Anti-IGF-I receptor antibody
An anti-IGF-I receptor antibody targeting the CR domain enhances muscle growth and prolongs treatment intervals without hypoglycemic effects, improving upon existing IGF-I receptor therapies by stabilizing glucose levels and reducing administration frequency.
Patent Information
- Application Number
- JP2021096162
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2017-05-30
- Filing Date
- 2021-06-08
- Publication Date
- 2026-01-14
- Estimated Expiration
- 2038-05-29
AI Technical Summary
Current treatments with IGF-I receptor agonists face challenges such as frequent administration due to short half-life, hypoglycemic side effects, and limited muscle mass-promoting activity, while antagonist antibodies cause hyperglycemia and have limited therapeutic applications.
Development of an anti-IGF-I receptor antibody that specifically binds to the CR domain, inducing cell proliferation and muscle mass increase without altering glucose uptake or blood glucose levels, with a long-lasting effect achievable through less frequent administration.
The antibody effectively promotes muscle growth and prolongs treatment intervals while maintaining stable blood glucose levels, addressing compliance and side effect issues of existing IGF-I receptor therapies.
Smart Images

Figure 0007798489000008 
Figure 0007798489000009 
Figure 0007798489000010
Abstract
Description
[Technical Field]
[0001] The present invention relates to an anti-IGF-I receptor antibody, and more particularly to an anti-IGF-I receptor antibody that specifically binds to the IGF-I receptor of a vertebrate. [Background technology]
[0002] 1.IGF-I IGF-I is an insulin-like growth factor secreted primarily by the liver. It exerts various physiological functions in various organs by acting on IGF-I receptors. This suggests that IGF-I is expected to be useful in treating a variety of diseases. Since IGF-I shares a high degree of homology (approximately 40%) with the amino acid sequence of proinsulin, it may also bind to insulin receptors and exert insulin-like effects (Non-Patent Document 1). Furthermore, since the IGF-I receptor shares a high degree of homology (approximately 60%) with the amino acid sequence of the insulin receptor, the two receptors may form heterodimers (Non-Patent Document 1). Insulin exerts a potent blood glucose-lowering effect by acting on the insulin receptor, and is therefore used in therapy as a hypoglycemic drug.
[0003] 2.IGF-I receptor The IGF-I receptor is a transmembrane protein composed of an α chain and a β chain, and includes six extracellular domains, L1, CR, L2, Fn1, Fn2, and Fn3, a transmembrane domain, and an intracellular domain (Non-Patent Document 2). The intracellular domain of the IGF-I receptor contains a tyrosine kinase. The cysteine-rich domain (CR), which is an extracellular domain, is involved in the activation of intracellular tyrosine kinase, which is accompanied by a conformational change of the IGF-I receptor upon binding of IGF-I to the IGF-I receptor. The IGF-I receptor forms a homodimeric complex (homozyme), and upon binding of IGF-I, activates the receptor kinase to transmit a signal. It also forms a heterodimeric complex (heterozyme) with the insulin receptor, and upon binding of insulin or IGF-I, activates the receptor kinase to transmit a signal (Non-Patent Documents 3 and 4).
[0004] 3. Physiological functions of IGF-I IGF-I has been shown to have growth-promoting effects such as height and weight gain, as well as insulin-like metabolic effects such as promoting glucose metabolism and hypoglycemic effects. Mecasermin, a human recombinant IGF-I, has been shown to improve symptoms associated with insulin receptor abnormalities, such as hyperglycemia, hyperinsulinemia, acanthosis nigricans, and hirsutism. It has also been shown to improve growth disorders associated with growth hormone-resistant dwarfism (Non-Patent Document 5). IGF-I is known to promote growth by enhancing the DNA synthesis ability of human chondrocytes, and administration of IGF-I increases body weight and femoral length in hypophysectomized rats (Non-Patent Document 5).
[0005] 4. IGF-I's effect on increasing muscle mass Enhancement of IGF-I-mediated cell proliferation activity requires sustained activation of the IGF-I receptor (Non-Patent Document 6). Animals overexpressing the IGF-I receptor have increased muscle mass (Non-Patent Document 7). Furthermore, sustained administration of IGF-I / IGFBP3 increases grip strength and improves the ability of patients with proximal femoral fractures to rise from a sitting position without assistance (Non-Patent Document 8). It is known that IGF-I concentrations in muscle of elderly humans and mice are lower than those of young mice (Non-Patent Documents 9 and 10). However, muscle mass was improved in elderly mice in which IGF-I was forcibly expressed specifically in muscle tissue compared to wild-type mice (Non-Patent Document 11).
[0006] 5. Leading products that increase muscle mass Anamorelin, a ghrelin receptor agonist, increased lean body mass in a clinical trial of cachexia, a disuse muscle atrophy, but caused nausea and elevated blood glucose levels as side effects (Non-Patent Document 12). Myostatin is a negative regulator of skeletal muscle formation that acts on activin receptor II (ActRII) and inhibits Akt / mTOR (Non-Patent Documents 13-15). The anti-myostatin antibody LY2495655 increases muscle mass in patients undergoing total hip arthroplasty and in elderly people (Non-Patent Documents 16 and 17). In addition, bimagrumab, an anti-ActRII antibody, increases muscle mass in patients with neuromuscular diseases (Non-Patent Document 18). However, there are currently no drugs that can promote skeletal muscle formation and be used for treatment.
[0007] 6. Leading products that promote growth Human recombinant GH preparations (growth hormone preparations) activate GH receptors, induce IGF-I secretion, and are known to promote growth. However, because they are administered as subcutaneous injections once daily, compliance (e.g., missed doses) can lead to a decrease in growth-promoting effects (Non-Patent Document 19). Long-acting GH preparations that can be administered once a week or once every two weeks are currently under development, with improved GH kinetics. However, there are currently no drugs available for treatment that improve compliance and have growth-promoting effects. Furthermore, GH preparations have been shown to have a reduced growth-promoting effect in patients with reduced sensitivity to GH receptor activation, GH receptor abnormalities, or resistance to GH treatment (Non-Patent Document 20). IGF-I acts downstream of the GH receptor and is the only therapeutic agent that has growth-promoting effects even in patients with reduced sensitivity to GH receptor activation. However, IGF-I preparations are injectable twice daily, which not only leads to poor compliance but also causes hypoglycemia as a known side effect (Non-Patent Document 21). Currently, there are no drugs that can improve compliance with IGF-I and hypoglycemia and can be used for treatment.
[0008] 7. IGF-I's blood sugar lowering effect IGF-I is known to have an insulin-like effect, which is its hypoglycemic effect. IGF-I enhances glucose uptake in rat muscle-derived cells (Non-Patent Document 5). Furthermore, administration of IGF-I reduces blood glucose levels in rats (Non-Patent Document 5). It has been reported that the blood glucose-lowering effect of IGF-I can induce hypoglycemia as a clinical side effect (Non-Patent Document 21). Furthermore, since IGF-I causes hypoglycemia when administered to humans, it is necessary to administer appropriate doses starting from a low dose at the start of treatment and to observe various clinical findings, including blood glucose levels, after administration (Non-Patent Document 5). IGF-I exerts its hypoglycemic effect through enhanced phosphorylation of Akt, a downstream signal of the IGF-I receptor. An active mutant of Akt enhances glucose uptake in 3T3-L1 cells (Non-Patent Document 22). Meanwhile, mice lacking Akt2 exhibit elevated blood glucose levels (Non-Patent Document 23). Furthermore, Akt inhibitors inhibit insulin-stimulated glucose uptake in rat muscle-derived cells (Non-Patent Document 24). Furthermore, IGF-I is known to activate the insulin receptor, which is involved in its hypoglycemic effect. Based on these findings, it is believed that the hypoglycemic effect of IGF-I involves excessive activation of Akt and activation of the insulin receptor.
[0009] 8. IGF-I has a short half-life in the blood The half-life of IGF-I in the blood is short, necessitating frequent administration in treatment. In fact, mecasermin, a human recombinant IGF-I, has a half-life of approximately 11 to 16 hours in the blood, and must be administered once or twice daily in the treatment of short stature (Non-Patent Document 5). Approximately 70 to 80% of IGF-I in the blood is bound to IGFBP3. The free form of IGF-I is physiologically active. The binding to IGFBP3 maintains the half-life of IGF-I in the blood at approximately 10 to 16 hours (Non-Patent Document 1). IPLEX, a combination drug of IGF-I and IGFBP3, has a blood half-life of approximately 21 to 26 hours, which is longer than that of IGF-I, making it possible to administer it once daily (Non-Patent Document 23). However, IPLEX has been withdrawn from the market. Attempts have been made to develop PEGylated IGF-I that improves the dynamics of IGF-I, but no drugs have been used for treatment (Patent Document 1).
[0010] 9. Expected therapeutic effects of IGF-I IGF-I is known to act on many different organs and to have a wide range of physiological functions (Non-Patent Document 21). IGF-I has been reported to have neuroprotective effects in the central nervous system through its mitochondrial protection and antioxidant effects via IGF-I receptor activation (Non-Patent Documents 26 and 27). IGF-I also promotes neurite formation after injury (Non-Patent Document 28). IGF-I is a major factor in promoting growth (Non-Patent Documents 29 and 30). In fact, mecasermin, a human recombinant IGF-I, is used clinically as a therapeutic agent for short stature. IGF-I is thought to be useful in the treatment of liver cirrhosis. Liver cirrhosis is a disease that progresses from liver damage or chronic liver disease and is accompanied by liver fibrosis. In an animal model of liver cirrhosis, administration of IGF-I suppressed liver fibrosis (Non-Patent Document 31). IGF-I is also known to be involved in kidney development and function. In renal mesangial cells, IGF-I has a protective effect against oxidative stress and apoptosis caused by glucotoxicity (Non-Patent Document 32). IGF-I is expected to be a therapeutic agent for nephropathy.
[0011] Conditions that are expected to be improved by administration of IGF-I include dwarfism, Larondosis, liver cirrhosis, liver fibrosis, aging, intrauterine growth retardation (IUGR), neurological diseases, stroke, spinal cord injury, cardiovascular protection, diabetes, insulin resistance, metabolic syndrome, nephropathy, osteoporosis, cystic fibrosis, wound healing, myotonic dystrophy, AIDS-associated sarcopenia, HIV-associated fat redistribution syndrome, burns, Crohn's disease, Werner's syndrome, X-linked combined immunodeficiency, hearing loss, anorexia nervosa, and retinopathy of prematurity (Non-Patent Document 21). IGF-I is expected to be a therapeutic agent for various diseases due to its diverse physiological effects. However, its side effect of hypoglycemic effect and its short half-life, which requires multiple administrations, pose challenges for its clinical use.
[0012] 10.IGF-I receptor agonist antibody Antibody preparations generally have a long half-life and are effective when administered once or twice a month. IGF-I receptor agonist antibodies have been reported to activate the receptor in vitro, but there have been no reports of antibodies that have demonstrated agonistic activity against the IGF-I receptor in vivo (Non-Patent Documents 33-37). The antibodies 3B7 and 2D1 enhance cellular DNA synthesis in vitro (Non-Patent Document 34). Antibodies 11A1, 11A4, 11A11, and 24-57 enhance tyrosine phosphorylation of the IGF-I receptor in vitro (Non-Patent Document 35). Antibodies 16-13, 17-69, 24-57, 24-60, 24-31, and 26-3 have been shown to enhance cellular DNA synthesis and glucose uptake in vitro, and these antibodies may have blood glucose-lowering effects (Non-Patent Documents 36, 37).
[0013] However, there have been no reports of IGF-I receptor agonist antibodies that have demonstrated cell proliferation activity in vitro using primary cultured cells, especially human myoblasts, much less those that have demonstrated muscle mass-increasing activity in vivo.
[0014] 11.IGF-I receptor antagonist antibody Antibodies that bind to IGF-I receptors have been used to treat malignant tumors, etc., by utilizing their antagonistic effect of inhibiting the binding of IGF-I to the IGF-I receptor. However, existing IGF-I receptor antagonist antibodies not only have many side effects such as hyperglycemia when used alone (Non-Patent Document 38), but also increase the incidence of hyperglycemia when used in combination with other anticancer drugs (Non-Patent Document 39), so their therapeutic applications are thought to be limited. [Prior art documents] [Patent documents]
[0015] [Patent Document 1] "Use of PEGylated IGF-I Variants for the Treatment of Neuromuscular Disorders," JP 2011-518778 A (WO 2009 / 121759), 2011 [Non-patent literature]
[0016] [Non-Patent Document 1] Ohlsson, C., et al., The role of liver-derived insulin-like growth factor-I. Endocr Rev, 2009. 30(5): p. 494-535. [Non-patent document 2] Kavran, JM, et al., How IGF-I activates its receptor. Elife, 2014. 3. [Non-patent document 3] Bailyes, EM, et al., Insulin receptor / IGF-I receptor hybrids are widely distributed in mammalian tissues: quantification of individual receptor species by selective immunoprecipitation and immunoblotting. Biochem J, 1997. 327 ( Pt 1): p. 209-15. [Non-patent document 4] Pandini, G., et al., Insulin / insulin-like growth factor I hybrid receptors have different biological characteristics depending on the insulin receptor isoform involved. J Biol Chem, 2002. 277(42): p. 39684-95. [Non-patent document 5] OrphanPacific, IF. 2015. [Non-patent document 6] Fukushima, T., et al., Phosphatidylinositol 3-kinase (PI3K) activity bound to insulin-like growth factor-I (IGF-I) receptor, which is continuously sustained by IGF-I stimulation, is required for IGF-I-induced cell proliferation. J Biol Chem, 2012. 287(35): p. 29713-21. [Non-Patent Document 7] Schiaffino, S. and C. Mammucari, Regulation of skeletal muscle growth by the IGF-I-Akt / PKB pathway: insights from genetic models. Skelet Muscle, 2011. 1(1): p. 4. [Non-Patent Document 8] Boonen, S., et al., Musculoskeletal effects of the recombinant human IGF-I / IGF binding protein-3 complex in osteoporotic patients with proximal femoral fracture: a double-blind, placebo-controlled pilot study. J Clin Endocrinol Metab, 2002. 87(4): p. 1593-9. [Non-Patent Document 9] Barton-Davis, E.R., et al., Viral mediated expression of insulin-like growth factor I blocks the aging-related loss of skeletal muscle function. Proc Natl Acad Sci U S A, 1998. 95(26): p. 15603-7. [Non-Patent Document 10] Lamberts, S.W., A.W. van den Beld, and A.J. van der Lely, The endocrinology of aging. Science, 1997. 278(5337): p. 419-24. [[ID=^{14}]] [Non-Patent Document 11] Musaro, A., et al., Localized IGF-I transgene expression sustains hypertrophy and regeneration in senescent skeletal muscle. Nat Genet, 2001. 27(2): p. 195-2
Outdoor Tools 12
Outdoor Content13
Outdoor Tools 14
Outdoor Tools 15
Outdoor Content 16
Non-Patent Document 17
Non-Patent Document 18
Non-Patent Document 19
Non-Patent Document 20
Non-Patent Document 21
Direct Accounts 27
Direct Environment 28
Direct Account 29
Draw 30 pages
Direct Entries 31
Direct Environment 32
Direct Entries 33
Direct Entries 34
Direct Entries 35
[0017] An object of the present invention is to provide an anti-IGF-I receptor antibody, a fragment thereof, or a derivative thereof that specifically binds to a vertebrate IGF-I receptor. Another object of the present invention is to provide an antibody that increases muscle mass or growth plate cartilage thickness via the IGF-I receptor without lowering blood glucose levels. [Means for solving the problem]
[0018] That is, the present invention relates to the following. [1] An anti-IGF-I receptor antibody, a fragment thereof, or a derivative thereof, which specifically binds to a vertebrate IGF-I receptor and has the activity of inducing proliferation of vertebrate-derived cells. [2] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to [1], which has the activity of inducing proliferation of vertebrate-derived cells at least as great as that of natural IGF-I. [3] In vitro ECs with proliferation-inducing activity in vertebrate-derived cells 50 The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to [1] or [2], wherein the value is 1 / 20 or less of that of natural IGF-I. [4] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, described in any one of [1] to [3], which, when contacted with cultured vertebrate-derived cells, has an improved persistence of its proliferation-inducing effect on the cultured cells relative to the contact time with the cultured cells compared to natural IGF-I. [5] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [2] to [4], wherein the native IGF-I is human IGF-I having the amino acid sequence set forth in SEQ ID NO: 1. [6] In vitro EC of vertebrate-derived cell proliferation-inducing activity 50 The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to any one of [1] to [5], wherein the value is 0.1 nmol / L or less. [7] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, described in any one of [1] to [6], which has the activity of inducing an increase in muscle mass and / or body length of a vertebrate when administered parenterally to the vertebrate. [8] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to any one of [1] to [7], which is administered to a vertebrate at a frequency of once a week or less. [9] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [1] to [8], wherein the vertebrate is a human or a non-human animal including a guinea pig, monkey, rabbit, cow, pig, horse, sheep, dog or chicken, or a non-human animal expressing a human IGF-I receptor.
[10] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, described in any one of [1] to [9], characterized in that it does not induce glucose uptake in differentiated muscle cells at a dose that induces proliferation of vertebrate-derived cells.
[11] EC that shows proliferation-inducing activity on vertebrate-derived cells in vitro 50 The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to
[10] , characterized in that it does not induce glucose uptake in differentiated muscle cells even at a dose 100 times or more the normal dose.
[12] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to
[10] or
[11] , wherein the vertebrate-derived cells are myoblasts derived from a human or a non-human mammal.
[13] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, described in any one of [7] to
[12] , which is administered parenterally to a vertebrate and does not reduce the blood glucose level of the vertebrate at a dose that induces an increase in muscle mass and / or body length of the vertebrate.
[14] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to
[13] , which is administered parenterally to a vertebrate and does not cause fluctuations in the blood glucose level of the vertebrate, even at a dose 10 times or more the effective dose for inducing an increase in muscle mass and / or body length of the vertebrate.
[15] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to any one of [1] to
[14] , which binds to the CR domain of the IGF-I receptor.
