) and DOX·HCl (1.1 equiv.) in NMP (8 mL) were treated with EtN (1 equiv.) at room temperature. The mixture was then incubated in the dark for 3 days. The mixture was then diluted with 10% 2-propanol / ethyl acetate (100 mL), washed with water (3 × 100 mL) and brine (50 mL), dried, and evaporated to give a deep orange oil. This was purified by flash chromatography on silica gel to give the pure product as a red solid (92%).

[0140] Step 8: Preparation of MC-Val-Lys-PABC-DOX MC-Val-Lys(Alloc)-PABC-DOX (1.0 equiv.) in THF (7 mL) was treated with Pd(PPh3)4 (0.03 equiv.), acetic acid (2.5 equiv.), and tributyltin hydride (1.5 equiv.) under argon at room temperature. The mixture was stirred in the dark at room temperature for 1 hour, during which time an orange solid began to form. The mixture was diluted with ether (25 mL), followed by the addition of 1 M HCl in ether (2 mL). The resulting suspension was briefly sonicated and then filtered. The orange solid was washed repeatedly with ether and then dissolved in 5:1 DCM:MeOH. To this was added Celite (7 g), and the solvent was then evaporated. The resulting solid was adsorbed onto Celite® and dry-loaded onto a Celite column (prepared from a 100:1 DCM:MeOH slurry). The column was eluted with a 100:1 mixture of DCM:MeOH followed by a 10:1 mixture of DCM:MeOH to give the desired product as an orange solid (30%). Linker derivatives with different amino acid sequences, MC-Ala-Lys-PABC-DOX and MC-Val-Cit-PABC-DOX, were synthesized according to the same procedure described above, except that the citrulline linker did not require an Alloc protecting group.

[0141] Step 9: Coupling of Cathepsin B-Sensitive Linkers to Cellophil Copolymers The linker oxorubicin conjugate described above was then coupled to the Cellophil copolymer (Example 13, Step 7) using the following general procedure. To a solution of Cellophil copolymer (1.0 equiv.) and EtN (12 equiv.) in DMF, a solution of linkeroxorubicin conjugate (10 equiv.) was added dropwise at room temperature under an inert atmosphere. The reaction mixture was stirred overnight at room temperature. Finally, the mixture was diluted with ddH2O, and the resulting suspension was filtered. The filtrate was then dialyzed (MWCO 3.5 kDa) against ddH2O (2 x 10 L), and the concentrate was lyophilized to yield a red, free-flowing powder (60-70% yield). The structure of the resulting compound was verified by NMR spectroscopy.

[0142] Example 18 Cathepsin B-mediated release of doxorubicin from Cellophil copolymers. Human liver cathepsin B (Merck, MW approximately 27500) (5 units) was dissolved in 400 μL of acetate buffer (50 mM acetate + 1 mM EDTA, pH 5.0). 10 μL of the enzyme solution was incubated with 390 μL of activation solution (5 mM dithiothreitol, 100 mM sodium phosphate buffer, 5 mM EDTA, 100 mM NaCl, 0.01% Brij 58, pH 6.0) at 37°C for approximately 30 minutes. Meanwhile, 20 μL of the polymer linker-DOX conjugate of Example 17 (1 μmol) was added to 1473 μL of the activation solution and incubated at 37°C. 32 μL of the activated enzyme (0.01 U) was added to the substrate solution, and the reaction was incubated at 37°C. The release of free DOX was monitored by HPLC and photometric measurement. MC-Val-Lys-PABC-PNP-DOX exhibited the shortest half-life, followed by MC-Ala-Lys-PABC-DOX and MC-Val-Cit-PABC-DOX.

[0143] Example 19 Copolymerization of doxorubicin-containing co-primary monomers (AK-DOX-V1 and AK-DOX-V2). Synthesis of Cellophil copolymers containing doxorubicin using BOC-G as the RAFT agent n -RAFT intermediate, BOC-G n -DMA-RAFT prepolymer, RAFT-PEG X This is achieved by the general procedure for copolymerization of co-lead monomers (Example 13, Step 7) using -BOC, or the corresponding BOC deprotection reagent (obtained according to the protocol described in Example 13, Step 6) (1.0 equivalent) and doxorubicin-containing co-lead monomer (8.0 equivalents) (AK-DOX-V1 or AK-DOX-V2).

[0144] Example 20 AK-phenol copolymerization The synthesis of Cellophil copolymers containing iodine-reactive monomers was performed using the following RAFT reagents: BOC-G3-RAFT intermediate, BOC-G3-DMA-RAFT prepolymer, and RAFT-PEG. 11 This was achieved by the general procedure for copolymerization of co-leading monomers (Example 13, Step 7) using -BOC, or the corresponding BOC deprotection reagent (obtained according to the protocol described in Example 13, Step 6) (1.0 equiv.) and AK-phenol (8.0 equiv.) as the co-leading monomer. Instead of ddHO, 0.1 M NaHCO was used as the solvent. The structure of the desired product was verified by NMR spectroscopy.

[0145] Example 21 Iodination of iodine-reactive polymer supports To a solution of the AK-phenol copolymer of Example 20 (70 mg, 7.0 μmol) in PBS buffer (pH = 7.4), NaI (7.86 mg, 52 μmol) and chloramine T (14.8 mg, 52 μmol) were added sequentially. The reaction mixture was then stirred at room temperature for 30 minutes, after which it was diluted with an aqueous solution of NaSO (0.3 M). The resulting solution was then dialyzed against 10 L of ddHO, and the concentrate was freeze-dried. The structure of the desired product was verified by NMR spectroscopy.

[0146] Example 22 Coupling of H2N-G5-Cellophil-(Fluorescein)8 to a Her2+ model antibody using a sortase-mediated reaction H2N-G5-Cellophil-(Fluorescein)8 (Example 16) can be conjugated to a fully human monoclonal antibody against the Her2 antigen using the following general procedure: A Her2 monoclonal antibody (10 μM) genetically modified with a sortase motif (LPETG) and a hexahistidine tag (His6) at the C-terminus of the heavy chain is incubated with H2N-G5-Cellophil-(Fluorescein)8 (100 μM) in the presence of 0.62 μM sortase A in 50 mM Hepes, 150 mM NaCl, 5 mM CaCl2, pH 7.5 at 25°C for 3.5 hours. The reaction is terminated by passing the column through a Protein A HiTrap column (GE Healthcare) equilibrated with 25 mM sodium phosphate (pH 7.5). The packed column is washed with 5 column volumes (CV) of buffer. The bound conjugate was eluted with 5 CV of elution buffer (0.1 M citric acid, pH 2.8), and 1 CV fractions were collected into tubes containing 25% (v / v) 1 M Tris base to neutralize the solution. Protein-containing fractions were pooled and subsequently buffer-exchanged into 10 mM sodium succinate pH 5.0, 100 mg / mL trehalose, and 0.1% (w / v) polysorbate 20 using a NAP-25 column (GE Healthcare) according to the manufacturer's instructions. The success of the coupling reaction was quantitatively verified by SDS-PAGE on a 4-20% gradient Tris-glycine gel and Western blot (WB) analysis using an anti-His6 primary antibody and a horseradish peroxidase-conjugated secondary antibody. WB signal detection was performed using an enhanced chemiluminescence (ECL) kit (Pierce™, ECL Western Blotting Substrate). Unmodified anti-Her2-LPETG-His6 antibody served as a control. Disappearance of the anti-His6 antibody indicated the completion of the sortase reaction. For quantitative analysis, size exclusion chromatography was performed. The drug-to-antibody ratio (DAR) was calculated by comparing the peak intensity of the remaining unmodified antibody (UV detection wavelength 280 nm).

