Nucleic acid molecules for reducing PAPD5 and PAPD7 mRNA for the treatment of hepatitis B infection

Nucleic acid molecules targeting PAPD5 and PAPD7 inhibit HBsAg and HBeAg secretion, addressing the limitations of current HBV treatments by enhancing immune response and reducing chronic infection through simultaneous knockdown of both antigens.

JP7798836B2Active Publication Date: 2026-01-14F HOFFMANN LA ROCHE & CO AG
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2023129333
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2017-12-18
Filing Date
2023-08-08
Publication Date
2026-01-14
Estimated Expiration
2038-10-16

AI Technical Summary

Technical Problem

Current treatments for hepatitis B virus (HBV) infection, such as nucleoside analogues, fail to effectively reduce hepatitis B surface antigen (HBsAg) and hepatitis B e antigen (HBeAg) levels, leading to weak immune responses and chronic infection, with HBsAg clearance rarely exceeding 2% and HBeAg contributing to viral persistence and immune dysfunction.

Method used

Development of nucleic acid molecules that inhibit the expression of both PAPD5 and PAPD7, targeting HBsAg and HBeAg secretion, using antisense oligonucleotides conjugated with a trivalent N-acetylgalactosamine moiety to target the asialoglycoprotein receptor, achieving simultaneous knockdown of both proteins.

Benefits of technology

The nucleic acid molecules demonstrate significant reduction in HBsAg and HBeAg levels, improving immune response and potentially preventing chronic HBV infection, with a single molecule offering simplicity and efficacy in delivery and concentration requirements.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007798836000076
    Figure 0007798836000076
  • Figure 0007798836000077
    Figure 0007798836000077
  • Figure 0007798836000078
    Figure 0007798836000078
Patent Text Reader

Abstract

To identify novel nucleic acid molecules that can inhibit the expression of both PAPD5 and PAPD7 in vivo and in vitro.SOLUTION: The present invention provides a nucleic acid molecule that is complementary to both PAP-related domain-containing 5 (PAPD5) and PAP-related domain-containing 7 (PAPD7), and inhibits the expression of both PAPD5 and PAPD7 when using a single nucleic acid molecule. The present invention also provides PAPD5 and PAPD7 specific nucleic acid molecules used for the treatment and / or prevention of HBV infections, especially chronic HBV infections. Also included in the present invention are pharmaceutical compositions for use in the treatment and / or prevention of HBV infections.SELECTED DRAWING: Figure 3
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] FIELD OF THE INVENTION The present invention relates to nucleic acid molecules that are complementary to both PAP-associated domain-containing 5 (PAPD5) and PAP-associated domain-containing 7 (PAPD7), and that, when used with a single oligonucleotide, result in inhibition of expression of both PAPD5 and PAPD7. The present invention also provides PAPD5- and PAPD7-specific nucleic acid molecules for use in the treatment and / or prevention of HBV infection, particularly chronic HBV infection. Pharmaceutical compositions for use in the treatment and / or prevention of HBV infection are also included in the present invention. [Background technology]

[0002] HBV infection remains a major health problem worldwide, with an estimated 350 million chronic carriers. Approximately 25% of carriers die from chronic hepatitis, cirrhosis, or liver cancer. Hepatitis B virus is the second most important carcinogen after tobacco, causing 60% to 80% of all primary liver cancers. HBV is 100 times more infectious than HIV.

[0003] Hepatitis B virus (HBV) is an enveloped, partially double-stranded DNA virus. The compact 3.2 kb HBV genome consists of four overlapping open reading frames (ORFs) encoding the core, polymerase (Pol), envelope, and X proteins. The Pol ORF is the longest, and the envelope ORF is located within it, while the X and core ORFs overlap with the Pol ORF. The HBV life cycle involves two major events: 1) the generation of closed circular DNA (cccDNA) from relaxed circular (RC DNA) and 2) the generation of RC DNA by reverse transcription of pregenomic RNA (pgRNA). Prior to infection of host cells, the HBV genome resides within virions as RC DNA. HBV virions can enter host cells by nonspecifically binding to negatively charged proteoglycans present on the surface of human hepatocytes (Schulze, Hepatology, 46, (2007), 1759-68) and by specifically binding the HBV surface antigen (HBsAg) to the hepatocyte sodium taurocholate cotransporting polypeptide (NTCP) receptor (Yan, J Virol, 87, (2013), 7977-91). All HBV viral mRNAs are capped, polyadenylated, and exported to the cytoplasm for translation. In the cytoplasm, assembly of new virions begins, and the nascent pgRNA is packaged with viral Pol, allowing reverse transcription of pgRNA into RC DNA via a single-stranded DNA intermediate.