[16] An anti-IGF-I receptor antibody, a fragment thereof, or a derivative thereof, which binds to the CR domain of the IGF-I receptor and inhibits the binding of IGF-I or IGF-II to the IGF-I receptor.
[17] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to
[15] or
[16] , characterized in that it binds to an epitope containing or in the vicinity of ProSerGlyPheIleArgAsnX1X2GlnSerMet (X1 is Gly or Ser, and X2 is Ser or Thr) in the sequence of the CR domain of the IGF-I receptor.
[18] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to
[17] , characterized in that it binds to an epitope comprising ProSerGlyPheIleArgAsnGlySerGlnSerMet or its vicinity in the sequence of the CR domain of the IGF-I receptor.
[19] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [1] to
[18] , which has cross-reactivity with the IGF-I receptor of humans or non-human animals including guinea pigs, monkeys, rabbits, cows, pigs, horses, sheep, dogs, or chickens.
[20] The antigen-antibody reaction of the anti-IGF-I receptor antibody or its fragment, or a derivative thereof, has a dissociation equilibrium constant (KD) of 1 × 10 -8 The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [1] to
[19] , characterized in that it has an affinity strength of M or less.
[21] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, described in any one of
[16] to
[20] , wherein the anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof has at least one of the characteristics 1) to 4). 1) It has the activity of inducing proliferation of vertebrate-derived cells. 2) When administered parenterally to a vertebrate, it has the activity of inducing an increase in muscle mass and / or body length in the vertebrate. 3) It does not induce glucose uptake in differentiated muscle cells at doses that induce proliferation of vertebrate-derived cells. 4) When parenterally administered to a vertebrate, it does not alter the blood glucose level of the vertebrate at a dose that induces an increase in muscle mass and / or body length of the vertebrate.
[22] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of
[16] to
[21] , wherein the anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof has at least one of the characteristics 1) to 4). 1) Inhibits IGF-I-induced proliferation of vertebrate-derived cells. 2) By parenteral administration to a vertebrate, it inhibits cell proliferation in a cell proliferative disorder caused by IGF-I in the vertebrate. 3) At doses that inhibit IGF-I-induced proliferation of vertebrate-derived cells, it does not affect glucose uptake in differentiated muscle cells. 4) When parenterally administered to a vertebrate, the compound does not change the blood glucose level of the vertebrate at a dose sufficient to inhibit cell proliferation in a cell proliferative disorder caused by IGF-I in the vertebrate.
[23] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [1] to
[22] , wherein the anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof is a Fab, scFv, diabody, or bispecific antibody, or a derivative thereof.
[24] The CDR-1 (CDR-H1) sequence of the heavy chain variable region is SEQ ID NO: 3 or an amino acid sequence in which any one amino acid residue of SEQ ID NO: 3 has been substituted, deleted, or inserted. an amino acid sequence of SEQ ID NO: 4 or an amino acid sequence of SEQ ID NO: 4 in which one or two amino acid residues are substituted, deleted, or inserted as the CDR-2 (CDR-H2) sequence of the heavy chain variable region; an amino acid sequence of SEQ ID NO: 5 or an amino acid sequence of SEQ ID NO: 5 in which one or two amino acid residues are substituted, deleted, or inserted as the CDR-3 (CDR-H3) sequence of the heavy chain variable region; an amino acid sequence of SEQ ID NO: 6 or an amino acid sequence of SEQ ID NO: 6 in which one or two amino acid residues are substituted, deleted, or inserted as the CDR-1 (CDR-L1) sequence of the light chain variable region; The CDR-2 (CDR-L2) sequence of the light chain variable region is SEQ ID NO: 7 or an amino acid sequence in which any one amino acid residue of SEQ ID NO: 7 has been substituted, deleted, or inserted; and an amino acid sequence of SEQ ID NO: 8 or an amino acid sequence in which one or two amino acid residues of SEQ ID NO: 8 have been substituted, deleted, or inserted as the CDR-3 (CDR-L3) sequence of the light chain variable region; The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [1] to
[23] , comprising an amino acid sequence comprising the following:
[25] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to
[24] , further comprising an immunoglobulin framework sequence.
[26] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to
[25] , wherein the framework sequence of the immunoglobulin is a framework sequence of each class of immunoglobulin of a human or non-human animal, including a guinea pig, a monkey, a rabbit, a cow, a pig, a horse, a sheep, a dog, a chicken, a mouse, or a rat.
[27] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [1] to
[26] , which comprises an amino acid sequence comprising SEQ ID NO: 9 or an amino acid sequence having 90% or more homology to SEQ ID NO: 9 as a heavy chain variable region, and SEQ ID NO: 10 or an amino acid sequence having 90% or more homology to SEQ ID NO: 10 as a light chain variable region.
[28] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [1] to
[27] , further comprising a constant region in each class of immunoglobulin from a human or non-human animal, including a guinea pig, monkey, rabbit, cow, pig, horse, sheep, dog, chicken, mouse, or rat.
[29] A nucleic acid molecule consisting of a polynucleotide sequence encoding the anti-IGF-I receptor antibody or a fragment thereof according to any one of [1] to
[28] , or a derivative thereof.
[30] A cloning vector or expression vector comprising at least one nucleic acid molecule according to
[29] .
[31] A recombinant cell in which the vector described in
[30] has been introduced into a host cell.
[32] A method for producing an anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, described in any one of [1] to
[28] , which comprises the steps of culturing the recombinant cell described in
[31] and purifying the anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, produced from the recombinant cell.
[33] A pharmaceutical composition comprising an anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, described in any one of [1] to
[28] , a nucleic acid molecule described in
[29] , a vector described in
[30] , or a recombinant cell described in
[31] .
[34] The pharmaceutical composition according to
[33] , further comprising an active ingredient other than the anti-IGF-I receptor antibody or fragment thereof or derivative thereof described in any one of [1] to
[28] , the nucleic acid molecule described in
[29] , the vector described in
[30] , or the recombinant cell described in
[31] .
[35] The pharmaceutical composition described in
[34] , wherein the active ingredient is one or more selected from growth hormone or an analog thereof, insulin or an analog thereof, IGF-II or an analog thereof, an anti-myostatin antibody, a myostatin antagonist, an anti-activin type IIB receptor antibody, an activin type IIB receptor antagonist, a soluble activin type IIB receptor or an analog thereof, ghrelin or an analog thereof, follistatin or an analog thereof, a beta-2 agonist, and a selective androgen receptor modulator.
[36] Active ingredients include corticosteroids, antiemetics, ondansetron hydrochloride, granisetron hydrochloride, metroclopramide, domperidone, haloperidol, cyclizine, lorazepam, prochlorperazine, dexamethasone, levomepromazine, tropisetron, cancer vaccines, GM-CSF inhibitors, and GM-CSF. DNA vaccines, cell-based vaccines, dendritic cell vaccines, recombinant viral vaccines, heat shock protein (HSP) vaccines, allogeneic tumor vaccines, autologous tumor vaccines, analgesics, ibuprofen, naproxen, choline magnesium trisalicylate, oxycodone hydrochloride, antiangiogenic drugs, antithrombotic drugs, anti-PD-1 antibodies, nivolumab, pembrolizumab, anti-PD-L1 antibodies, atezolizumab, anti-CTLA4 antibodies, ipilimumab, anti-CD20 antibodies, rituximab, anti-HER2 antibodies, trastuzumab, anti-CCR4 antibodies, mogamulizumab, anti-VEGF antibodies, bevacizumab, anti-VEGF receptor antibodies, soluble VEGF receptor fragments, anti-TWEAK antibodies, anti-TWEAK receptor antibodies, soluble TWEAK receptor fragments, AMG 706, AMG 386, the pharmaceutical composition according to
[34] or
[35] , comprising an ingredient selected from the group consisting of an antiproliferative agent, a farnesyl protein transferase inhibitor, an αvβ3 inhibitor, an αvβ5 inhibitor, a p53 inhibitor, a Kit receptor inhibitor, a Ret receptor inhibitor, a PDGFR inhibitor, a growth hormone secretion inhibitor, an angiopoietin inhibitor, a tumor-infiltrating macrophage inhibitor, a c-fms inhibitor, an anti-c-fms antibody, a CSF-1 inhibitor, an anti-CSF-1 antibody, a soluble c-fms fragment, pegvisomant, gemcitabine, panitumumab, irinotecan, and SN-38.
[37] A pharmaceutical used for treating or preventing a condition related to IGF-I, comprising one or more of the anti-IGF-I receptor antibody or fragment thereof described in [1] to
[28] , or a derivative thereof, the nucleic acid molecule described in
[29] , the vector described in
[30] , and the recombinant cell described in
[31] .
[38] The pharmaceutical composition according to
[37] , wherein the IGF-I-related condition is selected from disuse muscle atrophy, short stature, diabetic nephropathy, chronic renal failure, Larondosis, cirrhosis, hepatic fibrosis, aging, intrauterine growth retardation (IUGR), neurological disease, stroke, spinal cord injury, cardiovascular protection, diabetes, insulin resistance, metabolic syndrome, osteoporosis, cystic fibrosis, wound healing, myotonic dystrophy, AIDS sarcopenia, HIV-associated fat redistribution syndrome, burns, Crohn's disease, Werner's syndrome, X-linked combined immunodeficiency, hearing loss, anorexia nervosa and retinopathy of prematurity, Turner's syndrome, Prader-Willi syndrome, Silver-Russell syndrome, idiopathic short stature, obesity, multiple sclerosis, fibromyalgia, ulcerative colitis, low muscle mass, myocardial ischemia, and low bone mineral density.
[39] The pharmaceutical agent according to
[37] or
[38] , which is administered parenterally.
[40] The pharmaceutical agent according to any one of
[37] to
[39] , which is an animal pharmaceutical agent to be administered to a non-human animal.
[41] The pharmaceutical according to
[40] , wherein the veterinary pharmaceutical is administered for the purpose of increasing muscle mass and / or body length, promoting growth, increasing milk production, promoting reproduction, or preventing aging.
[42] The animal drug according to
[40] or
[41] , wherein the non-human animal is a guinea pig, monkey, rabbit, cow, pig, horse, sheep, dog, or chicken.
[43] The pharmaceutical agent according to any one of
[37] to
[42] , which is used for the treatment or prevention of a disease caused by the action of IGF-I or IGF-II on an IGF-I receptor.
[44] Diseases caused by the action of IGF-I or IGF-II on the IGF-I receptor include liver cancer, neuroblastoma, rhabdomyosarcoma, osteosarcoma, childhood cancer, acromegaly, ovarian cancer, pancreatic cancer, benign prostatic hyperplasia, breast cancer, prostate cancer, bone cancer, lung cancer, colorectal cancer, cervical cancer, synovial sarcoma, bladder cancer, gastric cancer, Wilms' tumor, diarrhea associated with metastatic carcinoid and vasoactive intestinal peptide-secreting tumors, vipoma, Werner-Morrison syndrome, Beckwith-Wiedemann syndrome, kidney cancer, renal cell carcinoma, transitional cell carcinoma, and euthyroidism.
[43] The pharmaceutical composition according to
[43] , wherein the disease is selected from the group consisting of: Ing's sarcoma, leukemia, acute lymphoblastic leukemia, brain tumor, glioblastoma, non-glioblastoma brain tumor, meningioma, pituitary adenoma, vestibular schwannoma, primitive neuroectodermal tumor, medulloblastoma, astrocytoma, oligodendroglioma, ependymoma, choroid plexus papilloma, gigantism, psoriasis, atherosclerosis, vascular smooth muscle restenosis, inappropriate microvascular proliferation, diabetic retinopathy, Graves' disease, multiple sclerosis, systemic lupus erythematosus, chronic thyroiditis, myasthenia gravis, autoimmune thyroiditis, and Behcet's disease.
[45] A method for culturing cells derived from a vertebrate in vitro, comprising a step of contacting the cells derived from the vertebrate with one or more of the anti-IGF-I receptor antibody or a fragment thereof described in any one of [1] to
[28] , or a derivative thereof, the nucleic acid molecule described in
[29] , the vector described in
[30] , and the recombinant cell described in
[31] during the culturing process.
[46] The culture method according to
[45] , wherein the contacting step is carried out for the purpose of promoting proliferation or inducing differentiation of cells derived from a vertebrate.
[47] The culture method according to
[45] or
[46] , wherein the anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof is adsorbed or immobilized on a solid phase.
[48] A genetically modified animal in which a mutation has been introduced into the CR domain of the IGF-I receptor gene, characterized in that the CR domain of the IGF-I receptor has, through genetic recombination, the amino acid sequence ProSerGlyPheIleArgAsnGlySerGlnSerMet.
[49] A genetically modified animal into which a heterologous IGF-I receptor gene has been introduced, wherein the amino acid residues X1 and / or X2 in the sequence of the ProSerGlyPheIleArgAsnX1X2GlnSerMet portion of the CR domain of the amino acid sequence encoded by the introduced IGF-I receptor gene do not match the amino acid sequence of the IGF-I receptor endogenously possessed by the animal. [Effects of the Invention]
[0019] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof of the present invention has the effect of specifically binding to the IGF-I receptor of a vertebrate. [Brief explanation of the drawings]
[0020] [Figure 1] FIG. 1 shows the results of comparing the amino acid sequences of the CR domains of IGF-I receptors (amino acid sequences are shown in single-letter code) among mice, rats, humans, guinea pigs, and rabbits. [Figure 2] FIG. 1 shows the results of ELISA using mutants of the putative epitope of IGF11-16. [Figure 3] FIG. 1 shows the proliferation activity of human myoblasts after drug withdrawal of IGF11-16 and IGF-I. [Figure 4] FIG. 1 shows the effect of adding IGF-I and IGF11-16 to human differentiated muscle cells on glucose uptake. [Figure 5] FIG. 1 shows the weight of the extensor digitorum longus muscle two weeks after continuous administration of IGF-I using an osmotic pump or a single subcutaneous or intravenous administration of IGF11-16 to guinea pigs. [Figure 6] FIG. 1 shows the time course of blood glucose levels following a single subcutaneous administration of IGF-I to guinea pigs under fasting conditions. [Figure 7] FIG. 1 shows the time course of blood glucose levels following a single subcutaneous administration of IGF11-16 to guinea pigs under fasting conditions. [Figure 8] FIG. 1 shows the time course of blood glucose levels following a single intravenous administration of IGF11-16 to guinea pigs under fasting conditions. [Figure 9] FIG. 1 shows the effect of IGF11-16 on increasing the thickness of growth plate cartilage in hypophysectomized guinea pigs (HPX). [Figure 10] FIG. 1 shows the tibia length-enhancing effect of IGF11-16 in hypophysectomized guinea pigs (HPX). [Figure 11] FIG. 1 shows the time course of blood IGF-I kinetics following a single subcutaneous administration to fasted guinea pigs. [Figure 12] FIG. 1 shows the time course of blood kinetics following a single subcutaneous administration of IGF11-16 to guinea pigs under fasting conditions. DETAILED DESCRIPTION OF THE INVENTION
[0021] The present invention will be described below based on specific embodiments, but the present invention is not limited to these embodiments. All documents cited in this specification, including patent publications, patent application publications, and non-patent publications, are incorporated herein by reference in their entirety for all purposes.
[0022] [IGF] IGF stands for insulin-like growth factor, and includes IGF-I and IGF-II. IGF-I and IGF-II are in vivo ligands with agonistic activity that bind to the IGF-I receptor (insulin-like growth factor-I receptor) described below and transmit signals for cell division and metabolism into cells. IGF-I and IGF-II are known to weakly cross-bind with the insulin receptor (INSR), which is structurally similar to the IGF-I receptor. This specification focuses primarily on IGF-I, whose physiological functions are better known. However, when examining effects or diseases mediated by the binding between the IGF-I receptor and its ligand, the effects of both IGF-I and IGF-II may be included in the description.
[0023] IGF-I, also known as somatomedin C, is a hormone consisting of a single polypeptide of 70 amino acids. The sequence of human IGF-I can be obtained by referring to EMBL-EBI UniProtKB - Accession No. P50919, etc., and the amino acid sequence of mature IGF-I is shown in SEQ ID NO: 1 in the Sequence Listing. This sequence consisting of 70 amino acids is conserved across many species. In the present invention, when "IGF-I" is referred to alone, it means an IGF-I protein having hormonal activity, unless otherwise specified.
[0024] IGF-I is produced in various cells in the body, including liver cells, and is also present in blood and other body fluids. Therefore, natural IGF-I can be purified from animal body fluids or cultures of primary cultured cells or established cell lines isolated from animals. Furthermore, since IGF-I production in cells is induced by growth hormone, IGF-I can also be purified from body fluids of animals administered with growth hormone or from cultures of primary cultured cells or established cell lines isolated from animals cultured in the presence of growth hormone. Alternatively, IGF-I can be produced using recombinant cells in which a nucleic acid molecule encoding the amino acid sequence of IGF-I is incorporated into an expression vector and introduced into a eukaryotic host cell, such as a prokaryotic organism such as Escherichia coli, yeast, insect cells, or mammalian-derived cultured cells, or using transgenic animals or plants carrying the IGF-I gene. Furthermore, human IGF-I is also available as a research reagent (Enzo Life Sciences, catalog: ADI-908-059-0100, Abnova, catalog: P3452, etc.) or as a pharmaceutical (Somazon®, mecasermin, INCRELEX®, etc.). The in vivo and in vitro activities of the IGF-I used can be evaluated for its specific activity by comparing it with the activity of an IGF-I reference material with NIBSC code: 91 / 554 from the World Health Organization's National Institute for Biological Standards and Control (NIBSC), expressed as 1 international unit / microgram. The IGF-I used in the present invention is considered to have a specific activity equivalent to that of the IGF-I with NIBSC code: 91 / 554.