[0147] Example 23 Toxicity testing of H2N-G3-Cellophil copolymers The polymeric carrier of the present disclosure is not biodegradable. Therefore, it was important to demonstrate that the carrier is non-toxic to healthy tissue. A toxicity study of the polymeric carrier of the present disclosure (without payload) was conducted. Briefly, HepG2 cells were plated at 100 μL per well in a 96-well black-walled, clear-bottom polystyrene plate. The test compound was H2N-G3-Cellophil copolymer (12 kDa) containing DMA and AK (90 / 10 mol%), prepared according to the procedure described in Example 13, Step 7. HepG2 cells were dosed with the test compound at concentrations ranging from 0.04 to 100 μM. At the end of a 72-hour incubation at 37°C, the appropriate dye or antibody was added to the culture. The plates were then scanned using an automated fluorescent cell imager (ArrayScan®, Thermo Scientific Cellomics). The following eight cell health parameters (CHPs) were assessed:

[0148] Cell counting: A decreased number of cells per well indicates toxicity due to necrosis, apoptosis, or reduced cell proliferation. Nuclear size: An increase in nuclear field can indicate necrosis or G2 cell cycle arrest, while a decrease can indicate apoptosis. DNA structure: An increase in DNA structure can indicate chromosomal instability and DNA fragmentation. Mitochondrial mass: A decrease in mitochondrial mass indicates a loss of total mitochondria, while an increase suggests mitochondrial swelling or an adaptive response to cellular energy demands. Mitochondrial membrane potential (Δψm): A decrease indicates a loss of mitochondrial integrity, which typically results in apoptotic signaling, while an increase in mitochondrial membrane potential indicates an adaptive response to cellular energy demands. Oxidative stress: An increase in reactive oxygen species (ROS) is an early cytotoxic response. Glutathione content: A decrease in glutathione (GSH) content can be the result of ROS production or direct binding to the test compound. An increase in GSH content represents an adaptive response of the cell to oxidative stress. Cellular ATP: Upon cell lysis, ATP is released from the cell. Metabolically inactive cells do not release ATP. Thus, a reduction in metabolically active cells results in a reduction in the detected ATP levels. [Table 2] Control 1: carbonyl cyanide 3-chlorophenylhydrazone; Control 2: L-buthionine-sulfoximine; MEC: minimum effective dose, i.e., the lowest dose at which an effect is detected: AC 50 : concentration at which 50% of the maximal effect is observed; MTD: maximum tolerated dose, i.e., concentration at which <20% cell loss is observed. NR: no response; NS: not statistically significant. This study revealed that exposure of HepG2 cells to concentrations of G3-Cellophil copolymer up to 100 μM had no effect on the tested CHPs, demonstrating the high biocompatibility of the copolymers of the present disclosure.

[0149] Example 24 Cellophil-(fluorescein) n -Cancer cell specificity of ADC The affinity of the HER2 antibody-functionalized G5-Cellophil-(fluorescein)8 copolymer of Example 22 to its target cells was examined in experiments using SKBR3 and MDA-MB-468 cancer cell lines. SKBR3 cells overexpress human epidermal growth factor receptor 2 (HER2+), while MDA-MB-468 cells do not express this receptor (HER2-). Binding was assessed by FACS (fluorescence-activated cell sorting) using the following brief protocol.

[0150] Cells are plated in 96-well plates at a density of 5,000–10,000 cells per well in 160 μL of medium [DMEM supplemented with 4.5 g / L glucose, 1.5 mM L-glutamine, and 10% fetal calf serum (MG-30, CLS)]. After 1 day of incubation at 37 °C in a humidified incubator with a 5% CO atmosphere, cells are harvested, washed, and the cell suspension is diluted to 1.25 × 10 in ice-cold PBS (pH 7.5) supplemented with 10% fetal calf serum (FCS), 1% sodium azide, and diluted to 1.25 × 10. 6 Adjust the cell suspension to a concentration of 12 x 75 mm cells / mL. 2 polystyrene round bottom plate, then 5 μg / mL Cellophil-(fluorescein) 16 -ADC for 45 minutes at 4° C. The cells are then centrifuged at 400×g for 5 minutes, washed three times by resuspending in 500 μL of ice-cold PBS (pH 7.5, supplemented with 10% FCS, 1% sodium azide), and then analyzed by flow cytometer.

[0151] Cellophil-(fluorescein) 16 Comparison of FACS staining of SKBR3 cells exposed to Cellophil-Fluorescein-ADC or to fluorescein-tagged trastuzumab demonstrates the preservation of antibody target affinity in the Cellophil-Fluorescein-ADC. MDA-MB-468 cells are used to analyze nonspecific binding of the Cellophil-ADC.

[0152] Example 25 Binding of G5-Cellophil-(fluorescein)8 to model proteins A model protein (red fluorescent mCherry) was genetically modified with a sortase recognition motif (LPETG) at the C-terminus and an additional cysteine ​​near the N-terminus. A DNA fragment containing the modified coding sequence of mCherry was synthesized in vitro. Coding sequence of Cys-mCherry-LPETG-His6 (SEQ ID NO: 1): 5’-ATGTGTGGTGGTAGCGGTGGTTCAGGTGGTTCTGGCGGTAGTGGTGGCAGCATGGTTAGCAAAGGTGAAGAGGATAATATGGCCATCATCAAAGAATTCATGCGCTTCAAAGTTCACATGGAAGGTAGCGTTAATGGCCACGAATTTGAAATTGAAGGTGAAGGCGAAGGTCGTCCGTATGAAGGCACCCAGACCGCAAAACTGAAAGTTACCAAAGGTGGTCCGCTGCCGTTTGCATGGGATATTCTGAGTCCGCAGTTTATGTATGGTAGCAAAGCCTATGTTAAACATCCGGCAGATATTCCGGATTACCTGAAACTGAGCTTTCCGGAAGGTTTTAAATGGGAACGTGTGATGAATTTTGAAGATGGTGGTGTTGTTACCGTTACACAGGATAGCAGCCTGCAGGATGGTGAATTTATCTATAAAGTTAAACTGCGTGGCACGAATTTTCCGAGTGATGGTCCGGTTATGCAGAAAAAAACCATGGGTTGGGAAGCAAGCAGCGAACGTATGTATCCGGAAGATGGCGCACTGAAAGGTGAAATTAAACAGCGTCTGAAGCTGAAAGATGGCGGTCATTATGATGCAGAAGTTAAAACCACCTACAAAGCCAAAAAACCGGTTCAGCTGCCTGGTGCATATAACGTTAACATCAAACTGGATATTACCAGCCACAACGAGGATTATACCATTGTGGAACAGTATGAACGTGCAGAAGGTCGCCATAGTACCGGTGGTATGGATGAACTGTATAAAGGTGGCAGTGGTGGATCTGGTGGCTCAGGCGGAAGCGGTGGTAGCCTGCCGGAAACCGGTGGTCTGAATGATATTTTTGAAGCCCAGAAAATCGAATGGCATGAACATCATCAC CATCACCACTAA-3’

[0153] This DNA fragment was subcloned into the cloning vector pMA-T (Invitrogen / Thermo Fisher Scientific, Germany). The latter construct was digested with Ndel and BamH1. The digestion product was electrophoresed on a 1.5% agarose gel, and the fragment containing the mCherry DNA was excised and DNA extracted using a Qiagen gel extraction kit (Qiagen, Hilden, Germany). The purified DNA fragment was then ligated into the expression vector pET28-c using T4 DNA ligase (New England Biolabs, UK). The accuracy of the inserted DNA sequence was subsequently verified by sequence analysis. For protein production, the resulting plasmid (pCIS-[C]-mcherry-[LPETG]) was transformed into competent Escherichia coli BL21DE3 cells. Cells were grown (LB medium + 100 μg / ml ampicillin, 37°C, 500 ml shake flasks) until an OD of 0.4 was reached. 600 After incubation at 4°C for 15 min, protein expression was induced with 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG). Cells were harvested after 4 h by centrifugation (6,000 × g, 15 min, 4°C), suspended in lysis buffer (50 mM NaH2PO4, 0.5 M NaCl, pH 8.0), and lysed by sonication. Cell debris was removed by centrifugation (30,000 × g, 30 min, 4°C). Purification of the Cys-mcherry-LPETG-His6 protein was performed by nickel-NTA affinity chromatography (nickel-NTA agarose, Thermo Fisher Scientific, Germany) according to the manufacturer's protocol. Protein yield was quantified by Bradford assay (Bio-Rad Laboratories GmbH, München, Germany), and the size and purity of the recombinant protein were verified by SDS-PAGE.

[0154] Purified LPETG-tagged mCherry (10 μM) was then incubated with different concentrations of H2N-G5-Cellophil-(fluorescein)8 (20-100 μM) from Example 16 in the presence of increasing concentrations of sortase A (0.062-0.62 μM) in 50 mM Hepes, 150 mM NaCl, 5 mM CaCl2, pH 7.5 for 3.5 h at 25°C. Control reactions lacking Cellophil copolymer or sortase A were performed in parallel. Reactions (20 μl) were stopped by adding 5 μl of 4× SDS-PAGE loading buffer + 10% w / v β-mercaptoethanol (Biorad, Germany) and heat treatment (5 min, 95°C, 600 rpm, constant shaking). The samples were then electrophoresed on a 4-20% SDS-PAGE gel (Mini-PROTEAN® TGX™ Precast Gels, Biorad, Germany) at 150 V for 30 min, followed by Coomassie Blue staining. Successful coupling was estimated based on the appearance of a product larger than mCherry.