[0004] The secretion of antiviral cytokines by hepatocytes and / or intrahepatic immune cells in response to HBV infection plays a central role in viral clearance from the infected liver. However, chronically infected patients exhibit only weak immune responses due to various escape strategies employed by the virus to counteract the host cell recognition system and subsequent antiviral responses.

[0005] Numerous observations have shown that several HBV viral proteins can counteract the initial host cell response by interfering with the virus recognition signaling system and subsequent interferon (IFN) antiviral activity. Among these, excessive secretion of empty HBV subviral particles (SVPs, HBsAg) is thought to be involved in maintaining the immune tolerance state observed in chronically infected patients (CHBs). Persistent exposure to HBsAg and other viral antigens can lead to the loss or progressive dysfunction of HBV-specific T cells (Kondo, Journal of Immunology (1993), 150, 4659-4671; Kondo, Journal of Medical Virology (2004), 74, 425-433; Fisicaro, Gastroenterology, (2010), 138, 682-93). Furthermore, HBsAg has been reported to suppress the function of immune cells such as monocytes, dendritic cells (DCs), and natural killer (NK) cells through direct interaction (Op den Brouw, Immunology, (2009b), 126, 280-9; Woltman, PLoS One, (2011), 6, e15324; Shi, J Viral Hepat. (2012), 19, e26-33; Kondo, ISRN Gasteroenterology, (2013), Article ID 935295).

[0006] HBsAg quantification is an important biomarker for prognosis and treatment response in chronic hepatitis B. However, HBsAg clearance and seroconversion are rarely observed in chronically infected patients, yet they represent one of the ultimate goals of treatment. Current treatments, such as nucleoside (nucleotide) analogues, are molecules that inhibit HBV DNA synthesis but do not aim to reduce HBsAg levels. Even with long-term treatment, nucleoside (nucleotide) analogues only produce weak HBsAg clearance (-1% to 2%), comparable to that observed naturally (Janssen, Lancet, (2005), 365, 123-9; Marcellin, N. Engl. J. Med., (2004), 351, 1206-17; Buster, Hepatology, (2007), 46, 388-94). It has recently been shown that fully or partially integrated hepatitis B virus DNA is responsible for HBsAg expression in chronically infected individuals (see Wooddell et al 2017 Sci. Transl. Med. Vol 9, Issue 409, eaan0241).

[0007] Hepatitis B e antigen (also known as HBV envelope antigen or HBeAg) is a viral protein secreted by hepatitis B-infected cells. HBeAg causes chronic hepatitis B infection and is used as a marker of active viral disease and the degree of infection in a patient.

[0008] The function of the hepatitis B virus precore, or HBeAg, is not fully understood. However, it is well known that HBeAg plays an important role in viral persistence. HBeAg is thought to promote HBV chronicity by functioning as an immunomodulatory protein. In particular, HBeAg is a secreted accessory protein that appears to attenuate the host immune response to intracellular nucleoside proteins (Walsh, Virology, 2011, 411(1):132-141). HBeAg may act as an immune tolerant that contributes to HBV persistence and may function in utero, given that soluble HBeAg crosses the placenta (Walsh, Virology, 2011, 411(1):132-141). Furthermore, HBeAg downregulates i) cellular genes that control intracellular signaling and ii) Toll-like receptor 2 (TLR-2), which dampens the innate immune response to viral infection (Walsh, Virology, 2011, 411(1):132-141). In the absence of HBeAg, HBV replication leads to upregulation of the TLR2 pathway (Walsh, Virology, 2011, 411(1):132-141). Thus, HBeAg plays an important role in regulating virus / host interactions and influencing the host immune response (Walsh, Virology, 2011, 411(1):132-141). Therefore, reducing HBeAg in HBeAg-positive patient populations may reverse HBV-specific immune dysfunction (Milich, 1997, J. Viral. Hep. 4: 48-59; Milich, 1998, J. Immunol. 160: 2013-2021). Furthermore, secreted HBeAg is much more efficient than intracellular hepatitis core antigen (HBcAg) in inducing T cell tolerance, and the split T cell tolerance between HBeAg and HBcAg and the clonal heterogeneity of HBc / HBeAg-specific T cell tolerance may have a significant impact on natural HBV infection, especially precore-negative chronic hepatitis (Chen, 2005, Journal of Virology, 79: 3016-3027).