[0025] [IGF-I receptor] IGF-I receptor refers to the insulin-like growth factor-I receptor. Unless otherwise specified, "IGF-I receptor" herein refers to the IGF-I receptor protein. The IGF-I receptor is a protein structured by the assembly of two subunits, each consisting of an α chain and a β chain. In the amino acid sequence of the human IGF-I receptor shown in SEQ ID NO: 2, the portion consisting of amino acids 31 to 735 of the amino acid sequence corresponds to the α chain, and the β chain corresponds to the sequence from 740 onward. The α chain of the IGF-I receptor contains the IGF-I binding site, and the β chain has a transmembrane structure and functions to transmit signals into cells. The α chain of the IGF-I receptor is divided into domains: L1, CR, L2, FnIII-1, and FnIII-2a / ID / FnIII-2b. In the amino acid sequence of the human IGF-I receptor shown in SEQ ID NO: 2, the portion from positions 31 to 179 corresponds to the L1 domain, the portion from positions 180 to 328 corresponds to the CR domain, the portion from positions 329 to 491 corresponds to the L2 domain, the portion from positions 492 to 607 corresponds to the FnIII-1 domain, and the portion from positions 608 to 735 corresponds to the FnIII-2a / ID / FnIII-2b domain. Among these, the CR (cysteine-rich domain) domain is involved in the activation of the intracellular tyrosine kinase of the β chain, which is accompanied by a conformational change of the receptor upon binding of IGF-I to the IGF-I receptor. The amino acid sequence of the human IGF-I receptor can be found in EMBL-EBI UniProtKB (Accession No. P08069), etc., and is also shown in SEQ ID NO: 2 of the Sequence Listing.
[0026] IGF-I receptors are known to be expressed in a wide range of tissues and cells in the body and are stimulated by IGF-I, inducing cell proliferation and activating intracellular signals. In particular, myoblasts can be used to evaluate the effects of IGF-I via the IGF-I receptor, using cell proliferation activity as an indicator. This makes myoblasts useful for analyzing the effects of antibodies that bind to the IGF-I receptor. Furthermore, by incorporating a nucleic acid molecule encoding the amino acid sequence of the IGF-I receptor of a human or other vertebrate into an expression vector and introducing it into a eukaryotic host, such as an insect cell or mammalian cultured cell, the IGF-I receptor encoded by the introduced nucleic acid can be expressed on the cell membrane of the recombinant cells, thereby artificially producing cells expressing the IGF-I receptor of a human or other vertebrate. These IGF-I receptor-expressing cells can be used to analyze antibody binding and investigate intracellular signal transduction.
[0027] [Anti-IGF-I receptor antibody] An antibody is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain comprises a heavy chain variable region (abbreviated as VH) and a heavy chain constant region, which in turn comprises three domains, CH1, CH2, and CH3. Each light chain comprises a light chain variable region (abbreviated as VL) and a light chain constant region. The light chain constant region comprises one domain, CL. There are two types of light chain constant regions, termed λ chains and κ chains. Heavy chain constant regions include γ chains, μ chains, α chains, δ chains, and ε chains, and antibody isotypes, such as IgG, IgM, IgA, IgD, and IgE, are determined by the heavy chain. The VH and VL regions are further subdivided into four more conserved regions (FR-1, FR-2, FR-3, and FR-4) called framework regions (FRs) and three hypervariable regions (CDR-1, CDR-2, and CDR-3) called complementarity-determining regions (CDRs). The VH contains three CDRs and four FRs arranged from the amino terminus to the carboxy terminus in the following order: FR-1, CDR-1 (CDR-H1), FR-2, CDR-2 (CDR-H2), FR-3, CDR-3 (CDR-H3), and FR-4. The VL contains three CDRs and four FRs arranged from the amino terminus to the carboxy terminus in the following order: FR-1, CDR-1 (CDR-L1), FR-2, CDR-2 (CDR-L2), FR-3, CDR-3 (CDR-L3), and FR-4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
[0028] The antibody of the present invention may be an antibody fragment and / or derivative. Examples of antibody fragments include F(ab')2, Fab, and Fv. Examples of antibody derivatives include antibodies with artificially introduced amino acid mutations in the constant region, antibodies with modified constant region domain configurations, antibodies with two or more Fc domains per molecule, antibodies composed of only heavy chains or only light chains, glycosylated antibodies, bispecific antibodies, antibody conjugates bound to antibodies or antibody fragment compounds or proteins other than antibodies, antibody enzymes, nanobodies, tandem scFvs, bispecific tandem scFvs, diabodies, and VHHs. In the present invention, the term "antibody" is intended to include antibody fragments and / or derivatives, unless otherwise specified.
[0029] Furthermore, while monoclonal antibodies classically refer to antibody molecules obtained from clones derived from a single antibody-producing cell, they also refer to a single type of antibody molecule containing a combination of VH and VL consisting of a specific amino acid sequence. Monoclonal antibodies can also be obtained by obtaining nucleic acid molecules having gene sequences encoding the amino acids of the antibody protein, and antibodies can also be produced by genetic engineering using such nucleic acid molecules. Furthermore, techniques well known to those skilled in the art include modifying antibodies to improve their binding and specificity using genetic information such as H chains, L chains, their variable regions, and CDR sequences, and producing antibodies with a structure suitable for use as therapeutic agents by modifying antibodies from animals such as mice into human antibodies. Human monoclonal antibodies can also be obtained by using non-human transgenic animals into which human antibody genes have been introduced as animals to be sensitized with antigens. Alternatively, as a method that does not require sensitization of animals, those skilled in the art can appropriately perform a technique in which antibodies that specifically bind to corresponding antigens or phage clones consisting of specific amino acid sequences are obtained using a phage library that expresses the antigen-binding region of a human antibody or a portion thereof (human antibody phage display), and human antibodies are produced from this information (see, for example, the review by Taketo Tanaka et al., Keio J. Med., Vol. 60, pp. 37-46). Furthermore, when designing antibodies to be administered to animals other than humans, those skilled in the art can design them using appropriate amino acid sequence information of the CDRs and variable regions, as in humanization techniques.
[0030] In the present invention, the term "antigen-antibody reaction" refers to an antibody-IGF-I receptor-I antibody reaction with an equilibrium dissociation constant (KD) of 1 × 10 -8 The antibody of the present invention binds to the IGF-I receptor with an affinity of typically 1×10 -8 M or less, especially 1×10 -9 M or less, and even 1×10 -10 It is preferred that the binding occurs with a KD of M or less.
[0031] Antibody specificity refers to the ability of an antibody to undergo a strong antigen-antibody reaction with a specific antigen. In particular, in the present invention, an IGF-I receptor-specific antibody refers to an antibody whose antigen-antibody reactivity with INSR, which has a high similarity to the primary structure (amino acid sequence) and higher-order structure of IGF-I receptor, is 1.5 times or less higher than its reactivity with mock cells at a concentration that shows a significant antigen-antibody reaction with IGF-I receptor-expressing cells.
[0032] Those skilled in the art can measure antigen-antibody reactions by appropriately selecting binding assays in solid-phase or liquid-phase systems. Examples of such assays include, but are not limited to, enzyme-linked immunosorbent assay (ELISA), enzyme immunoassay (EIA), surface plasmon resonance (SPR), fluorescence resonance energy transfer (FRET), and luminescence resonance energy transfer (LRET). Furthermore, when measuring such antigen-antibody binding, it is also possible to label the antibody and / or antigen with an enzyme, fluorescent substance, luminescent substance, radioisotope, or the like, and detect the antigen-antibody reaction using a measurement method suited to the physical and / or chemical properties of the labeled substance.
[0033] The anti-IGF-I receptor antibody of the present invention includes both an agonist antibody and an antagonist antibody. The IGF-I receptor agonist antibody of the present invention has the effect of enhancing the proliferation activity of myoblasts when used alone. The IGF-I receptor antagonist antibody of the present invention has the effect of inhibiting the proliferation activity of myoblasts caused by IGF-I when used simultaneously with IGF-I.
[0034] The IGF-I receptor agonist antibody of the present invention, which strongly binds to a specific domain of the IGF-I receptor, has the effect of enhancing the proliferation activity of myoblasts in vitro.
[0035] Furthermore, the IGF-I receptor agonist antibody of the present invention does not have the effect of enhancing glucose uptake in differentiated muscle cells in vitro at an effective concentration that enhances the proliferation activity of myoblasts, more preferably at a concentration 10 times higher than the effective concentration, and even more preferably at a concentration 100 times higher than the effective concentration.
[0036] IGF-I has a significant blood glucose lowering effect at doses that increase muscle mass, but the IGF-I receptor agonist antibody of the present invention does not have a blood glucose lowering effect even at doses that increase muscle mass, more preferably at doses that are 10 times or more higher than that dose.
[0037] Furthermore, a single administration of an IGF-I receptor agonist antibody to guinea pigs has in vivo activity that increases muscle mass to the same extent as that achieved by continuous administration of IGF-I. Furthermore, the IGF-I receptor agonist antibody of the present invention has a long half-life in the blood and exhibits muscle mass-increasing effects after a single administration to animals.
[0038] Based on the above, the IGF-I receptor agonist antibody of the present invention has the potential to be a therapeutic or preventive agent for various diseases associated with the IGF-I receptor, such as disuse muscle atrophy and dwarfism, which are expected to have the effects of IGF-I, and is capable of overcoming the hypoglycemic effect, which is a problem associated with IGF-I, and of prolonging its half-life in the blood.
[0039] The IGF-I receptor antagonist antibody of the present invention inhibits the binding of IGF-I to the IGF-I receptor. In one embodiment of the IGF-I receptor antagonist antibody of the present invention, the antibody activates the IGF-I receptor but inhibits the action of IGF-I on the IGF-I receptor. In this case, the antibody has the effect of negating the additive agonist activity of IGF-I, such as the proliferation-inducing activity of IGF-I in myoblasts. Another embodiment of the IGF-I receptor antagonist antibody of the present invention is an antibody that binds to the IGF-I receptor but does not activate it. Examples of such antagonist antibodies that do not activate the IGF-I receptor through cross-linking include, but are not limited to, antibodies with monovalent antigen-binding activity such as Fab and scFv, antibodies with bivalent binding sites such as bispecific antibodies, in which only one binding site binds to a specific domain of the IGF-I receptor, and antibodies in which the distance between the bivalent binding sites is changed by a linker or the like. Among the IGF-I receptor antagonist antibodies of the present invention, antibodies that bind to IGF-I receptor but lack agonistic activity can be confirmed to have binding activity to IGF-I receptor by measuring the antigen-antibody reaction between the antibody and IGF-I receptor, and to lack cell proliferation-inducing activity by cell proliferation tests using cells such as myoblasts. Furthermore, the IGF-I receptor antagonist antibodies do not affect glucose uptake in differentiated muscle cells in vitro or blood glucose levels in vivo. Therefore, the IGF-I receptor antagonist antibodies of the present invention, as anti-IGF-I receptor antibodies that do not exhibit side effects such as hyperglycemia, have the potential to be used as therapeutic or preventive agents for malignant tumors such as breast cancer, colon cancer, sarcoma, lung cancer, prostate cancer, thyroid cancer, and myeloma.
[0040] [Anti-IGF-I receptor antibody binding] The anti-IGF-I receptor antibody of the present invention has an epitope in the CR domain of the IGF-I receptor, whereas the IGF-I receptor agonist antibody does not bind to INSR, which has a high similarity to the primary structure (amino acid sequence) and higher-order structure of the IGF-I receptor. It is thought that the anti-IGF-I receptor antibodies of the present invention, by binding to the CR domain of the IGF-I receptor, activate a homo-type receptor in which the IGF-I receptor forms a dimer, or a hetero-type receptor in which the IGF-I receptor and INSR form a dimer.
[0041] [Anti-IGF-I receptor antibody sequence] The sequence of the anti-IGF-I receptor antibody of the present invention is not particularly limited, as long as it specifically binds to the IGF-I receptor of a vertebrate and has the activity of inducing cell proliferation. However, it is preferable that each CDR sequence has a specific amino acid sequence. Specifically, this is as follows. In the present invention, "identity" of an amino acid sequence means the proportion of identical amino acid residues, and "similarity" means the proportion of identical or similar amino acid residues. Homology and identity can be determined, for example, by the BLAST method (NCBI PBLAST default conditions).
[0042] Here, "similar amino acid residues" refers to amino acid residues having side chains with similar chemical properties (e.g., charge or hydrophobicity). Examples of similar amino acid residues include the following combinations: 1) Amino acid residues with aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine residues. 2) Amino acid residues with aliphatic hydroxyl side chains: serine and threonine residues. 3) Amino acid residues with amide-containing side chains: asparagine and glutamine residues. 4) Amino acid residues with aromatic side chains: phenylalanine, tyrosine, and tryptophan residues. 5) Amino acid residues with basic side chains: lysine, arginine, and histidine residues. 6) Amino acid residues with acidic side chains: aspartic acid and glutamic acid residues. 7) Amino acid residues with sulfur-containing side chains: cysteine and methionine residues.
[0043] In the present invention, the CDR-1 (CDR-H1) sequence of the heavy chain variable region is preferably SEQ ID NO: 3 (SerTyrTrpMetHis) or an amino acid sequence in which one amino acid residue in SEQ ID NO: 3 has been substituted, deleted, or inserted. Furthermore, the CDR-H1 sequence preferably has 80% or more homology with SEQ ID NO: 3. In the present invention, when an amino acid residue (hereinafter referred to as the "first amino acid residue") in a certain amino acid sequence is substituted with another amino acid residue (hereinafter referred to as the "second amino acid residue"), it is more preferable that the first amino acid residue before substitution and the second amino acid residue after substitution are similar in structure and / or properties to each other.
[0044] The CDR-2 (CDR-H2) sequence of the heavy chain variable region is preferably SEQ ID NO: 4 (GluThrAsnProSerAsnSerValThrAsnTyrAsnGluLysPheLysSer) or an amino acid sequence in which one or two amino acid residues in SEQ ID NO: 4 have been substituted, deleted, or inserted. Furthermore, the CDR-H2 sequence preferably has a homology of 82% or more, preferably 88% or more, and even more preferably 94% or more with SEQ ID NO: 4.
[0045] The CDR-3 (CDR-H3) sequence of the heavy chain variable region is preferably SEQ ID NO: 5 (GlyArgGlyArgGlyPheAlaTyr) or an amino acid sequence in which one or two amino acid residues in SEQ ID NO: 5 have been substituted, deleted, or inserted. Furthermore, the CDR-H3 sequence preferably has a homology of 75% or more, more preferably 87% or more, with SEQ ID NO: 5.
[0046] The CDR-1 (CDR-L1) sequence of the light chain variable region is preferably SEQ ID NO: 6 (ArgAlaSerGlnAsnIleAsnPheTrpLeuSer) or an amino acid sequence in which one or two amino acid residues in SEQ ID NO: 6 have been substituted, deleted, or inserted. Furthermore, the CDR-L1 sequence preferably has 81% or more homology with SEQ ID NO: 6, and more preferably 90% or more homology.
[0047] The CDR-2 (CDR-L2) sequence of the light chain variable region is preferably SEQ ID NO: 7 (LysAlaSerAsnLeuHisThr) or an amino acid sequence in which one amino acid residue in SEQ ID NO: 7 has been substituted, deleted, or inserted. Furthermore, the CDR-L2 sequence preferably has 85% or more homology with SEQ ID NO: 7.
[0048] The CDR-3 (CDR-L3) sequence of the light chain variable region is preferably SEQ ID NO: 8 (LeuGlnGlyGlnSerTyrProTyrThr) or an amino acid sequence in which one or two amino acid residues in SEQ ID NO: 8 have been substituted, deleted, or inserted. Furthermore, the CDR-L3 sequence preferably has a homology of 77% or more, more preferably 88% or more, with SEQ ID NO: 8.
[0049] In particular, the anti-IGF-I receptor antibody of the present invention preferably has the following combination of CDR sequences: As the CDR-H1 sequence, the amino acid sequence of SEQ ID NO:3 As the CDR-H2 sequence, the amino acid sequence of SEQ ID NO: 4 As the CDR-H3 sequence, the amino acid sequence of SEQ ID NO:5 As the CDR-L1 sequence, the amino acid sequence of SEQ ID NO: 6 As the CDR-L2 sequence, the amino acid sequence of SEQ ID NO: 7, and The CDR-L3 sequence is the amino acid sequence of sequence 8.
[0050] Methods for identifying the CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, or CDR-L3 sequences in an antibody include, for example, the Kabat method (Kabat et al., The Journal of Immunology, 1991, Vol. 147, No. 5, pp. 1709-1719) and the Chothia method (Al-Lazikani et al., Journal of Molecular Biology, 1997, Vol. 273, No. 4, pp. 927-948). These methods are common general technical knowledge to those skilled in the art, and an overview of them can be found, for example, on the internet homepage of Dr. Andrew C.R. Martin's Group (http: / / www.bioinf.org.uk / abs / ).
[0051] The framework sequences of the immunoglobulins that are the antibodies of the present invention are preferably framework sequences of each class of vertebrate immunoglobulins, particularly those of humans or non-human animals, including guinea pigs, monkeys, rabbits, cows, pigs, horses, sheep, dogs, chickens, mice, and rats.
[0052] The anti-IGF-I receptor antibody of the present invention preferably has specific amino acid sequences as its heavy chain variable region and light chain variable region, specifically as follows.
[0053] The heavy chain variable region is preferably SEQ ID NO: 9, an amino acid sequence in which one or two amino acid residues in SEQ ID NO: 9 have been substituted, deleted, or inserted, or an amino acid sequence having 90% or more homology to SEQ ID NO: 9. The light chain variable region is preferably SEQ ID NO: 10, an amino acid sequence in which one or two amino acid residues in SEQ ID NO: 10 have been substituted, deleted, or inserted, or an amino acid sequence having 90% or more homology to SEQ ID NO: 10. In particular, the anti-IGF-I receptor antibody of the present invention is preferably IGF11-16. That is, it preferably comprises a combination of SEQ ID NO: 9 as the heavy chain variable region and SEQ ID NO: 10 as the light chain variable region.
[0054] Those skilled in the art can design humanized anti-IGF-I receptor antibodies of the present invention by appropriately combining the amino acid sequences of the above-mentioned heavy and light chain CDRs and / or chain variable regions with the amino acid sequences of the heavy and light chain framework regions and / or constant regions of a human antibody. The amino acid sequences of the heavy and light chain framework regions and / or constant regions of the humanized antibody can be selected from, for example, human IgG, IgA, IgM, IgE, and IgD classes or mutants thereof.