[0155] Example 26 Functionalization of Cellophil-(fluorescein) 8 with the tumor cell-specific aptamer DML-7 Step 1: Synthesis of 1-((3-azidopropyl)amino)-2-methyl-1-oxopropan-2-ylethyl carbono-trithioate: To a solution of 2,5-dioxopyrrolidin-1-yl 2-(((ethylthio)carbonothioyl)thio)-2-methylpropanoate (2.4 g, 7.47 mmol, 1.0 equiv.) and EtN (1.249 mL, 8.96 mmol, 1.2 equiv.) in CHCl (44 mL) was added a solution of 3-azidopropan-1-amine (0.879 mL, 8.96 mmol, 1.2 equiv.) in CHCl (15 mL) dropwise over 60 min at room temperature under an inert atmosphere. The reaction mixture was stirred overnight at room temperature. Finally, the reaction mixture was washed successively with aqueous HCl (1 M, 3 × 20 mL), ddH0 (2 × 25 mL), and saturated aqueous NaHCO (20 mL). The organic phase was dried (NaSO), and the volatiles were removed under reduced pressure. The residual orange oil (2.25 g, 7.34 mmol, 98%) was used without further purification. The structure of the title compound was verified by NMR spectroscopy.

[0156] Step 2: Synthesis of RAFT-DMA-N3 prepolymer The synthesis of the title compound was achieved following the general protocol for prepolymer synthesis in Example 13, Step 5, using 1-((3-azidopropyl)amino)-2-methyl-1-oxopropan-2-ylethyl carbonotrithioate as the starting material. The structure of the title compound was verified by MS and NMR spectroscopy.

[0157] Step 3: Synthesis of Cellophil-N3 The synthesis of the title compound was accomplished using RAFT-DMA-N3 prepolymer as the starting material according to the general protocol of Example 13, Step 7. The structure of the title compound was verified by NMR spectroscopy.

[0158] Step 4: Synthesis of Cellophil-(fluorescein)8-N3 The synthesis of the title compound was accomplished using Cellophil-N3 and fluorescein-NHS as starting materials, following the general protocol for amine-reactive activators in Example 15. The structure of the title compound was verified by NMR spectroscopy.

[0159] Alternative synthesis: Synthesis of fluorescein-containing Cellophil copolymers can be achieved via the general procedure for copolymerization of co-leading monomers (Example 13, Step 7) using RAFT-DMA-N3 prepolymer as the RAFT reagent and AK-Fluorescein-V2 (8.0 equiv.) as the co-leading monomer.

[0160] Step 5: Synthesis of aptamer DML-7-[C6]-NH2 A modified form of the aptamer DML-7, known for its specificity to metastatic prostate cancer cells (Duan et al. (2016) Oncotarget 7(24): 36436), was synthesized on solid phase (Sigma Aldrich, Gillingham, UK). 5'-ACGCTCGGATGCCACTACAGGTTGGGG TCGGGCATGCGTCCGGAGAAGGGCAAAC GAGAGGTCACCAGCACGTCCATGAG-3' (SEQ ID NO: 2)-[C6]-NH2 A six-carbon atom spacer and a reactive amino group were added to facilitate functionalization. The lyophilized powder of the aptamer was then rehydrated with buffer at room temperature for 2 hours. The solution was then heated at 95°C for 10 minutes and then cooled to room temperature overnight to obtain the correct three-dimensional conformation.

[0161] Step 6: Coupling of DML-7-[C6]-NH2 aptamer to Cellophil-(fluorescein)8-N3 To a solution of DML-7-[C6]-NH2 (1.0 equivalent, prepared in step 5) in DNAase-free PBS buffer, dibenzocyclooctyne-N-hydroxysuccinimidyl ester (1.5 equivalents) is added. The reaction mixture is mixed at room temperature until complete conversion of the aptamer amine is observed (LC-MS). Cellophil-(fluorescein)8-N3 (2.0 equivalents) is then added and allowed to react until complete conversion of the alkyne-aptamer intermediate is observed. The mixture is then purified by semi-preparative GPC using water (+0.01% NaN3) as the eluent. The purified fractions containing the desired product are desalted on a desalting column (PD10, Thermo Fisher Scientific, Germany). The desired product is then lyophilized to obtain a white powder.

[0162] The resulting aptamer-containing Cellophil-(fluorescein)8 was analyzed by electromobility shift assay (EMSA). For this analysis, 18 μL of a stock solution of the latter copolymer (0.3 mg / mL in EMSA buffer (10 mM Tris-HCl, 75 mM KCl, 0.25 mM EDTA, 0.1% Triton X100, 5% glycerol (v / v), 0.2 mM DTT, pH 8.0)) was added to 2 μL of 5× nucleic acid sample buffer (Biorad, Germany). Subsequently, the sample was electrophoresed on a 1.5% agarose gel (supplemented with 0.25 μg / mL ethidium bromide and 1× TAE buffer for UV staining, 135 V, 35 min). The DML-7 aptamer and Cellophil-(fluorescein)8-N3 served as controls. The shift in band migration clearly confirms the increase in molecular weight of the aptamer due to covalent attachment to the Cellophil-(fluorescein) 8 moiety.

[0163] Example 27 Synthesis of oxime-functionalized polymer supports Step 1: Synthesis of tert-butyl (6,6-dimethyl-7,12-dioxo-4-thioxo-3,5-dithia-8,11-diazatridecan-13-yl)oxycarbamate (RAFT-EDA-oxime-BOC) To a solution of 2-(((tert-butoxycarbonyl)amino)oxy)acetic acid (486 mg, 2.54 mmol, 1.0 equiv) in CHCl (40 mL) was added HOBt hydrate (467 mg, 3.05 mmol) and N-((ethylimino)methylene)-N,N-dimethylpropane-1,3-diamine hydrochloride (511 mg, 2.67 mmol, 1.05 equiv) under N at 0° C. The resulting solution was stirred at 0° C. for 30 min. Finally, 2-(2-(((ethylthio)carbonothioyl)thio)-2-methylpropanamido)ethanaminium 2,2,2-trifluoroacetate (966 mg, 2.54 mmol, 1.0 equiv.) and N-ethyl-N-isopropylpropan-2-amine (2.24 mL, 13.2 mmol, 5.2 equiv.) were added successively, and the reaction mixture was stirred at 0 °C for 1 h and then at room temperature overnight. All volatiles were removed under reduced pressure, and the residue was taken up in EtOAc (100 mL). The organic mixture was washed successively with a saturated aqueous solution of NH Cl (3 × 40 mL), a saturated aqueous solution of NaHCO (3 × 40 mL), ddH O (3 × 40 mL), and brine (40 mL). The organic phase was dried (Na SO ), and all volatiles were removed under reduced pressure. The resulting yellow solid residue was suspended in Et O (40 mL). The suspension was filtered, and the filter cake was washed with EtO (2 × 20 mL), ddH2O (3 × 20 mL), and Et2O (3 × 20 mL) and dried under vacuum. The product was isolated as a yellow powder (900 mg, 2.00 mmol, 79% yield). The structure of the title compound was verified by NMR spectroscopy.

[0164] Step 2: Synthesis of RAFT-DMA-oxime-BOC prepolymer The synthesis of the title compound was achieved using RAFT-EDA-oxime-BOC as the starting material following the general protocol for prepolymer synthesis in Example 13, Step 5. The structure of the desired product was verified by MS and NMR spectroscopy.

[0165] Step 3: Synthesis of Cellophil-oxime-BOC The synthesis of the title compound was accomplished using RAFT-DMA-oxime-BOC prepolymer as the starting material according to the general protocol in Example 13, Step 7. The structure of the title compound was verified by GPC and NMR spectroscopy.

[0166] Step 4: Synthesis of Cellophil-(fluorescein) 8-oxime-BOC Synthesis of the title compound can be achieved using Cellophil-oxime-BOC and FITC as starting materials following the general protocol for amine-reactive activators in Example 15. The structure of the title compound can be verified by NMR spectroscopy.