[0009] Therefore, reducing HBeAg secretion in addition to HBsAg secretion may result in improved inhibition of the development of chronic HBV infection compared with inhibiting HBsAg secretion alone. Furthermore, the highest transmission rate from acute to chronic infection (>80%) has been reported in cases of maternal-fetal and neonatal HBV infection from HBeAg-positive mothers (Liaw, Lancet, 2009, 373: 582-592; Liaw, Dig. Dis. Sci., 2010, 55: 2727-2734; and Hadziyannis, 2011, Journal of Hepatology, 55: 183-191). Therefore, reducing HBeAg in pregnant mothers may not only reduce the degree of infection in patients but also prevent the development of chronic HBV infection in their children.

[0010] Therefore, there is an unmet medical need for inhibiting viral expression, in particular the secretion of HBsAg and HBeAg, in the treatment of HBV (Wieland, SF & FV Chisari. J Virol, (2005), 79, 9369-80; Kumar et al. J Virol, (2011), 85, 987-95; Woltman et al. PLoS One, (2011), 6, e15324; Op den Brouw et al. Immunology, (2009b), 126, 280-9).

[0011] WO2017 / 066712 describes the downregulation of PAPD5 in relation to the treatment and diagnosis of telomere disorders, and five shRNA constructs for this purpose are described. PCT / EP2017 / 064980 discloses targeting PAPD5 or PAPD7 using nucleic acid molecules and combinations of such molecules to treat HBV infection. Summary of the Invention

[0012] Object of the invention The present invention identifies novel nucleic acid molecules that can inhibit the expression of both PAPD5 and PAPD7 in vivo and in vitro. The ability to inhibit two target nucleic acids with a single molecule offers distinct advantages in terms of production, simplicity of delivery to target cells, pharmacokinetic / pharmacodynamic (PK / PD) simplicity, and the concentration required to achieve therapeutic efficacy. Furthermore, the present invention demonstrates a correlation between knockdown of PAPD5 and PAPD7 and HBV antigen inhibition, including HBsAg inhibition. [Brief explanation of the drawings]

[0013] The diagram shows the following: [Figure 1A-B] Figure 1 shows exemplary antisense oligonucleotide conjugates in which the oligonucleotide is shown as a wavy line (AD), "oligonucleotide" (EH), or T2(I), and the conjugate moiety targeting the asialoglycoprotein receptor is a trivalent N-acetylgalactosamine moiety. Compounds A through D contain a dilysine branched molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In compounds A and B, the oligonucleotide is directly attached to the conjugate moiety targeting the asialoglycoprotein receptor moiety without a linker. In compounds C and D, the oligonucleotide is attached to the conjugate moiety targeting the asialoglycoprotein receptor moiety via a C6 linker. Compounds E through I contain commercially available trebler branched molecules, spacers of various lengths and structures, and three terminal GalNAc carbohydrate moieties. [Figure 1C-E]Figure 1 shows exemplary antisense oligonucleotide conjugates in which the oligonucleotide is shown as a wavy line (AD), "oligonucleotide" (EH), or T2(I), and the conjugate moiety targeting the asialoglycoprotein receptor is a trivalent N-acetylgalactosamine moiety. Compounds A through D contain a dilysine branched molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In compounds A and B, the oligonucleotide is directly attached to the conjugate moiety targeting the asialoglycoprotein receptor moiety without a linker. In compounds C and D, the oligonucleotide is attached to the conjugate moiety targeting the asialoglycoprotein receptor moiety via a C6 linker. Compounds E through I contain commercially available trebler branched molecules, spacers of various lengths and structures, and three terminal GalNAc carbohydrate moieties. [Figure 1F-H] Figure 1 shows exemplary antisense oligonucleotide conjugates in which the oligonucleotide is shown as a wavy line (AD), "oligonucleotide" (EH), or T2(I), and the conjugate moiety targeting the asialoglycoprotein receptor is a trivalent N-acetylgalactosamine moiety. Compounds A through D contain a dilysine branched molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In compounds A and B, the oligonucleotide is directly attached to the conjugate moiety targeting the asialoglycoprotein receptor moiety without a linker. In compounds C and D, the oligonucleotide is attached to the conjugate moiety targeting the asialoglycoprotein receptor moiety via a C6 linker. Compounds E through I contain commercially available trebler branched molecules, spacers of various lengths and structures, and three terminal GalNAc carbohydrate moieties. [Figure 1I]Figure 1 shows exemplary antisense oligonucleotide conjugates in which the oligonucleotide is shown as a wavy line (AD), "oligonucleotide" (EH), or T2(I), and the conjugate moiety targeting the asialoglycoprotein receptor is a trivalent N-acetylgalactosamine moiety. Compounds A through D contain a dilysine branched molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In compounds A and B, the oligonucleotide is directly attached to the conjugate moiety targeting the asialoglycoprotein receptor moiety without a linker. In compounds C and D, the oligonucleotide is attached to the conjugate moiety targeting the asialoglycoprotein receptor moiety via a C6 linker. Compounds E through I contain commercially available trebler branched molecules, spacers of various lengths and structures, and three terminal GalNAc carbohydrate moieties. [Figure 2]