[0055] When the anti-IGF-I receptor antibody of the present invention is an IGF-I receptor agonist antibody, the antibody or antigen-binding fragment thereof preferably belongs to the human IgG class or a variant thereof, preferably the human IgG4 subclass, the human IgG1 subclass, or a variant thereof. In one example, a stabilized IgG4 constant region contains a proline at position 241 in the hinge region according to the Kabat system. This position corresponds to position 228 in the hinge region according to the EU numbering system (Kabat et al., Sequences of Proteins of Immunological Interest, DIANE Publishing, 1992; Edelman et al., Proc. Natl. Acad. Sci USA, 63, 78-85, 1969). In human IgG4, this residue is generally serine, and substitution of serine with proline can induce stabilization. In one example, the N297A mutation can be incorporated into the constant region of an IgG1 to minimize its ability to bind to Fc receptors and / or fix complement.
[0056] [Competitive join] The scope of the present invention also includes antibodies that bind competitively to the IGF-I receptor with the anti-IGF-I receptor antibody of the present invention. In the present invention, "competitive binding" refers to the phenomenon in which, when multiple monoclonal antibodies coexist with an antigen, the binding of one antibody to the antigen is inhibited by the binding of another antibody to the antigen. Generally, this can be measured by adding varying amounts (concentrations) of a monoclonal antibody to a fixed amount (concentration) of another monoclonal antibody and measuring the amount (concentration) of the monoclonal antibody that reduces the binding of the former fixed amount to the antigen. The degree of inhibition is expressed as the IC 50 A monoclonal antibody that competitively binds to the anti-IGF-I receptor antibody of the present invention is one that has an IC value of 10 nM when antigen-antibody binding is detected using the anti-IGF-I receptor antibody of the present invention, for example, an IGF11-16 antibody. 50The term "antibody" generally refers to an antibody with a binding activity of 1000 nM or less, preferably 100 nM or less, and even 10 nM or less. When measuring competitive binding, the antibody used can be labeled with an enzyme, fluorescent substance, luminescent substance, radioisotope, etc., and the measurement can be performed by detecting the antibody using a measurement method suitable for the physical and / or chemical properties of the labeled substance.
[0057] [Cross-reactivity] The anti-IGF-I receptor antibodies of the present invention preferably cross-react with IGF-I receptors of other vertebrates. Cross-reactivity refers to the ability of an antibody to bind to an antigen of an animal species other than the animal species (e.g., human) of the IGF-I receptor with which the antibody has an antigen-antibody reaction. The antibody preferably cross-reacts with the IGF-I receptor of a non-human animal, including humans, guinea pigs, monkeys, rabbits, cows, pigs, horses, sheep, dogs, or chickens, other than the animal species with which the antibody has an antigen-antibody reaction. In Example 7, the anti-IGF-I receptor antibody IGF11-16 antibody was shown to bind to the sequence ProSerGlyPheIleArgAsnGlySerGlnSerMet in the CR domain of the human IGF-I receptor. The sequence ProSerGlyPheIleArgAsnGlySerGlnSerMet is conserved in the homologous region of IGF-I receptors from monkeys (cynomolgus monkeys), rabbits, guinea pigs, cattle, sheep, horses, and dogs, and is cross-reactive with IGF-I receptors among these species. Furthermore, in mice and rats, the amino acid sequence of the homologous region is ProSerGlyPheIleArgAsnSerThrGlnSerMet. Obtaining an anti-IGF-I receptor antibody that binds to this region allows the production of antibodies that bind to IGF-I receptors from mice, rats, and other animals and have similar properties and functions to IGF11-16.
[0058] It is also possible to use an animal species that does not cross-react with the anti-IGF-I receptor antibody of the present invention and genetically modify the cells or animals to produce cells or animals that express an IGF-I receptor with which the anti-IGF-I receptor antibody of the present invention cross-reacts.
[0059] [Proliferation-inducing activity of vertebrate-derived cells, and activity of increasing muscle mass and / or body length] In one embodiment of the present invention, the anti-IGF-I receptor antibody has the activity of inducing proliferation of vertebrate-derived cells. Although the existence of IGF-I receptor agonist antibodies has already been known, there have been no reports of antibodies that have shown cell proliferation-inducing activity in primary cultured cells, especially myoblasts. Furthermore, in vitro, the EC of IGF-I was found to be significantly increased. 50 There have been no reports of antibodies that have cell proliferation-inducing activity at doses lower than the above values. The vertebrate-derived cells of the present invention are preferably cells derived from mammals, birds, reptiles, amphibians, or fish, more preferably cells derived from mammals or birds, and even more preferably cells derived from humans, monkeys, rabbits, guinea pigs, cows, pigs, sheep, horses, or dogs. Cell proliferation can be induced by the anti-IGF-I receptor antibodies of the present invention in cells derived from these species that express an IGF-I receptor with which the anti-IGF-I receptor antibodies of the present invention cross-react. Furthermore, cells or animals modified to express a certain type of IGF-I receptor that cross-reacts with the anti-IGF-I receptor antibodies of the present invention, or cells derived from such modified animals, are also included in the vertebrate-derived cells of the present invention.
[0060] Primary cultured cells, established cell lines, or transformed cells of these cells can be used to examine the in vitro proliferation-inducing activity of vertebrate-derived cells. Primary cultured cells are cells isolated from the organs or tissues of an organism and are usually capable of being subcultured for a certain number of passages. Primary cultured cells derived from vertebrates can be obtained from vertebrate organs or tissues by enzyme treatment, physical dispersion, or explant methods. Organs or tissues obtained from vertebrates, or fragments thereof, can also be used. Examples of organs or tissues from which the primary cells are prepared include, preferably, endocrine tissues such as the thyroid gland, parathyroid gland, and adrenal gland; immune tissues such as the appendix, tonsils, lymph nodes, and spleen; respiratory tracts such as the trachea and lungs; digestive tracts such as the stomach, duodenum, small intestine, and large intestine; urinary tracts such as the kidneys and bladder; male reproductive organs such as the vas deferens, testes, and prostate; female reproductive organs such as the breast and fallopian tubes; and muscle tissues such as cardiac muscle and skeletal muscle. The liver, kidney, or digestive tract, or muscle tissue is more preferred, and muscle tissue is even more preferred. The primary cultured cells used to examine the proliferation-inducing activity of anti-IGF-I receptor antibodies of the present invention are cells that express IGF-I receptor and whose proliferation is induced by IGF-I that binds to the IGF-I receptor. A representative example is skeletal muscle myoblasts, which are primary cultured cells isolated from muscle tissue. Primary cultured cells derived from humans or animals can be purchased separately or commercially available and used. Human primary cultured cells can be obtained from institutions or companies such as ATCC (registered trademark), ECACC, Lonza, Gibco (registered trademark), Cell Applications, ScienCell research laboratories, and PromoCell.
[0061] A cell line is a cultured cell that is immortalized from an organism and can grow semipermanently while maintaining certain properties. Cell lines include those derived from non-tumor origins and tumor origins. As vertebrate-derived cell lines for examining the proliferation-inducing activity of the anti-IGF-I receptor antibodies of the present invention, cells that express IGF-I receptor and whose proliferation is induced by IGF-I that binds to the IGF-I receptor are used. Examples of cell lines that express IGF-I receptor and whose cell proliferation is induced by IGF-I include, but are not limited to, human neuroblastoma SH-SY5Y, human epidermal keratinocyte cell line HaCaT, human alveolar basal epithelial adenocarcinoma cell line A549, human colon adenocarcinoma cell line Caco-2, human hepatoma-derived cell line HepG2, human cervical cancer cell line Hela, human cervical cancer cell line SiHa, human breast cancer cell line MCF7, human pluripotent embryonal carcinoma NTERA-2, and human osteosarcoma cell line U-2-OS.
[0062] Furthermore, cells for which proliferation induction by the anti-IGF-I receptor antibodies of the present invention is examined also include transformed cells of primary cultured cells or established cell lines. Examples of such transformed cells include iPS cells prepared from primary cultured cells and cells or tissues induced to differentiate from such iPS cells. Other transformed cells also include cells in which genes are introduced into primary cultured cells or established cell lines and the genes are expressed transiently or sustainedly. The genes introduced and expressed in such cells may include the genes for human or other species of IGF-I receptor.
[0063] Methods for examining cell proliferation induction by the anti-IGF-I receptor antibody of the present invention in vertebrate-derived cells include cell counting, DNA synthesis, and changes in metabolic enzyme activity. Cell counting can be performed using a hemocytometer or a cell counting device such as a Coulter counter. DNA synthesis can be measured by measuring the incorporation of [H]-thymidine or 5-bromo-2'-deoxyuridine (BrdU). Changes in metabolic enzyme activity can be measured using the MTT method, XTT method, or WST method. Those skilled in the art can also use other methods as appropriate. Cell proliferation induction activity can be determined by determining whether cell proliferation is increased when the cultured cells used in the test are reacted with the anti-IGF-I receptor antibody of the present invention compared to when the antibody is not reacted. In this case, it is convenient to evaluate the activity by reacting IGF-I, the ligand for the natural IGF-I receptor, under the same conditions as the control for the induction activity and then measuring the activity.
[0064] When the cultured cells to be tested are reacted with varying concentrations of the anti-IGF-I receptor antibody of the present invention and IGF-I, the concentration at which 50% of the maximum proliferation activity is exhibited is defined as EC 50 When the proliferation activity is evaluated using human skeletal muscle myoblasts, the cell proliferation-inducing activity of the anti-IGF-I receptor antibody of the present invention preferably has an EC value equivalent to that of IGF-I. 50 value, and more preferably the EC value of the anti-IGF-I receptor antibody of the present invention. 50 The EC value of the anti-IGF-I receptor antibody of the present invention is 1 / 10 or less, more preferably 1 / 20 or less, of that of IGF-I. 50 The EC value of the anti-IGF-I receptor antibody of the present invention was 1 / 50 or less of that of IGF-I. 50 The value is preferably 0.5 nmol / L or less, more preferably 0.3 nmol / L or less, and even more preferably 0.1 nmol / L or less.
[0065] The in vivo proliferation-inducing activity of vertebrate-derived cells can be examined by parenterally administering the anti-IGF-I receptor antibody of the present invention to the vertebrate and measuring changes in the weight, size, cell number, etc. of the whole individual or the organ or tissue in the administered individual, or by using an animal transplanted with the vertebrate cells and measuring changes in the weight, size, cell number, etc. of a graft containing the transplanted vertebrate cells in the transplanted individual. Measurements of the whole individual include body weight, body length, limb circumference, etc., body composition measurement using impedance analysis, creatinine, height coefficient, etc. Measurements of organs, tissues, or grafts in individuals include directly recovering the target organ, tissue, or graft in non-human animals and calculating the weight, size, and cell number contained therein. Non-invasive methods for measuring organs, tissues, or grafts in individuals include image analysis using X-ray images, CT, or MRI, and contrast methods using isotope or fluorescent tracers. When the target tissue is skeletal muscle, changes in muscle strength, etc., are used as indicators. In addition, those skilled in the art can use other appropriate methods to examine the effect of the anti-IGF-I receptor antibody of the present invention on the in vivo proliferation-inducing activity of vertebrate-derived cells. The in vivo cell proliferation-inducing activity of the anti-IGF-I receptor antibody of the present invention can be examined by comparing the results of measurements, etc., performed by the methods described above, between individuals administered with the anti-IGF-I receptor antibody of the present invention and individuals administered with an antibody other than the anti-IGF-I receptor antibody of the present invention or another control substance.
[0066] The anti-IGF-I receptor antibody of the present invention has the characteristic of having a longer cell proliferation-inducing effect relative to the time of contact with cells than native IGF-I, thereby exhibiting improved durability. In the in vitro cell proliferation-inducing activity test in Example 12, native IGF-I lost its cell proliferation-inducing activity when contacted with cells and then washed with IGF-I-free medium, whereas the anti-IGF-I receptor antibody, IGF11-16 antibody of the present invention, maintained its cell proliferation-inducing activity even when contacted with cells and then washed with IGF11-16 antibody-free medium. Furthermore, in Example 16, the blood kinetics of IGF-I and the anti-IGF-I receptor antibody, IGF11-16 antibody of the present invention, were compared. Approximately 50% or more of native IGF-I was eliminated from the blood within 24 hours after administration to animals, whereas more than 60% of the IGF11-16 antibody remained in the blood even 48 hours after administration to animals, demonstrating its long-term presence in the blood. These findings demonstrate that the anti-IGF-I receptor antibody of the present invention exhibits a long-lasting cell proliferation-inducing effect in vitro and in vivo.
[0067] Furthermore, the in vivo effects of the anti-IGF-I receptor antibody of the present invention include an effect of increasing muscle mass and / or body length. IGF-I acts not only on the proliferation and differentiation of myoblasts in skeletal muscles as described above, but also on thickening muscle fibers, and it is believed that these comprehensive effects have the effect of increasing muscle mass. When administered to an animal, the anti-IGF-I receptor antibody of the present invention also has the effect of increasing the muscle mass of the animal, similar to IGF-I. The effect of an IGF-I receptor agonist antibody is to increase muscle mass in vivo. The anti-IGF-I receptor antibody of the present invention is the first to be shown to have this property.
[0068] Methods for measuring the muscle mass-increasing effect of the anti-IGF-I receptor antibody of the present invention include, for whole-individual measurements, measurements of body weight, body length, limb circumference, etc., body composition measurement by impedance analysis, creatinine, height index, etc., as well as image analysis by CT or MRI, and contrast methods using isotope or fluorescent tracers. Changes in muscle strength, etc., can also be used as an indicator. For non-human animals, methods such as directly collecting muscle and measuring its weight and size are also possible. The muscle mass-increasing effect can be evaluated by comparing the increase in muscle mass between individuals administered with the anti-IGF-I receptor antibody of the present invention and individuals not administered the antibody, or by comparing the muscle mass in a single individual before and after administration of the anti-IGF-I receptor antibody of the present invention. The effect of increasing muscle mass can be determined by observing a difference in muscle mass increase following administration of the anti-IGF-I receptor antibody of the present invention. The effect of administering the anti-IGF-I receptor antibody of the present invention can be determined by observing a difference in muscle mass between individuals administered with and without the anti-IGF-I receptor antibody of the present invention, or between individuals before and after administration of the anti-IGF-I receptor antibody of the present invention, preferably 103% or more, more preferably 104% or more. IGF-I is also involved in bone growth and increases body length (height in humans). Therefore, the anti-IGF-I receptor antibody of the present invention also has the effect of increasing body length when administered to animals. The effect of increasing body length due to the anti-IGF-I receptor antibody of the present invention can be measured by measuring the individual's weight, body length, limb circumference, etc.
[0069] [Effects on glucose uptake in vertebrate-derived cells and / or blood glucose levels in animals] In one embodiment of the present invention, the anti-IGF-I receptor antibody has the characteristic of not affecting the intracellular glucose uptake in differentiated muscle cells derived from vertebrates and / or the blood glucose level in vertebrates. IGF-I is known to increase the cellular glucose uptake and lower the blood glucose level as part of its agonistic effect on the IGF-I receptor. However, the anti-IGF-I receptor antibody of the present invention, which functions as an IGF-I receptor agonist antibody, does not exhibit the proliferation-inducing activity in cells, as measured by in vitro EC 50 The unexpected effect is that the antibody does not induce glucose uptake in differentiated muscle cells even at doses 100 times or more the effective dose for inducing muscle mass increase when parenterally administered to animals, and does not alter blood glucose levels even at doses 10 times or more the effective dose. Furthermore, as an IGF-I receptor antagonist antibody, the characteristic of not affecting glucose uptake in differentiated muscle cells derived from vertebrate cells and / or blood glucose levels in vertebrates is advantageous in avoiding hyperglycemia and other problems that have been unmet when using conventional IGF-I receptor antagonist antibodies in human therapy. The vertebrate-derived cells of the present invention are preferably cells derived from mammals, birds, reptiles, amphibians, or fish, more preferably cells derived from mammals or birds, and even more preferably cells derived from humans, monkeys, rabbits, guinea pigs, cows, pigs, sheep, horses, or dogs. Furthermore, vertebrate-derived cells of the present invention also include cells or animals that have been modified to express an IGF-I receptor derived from a vertebrate species that is cross-reactive with the anti-IGF-I receptor antibody of the present invention, or an IGF-I receptor that has been mutated to have binding ability, or cells derived from such modified animals.
[0070] Primary cultured cells, established cell lines, or transformed cells of these cells can be used to examine the in vitro glucose uptake characteristics of vertebrate-derived cells harboring anti-IGF-I receptor antibodies of the present invention. Primary cultured cells are cells isolated from organs or tissues of living organisms and are generally capable of being subcultured for a certain number of passages. Primary cultured cells derived from vertebrates can be obtained from vertebrate organs or tissues by enzyme treatment, physical dispersion, explantation, or other methods. Preferred organs and tissues from which the primary cells are prepared include endocrine tissues such as the thyroid gland, parathyroid gland, and adrenal gland; immune tissues such as the appendix, tonsils, lymph nodes, and spleen; respiratory organs such as the trachea and lungs; digestive organs such as the stomach, duodenum, small intestine, and large intestine; urinary organs such as the kidneys and bladder; male reproductive organs such as the vas deferens, testes, and prostate; female reproductive organs such as the breast and fallopian tubes; and muscle tissues such as cardiac muscle and skeletal muscle, with the liver, kidneys, or digestive organs or muscle tissue being more preferred, and muscle tissue being even more preferred.
[0071] The primary cultured cells used to examine the characteristic of the anti-IGF-I receptor antibody of the present invention that does not affect intracellular glucose uptake are cells that express IGF-I receptor and in which intracellular glucose uptake is induced by IGF-I that binds to the IGF-I receptor. Representative examples include differentiated muscle cells obtained by differentiating skeletal muscle myoblasts, which are primary cultured cells isolated from muscle tissue.