[0167] Step 5: Synthesis of Cellophil-(fluorescein) 8-oxime Cellophil-(fluorescein) 8-oxime-BOC is deprotected according to the general procedure for BOC deprotection (Example 16).

[0168] Step 6: Coupling of Cellophil-(fluorescein) 8-oxime to aldehyde-IgG Cellophil-(fluorescein) 8-oxime can be covalently coupled to oxidized (NaIO4) polyclonal antibody IgG (aldehyde IgG) as described in the literature (Dong et al. (2017) Angew Chem Int Ed 56: 1273). The structure of the desired product can be verified by MS.

[0169] Example 28 Binding of Cellophil-(fluorescein)8-N3 to model proteins Step 1: Alkyne functionalization of mCherry model protein: To a solution of the cysteine-bearing mCherry model protein from Example 25 (1.0 equivalent) in degassed PBS buffer, pH 7.5, an excess of tris(2-carboxyethyl)phosphine (TCEP) (100 equivalents) is added under an inert atmosphere. The resulting solution is mixed thoroughly and allowed to stand for 20 minutes before adding a degassed solution of dibenzocyclooctyne-maleimide (DBCO-maleimide) in DMSO under an inert atmosphere. The resulting reaction mixture is stirred overnight at room temperature. The mixture is then purified by semi-preparative GPC using water (+0.01% NaN3) as the eluent. The purified fractions containing the desired product are desalted using a desalting column to obtain mCherry-DBCO.

[0170] Step 2: Cellophil functionalization of mCherry model protein via click chemistry: A solution of mCherry-DBCO (1.0 equivalent) and Cellophil-(fluorescein)-N (2.0 equivalents, obtained in Example 26, Step 4) in PBS buffer, pH 7.5, is stirred at room temperature for 16 hours. The mixture is then transferred to Ni according to the manufacturer's protocol. 2+ Purification is performed by NTA affinity chromatography (nickel-NTA agarose, Thermo Fisher Scientific, Germany). (mCherry contains a hexa-histidine tag.) The purified fractions containing the desired product are desalted using a desalting column to obtain mCherry-Cellophil (fluorescein). The resulting protein-polymer conjugate can be analyzed by SDS-PAGE using the protocol presented in Example 25 and Cys-mcherry-LPETG-His as a control (see Example 25). The increase in size of the product compared to the control observed in the Coomassie-stained gel indicates successful coupling of the polymer to the protein.

[0171] Example 29 Amine-modified NH2-G using the aza-Michael ligation strategy nFunctionalization of native lysine residues in Her2+ antibody (trastuzumab) with -Cellophil-(DOX)8 Trastuzumab-Cellophil-(DOX) 16 The synthesis of NH2-G is performed using NH2-G as the amine nucleophile coupled to the light chain of an antibody. n This was achieved using -Cellophil-(DOX)8 according to the protocol developed by Bernades, GJL (J Am Chem Soc (2018) 140: 4004-). This resulted in an ADC conjugate containing an average of 16 doxorubicin molecules per antibody molecule. Trastuzumab (20 mg / ml in PBS) was obtained from Carbosynth, UK.

[0172] Example 30 Trastuzumab-Cellophil-(DOX) 16 Anti-cancer efficacy of Trastuzumab-Cellophil-(DOX) 16 The anti-cancer efficacy of (see Example 29) can be verified as follows.

[0173] Experiments were performed in 96-well plates using the SKBR3 and MDA-MB-468 cancer cell lines. SKBR3 cells overexpress human epidermal growth factor receptor 2 (HER2+), whereas MDA-MB-468 cells do not express this receptor (HER2-). 5,000–10,000 cells were seeded into wells in 75 μL of Dulbecco's modified Eagle's medium (DMEM) supplemented with 4.5 g / L glucose, 1.5 mM L-glutamine, and 10% fetal bovine serum (MG-30, CLS). After 1 day of incubation at 37°C and 5% CO2 in a humidified incubator, the ADC trastuzumab-Cellophil-(DOX) in 25 μL of growth medium was added. 16Serial dilutions of Trastuzumab (prepared in Example 29) are added to the wells. The final ADC concentration in the wells ranges from 0.02 ng / mL to 20 μg / mL (ADC-naive cells serve as a negative control). Each dilution is tested in triplicate. For comparison purposes, parallel cultures receive serial dilutions of Trastuzumab in growth medium. After 72 hours of incubation, the plates are removed from the incubator and allowed to equilibrate to room temperature. After approximately 20 minutes, cell viability is assayed using the aWST-1 cell proliferation assay (Sigma-Aldrich, Germany) performed according to the manufacturer's instructions. The assay readout is the absorbance at 420-480 nm. Trastuzumab-Cellophil-(DOX) 16 The anticancer efficacy of the ADC is estimated by comparing the absorbance values ​​measured in ADC-treated, untreated, and trastuzumab-treated cultures. Comparison of the results from SKBR3 and MDA-MB-468 provides information about the target specificity of the ADC.

[0174] Example 31 Synthesis of click-reactive azido Cellophil(fluorescein) 8 using fluorescein-modified co-primary monomers AK-Fluorescein (Example 10) was copolymerized in a RAFT polymerization with an azide-modified RAFT agent (1-((3-azidopropyl)amino)-2-methyl-1-oxopropan-2-ylethyl carbonotrithioate) using the following protocol.

[0175] DMA (0.97 mmol, 80 equiv.) and AK-fluorescein (0.097 mmol, 8 equiv.) were dissolved in 2 ml of dry dioxane, and N3-RAFT [(1-((3-azidopropyl)amino)-2-methyl-1-oxopropan-2-ylethyl carbonotrithioate] (0.012 mmol, 1 equiv.) and AIBN (4.85 μmol, 0.4 equiv.) were added. After complete dissolution, polymerization was induced by heating to 65°C. Polymerization was complete after 6 hours of incubation at 65°C. Subsequently, the reaction mixture was cooled to room temperature, and the RAFT groups of the copolymer were removed using the protocol presented in Example 13. The resulting mixture was then dialyzed against ddHO (MWCO The concentrate was lyophilized to give N3-Cellophil-(fluorescein)8 as an orange powder (85%). The structure of this compound was verified by NMR spectroscopy and GPC analysis (MW approximately 13 kDa, PDI 1.08).

[0176] N3-Cellophil-(fluorescein)8 can be used in copper-free click reactions with alkyne (e.g., DBCO)-modified cancer cell-specific targeting moieties.

[0177] Example 32 Synthesis of iodine-loaded Cellophil antibody conjugates targeting oncogenic proteins To generate model antibody-polymer conjugates for a wide range of cancer genes, we selected a commercially available antibody targeting the protein BMI-1. BMI-1 (polycomb ring finger oncogene) is required for efficient self-renewal differentiation of adult hematopoietic stem cells and adult peripheral and central nervous system neural stem cells. BMI-1 has been reported to be an oncogene that regulates the cell cycle inhibitor genes p16 and p19. Overexpression of BMI-1 appears to play an important role in several types of cancer, including bladder, skin, prostate, breast, ovarian, and colorectal cancers, as well as hematological malignancies (Lessard J et al. (2003). Nature 423 (6937): 255-60. doi:10.1038; Molofsky AV et al. (2005). Genes Dev. 19 (12): 1432-7. doi:10.1101 / gad.1299505).

[0178] NH2-GGG-Cellophil [DMA] that can be loaded with radioactive iodine 41 The synthesis of [AK-phenol 3] was carried out using the same protocol as presented in Example 20, but with the molar ratio of AK-phenol (3 equivalents) to the main monomer DMA (41 equivalents). The average molecular weight (5.6 kDa) and molecular weight distribution (PDI 1.18) of the resulting copolymer were recorded by LC-MS and gel permeation chromatography. After purification by dialysis and freeze-drying, the Cellophil copolymer was coupled to AbFlex™ BMI-1 (monoclonal) antibody against the full-length human polycomb ring finger oncogene containing the sortase recognition motif (LPETG) using the following protocol.

[0179] BMI-1 antibody [6 μM] was incubated with NH2-GGG-Cellophil [DMA 41The reaction mixture was incubated with [120 μM] AK-phenol 3 in the presence of [2 μM] sortase A (sortase A5 protein [S. aureus, Uniprot A0A077UNB8-1], Active Motif Inc., USA, containing amino acid substitutions P94R, D160N, D165A, K190E, and K196T and containing a C-terminal 6xHis tag) in a HEPES-based reaction buffer (Active Motif Inc., USA) for 1 h at 30°C. U.S. Patent No. 9,267,127. Control reactions lacking Cellophil copolymer or sortase A were performed in parallel. The calcium-dependent coupling reaction was stopped by the addition of EDTA disodium salt (250 mM) to a final concentration of 5 mM, and samples were stored at 4°C until final characterization.