[0033] Figure 1 shows the structural formula of a trivalent GalNAc cluster (GN2), which is useful as a linking moiety in the present invention. The wavy line indicates the site of attachment of the cluster, e.g., to a C6 amino linker or directly to an oligonucleotide. [Figure 3] 1 shows the correlation between knockdown of PAPD5 and PAPD7 in Hela cells in Example 1 and reduction of HBsAg in dHepRG cells in Example 2. [Figure 4] Structural formula of Compound No. (CMP ID NO:) 20_12. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, Ca2+, or mixtures thereof, associated with the compound. [Figure 5] Structural formula of Compound No. 20_13. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, Ca2+, or mixtures thereof, associated with the compound. [Figure 6] Structural formula of Compound No. 20_14. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, Ca2+, or mixtures thereof, associated with the compound. [Figure 7]Structural formula of Compound No. 20_15. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, Ca2+, or mixtures thereof, associated with the compound. [Figure 8] Structural formula of Compound No. 20_18. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, Ca2+, or mixtures thereof, associated with the compound. [Figure 9] Structural formula of Compound No. 20_36. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, Ca2+, or mixtures thereof, associated with the compound. [Figure 10] Structural formula of Compound No. 20_30. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, Ca2+, or mixtures thereof, associated with the compound. [Figure 11] Figure 1 shows the in vitro reduction of PAPD5 and PAPD7 achieved with oligonucleotides targeting human and mouse transcripts (Table 5) in the human HeLa cell line (A) and primary mouse hepatocytes (PMH, B). [Figure 12] Structural formula of Compound No. 20_20. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, Ca2+, or mixtures thereof, associated with the compound. [Figure 13] Structural formula of Compound No. 20_21. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, Ca2+, or mixtures thereof, associated with the compound. [Figure 14] Structural formula of Compound No. 21_2. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, Ca2+, or mixtures thereof, associated with the compound. [Figure 15] Structural formula of Compound No. 20_22. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, Ca2+, or mixtures thereof, associated with the compound. [Figure 16]Structural formula of Compound No. 21_33. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, Ca2+, or mixtures thereof, associated with the compound. [Figure 17] Structural formula of Compound No. 21_34. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, Ca2+, or mixtures thereof, associated with the compound. [Figure 18] In vivo time course effects on HBsAg and HBeAg in an AAV / HBV mouse model after a single treatment with two 10 mg / kg oligonucleotides, one targeting PAPD5 and one targeting PAPD7. DETAILED DESCRIPTION OF THE INVENTION

[0014] definition nucleic acid molecule The term "nucleic acid molecule" or "therapeutic nucleic acid molecule" as used herein is defined as a molecule (i.e., a nucleotide sequence) containing two or more covalently linked nucleosides, as commonly understood by those skilled in the art. The nucleic acid molecules referred to in the methods of the present invention are generally therapeutic oligonucleotides less than 50 nucleotides in length. The nucleic acid molecule may be or contain an antisense oligonucleotide, or may be another oligomeric nucleic acid molecule, such as a CRISPR RNA, siRNA, shRNA, aptamer, or ribozyme. Nucleic acid molecules are compositions typically created in a laboratory by solid-phase chemical synthesis followed by purification. When referring to the sequence of a nucleic acid molecule, it refers to the sequence or order of the nucleobase moieties, or modifications thereof, or covalently linked nucleotides or nucleosides. The nucleic acid molecules of the present invention are artificial, chemically synthesized, and usually purified or isolated. The nucleic acid molecules of the present invention may contain one or more modified nucleosides or nucleotides.