[0072] The differentiated muscle cells of the present invention refer to differentiated muscle cells, including those that have not yet fully differentiated. For convenience, the term "differentiated muscle cells" used in the present invention refers to cells approximately 6 days after the start of differentiation. Primary cultured cells derived from humans or animals can be purchased and used as separate or commercially available cells. Human primary cultured cells can be obtained from institutions or companies such as ATCC (registered trademark), ECACC, Lonza, Gibco (registered trademark), Cell Applications, ScienCell research laboratories, and PromoCell.
[0073] A cell line is a cultured cell that is derived from an organism and is immortalized to allow semi-permanent proliferation while maintaining certain properties. Cell lines include those derived from non-tumor origin and tumor origin. As a vertebrate-derived cell line for investigating the effect of the anti-IGF-I receptor antibody of the present invention on intracellular glucose uptake, cells that express an IGF-I receptor and whose intracellular glucose uptake is induced by IGF-I that binds to the IGF-I receptor are used. Examples of cells that express an IGF-I receptor and whose intracellular glucose uptake is induced by IGF-I include, but are not limited to, skeletal muscle cells, adipocytes, and epidermal keratinocytes.
[0074] Furthermore, cells for which the effect of the anti-IGF-I receptor antibody of the present invention on intracellular glucose uptake can be examined include transformed cells of primary cultured cells or established cell lines. Examples of such transformed cells include iPS cells prepared from primary cultured cells and cells induced to differentiate from such iPS cells. Other transformed cells include cells obtained by introducing a gene into primary cultured cells or established cell lines and expressing the gene transiently or sustainably. The gene introduced and expressed in such cells may include a gene encoding an IGF-I receptor from a human or other species.
[0075] Methods for examining the effect of the anti-IGF-I receptor antibody of the present invention on glucose uptake in vertebrate-derived cells include measuring intracellular glucose concentration, measuring the amount of intracellular uptake of a glucose-related tracer substance, and measuring changes in glucose transporters. Methods for measuring glucose concentration include absorbance measurement methods such as enzymatic methods. Methods for measuring the amount of intracellular uptake of a glucose-related tracer substance include measuring the amount of [H]-2'-deoxyglucose uptake. Methods for observing changes in glucose transporters include cell immunostaining and Western blotting. However, those skilled in the art can also use other methods as appropriate. The effect on intracellular glucose uptake can be determined by determining whether the intracellular glucose uptake when the anti-IGF-I receptor antibody of the present invention is reacted with the cultured cells used in the test is the same as that when the antibody is not reacted. In this case, it is convenient to evaluate the activity by reacting IGF-I, the original ligand of the IGF-I receptor, under the same conditions as a control for the inducing activity and measuring it.
[0076] The cultured cells to be tested were reacted with varying concentrations of the anti-IGF-I receptor antibody of the present invention and IGF-I, and the glucose uptake into cells in the untreated group was taken as 100%. When glucose uptake was assessed using differentiated human muscle cells, the glucose uptake of the anti-IGF-I receptor antibody of the present invention is preferably equal to or less than the glucose uptake of IGF-I at the same concentration, more preferably equal to or less than 110% of the untreated group, and even more preferably equal to 100% of the untreated group. Furthermore, when glucose uptake was assessed using differentiated human muscle cells, the glucose uptake when 100 nmol / L of the anti-IGF-I receptor antibody of the present invention was added was preferably equal to or less than 110%, more preferably equal to or less than 105%, and even more preferably 95 to 100%.
[0077] In vivo glucose uptake in vertebrate-derived cells can be examined by parenterally administering the anti-IGF-I receptor antibody of the present invention to the vertebrate and measuring changes in the glucose content in the organs or tissues of the administered individual. Measurements of the entire individual can be performed by measuring blood glucose levels or hemoglobin A1C, which uses glycated proteins as an indicator. Measurements of glucose uptake in individual organs or tissues can be performed by directly recovering the target organ or tissue in non-human animals and calculating the glucose content or tracer. Non-invasive methods for measuring glucose uptake in individual organs or tissues include image analysis using X-ray images, CT, or MRI, and contrast methods using isotope or fluorescent tracers. When the target tissue is skeletal muscle, glucose clamps and other methods can also be used as indicators. Those skilled in the art can also use other appropriate methods to examine the effect of the anti-IGF-I receptor antibody of the present invention on in vivo glucose uptake in vertebrate-derived cells.
[0078] Furthermore, the anti-IGF-I receptor antibodies of the present invention are characterized in that, when parenterally administered to a vertebrate, they do not alter the blood glucose level of the vertebrate, even at the same dose, preferably at a dose 10 times or more higher than the effective dose for inducing an increase in muscle mass in the vertebrate. Animals used to examine changes in blood glucose levels in vertebrates in response to anti-IGF-I receptor antibodies of the present invention are preferably mammals, birds, reptiles, amphibians, or fish, more preferably mammals or birds, and even more preferably humans, monkeys, rabbits, guinea pigs, cows, pigs, sheep, horses, or dogs. Animals used to examine changes in blood glucose levels in vertebrates in response to anti-IGF-I receptor antibodies of the present invention also include animals modified to express a certain type of IGF-I receptor that cross-reacts with the anti-IGF-I receptor antibodies of the present invention. Blood glucose levels can be measured using invasive methods such as colorimetry and electrode methods, enzymes used for detection such as the glucose oxidase (GOD) method and the glucose dehydrogenase (GDH) method, and non-invasive methods such as optical measurement. Those skilled in the art can also select other methods as appropriate. The normal fasting blood glucose range for humans is 100 mg / dL to 109 mg / dL. Adverse events caused by drug administration on blood glucose levels (Common Terminology Criteria for Adverse Events v4.0) are defined as hypoglycemia when blood glucose levels fall below the range of 77 mg / dL-55 mg / dL, and hyperglycemia when blood glucose levels rise above the range of 109 mg / dL-160 mg / dL. Drug administration having no effect on blood glucose levels means that blood glucose levels after drug administration are between 55 mg / dL and 160 mg / dL, more preferably between 77 mg / dL and 109 mg / dL. However, normal blood glucose levels and the range of their fluctuation vary depending on the animal to which the antibody is administered, and even in humans, blood glucose levels at the time of administration are not necessarily within the normal range. Therefore, in the present invention, not fluctuating the blood glucose levels of a vertebrate means that the blood glucose levels of a vertebrate administered with the anti-IGF-I receptor antibody of the present invention change by preferably within 30%, more preferably within 20%, and even more preferably within 10%.
[0079] [Method for producing anti-IGF-I receptor antibody] The antibody of the present invention can be obtained using techniques well known to those skilled in the art. The antibody of the present invention can be a polyclonal antibody or a monoclonal antibody (Milstein et al., Nature (England), October 6, 1983, Vol. 305, No. 5934, pp. 537-540). For example, polyclonal antibodies can be recovered from the serum of a mammal sensitized with the IGF-I receptor peptide of SEQ ID NO: 2 as an antigen. When a peptide is used as an antigen, the antigen can be bound to a carrier protein such as BSA or KLH, or to polylysine. A specific example of a peptide used as an antigen is ProSerGlyPheIleArgAsnGlySerGlnSerMet, a partial sequence of SEQ ID NO: 2, but is not limited thereto. The monoclonal antibody of the present invention can be recovered from the culture of a hybridoma obtained by extracting immune cells from a mammal sensitized with the antigen and fusing them with myeloma cells, etc., followed by cloning the hybridoma. A method for obtaining such a monoclonal antibody is described in Example 1, and examples of the monoclonal antibody obtained thereby include, but are not limited to, a monoclonal antibody (IGF11-16) having the VH amino acid sequence of SEQ ID NO: 9 and the VL amino acid sequence of SEQ ID NO: 10.
[0080] It is also possible to obtain nucleic acid molecules having gene sequences encoding the amino acid sequences of the antibody proteins from the obtained monoclonal antibodies, and such nucleic acid molecules can be used to produce antibodies by genetic engineering. Using the genetic information of the antibody, such as information on the H chain, L chain, their variable regions, and CDR sequences, to modify the antibody to improve its binding ability or specificity, or to produce antibodies with a structure suitable for use as a therapeutic agent by modifying an antibody from an animal such as a mouse into a human antibody, are well known techniques to those skilled in the art. Human monoclonal antibodies can also be obtained by using non-human transgenic animals into which human antibody genes have been introduced as animals to be sensitized to antigens. Alternatively, as a method that does not require sensitization of animals, those skilled in the art can use a phage library expressing human antibody variable regions or portions thereof (human antibody phage display) to obtain antibodies that specifically bind to corresponding antigens or phage clones consisting of specific amino acid sequences, and then produce human antibodies from that information (see, for example, the review by Taketo Tanaka et al., Keio J. Med., Vol. 60, pp. 37-46).
[0081] Furthermore, the aforementioned monoclonal antibodies can be produced by culturing hybridomas producing the desired antibodies and purifying the antibodies from the resulting culture supernatants using standard methods. Another production method involves obtaining antibody-encoding genes, more specifically genes encoding the heavy and / or light chains of immunoglobulins, from hybridomas producing the desired antibodies or phage clones obtained by human antibody phage display, constructing vectors for expressing the genes, and introducing the vectors into host cells (mammalian cells, insect cells, microorganisms, etc.) to produce the antibodies. Those skilled in the art can use known techniques to genetically modify the genes encoding the immunoglobulin heavy and / or light chains to introduce desired traits, and to produce humanized antibodies, antibody chimeric proteins, small molecules, and scaffold antibodies using structural information on the variable regions or CDR regions of the immunoglobulin heavy and / or light chains. Furthermore, for the purpose of improving antibody performance or avoiding side effects, modifications can be made to the structure of the antibody constant region or to the sugar chain portion, as appropriate, using techniques well known to those skilled in the art.
[0082] The anti-IGF-I receptor antibody of the present invention can be obtained using techniques well known to those skilled in the art. Specifically, the anti-IGF-I receptor antibody of the present invention is usually a monoclonal antibody (Milstein et al., Nature, 1983, Vol. 305, No. 5934, pp. 537-540), and such a monoclonal antibody can be prepared, for example, by the following method.
[0083] For example, a nucleic acid molecule encoding the amino acid sequence of the immunoglobulin heavy and / or light chain of the anti-IGF-I receptor antibody of the present invention is prepared. The nucleic acid molecule may then be introduced into various vectors or plasmids to prepare vectors or plasmids containing the nucleic acid molecule. Next, host cells are transformed with the nucleic acid molecule, vector, or plasmid. Examples of host cells include eukaryotic cells such as mammalian cells, insect cells, yeast cells, or plant cells, or bacterial cells. The transformed host cells are then cultured under appropriate conditions for producing the anti-IGF-I receptor antibody of the present invention. If necessary, the resulting anti-IGF-I receptor antibody of the present invention may be isolated from the host cells. The various techniques used in these procedures are all well known to those skilled in the art.
[0084] Furthermore, methods using animal sensitization include using non-human transgenic animals into which a human antibody gene has been introduced as the animal to be sensitized to the antigen, sensitizing the animal with IGF-I receptor and / or a partial peptide thereof, etc., extracting immune cells, and fusing them with myeloma cells, etc. to obtain hybridomas, cloning the resulting hybridomas, and purifying and recovering the antibodies from the resulting culture supernatant by standard methods. Methods for obtaining such monoclonal antibodies are described, for example, in WO 2013 / 180238.
[0085] Alternatively, a technique can be used in which a phage library expressing the variable region of a desired humanized antibody or a portion thereof (human antibody phage display) is used to obtain antibodies that specifically bind to a corresponding antigen or phage clones consisting of a specific amino acid sequence, and then humanized antibodies are produced from this information (see, for example, the review by Taketo Tanaka et al., The Keio Journal of Medicine, Vol. 60, pp. 37-46).
[0086] Here, those skilled in the art can use known techniques to produce antibody chimeric proteins, low-molecular-weight antibodies, scaffold antibodies, etc. by genetically modifying genes encoding immunoglobulin heavy and / or light chains to introduce desired traits or by using structural information on the variable regions or CDR regions of immunoglobulin heavy and / or light chains. Furthermore, for the purpose of improving antibody performance or avoiding side effects, modifications to the structure of the antibody constant region or modifications to the sugar chain portion can also be appropriately performed using techniques well known to those skilled in the art.
[0087] [Drugs containing anti-IGF-I receptor antibodies] The anti-IGF-I receptor antibodies of the present invention can be used as therapeutic or preventive agents for conditions associated with IGF-I or diseases caused by the action on the IGF-I receptor. Specifically, IGF-I-related conditions or diseases that can be treated or prevented with an IGF-I receptor agonist antibody include disuse muscle atrophy, short stature, liver cirrhosis, liver fibrosis, diabetic nephropathy, chronic renal failure, Larondosis, aging, intrauterine growth retardation (IUGR), cardiovascular protection, diabetes, insulin resistance, metabolic syndrome, osteoporosis, cystic fibrosis, myotonic dystrophy, AIDS-associated sarcopenia, HIV-associated fat redistribution syndrome, Crohn's disease, Werner's syndrome, X-linked combined immunodeficiency, hearing loss, anorexia nervosa and retinopathy of prematurity, Turner's syndrome, Prader-Willi syndrome, Silver-Russell syndrome, idiopathic short stature, obesity, multiple sclerosis, ulcerative colitis, low muscle mass, myocardial ischemia, and low bone mineral density. Diseases that can be treated or prevented with an IGF-I receptor antagonist antibody include neuroblastoma, rhabdomyosarcoma, osteosarcoma, and pediatric Cancer, acromegaly, ovarian cancer, pancreatic cancer, benign prostatic hyperplasia, breast cancer, prostate cancer, bone cancer, lung cancer, colorectal cancer, cervical cancer, synovial sarcoma, bladder cancer, gastric cancer, Wilms' tumor, diarrhea associated with metastatic carcinoid and vasoactive intestinal peptide-secreting tumors, vipoma, Werner-Morrison syndrome, Beckwith-Wiedemann syndrome, kidney cancer, renal cell carcinoma, transitional cell carcinoma, Ewing's sarcoma, leukemia, acute lymphoblastic leukemia Examples of anti-IGF-I receptor antibodies of the present invention include leukemia, brain tumors, glioblastomas, non-glioblastoma brain tumors, meningiomas, pituitary adenomas, vestibular schwannomas, primitive neuroectodermal tumors, medulloblastomas, astrocytomas, oligodendrogliomas, ependymoma, choroid plexus papillomas, gigantism, psoriasis, atherosclerosis, vascular smooth muscle restenosis, inappropriate microvascular proliferation, diabetic retinopathy, Graves' disease, systemic lupus erythematosus, chronic thyroiditis, myasthenia gravis, autoimmune thyroiditis, and Behçet's disease. The anti-IGF-I receptor antibodies of the present invention are particularly preferred for use as therapeutic or preventive agents for disuse muscle atrophy and / or dwarfism. Furthermore, the anti-IGF-I receptor antibodies of the present invention are advantageous in that they do not cause fluctuations in blood glucose levels upon administration.
[0088] Drugs containing the anti-IGF-I receptor antibodies of the present invention may be formulated in the form of pharmaceutical compositions containing, in addition to the anti-IGF-I receptor antibodies of the present invention, pharmaceutically acceptable carriers and / or other additives. Formulations using pharmaceutically acceptable carriers and / or other additives can be carried out, for example, by the methods described in University of the Sciences in Philadelphia, "Remington: The Science and Practice of Pharmacy, 20th Edition," Lippincott Williams & Wilkins, 2000. One form of such therapeutic or prophylactic agents is provided as a liquid preparation prepared by dissolving, suspending, or emulsifying in a sterile aqueous or oily liquid, or as a lyophilized product. Examples of such solvents or dissolving solutions as diluents include aqueous liquids such as distilled water for injection and physiological saline, and when an osmolality adjuster (e.g., D-glucose, D-sorbitol, D-mannitol, sodium chloride, etc.) is added, a suitable solubilizing agent such as alcohol (e.g., ethanol), polyalcohol (e.g., propylene glycol, polyethylene glycol), nonionic surfactant (e.g., polysorbate 80, polyoxyethylene hydrogenated castor oil 50), etc. may also be used in combination. In addition, oily liquids may be used as solvents or dissolving solutions, such as sesame oil and soybean oil, and may also be used in combination with solubilizing agents such as benzyl benzoate and benzyl alcohol.In such formulations, additives such as buffers (e.g., phosphate buffers, acetate buffers), soothing agents (e.g., benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (e.g., human serum albumin, polyethylene glycol, etc.), preservatives (e.g., ascorbic acid, erythorbic acid, and their salts, etc.), coloring agents (e.g., copper chlorophyll, β-carotene, Red No. 2, Blue No. 1, etc.), preservatives (e.g., parahydroxybenzoic acid esters, phenol, benzethonium chloride, benzalkonium chloride, etc.), thickeners (e.g., hydroxypropyl cellulose, carboxymethyl cellulose, and their salts, etc.), stabilizers (e.g., human serum albumin, mannitol, sorbitol, etc.), and flavoring agents (e.g., menthol, citrus flavors, etc.) may be used as appropriate. Another example is a therapeutic or preventive agent for application to the mucosa. In these preparations, additives such as adhesives, adhesion enhancers, thickeners, and viscosifiers (e.g., mucin, agar, gelatin, pectin, carrageenan, sodium alginate, locust bean gum, xanthan gum, tragacanth gum, gum arabic, chitosan, pullulan, waxy starch, sucralfate, cellulose, and derivatives thereof (e.g., hydroxypropylmethylcellulose, polyglycerol fatty acid esters, acrylic acid (meth)acrylic acid alkyl copolymers or salts thereof, polyglycerol fatty acid esters, etc.) may be contained, primarily for the purpose of imparting properties such as adsorption and retention to the mucosa. However, the form, solvent, and additives of the therapeutic or preventive agent administered to the living body are not limited to these and can be appropriately selected by one skilled in the art.