[0180] For analysis, the antibody-polymer conjugates were digested with Fabricator® (Genovis Inc., USA). [FabRICATOR (IdeS) is a cysteine ​​protease that digests antibodies at specific sites below the hinge, generating homogenous pools of F(ab')2 and Fc / 2 fragments.] Digestion was performed according to the manufacturer's protocol. The cleavage products were then analyzed by SDS-PAGE using the protocol in Example 25. A shift in the antibody Fc / 2 band to a higher molecular weight indicated successful coupling of the Cellophil copolymer to the antibody. The efficiency of the coupling reaction was analyzed semiquantitatively by comparison with the remaining (unmodified) Fc / 2 band of a negative control. The coupling efficiency was found to be approximately 50%. For detailed characterization of the coupling products, LC-MS analysis of IdeS digested antibody-Cellophil conjugates was performed using the following protocol.

[0181] The reaction mixture of the IdeS-digested antibody-Cellophil conjugate was diluted 10-fold with ddH2O. 5 μL of the resulting solution was injected into an LCMS system (G6230 LC-MS TOF System, Agilent, Santa Clara, CA) and separated using a C8-HPLC column with an eluent consisting of water, isopropanol, ACN, and 0.1% FA. The chromatograms and spectra were then analyzed using Agilent's Masshunter software solution. Analysis of the chromatograms and spectra indicated that the copolymer was coupled only to the heavy chain of the mAB.

[0182] Cellophil anti-BMI-1 conjugates can be loaded with iodine radioisotopes to generate antibody polymer conjugates for targeted cancer therapy using the protocol provided in Example 21. In some embodiments, for example, in the case of iodine isotopes with long half-lives, loading of the AK-phenol-containing copolymer may be performed prior to coupling to the targeting antibody.

[0183] Example 33 mTG tag (=NH2-PEG n )-RAFT-BOC with Cellophil (DMA n / AK m ) Copolymer Synthesis The following procedure describes the synthesis of a Cellophil copolymer that can be functionalized with a covalent chelator to bind a radioisotope. The copolymer (mTG tag)-DMA presented here 30 / AK8 serves to illustrate the general synthetic procedure. The size of the copolymer and the number of functionalization sites contained in the copolymer can be varied by changing the molar ratio of the monomers used.

[0184] To a solution of DMA (116 μL, 1120 μmol, 30 equiv.) and AK (60 mg, 300 μmol, 8 equiv.) in ddHO, tert-butyl (6,6-dimethyl-7-oxo-4-thioxo-11,14,17,20,23-pentaoxa-3,5-dithia-8-azapentacosan-25-yl)carbamate (22 mg, 32.2 μmol, 1.0 equiv.) and VA044 (3.6 mg, 11.2 μmol, 0.3 equiv.) were added sequentially. The reaction mixture was stirred at 60 °C for 4 h. The reaction mixture was then diluted with ddHO and dioxane. To this solution, phosphinic acid (50 wt%, 27 μL, 158 μmol, 5 equiv.), TEA (22 μL, 158 μmol, 5 equiv.), and AIBN (1.6 mg, 9.5 μmol, 0.3 equiv.) were added sequentially. The reaction mixture was stirred at 75 °C for 8 h. The resulting mixture was then dialyzed (MWCO 3.5 kDa) against ddHO, and the concentrate was freeze-dried to obtain Cellophil BOC-NH-PEG-(DMAC). 30 The copolymer (Ak8) was obtained as a white powder (140 mg, 120 μmol, 78% over two steps). The structure of the resulting compound was verified by NMR spectroscopy and GPC using the following protocol. A 3.33 mg / mL stock solution of the copolymer was prepared in elution buffer (deionized water containing 0.05% (w / v) NaN3) and filtered through a 0.45 μm syringe filter. 0.4 mL of the stock solution was then injected into the port of a GPC instrument (1260 Infinity LC-System, Agilent, Santa Clara, CA). Chromatography was performed with the elution buffer at a constant flow rate of 0.5 mL / min. The copolymer sample was separated on a Supurema 3 column system (precolumn, 1000 Å, 30 Å; particle size 5 μm; PSS, Mainz, Germany) installed in an external column oven at 55 °C. The copolymer was analyzed by RI (refractive index) and UV detection. A calibration curve (10 points) was established using pullulan standards, and the molecular weights of the characterized copolymers were estimated by reference to this standard.

[0185] Example 34 Anhydrous DOTA / NHS-DOTA Cellophil [BOC-NH-PEG-(DMAC)] 30 Functionalization of [ / AK8] copolymers Cellophil BOC-NH-PEG-(DMAC) in ddHO 30 To a solution of NH-PEG-(AK8) (20 mg, 3.45 μmol), a solution of anhydrous DOTA (25 mg, 36 μmol) or NHS-DOTA (27 mg, 36 μmol) in DMSO was added and stirred at 35 °C for 24 h. 3 M HCl was then added to the solution and heated to 0 °C for 1 h. The resulting mixture was then dialyzed (MWCO 3.5 kDa) against ddHO, and the concentrate was freeze-dried to give NH-PEG-(DMAC). 30 The structure of the compound was verified by NMR spectroscopy.

[0186] Example 35 Cellophil [DBCO-NH-PEG-(DMAC)] 30 Synthesis of AK-DOTA8). Cellophil NH2-PEG5-(DMAC) in dry DMSO (1.5 mL) 30 A solution of DBCO-NHS (3.6 μmol), DBCO-NHS (18 μmol), and triethylamine (7.2 μmol) was stirred at 25° C. for 24 hours. The resulting mixture was then dialyzed against 0.1 M ammonium carbonate (MWCO 3.5 kDa), and the concentrate was freeze-dried to give Cellophil DBCO-NH-PEG-(DMAC). 30 The reaction was monitored by GPC, and the structure of the resulting compound was verified by NMR spectroscopy.

[0187] Example 36 Synthesis of radiolabeled trastuzumab-[Cellophil-(DOTA4]2 conjugates for diagnostic and therapeutic targeting of Her2 receptor-overexpressing cancer cells In tumor diagnosis, the detection limit of the primary tumor or its metastases is crucial for patient survival, since late-stage tumors are often associated with a poor prognosis. The use of radiolabeled tumor tissue-specific antibodies for the detection of cancer cells as well as for subsequent treatment is a potentially promising method for radiomedicine. However, this type of approach is hindered by a low signal-to-noise ratio, which is due to the fact that only a few radioisotopes can be conjugated to the targeting moiety / antibody and that the radioisotopes of interest have short half-lives (usually shorter than the half-life of the antibody). Therefore, increasing the radioisotope cargo is highly desirable. This example describes a radiolabeled antibody-Cellophil conjugate for improved tumor cell detection and treatment.

[0188] The DBCO-functionalized Cellophil polymers synthesized by the procedures presented in Examples 33-35 are conjugated to an IgG-type cancer cell-specific antibody (e.g., trastuzumab, which targets Her2+ cancer cells) in which glutamine at position 295 (Q295) has been functionalized with an azide group by the procedure described by Dennler et al. (Bioconjugate Chem. (2014) 25: 569-578).

[0189] Briefly, the antibody is deglycosylated with PNGase F (Merck KGaA, Darmstadt, Germany). A reaction mixture containing 1 unit of enzyme per 10 μg of trastuzumab (Carbosynth Ltd, Berkshire, UK) in PBS (pH 7.4) is incubated overnight at 37°C to activate Q295. Subsequently, deglycosylated trastuzumab (6.6 μM) in PBS (pH 8) is incubated with NH2-PEG5-azide (80 molar equivalents) and microbial transglutaminase (MTGase) (6 U / mL, Zedira, Darmstadt, Germany) for 16 hours at 37°C. After incubation, MTGase activity is blocked by the addition of MTGase reaction stopper (Zedira, Darmstadt, Germany). To remove excess NH2-PEG4-azide, MTGase and residual PNGase F, the reaction mixture was buffer exchanged (three times) into NHOAc (0.5 m, pH 5.5) using an Amicon® Ultra 4 mL column (100 kDa MWCO, Merck KGaA, Darmstadt, Germany).