[0015] In some embodiments, the nucleic acid molecule of the invention comprises or consists of 12 to 50 nucleotides in length, such as 13 to 40, such as 14 to 35, such as 15 to 30, such as 16 to 22, such as 16 to 18, or 15 to 17 contiguous nucleotides.

[0016] In some embodiments, a nucleic acid molecule, or a contiguous nucleotide sequence thereof, comprises or consists of 22 or fewer nucleotides, e.g., 20 or fewer nucleotides, e.g., 18 or fewer nucleotides, e.g., 14, 15, 16, or 17 nucleotides. Ranges given herein should be understood to include the endpoints of the ranges. Thus, when a nucleic acid molecule is said to comprise 10 to 30 nucleotides, both 10 nucleotides and 30 nucleotides are included.

[0017] In some embodiments, the contiguous nucleotide sequence comprises or consists of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides in length.

[0018] The nucleic acid molecule is for regulating the expression of a target nucleic acid in a mammal. In some embodiments, the nucleic acid molecule, such as an siRNA, an shRNA, or an antisense oligonucleotide, is typically for inhibiting the expression of a target nucleic acid.

[0019] In one embodiment of the invention, the nucleic acid molecule is selected from an RNAi agent, such as an siRNA or shRNA. In another embodiment, the nucleic acid molecule is a single-stranded antisense oligonucleotide, such as a high-affinity modified antisense oligonucleotide.

[0020] In some embodiments, the nucleic acid molecule is a phosphorothioate nucleic acid molecule. In some embodiments, the nucleic acid molecule comprises phosphorothioate internucleoside linkages.

[0021] In some embodiments, the nucleic acid molecule may be linked to a non-nucleoside moiety (conjugate moiety).

[0022] A library of nucleic acid molecules should be understood as a collection of variant nucleic acid molecules. The purpose of a library of nucleic acid molecules can vary. In some embodiments, the library of nucleic acid molecules is composed of oligonucleotides having overlapping nucleobase sequences that target common regions between the target nucleic acids of PAPD5 and PAPD7, with the goal of identifying the most potent sequences in the library of nucleic acid molecules. In some embodiments, the library of nucleic acid molecules is a library of designed variants of parent or ancestor nucleic acid molecules (child nucleic acid molecules), where the designed variants retain the core nucleobase sequence of the parent nucleic acid molecule.

[0023] Oligonucleotides The term "oligonucleotide" as used herein is defined as a molecule containing two or more covalently linked nucleosides, as commonly understood by those skilled in the art. Such covalently linked nucleosides can also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are typically produced in a laboratory by solid-phase chemical synthesis followed by purification. When referring to the sequence of an oligonucleotide, it refers to the sequence or order of covalently linked nucleotides or nucleosides of the nucleobase moiety, or modifications thereof. The oligonucleotides of the present invention are artificial, chemically synthesized, and typically purified or isolated. The oligonucleotides of the present invention may contain one or more modified nucleosides or nucleotides.

[0024] antisense oligonucleotides The term "antisense oligonucleotide" as used herein is defined as an oligonucleotide that can modulate the expression of a target gene by hybridizing to a target nucleic acid, particularly a continuous sequence on the target nucleic acid. Antisense oligonucleotides are not inherently double-stranded and are therefore not siRNAs or shRNAs. Preferably, the antisense oligonucleotides of the present invention are single-stranded. The term single-stranded is generally understood by those skilled in the art. In particular, it is understood that single-stranded oligonucleotides of the present invention can form hairpin or intermolecular duplex structures (duplexes between two molecules of the same oligonucleotide) as long as the degree of intra- or inter-self-complementarity is less than 50% of the full length of the oligonucleotide.

[0025] In one embodiment of the present invention, the antisense oligonucleotide is an RNase H recruiting oligonucleotide. In contrast to RNAi molecules, antisense oligonucleotides also act in the nucleus of the cell. Because they act in the nucleus of the cell, they are preferred for targeting pre-mRNA sequences and antisense oligonucleotides.

[0026] RNAi As used herein, the term "RNA interference (RNAi) molecule" refers to a short, double-stranded RNA molecule that can induce RNA-dependent gene silencing via the RNA-induced silencing complex (RISC) in the cytoplasm of a cell, where it interacts with the catalytic RISC component argonaute. One type of RNAi molecule is small interfering RNA (siRNA), a double-stranded RNA molecule that binds complementary mRNA after transcription, causing its degradation and loss of translation. Short hairpin RNA (shRNA) is an artificial RNA molecule with a hairpin structure that, when expressed, can reduce mRNA via DICER and the RNA downregulating silencing complex (RISC). RNAi molecules can be designed based on the RNA sequence of a gene of interest. The corresponding RNAi can then be synthesized chemically or by in vitro transcription, or expressed from a vector or PCR product.