[0089] A drug containing an anti-IGF-I receptor antibody of the present invention may contain other existing drugs (active ingredients) in addition to the anti-IGF-I receptor antibody of the present invention. Furthermore, a drug containing an anti-IGF-I receptor antibody of the present invention may be combined with other existing drugs to form a kit. Active ingredients to be combined with an IGF-I receptor agonist antibody include growth hormone or analogs thereof, insulin or analogs thereof, IGF-II or analogs thereof, anti-myostatin antibodies, myostatin antagonists, anti-activin type IIB receptor antibodies, activin IIB receptor antagonists, soluble activin type IIB receptor or analogs thereof, ghrelin or analogs thereof, follistatin or analogs thereof, beta-2 agonists, and selective androgen receptor modulators.In addition, the active ingredients to be combined with the IGF-I receptor antagonist antibody include corticosteroids, antiemetics, ondansetron hydrochloride, granisetron hydrochloride, metroclopramide, domperidone, haloperidol, cyclizine, lorazepam, prochlorperazine, dexamethasone, levomepromazine, tropisetron, cancer vaccines, GM-CSF inhibitors, GM-CSF DNA vaccines, cell-based vaccines, dendritic cell vaccines, recombinant viral vaccines, heat shock protein (HSP) vaccines, allogeneic tumor vaccines, autologous tumor vaccines, analgesics, ibuprofen, naproxen, choline magnesium trisalicylate, oxycodone hydrochloride, antiangiogenic drugs, antithrombotic drugs, anti-PD-1 antibodies, nivolumab, pembrolizumab, anti-PD-L1 antibodies, atezolizumab, anti-CTLA4 antibodies, ipilimumab, anti-CD20 antibodies, rituximab, anti-HER2 antibodies, trastuzumab, anti-CCR4 antibodies, mogamulizumab, anti-VEGF antibodies, bevacizumab, anti-VEGF receptor antibodies, soluble VEGF receptor fragments, anti-TWEAK antibodies, anti-TWEAK receptor antibodies, soluble TWEAK receptor fragments, AMG 706, AMG 386, antiproliferative drugs, farnesyl protein transferase inhibitors, αvβ3 inhibitors, αvβ5 inhibitors, p53 inhibitors, Kit receptor inhibitors, ret receptor inhibitors, PDGFR inhibitors, growth hormone secretion inhibitors, angiopoietin inhibitors, tumor-infiltrating macrophage inhibitors, c-fms inhibitors, anti-c-fms antibodies, CSF-1 inhibitors, anti-CSF-1 antibodies, soluble c-fms fragments, pegvisomant, gemcitabine, panitumumab, irinotecan, and SN-38. The doses of drugs other than the anti-IGF-I receptor antibody to be combined can be those used in conventional treatments, but may be increased or decreased depending on the situation.
[0090] The therapeutic or prophylactic agent of the present invention can be administered parenterally for the purpose of alleviating symptoms. In the case of parenteral administration, for example, it can be a nasal preparation, and liquid preparations, suspensions, solid preparations, etc. can be selected. Another form of parenteral administration can be an injection, and examples of the injection include subcutaneous injections, intravenous injections, drip injections, intramuscular injections, intraventricular injections, and intraperitoneal injections. Other examples of preparations used for parenteral administration include suppositories, sublingual preparations, transdermal preparations, and transmucosal preparations other than nasal preparations. Furthermore, it can also be administered locally intravascularly by being contained in or applied to a stent or intravascular embolization agent.
[0091] The dosage of the therapeutic or prophylactic agent of the present invention varies depending on the patient's age, sex, weight, symptoms, therapeutic effect, administration method, treatment time, and the type of active ingredient contained in the pharmaceutical composition. However, typically, an adult can receive a single dose of 0.1 mg to 1 g of the active ingredient, preferably 0.5 mg to 300 mg, once every one to four weeks or once every one to two months. Therefore, it is preferably administered at a frequency of once a week or less. However, the dosage and frequency of administration vary depending on various conditions, and therefore, a dosage and frequency less than the above-mentioned range may be sufficient, or a dosage and frequency greater than the above-mentioned range may be required.
[0092] [Use in non-human animals] In certain embodiments, the anti-IGF-I receptor antibodies of the present invention can be used for livestock or veterinary purposes in animals other than humans. Animals in which the anti-IGF-I receptor antibodies of the present invention can be used for livestock or veterinary purposes are preferably non-human mammals, birds, reptiles, amphibians, or fish, more preferably non-human mammals or birds, and even more preferably monkeys, rabbits, guinea pigs, cows, pigs, sheep, horses, or dogs. Currently, bovine growth hormone and porcine growth hormone are used to increase milk production in cows and promote the growth of piglets, and these effects are thought to be due to the action of IGF-I, the expression of which is induced by growth hormone (H. Jiang and X. Ge, Journal of Animal Science, Vol. 92, pp. 21-29, 2014). Therefore, the anti-IGF-I receptor antibodies of the present invention can be used, by utilizing their agonistic activity, to similarly enhance animal milk production and promote fetal and postnatal growth. Other examples of applications in which the anti-IGF-I receptor antibodies of the present invention can be used include, but are not limited to, increasing muscle mass or the muscle-to-fat weight ratio in animals, efficiently converting ingested feed into body tissue, increasing reproductive efficiency and enhancing reproductive capacity for species preservation, and treating wasting symptoms in animals due to trauma or wasting diseases. Furthermore, by utilizing another aspect of their antagonistic activity, the anti-IGF-I receptor antibodies of the present invention can also be used for treating malignant tumors in animals, controlling reproductive frequency, controlling individual growth, and other applications. When using the anti-IGF-I receptor antibodies of the present invention, those skilled in the art can appropriately modify their structure before use, for example, by modifying the amino acid sequence of the antibody framework or constant region to suit the animal to be administered, thereby reducing immunogenicity.
[0093] [Cell culture method using anti-IGF-I receptor antibody] IGF-I or its derivatives are widely used in cell culture techniques for maintaining, proliferating, and / or differentiating vertebrate-derived cells in vitro, and are commercially available as cell culture reagents. Due to stability issues and other factors, the effectiveness of IGF-I may weaken over time during long-term culture. Therefore, appropriate concentration adjustments and other measures are necessary for stable cell culture. Furthermore, since IGF-I induces glucose uptake into cells, an increase in intracellular glucose concentration may induce changes in cellular metabolism and characteristics, or a decrease in the glucose concentration in the culture medium may alter the culture environment. The anti-IGF-I receptor antibodies of the present invention are characterized by being more stable than IGF-I, inducing cell proliferation for a longer period after contact with cells, exhibiting cell proliferation-inducing activity at lower concentrations than IGF-I, and not inducing intracellular glucose uptake. The anti-IGF-I receptor antibodies of the present invention can be added in appropriate amounts to the culture medium for cell culture, or by being adsorbed or immobilized on a solid phase in the culture vessel, thereby reducing the amount used and effectively inducing cell proliferation of cells attached to the solid phase. In the present invention, the vertebrate-derived cells are preferably cells derived from mammals, birds, reptiles, amphibians, or fish, more preferably cells derived from mammals or birds, and even more preferably cells derived from humans, monkeys, rabbits, guinea pigs, cattle, pigs, sheep, horses, or dogs. Furthermore, primary cultured cells, established cell lines, or transformed cells of these cells, cells derived from genetically modified animals, and the like, can be used as the cells. Furthermore, organs and tissues derived from vertebrates or genetically modified vertebrates can also be cultured using the anti-IGF-I receptor antibodies of the present invention. The anti-IGF-I receptor antibodies of the present invention can be used in cell culture for substance production or in the culture process for cell therapy or regenerative medicine using the cells themselves. [Example]
[0094] [Example 1] Preparation of mouse monoclonal antibodies Mouse monoclonal antibodies can be produced using the hybridoma method of Kohler et al. (Nature 256:495-497, 1975). IGF-I receptor agonist antibodies were produced by immunizing mice with cells expressing human IGF-I receptors and using standard hybridoma techniques. All animal experiments were performed in accordance with institutional regulations. Standard methods were used to fuse spleen-derived cells harvested from mice with a mouse myeloma cell line (P3U1). Hybridomas were selected using a medium containing hypoxanthine, aminopterin, and thymidine. Hybridoma culture media were used to assess binding activity using Cell ELISA with IGF-I receptor-expressing cells and to assess activation of the IGF-I receptor intracellular tyrosine kinase using PathHunter®, and wells containing positive hybridomas were selected. Hybridomas contained in these wells were single cloned by limiting dilution. This single cloned positive hybridoma was cultured in serum-free medium, and a monoclonal antibody was purified from the culture medium using a Protein A column (Ab-Capcher, Proteinova). Using this monoclonal antibody, we identified the IGF-I receptor agonist antibody IGF11-16 by assessing its activity in inhibiting human myoblast proliferation.
[0095] [Example 2] Determination of antibody isotype To determine the antibody isotype of the IGF-I receptor agonist antibody, ELISA was performed using an antibody specific for the antibody isotype. Anti-mouse IgG antibody (TAGO, 6150) diluted 2000-fold with PBS was added to a 96-well plate (Nunc, MaxiSorp) at 50 μL / well and incubated overnight at 4°C. The 96-well plate was replaced with 3% BSA / PBS for the ELISA. The IGF-I receptor agonist antibody was added to the 96-well plate with immobilized anti-mouse IgG antibody at 30 μL / well and incubated at room temperature for 1.5 hours. After washing with washing solution, antibodies specific for various mouse IgG isotypes, including anti-mouse IgG1 antibody-ALP conjugate (SBA, 1070-04), anti-mouse IgG2a antibody-ALP conjugate (SBA, 1080-04), anti-mouse IgG2b antibody-ALP conjugate (SBA, 1090-04), and anti-mouse IgG3 antibody-ALP conjugate (SBA, 1100-04), were added at 30 μL / well and incubated at room temperature for 1 hour. Substrate (PNPP) was added at 100 μL / well and incubated at room temperature for 45 minutes. The absorbance at 405-550 nm was calculated. The absorbance at 405-550 nm was used to assess binding activity. IGF11-16 showed reactivity with anti-mouse IgG1 antibody, indicating that the antibody isotype was IgG1.
[0096] [Example 3] Determination of antibody sequence SMARTer® RACE was used to determine the gene sequences of the light and heavy chains of an IGF-I receptor agonist antibody. Fragments of the antibody heavy and light chain genes, including the initiation and termination codons, were obtained from RNA derived from the antibody-producing hybridoma using SMARTer® RACE, and their nucleotide sequences were determined. First-strand cDNA was synthesized using the SMARTer® RACE 5' / 3' Kit (634859, Clontech) with total RNA derived from the hybridoma as a template, and the cDNA was then amplified by PCR. Using the resulting cDNA as a template, PCR was performed using primers specific for the universal sequence provided with the kit and primers specific for the heavy and light chains of the antibody, respectively. Primers were designed based on Accession No. BC080787 for the light chain (kappa) of the mouse antibody and LT160966 for the IgG1 of the mouse antibody. The primer sequences for the mouse antibody light chain and heavy chain were designed as follows: ggtgaagttgatgtcttgtgagtgg and gctcttctcagtatggtggttgtgc, respectively. The resulting PCR products were used for TA cloning as 5' RACE PCR products.
[0097] For TA cloning, the 5' RACE PCR product was electrophoresed, and cDNA containing the desired molecular weight was purified using a QIAEX II Gel Extraction Kit (20021, Qiagen). The purified cDNA was reacted with a TaKaRa-Taq (R001A, Takara) at 72°C for 5 minutes to add adenines to the 5' and 3' ends. The cDNA was then cloned into a Topoisomerase I-activated pCR® II-TOPO® vector (hereafter referred to as the TOPO vector) using a TOPO® TA Cloning® Kit (450641, Thermo Fisher Scientific) according to the attached protocol. The TOPO vector containing the desired cDNA was transformed into Escherichia coli TOP10 and cultured on agar medium containing 50 μg / mL kanamycin. Insertion of the desired cDNA into the TOPO vector was confirmed by colony PCR. The nucleotide sequence of the cloned cDNA was identified. Similarly, the nucleotide sequence of the 3' RACE PCR product was identified, and the full-length sequence of the antibody gene was determined. The full-length gene sequence of the IGF11-16 light chain is shown in SEQ ID NO: 27, the full-length amino acid sequence in SEQ ID NO: 28, the full-length gene sequence of the IGF11-16 heavy chain in SEQ ID NO: 29, and the full-length amino acid sequence in SEQ ID NO: 30. In addition, CDR-H1 of IGF11-16 is shown in SEQ ID NO: 3, CDR-H2 is shown in SEQ ID NO: 4, CDR-H3 is shown in SEQ ID NO: 5, CDR-L1 is shown in SEQ ID NO: 6, CDR-L2 is shown in SEQ ID NO: 7, and CDR-L3 is shown in SEQ ID NO: 8, the heavy chain variable region is shown in SEQ ID NO: 9, and the light chain variable region is shown in SEQ ID NO: 10.
[0098] [Example 4] Binding activity to IGF-I receptor (ELISA) To examine the binding activity of IGF-I receptor agonist antibodies to IGF-I receptors from humans (sequence number 2, NP_000866), guinea pigs (sequence number 11, XP_003475316), cynomolgus monkeys (sequence number 12, NP_001248281), rabbits (sequence number 13, XP_017193273), rats (sequence number 14, NP_494694), and mice (sequence number 15, NP_034643), cell ELISA was performed using cells expressing various IGF-I receptors.
[0099] P3U1 cells were transfected by lipofection with pEF1 expression vectors (Thermofisher) incorporating IGF-I receptor genes from human (SEQ ID NO: 16), guinea pig (SEQ ID NO: 17), cynomolgus monkey (SEQ ID NO: 18), rabbit (SEQ ID NO: 19), rat (SEQ ID NO: 20), and mouse (SEQ ID NO: 21). After lipofection, 0.8 × 10 P3U1 cells were cultured overnight or longer. 5 The cells were added to a 96-well plate (poly-D-lysine coated) at 100 cells / well and fixed with 10% buffered formalin (Mildform® 10NM, Wako). The cells were blocked with phosphate buffer containing 3% BSA and used for ELISA.
[0100] For ELISA, 30 μL of an IGF11-16 antibody solution adjusted to 10 nM in 0.1% skim milk / 3% BSA / PBS was added to each well and incubated at room temperature for approximately 1 hour and 30 minutes. The wells were washed twice with washing buffer. 30 μL of an anti-mouse IgG antibody-HRP conjugate solution adjusted to various concentrations in 0.1% skim milk / 3% BSA / PBS was added to each well and incubated at room temperature for approximately 1 hour. The wells were washed twice with washing buffer. The reaction was initiated by adding 50 μL of substrate (TMB) to each well. After approximately 20 minutes, 50 μL of 0.5 M sulfuric acid was added to each well, and the absorbance at 450 and 550 nm was measured, and the absorbance at 450-550 nm was calculated. The binding activity was calculated by setting the absorbance at 450-550 nm to 1 for cells transfected with a vector lacking the IGF-I receptor gene (mock cells, SEQ ID NO: 22) (Table 1).
[0101] [Table 1]
[0102] IGF11-16 increased the binding activity of cells expressing human, guinea pig, cynomolgus monkey, and rabbit IGF-I receptors by more than five times compared to mock cells. On the other hand, the binding activity of IGF11-16 to cells expressing rat and mouse IGF-I receptors was similar to that of mock cells and did not increase. These results indicate that IGF11-16 binds to the IGF-I receptors of humans, guinea pigs, cynomolgus monkeys, and rabbits, but not to those of rats and mice.
[0103] [Example 5] Binding activity to insulin receptor (ELISA) To examine the binding activity of the IGF-I receptor agonist antibody to the insulin receptor, cell ELISA was performed using cells expressing the human insulin receptor.
[0104] HEK293T cells were transfected with the pEF1 expression vector (Thermofisher) containing the human insulin receptor gene by lipofection. After lipofection, 0.8 × 10 HEK293T cells were 5 Cells were added to a 96-well plate (poly-D-lysine coated) at a concentration of approximately 180 μL / well, fixed with 10% buffered formalin (Mildform® 10NM, Wako), and blocked with phosphate buffer containing 3% BSA before use in ELISA.
[0105] For ELISA, 30 μL of antibody solution prepared at various concentrations in 0.1% skim milk / 3% BSA / PBS was added to each well and incubated at room temperature for approximately 1 hour. The wells were washed twice with washing solution (Tris buffer containing Tween). 30 μL of anti-mouse IgG antibody-ALP conjugate solution prepared at various concentrations in 0.1% skim milk / 3% BSA / PBS was added to each well and incubated at room temperature for approximately 1 hour. The wells were washed twice with washing solution. 100 μL of substrate (PNPP) was added to each well to initiate the reaction. After approximately 30 minutes, absorbance was measured at 405 and 550 nm, and the absorbance at 405-550 nm was calculated. The binding activity was calculated by setting the absorbance at 405-550 nm to 1 for cells transfected with a vector lacking the IGF-I receptor gene and insulin receptor gene (mock cells, SEQ ID NO: 22) (Table 2).
[0106] [Table 2]
[0107] In an ELISA using immobilized cells expressing the human IGF-I receptor, 0.5 nM and 5 nM IGF11-16 increased the absorbance at 405-550 nm by approximately 3-fold or more compared to mock cells. On the other hand, in an ELISA using immobilized cells expressing the human insulin receptor, 0.5 nM and 5 nM IGF11-16 did not increase the absorbance at 405-550 nm by more than 1.5-fold. This indicates that IGF11-16 binds more strongly to the IGF-I receptor than to the insulin receptor.
[0108] [Example 6] Analysis of IGF-I receptor binding site (ELISA) To identify the epitope of the IGF-I receptor agonist antibody on the IGF-I receptor, we measured the binding of the IGF-I receptor agonist antibody to mutants in which various domains of the IGF-I receptor were replaced with domains of the insulin receptor, which has a similar structure to the IGF-I receptor.