[0190] The actual click reaction is then carried out by incubating trastuzumab-(NH-PEG-azide)2 with a three-fold molar excess of DBCO-functionalized Cellophil polymer for 3 hours at 37°C to yield trastuzumab-(Cellophil-DOTA4)2. Excess polymer and non-functionalized trastuzumab can be removed by size exclusion chromatography (SEC), and fractions containing fully functionalized antibody can be pooled.

[0191] Radiolabeling of the antibody-Cellophil conjugate with 111-InCl3 (4 MBq per μg of trastuzumab-(Cellophil-DOTA4)2) was carried out at 37°C for 1 hour, after which the indium-111-labeled antibody-polymer conjugate was purified by SEC on a Superdex75 10 / 300GL column (GE Healthcare, Chicago, USA) running at a flow rate of 0.5 mL / min. The large peak fractions were pooled. The resulting trastuzumab-[Cellophil-(DOTA-In-111)4]2 can be used to detect Her2+ cancer cells by positron emission tomography (PET) with higher sensitivity than that obtainable with conventional antibody-radioisotope conjugates, for example, in patients with breast, colon, or lung cancer. The increased sensitivity is due to the increased In-111 cargo compared to conventional radiolabeled antibodies.

[0192] The same procedure can be used to prepare therapeutic antibody-Cellophil conjugates loaded with a suitable therapeutic radioisotope, such as lutetium-177 [substituting 177-LuCl3 for 111-InCl3 used in the procedure described above].

[0193] Example 37 Cycloalkyne Cellophil (DOTA n Synthesis of )-COH To functionalize the copolymers of the present disclosure with a Click-reactive cycloalkyne group, such as DBCO, a Click-reactive moiety can be incorporated upon removal of the RAFT group. Step 1 - Synthesis of cycloalkyne initiator The DBCO-modified initiator is synthesized according to the protocol of Ulbrich and coworkers (Polym. Chem., 2014 5, 1340). Step 2—Synthesis of RAFT-Cellophil-CO2H copolymer: Synthesis of RAFT-Cellophil-CO2H copolymer is achieved following the general protocol described in Example 13 (starting with the ethyl RAFT reagent in steps 6-7). Step 3 - Cycloalkyne Cellophil (DOTA n Synthesis of )-CO2H copolymer: To a solution of RAFT-Cellophil-COH in DMSO / ddH2O (1 / 1), a cycloalkyne-containing initiator (20 equivalents) is added in one portion. The reaction mixture is sealed and heated at 70 °C until the yellow color disappears (4 h). The progress of the reaction is then monitored by HPLC. The resulting solution is cooled to room temperature, and the pH is adjusted to 8 before adding p-NCS-Bz-DOTA-GA (Chematech) or DOTA-NHS (2 equivalents per reactive amino group in the copolymer). The mixture is dialyzed against ddH2O (MWCO: 5000 Da), and the concentrate is lyophilized and characterized by NMR spectroscopy and SEC.

[0194] Example 38 Synthesis of radiolabeled trastuzumab-[Cellophil-(DOTA4]4 conjugates for therapeutic targeting of Her2 receptor-overexpressing cancer cells The DBCO-functionalized Cellophil polymer, synthesized by the procedures presented in Examples 33 and 35, was conjugated to an IgG-type cancer cell-specific antibody (Trastuzumab®, which targets Her2+ cancer cells) functionalized with two azide groups per heavy chain (leading to the addition of up to four azide groups per antibody) using a commercially available enzyme-based modification kit (SiteClick™ Antibody Labeling System, Thermo-Fisher-Scientific, Waltham, USA) used according to the manufacturer's protocol.

[0195] Coupling to the azide groups in trastuzumab-azide 4 was achieved using a 1.5-fold molar excess of DBCO-Cellophil copolymer over the azide groups of the antibody according to the protocol presented in Example 36. Successful coupling was verified by SDS-PAGE.

[0196] Radiolabeling with 177-LuCl3 [8 MBq per μg of trastuzumab-(Cellophil-DOTA4)4] was performed by incubation at 37°C for 1 hour, and the lutetium-177-labeled antibody-polymer conjugate was then purified by SEC on a Superdex75 10 / 300GL column (GE Healthcare, Chicago, USA). The resulting trastuzumab-[Cellophil-(DOTA-Lu-177)4]4 can be used to target and destroy Her2-overexpressing cancer cells.

[0197] The same procedure can be used to prepare diagnostic antibody-Cellophil conjugates, substituting the radioisotope Lu-177 for a suitable diagnostic radioisotope, such as gallium-68 [by substituting 68-GaCl for 177-LuCl in the procedure presented above].

[0198] Example 39 Synthesis of radiolabeled trastuzumab-[Cellophil-(DOTA8]2 conjugates from mTg-tagged Cellophil for diagnostic and therapeutic targeting of Her2 receptor-overexpressing cancer cells The Cellophil copolymer of Example 34 can be coupled directly to a monoclonal antibody such as trastuzumab via a transglutaminase-mediated reaction using the NH-PEG group of the copolymer as the substrate. To this end, the protocol of Example 36 is used, but NH-PEG-azide is replaced with NH-PEG-DMA. 30 The exception is when trastuzumab-[Cellophil-(DOTA8)] was substituted with / AK-DOTA8, which was used in a 40-fold molar excess over the antibody to generate an antibody with 16 chelators, i.e., trastuzumab-[Cellophil-(DOTA8)]2.

[0199] Example 40 Synthesis of tetrazine-functionalized Cellophil copolymers for coupling to targeting moieties via TCO-Tz click chemistry Step 1: Synthesis of tetrazine-Cellophil copolymer: A solution of Cellophil copolymer from Example 34 (3.6 μmol), 2,5-dioxopyrrolidin-1-yl 2-(4-(6-methyl-1,2,4,5-tetrazin-3-yl)phenyl)acetate (18 μmol) and triethylamine (7.2 μmol) in dry DMSO (1.5 mL) was stirred for 24 hours at 25° C. The resulting mixture was then dialyzed against 0.1 M ammonium carbonate (MWCO 3.5 kDa) and the concentrate was freeze-dried to obtain tetrazine-Cellophil [DMAC]. 30 The reaction was monitored by SEC, and the structure of the compound was verified by NMR spectroscopy.

[0200] Example 41 Fluorophore-modified Cellophil-[DMA] using tetrazine-strained alkyne [4+2] cycloaddition 30 Synthesis of / AK-DOTA8) A solution of the tetrazine-modified Cellophil copolymer of Example 40 (1.3 μmol) and (E)-6-amino-9-(2-carboxy-5-((5-(((cyclooct-4-en-1-yloxy)carbonyl)amino)pentyl)carbamoyl)phenyl)-4,5-disulfo-3H-xanthen-3-iminium (1.3 μmol) in dry DMSO (0.5 mL) was stirred at 25° C. for 24 hours. The resulting mixture was then dialyzed against 0.1 M ammonium carbonate (MWCO 3.5 kDa), and the concentrate was freeze-dried to yield AF dye 488 click Cellophil. The reaction was followed by GPC, and the structure of the resulting compound was verified by NMR spectroscopy. Pharmacodynamic studies can be performed using fluorophore-labeled Cellophil derivatives, for example, to determine the half-life or renal excretion of the copolymer in the bloodstream, where a strong readout signal would be beneficial.

[0201] Example 42 Cellophil tetrazine-[DMA]-mediated modification of TCO-modified proteins 30 / AK-DOTA8) coupling A solution of the tetrazine-functionalized Cellophil copolymer from Example 40 (3 equivalents) is dissolved in PBS (pH 7.4), and a transcyclooctene (TCO)-modified protein (1 equivalent containing two TCO groups) dissolved in PBS (pH 7.4) [prepared by a method similar to that presented in Example 36, substituting NH-PEG-TCO with NH-PEG-azide] is added dropwise under stirring at room temperature over 3 hours. The unreacted polymer is then removed by dialysis using a membrane with a 100 kDa MWCO. The success of the reaction is monitored by SDS-PAGE and HPLC.

[0202] Example 43 Synthesis of AK-DOTA To a solution of AK (50 mg, 250 μmol) and EtN (104 μL, 749 μmol) in anhydrous DMF (1 mL) was added DOTA-NHS (HPF6 / TFA salt) (200 mg, 262 μmol). The reaction mixture was stirred overnight at room temperature and filtered through a cotton pad. The filtrate was precipitated in MeCN and then filtered. The cake was washed with MeCN and dried under reduced pressure to give a white powder (95 mg, 65%). This compound can be used for the directed incorporation of chelating agents into copolymers during polymerization.