[0109] The following four substitutions were prepared in which the extracellular domain of the human IGF-I receptor (NP_000866) was replaced with the extracellular domain of the insulin receptor, or the extracellular domain of the human insulin receptor (NP_000199) was replaced with the extracellular domain of the IGF-I receptor. (Substitute 1) hIGFIR[L1-L2] / hINSR, a substitution product in which the L1 to L2 domains of the human insulin receptor are replaced with the L1 to L2 domains of the human IGF-I receptor. (Substitute 2) hINSR[L1-L2] / hIGFIR, a substitution product in which the L1 to L2 domains of the human IGF-I receptor are replaced with the L1 to L2 domains of the human insulin receptor. (Substitute 3) hINSR[L1] / hIGFIR, a substitution product in which the L1 domain of the human IGF-I receptor is replaced with the L1 domain of the human insulin receptor. (Substitute 4) hINSR[L2] / hIGFIR, a substitution product in which the L2 domain of the human IGF-I receptor is replaced with the L2 domain of the human insulin receptor.
[0110] P3U1 cells were transfected with pEF1 expression vectors (Thermofisher) incorporating the genes of the above four substitution variants of human IGF-I receptors by lipofection. The gene for hIGFIR[L1-L2] / hINSR (substitution variant 1) is shown in SEQ ID NO: 23, the gene for hINSR[L1-L2] / hIGFIR (substitution variant 2) is shown in SEQ ID NO: 24, the gene for hINSR[L1] / hIGFIR (substitution variant 3) is shown in SEQ ID NO: 25, and the gene for hINSR[L2] / hIGFIR (substitution variant 4) is shown in SEQ ID NO: 26. After lipofection, P3U1 cells were cultured overnight or longer and then transfected with 0.8 x 10 5 The cells were added to a 96-well plate (poly-D-lysine coated) at 1000 cells / well and fixed with 10% buffered formalin (Mildform® 10NM, Wako). The cells were blocked with phosphate buffer containing 3% BSA and used for ELISA.
[0111] For ELISA, 30 μL of antibody solution adjusted to 10 nM in 0.1% skim milk / 3% BSA / PBS was added to each well and incubated at room temperature for approximately 1 hour and 30 minutes. The wells were washed twice with washing buffer. 30 μL of anti-mouse IgG antibody-HRP conjugate solution adjusted to 5 nM in 0.1% skim milk / 3% BSA / PBS was added to each well and incubated at room temperature for approximately 1 hour. The wells were washed twice with washing buffer. The reaction was initiated by adding 50 μL of substrate (TMB) to each well. After approximately 20 minutes, the reaction was stopped by adding 50 μL of 0.5 M sulfuric acid. The absorbance at 450 and 550 nm was measured, and the absorbance at 450-550 nm was calculated. The binding activity was calculated by setting the absorbance at 450-550 nm relative to the absorbance at 450-550 nm for cells (mock cells) transfected with a vector lacking the gene for each substitution as 1 (Table 3).
[0112] [Table 3]
[0113] In an ELISA using immobilized cells expressing hIGFIR[L1-L2] / hINSR, hINSR[L1] / hIGFIR, and hINSR[L2] / hIGFIR, IGF11-16 increased the absorbance at 450-550 nm by more than five-fold compared to mock cells. However, the binding activity of IGF11-16 to cells expressing hINSR[L1-L2] / hIGFIR was weak. This indicates that IGF11-16 binds to the CR domain of the IGF-I receptor.
[0114] [Example 7] Determination of epitopes of IGF11-16 To identify the specific epitope of IGF11-16 from the CR domain, we predicted the binding sequence based on the species differences in the binding of IGF11-16 to the IGF-I receptor. Figure 1 shows the amino acid sequences of the CR domain of the IGF-I receptor in each species.
[0115] IGF11-16 binds to the IGF-I receptors of humans, guinea pigs, and rabbits, but not mice or rats. Based on this, we hypothesized that the amino acid sequence in the CR domain of the IGF-I receptor, which is common to humans, guinea pigs, and rabbits but different from mice and rats, is the epitope of IGF11-16.
[0116] To determine which amino acid in the CR domain of the IGF-I receptor IGF11-16 binds to, the binding to various amino acid substitutions in the CR domain was measured by ELISA.
[0117] Cell ELISA was performed using cells expressing IGF-I receptors in which the amino acid sequence predicted to bind to IGF11-16 in the CR domain had been mutated.
[0118] The following three types of amino acid substitutions in the CR domain were used. The wild-type human IGF-I receptor served as a positive control, and the wild-type rat IGF-I receptor inserted into the pEF1 expression vector (Thermofisher) served as a negative control. The expression levels of the various IGF-I receptors were assessed by measuring the reactivity of the FLAG M2 antibody to the FLAG tag (AspTyrLysAspAspAspAspLys) attached to the intracellular domain of the IGF-I receptor. (CR domain substitution 1) In the amino acid sequence of human IGF-I receptor (NP_000866, SEQ ID NO: 2), aspartic acid and alanine at positions 245 and 247 were substituted with asparagine and threonine, respectively. (CR domain substitution 2) In the amino acid sequence of human IGF-I receptor (NP_000866, SEQ ID NO: 2), glutamic acid at position 294 was substituted with aspartic acid. (CR domain substitution 3) In the amino acid sequence of human IGF-I receptor (NP_000866, SEQ ID NO: 2), glycine and serine at positions 315 and 316 were substituted with serine and threonine, respectively.
[0119] 9 × 10 HEK293T cells 6 HEK293T cells were seeded at 0.8 × 10 cells / well on a 10 cm dish coated with poly-D-lysine. The following day, each plasmid DNA was introduced into the cells by lipofection. The following day, HEK293T cells were detached using 0.25% trypsin / EDTA and suspended in culture medium. 0.8 × 10 HEK293T cells were seeded at 0.8 × 10 cells / well on a 10 cm dish coated with poly-D-lysine. The following day, each plasmid DNA was introduced into the cells by lipofection. The following day, HEK293T cells were detached using 0.25% trypsin / EDTA and suspended in culture medium. 5 The cells were added to a 96-well plate (poly-D-lysine coated) at 1000 cells / well and incubated overnight at 37°C in 5% CO. The medium was removed from the 96-well plate and fixed with 10% buffered formalin (Mildform® 10NM, Wako). The medium was then replaced with blocking buffer (3% BSA / PBS / sodium azide) and used for ELISA.
[0120] For ELISA, 50 μL of IGF11-16 antibody or FLAG M2 antibody solution prepared at 1 nM in 0.1% skim milk / 3% BSA / PBS was added to each well and incubated at room temperature for approximately 1 hour. The wells were washed twice with washing buffer. 50 μL of anti-mouse IgG antibody-HRP conjugate solution prepared at various concentrations in 0.1% skim milk / 3% BSA / PBS was added to each well and incubated at room temperature for approximately 1 hour. The wells were washed twice with washing buffer. 100 μL of substrate (TMB) was added to each well to initiate the reaction. After approximately 30 minutes, 100 μL of 0.5 M sulfuric acid was added to stop the reaction, and the absorbance at 450 nm was measured. The absorbance at 450 nm was evaluated as binding activity.
[0121] The results are shown in Figure 2. The reactivity of the FLAG M2 antibody to cells expressing each CR domain substitution was comparable, confirming that the expression levels of each CR domain substitution were approximately the same. IGF11-16 increased the absorbance at 450 nm to 2 or higher against wild-type human IGF-I receptor (without CR domain mutations), demonstrating enhanced binding activity. IGF11-16 increased the absorbance at 450 nm to 2 or higher against CR domain substitutions 1 and 2, demonstrating enhanced binding activity. On the other hand, the absorbance at 450 nm of CR domain substitution 3 was approximately 1, similar to the absorbance of the negative control rat IGF-I receptor, demonstrating no binding activity. These results indicate that the 315th and 316th amino acids of the IGF-I receptor are important for the binding activity of IGF11-16 to the CR domain of the IGF-I receptor.
[0122] From the above results, the binding site of IGF11-16 to the human IGF-I receptor was predicted to be near Gly (glycine) and Ser (serine) at positions 315 and 316. Since antibody recognition sequences generally consist of eight amino acid residues (average length of 6 to 10 residues) and IGF11-16 has cross-reactivity (no binding to rat IGF-I receptor, but binding to rabbit and human IGF-I receptors), the predicted sequence of the binding site of IGF11-16 to the human IGF-I receptor is ProSerGlyPheIleArgAsnGly. * Ser * GlnSerMet (Gly * Ser * indicates the amino acid sequence of positions 315 and 316).
[0123] [Example 8] Binding affinity to IGF-I receptor by surface plasmon resonance The binding characteristics (binding rate and dissociation rate) of the drug to the IGF-I receptor were measured by surface plasmon resonance (SPR) method.
[0124] Anti-His monoclonal antibody was immobilized on a CM3 sensor chip (GE) using an Amine Coupling Kit (BR-1000-50, GE) and a His Capture Kit (28-9950-56, GE). The immobilization conditions were NHS / EDC for 7 minutes, 50 μg / mL anti-His monoclonal antibody for 3 minutes, and ethanolamine for 7 minutes, with a target of ≥3000 RU. Various concentrations of drugs were used as analytes. The ligand used was recombinant human IGF-I receptor histidine tag (305-GR-050, R&D SYSTEMS, hereafter referred to as IGF-IR-His). Purified mouse IgG2a, κ, isotype Ctrl, Clone:MG2a-53 (401502, BioLegend, hereafter referred to as ctrl IgG2a) was used as a negative control.
[0125] The sensor chip CM3 with immobilized anti-His monoclonal antibody was placed in a Biacore T200. The reaction temperature was set to 36°C, and a running buffer (HBS-EP+, BR-1006-69, GE) was run at a flow rate of 30 μL / min. The ligand binding amount was set to approximately 100 RU, and 0.5 to 2 × 10 IGF-IR-His was run. -8 10 nmol / L Ctrl IgG2a was added and captured by anti-His monoclonal antibody. 10 nmol / L Ctrl IgG2a was added for 1 minute, and HBS-EP+ was flowed at a flow rate of 30 μL / min for 10 minutes or more. The analyte and HBS-EP+ were added to flow cells (1 and 2) and flow cells (3 and 4), respectively, and allowed to react.
[0126] The reaction conditions were a binding time of 600 seconds and a dissociation time of 600 seconds. After completion of the reaction, the sample was washed with regeneration buffer 1 (0.2% SDS), regeneration buffer 2 (100 mmol / L Tris-HCl (pH 8.5), 1 mol / L NaCl, 15 mmol / L MgCl), and regeneration buffer 3 (10 mmol / L glycine-HCl (pH 1.5)) for 1 minute each at a flow rate of 30 μL / min. Analysis was performed using a 1:1 binding model using Biacore T200 Evaluation software (ver. 2.0), and the dissociation rate constant (ka, 1 / Ms), binding rate constant (kd, 1 / s), and dissociation constant (KD, M) were calculated. The results are shown in Table 4.
[0127] [Table 4]
[0128] The k value of IGF11-16 for the human IGF-I receptor was approximately 1 / 5 that of IGF-I, indicating a slow binding rate. On the other hand, the k value of IGF11-16 for the human IGF-I receptor was lower than the lower limit of measurement of the measurement device and 1 / 1000 that of IGF-I, indicating a very slow dissociation rate and that IGF11-16 is unlikely to dissociate from the IGF-I receptor once bound. The K value of IGF11-16 for the human IGF-I receptor was 1 / 50 that of IGF-I, indicating a strong binding strength. This indicates that IGF11-16 has stronger binding activity to the IGF-I receptor than IGF-I.
[0129] [Example 9] Activation of IGF-I receptor or insulin receptor by PathHunter (registered trademark) To detect the activating effect of IGF-I receptor agonist antibodies on the IGF-I receptor, activation of downstream signals of the IGF-I receptor was measured using PathHunter (registered trademark) IGF1R Functional Assay (DiscoverX).
[0130] We used cell lines expressing the IGF-I receptor and the SH2 domain-containing adaptor protein SHC1-Enzyme Acceptor (EA) fusion protein, which binds to the intracellular tyrosine kinase of the IGF-I receptor. To detect the activating effect of IGF-I receptor agonist antibodies on the insulin receptor, we measured the activation of downstream signaling pathways of the insulin receptor using the PathHunter® INSR Functional Assay (DiscoverX). We used cell lines expressing the insulin receptor and the PLCG1-EA fusion protein, which contains an SH2 domain that binds to the intracellular tyrosine kinase of the insulin receptor. In these cell lines, ligand binding to the IGF-I receptor or insulin receptor induces receptor dimerization. Subsequent receptor phosphorylation recruits the SH2 domain-containing adaptor protein, forming a receptor signaling complex. This promotes the binding of EA to the spatially adjacent tyrosine kinase, resulting in the reconstitution of active β-galactosidase. By measuring the level of chemiluminescence signal from the substrate hydrolyzed by this β-galactosidase activity, it is possible to identify the effect of a drug on a receptor tyrosine kinase.
[0131] Cells expressing IGF-I receptor or insulin receptor were added to poly-D-lysine-coated or collagen-I-coated 96-well plates (black / clear or white / clear) at 90 μL / well (2 × 10 4 cells / well or 5 x 10 3 The cells were seeded at 100 μL / well and incubated at 37°C with 5% CO2. The following day, 10 μL of each drug concentration was added to each well and incubated at 37°C with 5% CO2. The following day, 30 μL of the culture supernatant was taken, and 15 μL of substrate solution was added. The reaction was allowed to proceed for 60 minutes, and the luminescence signal was measured using a luminometer (Tristar, Berthold). IGF-I receptor activation was calculated by setting the activity in the solvent-only treatment group as 100%. The results are shown in Table 5.
[0132] [Table 5]
[0133] The activation of insulin receptors was calculated by setting the activity in the group treated with only the solvent as 100%. The results are shown in Table 6.
[0134] [Table 6]
[0135] IGF-I receptor activation by drugs was measured using a cell line expressing the IGF-I receptor. In the cell line expressing the IGF-I receptor, IGF-I and IGF11-16 showed IGF-I receptor activation compared to the control.
[0136] Using a cell line expressing the insulin receptor, we measured the insulin receptor activation by drugs. Insulin-activated cell lines showed insulin receptor activation. Furthermore, IGF-I activated the insulin receptor in a concentration-dependent manner, with significant activation at 50 nM. On the other hand, IGF11-16 did not activate the insulin receptor.
[0137] IGF-I is known to be responsive to insulin receptors, and activation of the insulin receptor is known to induce hypoglycemic effects. IGF11-16 have been shown to act specifically on the IGF-I receptor and not to have insulin receptor-mediated hypoglycemic effects.
[0138] [Example 10] Cell proliferation activity in human myoblasts To examine the proliferation activity of IGF-I receptor agonist antibodies on human myoblasts, the drug was added to human myoblasts and the intracellular ATP level was measured after 4 days.
[0139] Normal human skeletal muscle myoblast cells (HSMM, Lonza) were cultured in SkBM-2 (Lonza, CC-3246) medium containing 1% BSA in a 96-well plate (coated with collagen type I) at 0.1 mL / well (2 × 10 3 The cells were seeded at 100 μL / well and incubated at 37°C with 5% CO2. The day after cell seeding, various drugs were added at 25 μL / well, and the plates were incubated at 37°C with 5% CO2 for 4 days. The amount of intracellular ATP was measured as an indicator of cell proliferation using the CellTiter-Glo® Luminescent Cell Viability Assay (Promega). After incubation for 4 days, the supernatant was removed from the 96-well plate so that the culture medium was 50 μL / well, and the plate was left to stand at room temperature for at least 30 minutes. CellTiter-Glo® reagent was added at 50 μL / well, and the plate was allowed to react for at least 10 minutes, after which the luminescence signal was measured using a luminometer (Tristar, Berthold). Activity in the group receiving only the solvent was calculated as 100%. The results are shown in Table 7.
[0140] [Table 7]
[0141] IGF-I and IGF11-16 enhanced cell proliferation activity compared to a control antibody (FLAG M2, Sigma-Aldrich).
[0142] IGF11-16 at concentrations of 0.00005, 0.0005, 0.005, 0.05, 0.5, 5, 50, and 500 nM enhanced the proliferation activity of human myoblasts in a concentration-dependent manner. EC 50 were 0.004 nM and 0.61 nM, respectively, and IGF11-16 showed activity more than 100 times stronger.
[0143] The 16-13 antibody and 26-3 antibody described in Non-Patent Document 35 did not show significant cell proliferation activity compared to the solvent control (containing sodium azide), and the activity was weaker than that of IGF11-16.
[0144] [Example 11] Cell proliferation activity in guinea pig myoblasts Guinea pig myoblasts (Cell Applications) were cultured in SkBM-2 (Lonza, CC-3246) medium containing 1% BSA in a 96-well plate (coated with collagen type I) at 0.1 mL / well (4 × 10 3 The cells were seeded at 100 μL / well and incubated at 37°C with 5% CO2. The day after cell seeding, various drugs were added at 25 μL / well, and the plates were incubated at 37°C with 5% CO2 for 4 days. The amount of intracellular ATP was measured as an indicator of cell proliferation using the CellTiter-Glo® Luminescent Cell Viability Assay (Promega). After incubation for 4 days, the supernatant was removed from the 96-well plate so that the culture medium was 50 μL / well, and the plate was left to stand at room temperature for 30 minutes or more. CellTiter-Glo® reagent was added at 50 μL / well, and the plate was allowed to react for 10 minutes or more, after which the luminescence signal was measured using a luminometer (Tristar, Berthold).
[0145] IGF11-16 at concentrations of 0.00005, 0.0005, 0.005, 0.05, 0.5, 5, 50, and 500 nM enhanced the proliferation activity of guinea pig myoblasts in a concentration-dependent manner. 50 were 0.004 nM and 0.76 nM, respectively, and IGF11-16 showed activity more than 100 times stronger.
[0146] [Example 12] In vitro comparison of duration of action with IGF-I To compare the duration of action of IGF11-16 and IGF-I, the medium was changed 18 hours after the addition of IGF11-16 or IGF-I, and the proliferation activity of human myoblasts was measured under conditions in which IGF11-16 and IGF-I were removed.
[0147] Normal human skeletal muscle myoblast cells (HSMM, Lonza) were cultured in SkBM-2 (Lonza, CC-3246) medium containing 1% BSA in a 96-well plate (coated with collagen type I) at 0.1 mL / well (2 × 10 3 The cells were seeded at 100 μL / well and incubated at 37°C in 5% CO2. The day after cell seeding, IGF11-16 or IGF-I was added at 25 μL / well. 18 hours after addition, the medium was replaced with either IGF11-16 or IGF-I-free or IGF-I-containing medium. The plates were incubated at 37°C in 5% CO2 for 4 days. The amount of intracellular ATP was measured as an indicator of cell proliferation using the CellTiter-Glo® Luminescent Cell Viability Assay (Promega). After 4 days of incubation, the supernatant was removed from the 96-well plate so that the culture medium was 50 μL / well, and the plate was left to stand at room temperature for at least 30 minutes. CellTiter-Glo® reagent was added at 50 μL / well, and after 10 minutes of incubation, the luminescence signal was measured using a luminometer (Tristar, Berthold). Cell proliferation activity was calculated as a percentage of the control group (control group, 0%) to which only solvent was added. The results are shown in Figure 3.
[0148] In the groups treated with 1 nM and 5 nM IGF-I for 4 days, cell proliferation activity increased to 39% and 75%, respectively. In the groups treated with 1 nM and 5 nM IGF-I for 18 hours followed by washout, cell proliferation activity was 8% and 10%, respectively, which was less than one-fifth of the activity in the group treated with 1 nM and 5 nM IGF-I for 4 days, showing a significant decrease in activity.
[0149] In the group treated with 0.5 nM IGF11-16 for 4 days, cell proliferation activity increased to 49%. In the group treated with 0.5 nM IGF11-16 for 18 hours followed by washout, cell proliferation activity was 30%, which was more than 60% of the activity of the group treated with 0.5 nM IGF11-16 for 4 days.
[0150] When comparing the cell proliferation activity of the 0.5 nM IGF11-16 treatment group with that of the 1 nM and 5 nM IGF-I treatment groups after drug washout, IGF11-16 showed statistically significantly stronger activity. These results indicate that IGF11-16 maintains the proliferation activity of human myoblasts even after drug washout and has a stronger effect than IGF-I. The fact that IGF11-16 maintained cell proliferation activity even after washout indicates that, unlike the effect of IGF-I, IGF11-16 binds strongly to the IGF-I receptor and has sustained IGF-I receptor activation.
[0151] [Example 13] Glucose uptake in differentiated human muscle cells To examine the glucose uptake effect of IGF11-16, we measured the amount of radiolabeled 3H-2-deoxyglucose uptake in differentiated human myocytes and compared it with the effect of IGF-I.
[0152] Normal human skeletal muscle myoblast cells (HSMM, Lonza) were plated in a 24-well plate (Costar, 3526) at 0.5 mL / well (2 × 10 4Cells were seeded at 1000 x g (1000 x 1000 cells / well) and incubated at 37°C in 5% CO. The medium (SkBM-2 (Lonza, CC-3246) supplemented with FBS (Lonza, CC-4423W), L-Glutamine (Lonza, CC-4422W), Dexamethasone (Lonza, CC-4421W), rhEGF (Lonza, CC-4420W), and GA-1000 (Lonza, CC-4419W)) was replaced until the cells reached confluence. Confluent HSMM cells were cultured in 0.5 mL / well of differentiation medium (DMEM / F12 (1:1) (Gibco, 11320) containing 2% Horse Serum (Sigma, H1270), 50 U / mL Penicillin, and 50 μg / mL Streptomycin (Gibco, 15070-063)) and incubated at 37°C in 5% CO2 to initiate differentiation into myocytes. Approximately 6 days after the start of differentiation, the cells were used as differentiated human myocytes for glucose uptake experiments.
[0153] Human differentiated myocytes were incubated overnight at 37°C and 5% CO2 with 0.5 mL / well of Starvation medium (1 g / L glucose-containing DMEM (Gibco, 11885) containing 0.1% BSA, Fatty Acid-free (Seikagaku Corporation, 82-002-5), 50 U / mL penicillin, and 50 μg / mL streptomycin (Gibco, 15070-063)). The following day, the medium was replaced with 0.5 mL / well of Starvation medium and incubated at 37°C and 5% CO2 for 2 hours. After washing the wells with 1 mL / well of PBS, 0.5 mL / well of treatment medium containing various drugs was added and incubated at 37°C and 5% CO2 for 2 hours. The treatment medium was prepared using a glucose uptake buffer (20 mmol / L HEPES (DOJINDO, 342-01375), 150 mmol / L NaCl (SIGMA, S5150), 5 mmol / L KCl (Wako, 163-03545), 5 mmol / L MgSO4 (Wako, 131-00405), 1.2 mmol / L KH2PO4 (Wako, 169-04245), 25 mmol / L CaCl2 (Fluka, 21114), and 2 mmol / L pyruvate (Wako, 190-14881) dissolved in water for injection and adjusted to pH 7.4 with NaOH) at a final concentration of 0.1 mmol / L glucose, 0.1% BSA, 3H-2-Deoxyguanosine mononitrate (3H-2-deoxyguanosine mononitrate), and 0.1% BSA. Glucose (1 μCi / mL) and various concentrations of human recombinant IGF-I or IGF-I receptor agonist antibody were prepared. Glucose uptake was terminated by adding 1 mL / well of chilled PBS to the wells and washing three times. Cells were lysed by adding 0.25 mL / well of 1N NaOH to the wells. The entire cell lysate was added to a vial containing 3 mL of liquid scintillator ULTIMA GOLD (PerkinElmer Japan) and stirred. 3H radioactivity (DPM) was measured for 3 minutes using a liquid scintillation counter. The glucose uptake rate of the treated group was calculated, with the mean glucose uptake (DPM) of the untreated group (control group) set at 100%. The results are shown in Figure 4.
[0154] IGF-I at 0.8, 4, 20, and 100 nM significantly and concentration-dependently enhanced glucose uptake. On the other hand, IGF11-16 showed no significant effect up to 100 nM. These results suggest that IGF11-16 has only a weak effect on glucose uptake in differentiated human muscle cells.
[0155] [Example 14] In vivo efficacy (muscle mass increasing effect in guinea pigs) To confirm the in vivo efficacy of the IGF-I receptor agonist antibody, guinea pigs were given a single dose of IGF11-16, and muscle mass was measured two weeks later. The effect was compared with that of continuous administration of IGF-I. A muscle mass-increasing effect was defined as an increase in muscle weight of guinea pigs by 5% or more compared to the control group.
[0156] IGF11-16 (0.03, 0.1, or 0.3 mg / kg) was administered subcutaneously or intravenously as a single dose to normal guinea pigs. As a positive control, human recombinant IGF-I (mecasermin) was administered continuously at 1 mg / kg / day via an osmotic pump (Alzet). Two weeks after drug administration, the guinea pigs were sacrificed by exsanguination under anesthesia, and the weight of the extensor digitorum longus muscle was measured. The results are shown in Figure 5.
[0157] The groups receiving IGF11-16 intravenously (iv) at 0.03, 0.1, and 0.3 mg / kg showed a dose-dependent and significant increase in muscle mass compared to the vehicle-treated control group. The group receiving IGF11-16 subcutaneously (sc) at 0.3 mg / kg also showed a significant increase in muscle mass compared to the control group.
[0158] The amount of muscle mass increased in the group receiving a single dose of IGF11-16 at 0.03 to 0.3 mg / kg was comparable to that in the group receiving continuous infusion of human recombinant IGF-I at 1 mg / kg / day (infusion).This indicates that IGF11-16 has a pharmacological effect in vivo when administered intravenously or subcutaneously in a single dose.
[0159] A single dose of IGF11-16 has been shown to have the same efficacy as continuous administration of IGF-I. Clinically, IGF-I (mecasermin) is administered once or twice daily. In vivo, however, IGF11-16 showed the same efficacy as continuous administration of IGF-I when administered once every two weeks, demonstrating its superior sustained efficacy compared to IGF-I.
[0160] [Example 15] In vivo blood glucose lowering effect (blood glucose lowering effect in guinea pigs) To confirm whether IGF-I receptor agonist antibodies have a hypoglycemic effect in vivo, a single dose of IGF11-16 was administered to guinea pigs, blood glucose levels were measured over time, and the blood glucose-lowering effect was compared with that of a single dose of IGF-I. A hypoglycemic effect is defined as a reduction in blood glucose levels to 50 mg / dL or below, or the induction of hypoglycemic symptoms.
[0161] IGF-I was administered subcutaneously in a single dose to guinea pigs to examine its hypoglycemic effect. The guinea pigs were fasted for 12 hours, and then human recombinant IGF-I (mecasermin) was administered subcutaneously in a single dose of 0.3, 1, 3, or 10 mg / kg. The guinea pigs were fasted until 24 hours after administration. Blood samples were taken from awake guinea pigs before administration (0 hours), and 1, 2, 4, 8, 10, and 24 hours after administration, and blood glucose levels were measured using a Glutest Sensor (Sanwa Kagaku Kenkyusho). The results are shown in Figure 6.
[0162] IGF-I showed a significant blood glucose lowering effect from 0.3 mg / kg onwards, hypoglycemic symptoms were observed at 1 mg / kg or higher, and deaths were observed at 3 mg / kg or higher.
[0163] IGF11-16 was administered subcutaneously in a single dose to guinea pigs to examine its hypoglycemic effect. The guinea pigs were fasted for 12 hours, and then IGF11-16 was administered subcutaneously in a single dose of 10, 30, or 100 mg / kg. The guinea pigs were fasted until 24 hours after administration. Blood samples were taken from awake guinea pigs before administration (0 hours), and 2, 4, 8, 10, and 24 hours after administration, and blood glucose levels were measured using a Glutest Sensor (Sanwa Kagaku Kenkyusho). The results are shown in Figure 7.
[0164] IGF11-16 did not significantly affect blood glucose levels, even in the 100 mg / kg group, compared with the vehicle-only control group, indicating that subcutaneous administration of IGF11-16 does not have a hypoglycemic effect and does not affect blood glucose levels.
[0165] IGF11-16 was administered intravenously to guinea pigs once to examine its hypoglycemic effect. The guinea pigs were fasted for 12 hours, and then IGF11-16 was administered intravenously at 0.1, 1.5, 6, and 20 mg / kg. The guinea pigs were fasted until 24 hours after administration. Blood samples were taken from awake guinea pigs before administration (0 hours), and 0.5, 1, 2, 4, 8, and 24 hours after administration, and blood glucose levels were measured using a Glutest Sensor (Sanwa Kagaku Kenkyusho). The results are shown in Figure 8.
[0166] IGF11-16 did not significantly affect blood glucose levels, even in the 20 mg / kg group, compared to the vehicle-only control group. This indicates that IGF11-16, even when administered intravenously, does not have a hypoglycemic effect and does not affect blood glucose levels.
[0167] IGF11-16 does not have the significant hypoglycemic effect of IGF-I, whether administered subcutaneously or intravenously, and does not affect blood glucose levels, demonstrating its potential as a drug that overcomes the hypoglycemia, a side effect of IGF-I.
[0168] [Example 16] In vivo efficacy (growth-promoting effect in guinea pigs) To confirm the in vivo bone efficacy of IGF-I receptor agonist antibodies, we compared the effects of continuous IGF-I administration and repeated daily administration of growth hormone (GH). Hypophysectomized guinea pigs were administered a single dose of IGF11-16, and tibia length and growth plate cartilage thickness were measured two weeks later as indicators of growth promotion. Hypophysectomized guinea pigs were given a single subcutaneous dose of IGF11-16 (0.3 mg / kg and 1 mg / kg). As a control, human recombinant IGF-I (mecasermin) was implanted subcutaneously using an osmotic pump (Alzet) and continuously administered at 1 mg / kg / day. As another control, human recombinant GH (Genotropin®) was administered subcutaneously at 1 mg / kg once daily. Two weeks after drug administration, the guinea pigs were sacrificed by exsanguination under anesthesia, and the thickness of the growth plate cartilage at the proximal tibia and the length of the tibia were measured. The results are shown in Figures 9 and 10.
[0169] The groups receiving subcutaneous administration of IGF11-16 at 0.3 mg / kg and 1 mg / kg (IGF11-16) showed a dose-dependent and significant increase in the thickness of growth plate cartilage and the length of the tibia compared to the control group (vehicle) in which hypophysectomized guinea pigs were treated with only the solvent, demonstrating a growth-promoting effect. The growth-promoting effect of a single dose of 0.3 mg / kg of IGF11-16 was comparable to that of a group receiving continuous administration of 1 mg / kg / day of human recombinant IGF-I (IGF-I). Furthermore, the growth-promoting effect of a single dose of 1 mg / kg of IGF11-16 was comparable to that of a group receiving repeated administration of 1 mg / kg / day of human recombinant GH (GH). These results demonstrate that a single dose of IGF11-16 has the same efficacy as continuous administration of IGF-I and repeated daily administration of GH. Clinically, the dosage regimens for human recombinant IGF-I (Mecasermin) and human recombinant GH (Genotropin®) are subcutaneous injections once to twice daily and six to seven times weekly, respectively. On the other hand, in vivo, IGF11-16 showed efficacy equivalent to continuous administration of IGF-I and repeated administration of GH once daily when administered once every two weeks, demonstrating its superior sustained efficacy compared to IGF-I and GH.
[0170] [Example 17] Blood kinetics of IGF-I and IGF11-16 IGF-I blood levels Guinea pigs were fasted for 12 hours and then subcutaneously administered human recombinant IGF-I at doses of 0.3, 1, 3, and 10 mg / kg. The guinea pigs were fasted until 24 hours after administration. Blood samples were taken from awake guinea pigs before administration (0 hours), and 1, 2, 4, 8, 10, and 24 hours after administration, and plasma human IGF-I concentrations were measured by ELISA (DG100, R&D). The results are shown in Figure 11.
[0171] Plasma IGF-I concentrations increased dose-dependently, and 24 hours after administration, plasma IGF-I concentrations had decreased to approximately 50% of their peak levels. The IGF-I concentrations in the 0.3 mg / kg group were below the lower limit of measurable levels 24 hours after administration. Plasma could not be collected from the 10 mg / kg group because the animals died of hypoglycemia 4 hours after administration.
[0172] IGF11-16 plasma levels Guinea pigs were fasted for 12 hours and subcutaneously administered an IGF-I receptor agonist antibody at 0.3, 1, 3, 10, 30, or 100 mg / kg. The guinea pigs were fasted until 24 hours after administration and then refed 24 hours later. Blood was collected from awake guinea pigs before administration (0 hours), and 2, 4, 8, 10, 24, 48, and 72 hours after administration, and plasma IGF11-16 concentrations were measured by ELISA. The results are shown in Figure 12. Plasma IGF11-16 concentrations increased dose-dependently, and even after 48 hours of administration, plasma IGF11-16 concentrations remained at approximately 50% or more of those at 24 hours after administration, demonstrating that the blood kinetics of IGF11-16 are more sustained than IGF-I. [Industrial Applicability]
[0173] The present invention can provide antibodies that specifically bind to the IGF-I receptor of vertebrates, increase muscle mass or growth plate cartilage thickness via the IGF-I receptor, and do not lower blood glucose levels, and therefore can be used to treat, prevent, or diagnose diseases related to anti-IGF-I receptor antibodies.
Claims
1. A method for analyzing the binding activity of an anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, which has proliferation-inducing activity on human-derived cells, or for examining intracellular signal transduction, using a genetically modified non-human animal in which a mutation has been introduced into the CR domain of the IGF-I receptor that the non-human animal endogenously possesses, wherein the CR domain of the mutated IGF-I receptor has an amino acid sequence including ProSerGlyPheIleArgAsnGlySerGlnSerMet.
2. (1) A step of using a genetically modified non-human animal in which a mutation has been introduced into the CR domain of an IGF-I receptor endogenously possessed by the non-human animal, wherein the CR domain of the mutated IGF-I receptor has an amino acid sequence containing ProSerGlyPheIleArgAsnGlySerGlnSerMet, sensitizing the genetically modified non-human animal with an IGF-I receptor and / or a partial peptide thereof, and extracting immune cells; (2) obtaining hybridomas by cell fusion of the immune cells with myeloma cells or the like; and (3) Cloning the obtained hybridomas and recovering anti-IGF-I receptor antibodies from the culture. A method for producing an anti-IGF-I receptor antibody, comprising:
3. A genetically modified non-human animal for evaluating the effect on cells derived from a non-human vertebrate of an anti-IGF-I receptor antibody, or a fragment thereof, or a derivative thereof, which specifically binds to a native human IGF-I receptor having the amino acid sequence set forth in SEQ ID NO: 2 and has the activity of inducing proliferation of human-derived cells, comprising: a mutation is introduced into the CR domain of an IGF-I receptor endogenously possessed by the non-human animal, and the CR domain of the mutated IGF-I receptor has an amino acid sequence including ProSerGlyPheIleArgAsnGlySerGlnSerMet; The antibody competitively binds to a native human IGF-I receptor with a reference antibody having an amino acid sequence comprising SEQ ID NO: 3 as the CDR-1 (CDR-H1) sequence of a derivative heavy chain variable region, SEQ ID NO: 4 as the CDR-2 (CDR-H2) sequence of a heavy chain variable region, SEQ ID NO: 5 as the CDR-3 (CDR-H3) sequence of a heavy chain variable region, SEQ ID NO: 6 as the CDR-1 (CDR-L1) sequence of a light chain variable region, SEQ ID NO: 7 as the CDR-2 (CDR-L2) sequence of a light chain variable region, and SEQ ID NO: 8 as the CDR-3 (CDR-L3) sequence of a light chain variable region, and when antigen-antibody binding to the native human IGF-I receptor is detected in the presence of 10 nM of the reference antibody, the IC 50 A genetically modified non-human animal, which is an anti-IGF-I receptor antibody having a specific activity of 1000 nM or less.
Citation Information
Patent Citations
Gene associated with FGF signal transduction
JP2004357612A
transgenic animal
JP2004500843A
Use of PEGylated IGF-I variants for the treatment of neuromuscular disorders
JP2011518778A