Claims

1. (a) (1) Dimethyl-acrylamide, N-isobutyl-acrylamide, N-tert.acrylamide, characterized in that the monomer has at least one vinyl group and does not contain an amino acid residue. one or more polymerizable primary monomers selected from butyl-acrylamide, N-hydroxyethyl-acrylamide, N-(2-hydroxypropyl)-acrylamide, N-(3-hydroxypropyl)-acrylamide, N-(3-hydroxypropyl)-methacrylamide, N-(2-hydroxypropyl)-methacrylamide, N-(3-aminopropyl)-acrylamide hydrochloride, N-(3-aminopropyl)-methacrylamide hydrochloride, 2-hydroxyethyl-methacrylate, 2-hydroxypropyl-acrylate, 3-hydroxypropyl-acrylate, 2-hydroxy-1-methylethyl-acrylate, 2-aminoethyl acrylate hydrochloride, 3-hydroxypropyl-methacrylate, 2-hydroxy-1-methylethyl-methacrylate, 2-hydroxyethyl-methacrylate, 2-hydroxypropyl-methacrylate and 2-aminoethyl methacrylate hydrochloride, wherein the primary monomer is an amino acid-free monomer; (2) Formula I, wherein at least one of Y and Z is H: 【Chemistry 11】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 - and Y is H or -CO-C n H 2n+1 (wherein n=1 to 8), and Z is H (when A is —O—) or —C n H 2n+1 (wherein n=1 to 8) and A is —O— or —NH—. or Formula II: 【Chemistry 12】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and Z is H (when A is O) or -C n H 2n+1 (wherein n=1 to 8) and A is —O— or —NH—. wherein said co-principal monomer is a monomer comprising an amino acid; (4) an agent for controlling radical polymerization; (5) an initiator system that generates free radical species; polymerizing a reaction mixture comprising: (c) after step (a), coupling an active agent to said copolymer. a copolymer comprising a plurality of active agent molecules made by wherein the active agent is a cytotoxic molecule, a tracer molecule, or a substance capable of overcoming tumor resistance; wherein the copolymer is characterized by a Mw / Mn in the range of 1.05 to 1.4, and wherein the mole percent of monomers of Formula I or Formula II is between 1% (mol) and 49.9% (mol) of all monomers present in the polymerization mixture. Copolymer.

2. 10. The copolymer comprising a plurality of activator molecules of claim 1, wherein the polymerization mixture of (a) further comprises: (3) One or more co-principal monomers of any of Formulas III-X: 【Chemistry 13】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 - and Z is H (when A is -O-) or -C n H 2n+1 (where n=1-8), payload refers to an active agent, L is a linker, and A is -O- or -NH-; 【Chemistry 14】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 - and Y is H or -CO-C n H 2n+1 (where n=1-8), payload refers to the active agent, and L is a linker); 【Chemistry 15】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 -, where payload refers to the active agent and L is a linker, where the linkers used to functionalize the alpha-amino and carboxy groups do not have to be the same; 【Chemistry 16】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 - and Z is H (when A is -O-) or -C n H 2n+1 (where n=1-8), payload refers to an active agent, L is a linker, and A is -O- or -NH-): 【Chemistry 17】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 -wherein payload refers to an active agent and L is a linker; [Chemistry 18] (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 -, where payload refers to the active agent and L is a linker, where the linkers used to functionalize the alpha-amino and carboxy groups do not have to be the same; 【Chemistry 19】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 - and Z is H (when A is -O-) or -C n H 2n+1 (wherein n=1 to 8), L is a linker, J is H or a radioactive iodine nucleus, and A is —O— or —NH—; 【Chemistry 20】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 -, J is H or a radioactive iodine nucleus, payload refers to an active agent, and L is a linker, where the linkers used to functionalize the alpha-amino and carboxy groups do not have to be identical. Including, the co-primary monomer is a monomer comprising an amino acid; Copolymer.

3. 2. The copolymer comprising multiple active agent molecules of claim 1, wherein the process further comprises step (b) functionalizing the copolymer with a cell-type-specific or tissue-type-specific targeting moiety, and step (c) is performed after step (b).

4. 10. The copolymer comprising a plurality of active agent molecules of claim 1, wherein the copolymer has a weight average molecular weight of 5,000 to 100,000 daltons as estimated by chromatography with reference to a pullulan standard.

5. 10. The copolymer comprising a plurality of active agent molecules of claim 1, wherein at least 80% (w) of the copolymer molecules have a weight average molecular weight of 5,000 to 100,000 daltons as estimated by chromatography with reference to a pullulan standard.

6. 6. The copolymer comprising a plurality of activator molecules according to claim 1, wherein the agent controlling the radical polymerization is a RAFT agent.

7. the copolymer is made by two sequential polymerization reactions; The first polymerization reaction is carried out with dimethyl-acrylamide, N-isobutyl-acrylamide, N-tert.butyl-acrylamide, N-hydroxyethyl-acrylamide, N-(2-hydroxypropyl)-acrylamide, N-(3-hydroxypropyl)-acrylamide, N-(3-hydroxypropyl)-methacrylamide, N-(2-hydroxypropyl)-methacrylamide, N-(3-aminopropyl)-acrylamide hydrochloride, N-(3-aminopropyl)-methacrylamide hydrochloride, methacrylic acid 2-hydroxyethyl-acrylate, 2-hydroxypropyl-acrylate, 3-hydroxypropyl-acrylate, 2-hydroxy-1-methylethyl-acrylate. the polymerization is carried out in a first reaction mixture comprising one or more principal polymerizable monomers free of amino acid groups selected from the group consisting of 2-hydroxypropyl-methacrylate, 2-aminoethyl acrylate hydrochloride, 3-hydroxypropyl-methacrylate, 2-hydroxy-1-methylethyl-methacrylate, 2-hydroxyethyl-methacrylate, 2-hydroxypropyl-methacrylate and 2-aminoethyl methacrylate hydrochloride, a RAFT agent to control copolymerization, and an initiator system that generates free radical species, wherein the polymerization results in a RAFT prepolymer, wherein the principal monomer is a monomer free of amino acids; A second polymerization reaction is carried out to obtain the RAFT prepolymer of the first polymerization reaction, Formula I: 【Chemistry 21】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 - and Y is H or -CO-C n H 2n+1 (wherein n=1 to 8), and Z is H (when A is —O—) or —C n H 2n+1 (wherein n=1 to 8) and A is —O— or —NH—. and / or II: 【Chemistry 22】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and Z is H (when A is O) or -C n H 2n+1 (wherein n=1 to 8) and A is —O— or —NH—. and an initiator system that generates free radical species, wherein the co-major monomer is a monomer comprising an amino acid; A copolymer comprising a plurality of active agent molecules according to claim 6.

8. 8. The copolymer comprising a plurality of activator molecules of claim 7, wherein the second reaction mixture further comprises: One or more co-principal monomers of Formulae III-X: 【Chemistry 23】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 - and Z is H (when A is -O-) or -C n H 2n+1 (where n=1-8), payload refers to an active agent, L is a linker, and A is -O- or -NH-; 【Chemistry 24】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 - and Y is H or -CO-C n H 2n+1 (where n=1-8), payload refers to the active agent, and L is a linker); 【Chemistry 25】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 -, where payload refers to the active agent and L is a linker, where the linkers used to functionalize the alpha-amino and carboxy groups do not have to be the same; 【Chemistry 26】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 - and Z is H (when A is -O-) or -C n H 2n+1 (where n=1-8), payload refers to an active agent, L is a linker, and A is -O- or -NH-): 【Chemistry 27】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 -wherein payload refers to an active agent and L is a linker; 【Chemistry 28】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 -, where payload refers to the active agent and L is a linker, where the linkers used to functionalize the alpha-amino and carboxy groups do not have to be the same; 【Chemistry 29】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 - and Z is H (when A is -O-) or -C n H 2n+1 (wherein n=1 to 8), L is a linker, J is H or a radioactive iodine nucleus, and A is —O— or —NH—; 【Transformation 30】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 -, J is H or a radioactive iodine nucleus, payload refers to an active agent, and L is a linker, where the linkers used to functionalize the alpha-amino and carboxy groups need not be identical, where said co-primary monomer is a monomer comprising an amino acid; and / or Dimethyl-acrylamide, N-isobutyl-acrylamide, N-tert. one or more polymerizable principal monomers free from an amino acid group selected from butyl-acrylamide, N-hydroxyethyl-acrylamide, N-(2-hydroxypropyl)-acrylamide, N-(3-hydroxypropyl)-acrylamide, N-(3-hydroxypropyl)-methacrylamide, N-(2-hydroxypropyl)-methacrylamide, N-(3-aminopropyl)-acrylamide hydrochloride, N-(3-aminopropyl)-methacrylamide hydrochloride, 2-hydroxyethyl-methacrylate, 2-hydroxypropyl-acrylate, 3-hydroxypropyl-acrylate, 2-hydroxy-1-methylethyl-acrylate, 2-aminoethyl acrylate hydrochloride, 3-hydroxypropyl-methacrylate, 2-hydroxy-1-methylethyl-methacrylate, 2-hydroxyethyl-methacrylate, 2-hydroxypropyl-methacrylate and 2-aminoethyl methacrylate hydrochloride, wherein said principal monomer is a monomer free from an amino acid. A copolymer comprising:

9. 7. The copolymer comprising a plurality of active agent molecules of claim 6, wherein the RAFT agent comprises a monodisperse spacer of 5 to 25 units.

10. 7. A copolymer comprising a plurality of active agent molecules according to claim 6, wherein the RAFT agent comprises a reactive group used to functionalize the copolymer with a cell-type or tissue-type specific targeting moiety; the reactive group is a thiol, aldehyde, alkyne, azide, tetrazine, strained alkene, amine, carboxyl, ester, diazirine, phenyl azide, thioester, diazo, Staudinger-reactive phosphinoester (or phosphinothioester), hydrazine, oxime, acrylate for performing aza-Michael ligation, or a motif that can be used in enzymatic coupling reactions, Copolymer.

11. 11. The copolymer comprising multiple active agent molecules of claim 10, wherein the motif comprises 2 to 8 amino acid units and is an oligo-glycine, a transglutaminase-reactive substrate, an aldehyde tag, or an autocatalytic intein sequence that allows for a sortase-mediated coupling reaction.

12. 12. The copolymer comprising multiple activator molecules according to any one of claims 6 to 11, wherein the RAFT group of the RAFT agent is eliminated after copolymerization or functionalization of the copolymer.

13. (a) one or more polymerizable principal monomers, characterized in that the monomer has at least one vinyl group and does not contain amino acid residues, such as dimethyl-acrylamide, N-isobutyl-acrylamide, N-tert. one or more polymerizable principal monomers selected from butyl-acrylamide, N-hydroxyethyl-acrylamide, N-(2-hydroxypropyl)-acrylamide, N-(3-hydroxypropyl)-acrylamide, N-(3-hydroxypropyl)-methacrylamide, N-(2-hydroxypropyl)-methacrylamide, N-(3-aminopropyl)-acrylamide hydrochloride, N-(3-aminopropyl)-methacrylamide hydrochloride, 2-hydroxyethyl-methacrylate, 2-hydroxypropyl-acrylate, 3-hydroxypropyl-acrylate, 2-hydroxy-1-methylethyl-acrylate, 2-aminoethyl acrylate hydrochloride, 3-hydroxypropyl-methacrylate, 2-hydroxy-1-methylethyl-methacrylate, 2-hydroxyethyl-methacrylate, 2-hydroxypropyl-methacrylate and 2-aminoethyl methacrylate hydrochloride, wherein said principal monomers are amino acid-free monomers; (b) one or more co-primary monomers of Formulae III-X: 【Chemistry 31】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 - and Z is H (when A is -O-) or -C n H 2n+1 (where n=1-8), payload refers to an active agent, L is a linker, and A is -O- or -NH-; 【Chemistry 32】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 - and Y is H or -CO-C n H 2n+1 (where n=1-8), payload refers to the active agent, and L is a linker); 【Transformation 33】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 -, where payload refers to the active agent and L is a linker, where the linkers used to functionalize the alpha-amino and carboxy groups do not have to be the same; 【Transformation 34】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 - and Z is H (when A is -O-) or -C n H 2n+1 (where n=1-8), payload refers to an active agent, L is a linker, and A is -O- or -NH-): 【Chemistry 35】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 -wherein payload refers to an active agent and L is a linker; 【Transformation 36】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 -, where payload refers to the active agent and L is a linker, where the linkers used to functionalize the alpha-amino and carboxy groups do not have to be the same; 【Chemistry 37】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 - and Z is H (when A is -O-) or -C n H 2n+1 (wherein n=1 to 8), L is a linker, J is H or a radioactive iodine nucleus, and A is —O— or —NH—; 【Transformation 38】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 -, J is H or a radioactive iodine nucleus, payload refers to an active agent, and L is a linker, where the linkers used to functionalize the alpha-amino and carboxy groups do not have to be identical, where said co-primary monomer is a monomer comprising an amino acid; (d) an agent that controls radical polymerization; and (f) an initiator system that generates free radical species; 1. A copolymer comprising a plurality of active agent molecules, prepared by polymerization of a reaction mixture comprising: the active agent is a cytotoxic molecule, a tracer molecule, or a substance capable of overcoming tumor resistance; wherein the copolymer is characterized by a Mw / Mn in the range of 1.05 to 1.4, and wherein the mole percent of monomers of Formula I or Formula II is between 1% (mol) and 49.9% (mol) of all monomers present in the polymerization mixture. Copolymer.

14. 14. The copolymer comprising a plurality of activator molecules of claim 13, wherein the reaction mixture further comprises: (c) Formula I: 【Chemistry 39】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and X is —NH(CH 2 ) 4 -, -NH(CH 2 ) 3 -, -O-C 6 H 4 -CH 2 --, --O-CH 2 -, -O-CH(CH 3 ) -, -S-CH 2 - or -NH-C 6 H 4 -CH 2 - and Y is H or -CO-C n H 2n+1 (wherein n=1 to 8), and Z is H (when A is —O—) or —C n H 2n+1 (wherein n=1 to 8) and A is —O— or —NH—. and / or Formula II: 【Chemistry 40】 (Wherein, R is —H, —CH 3 , -CH 2 -CH 3 or -(CH 2 ) 2 -CH 3 and Z is H (when A is O) or -C n H 2n+1 (wherein n=1 to 8) and A is —O— or —NH—. wherein said co-principal monomer is an amino acid-containing monomer; and / or (e) functionalizing the copolymer with cell-type-specific or tissue-type-specific targeting moieties; A copolymer comprising:

15. 15. The copolymer comprising a plurality of active agent molecules of claim 13 or 14, wherein the copolymer has a weight average molecular weight of 5,000 to 100,000 daltons as estimated by chromatography with reference to a pullulan standard.

16. 16. The copolymer comprising a plurality of activator molecules according to claims 13 to 15, wherein the agent controlling the radical polymerization is a RAFT agent.

17. 17. A copolymer comprising a plurality of active agent molecules according to claim 16, wherein the RAFT agent comprises a reactive group used to functionalize the copolymer with a cell-type or tissue-type specific targeting moiety; the reactive group is a thiol, aldehyde, alkyne, azide, tetrazine, strained alkene, amine, carboxyl, ester, diazirine, phenyl azide, thioester, diazo, Staudinger-reactive phosphinoester (or phosphinothioester), hydrazine, oxime, acrylate for performing aza-Michael ligation, or a motif that can be used in enzymatic coupling reactions, Copolymer.

18. 18. The copolymer comprising multiple active agent molecules of claim 17, wherein the motif comprises 2 to 8 amino acid units and is an oligo-glycine, a transglutaminase-reactive substrate, an aldehyde tag, or an autocatalytic intein sequence that allows for a sortase-mediated coupling reaction.

19. 19. The copolymer comprising multiple activator molecules according to any one of claims 16 to 18, wherein the RAFT group of the RAFT agent is eliminated after copolymerization or functionalization of the copolymer.

20. A pharmaceutical composition comprising an effective amount of a copolymer comprising a plurality of active agent molecules according to any one of claims 1 to 19, and a pharmaceutically acceptable carrier or excipient.

21. 21. The pharmaceutical composition of claim 20 for treating cancer, or another disease or condition, in a subject.

Citation Information

Patent Citations

  • New polymer materials for contact lens applications

    WO2017055536A1