[0027] siRNA and shRNA molecules are typically 20-50 nucleotides in length, e.g., 25-35 nucleotides in length, and interact with an endonuclease known as Dicer, which is believed to process dsRNA into 19-23 base pair small interfering RNAs with characteristic two-base 3' overhangs, which are then incorporated into the RNA-induced silencing complex (RISC). Effective extended forms of Dicer substrates are described in U.S. Patent Nos. 8,349,809 and 8,513,207, incorporated herein by reference. Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing. RNAi agents can be chemically modified using modified internucleotide linkages and high-affinity nucleosides, such as 2'-4' bicyclic ribose-modified nucleosides, including LNA and cET.

[0028] Contiguous nucleotide sequence The term "contiguous nucleotide sequence" refers to a region of an oligonucleotide that is complementary to a target nucleic acid. This term is used interchangeably herein with the terms "contiguous nucleobase sequence" and "oligonucleotide motif sequence." In some embodiments, all nucleotides of an oligonucleotide comprise a contiguous nucleotide sequence. In some embodiments, an oligonucleotide comprises a contiguous nucleotide sequence and may optionally include a nucleotide linker region that can be used to attach additional nucleotides, such as functional groups, to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid.

[0029] nucleotide Nucleotides are the building blocks of oligonucleotides and polynucleotides, and for purposes of the present invention, include both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides, such as DNA and RNA nucleotides, contain a ribose sugar moiety, a nucleobase moiety, and one or more phosphate groups (not present in nucleosides). Nucleosides and nucleotides may also be referred to interchangeably as "units" or "monomers."

[0030] Modified Nucleosides As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside that has been modified relative to an equivalent DNA or RNA nucleoside by the introduction of one or more modifications in the sugar or (nucleic acid) base moiety. In a preferred embodiment, the modified nucleoside comprises a modified sugar moiety. As used herein, the term modified nucleoside may also be used synonymously with the term "nucleoside analog" or modified "unit" or modified "monomer." Nucleosides with unmodified DNA or RNA sugar moieties are referred to herein as DNA or RNA nucleosides. Nucleosides with modifications in the base region of DNA or RNA nucleosides are also generally referred to as DNA or RNA if Watson-Crick base pairing is possible.

[0031] Modified internucleoside linkages The term "modified internucleoside linkage" is defined as a linkage other than a phosphodiester (PO) linkage that covalently links two nucleosides, as commonly understood by those skilled in the art. Nucleosides having modified internucleoside linkages are also referred to as "modified nucleotides." In some embodiments, modified internucleoside linkages increase the nuclease resistance of the nucleic acid molecules of the present invention compared to phosphodiester linkages. In the case of naturally occurring oligonucleotides, the internucleoside linkages include a phosphate group that forms a phosphodiester bond between consecutive nucleosides. Modified internucleoside linkages are particularly useful for stabilizing oligonucleotides and siRNAs for in vivo use and can help protect against nuclease cleavage in the DNA or RNA nucleoside regions of the oligonucleotides or siRNAs of the present invention, for example, in the gap region of a gapmer oligonucleotide as well as in the region of modified nucleosides.

[0032] In some embodiments, nucleic acid molecules, such as antisense oligonucleotides, shRNAs, or siRNAs, contain one or more internucleoside linkages that have been modified from natural phosphodiester to, for example, linkages that are more resistant to nuclease attack. Nuclease resistance can be determined by incubating the oligonucleotide in serum or by nuclease resistance assays (e.g., by using snake venom phosphodiesterase (SVPD), both of which are well known in the art). Internucleoside linkages that can increase the nuclease resistance of an oligonucleotide are called nuclease-resistant internucleoside linkages. In some embodiments, at least 50% of the internucleoside linkages of the antisense oligonucleotide or its consecutive nucleotide sequence are modified, for example, at least 60%, for example, at least 70%, for example, at least 80%, for example, at least 90% of the internucleoside linkages of the oligonucleotide or its consecutive nucleotide sequence are modified. In some embodiments, all of the internucleoside linkages of the oligonucleotide or its consecutive nucleotide sequence are modified. It will be appreciated that in some embodiments, the nucleosides linking the oligonucleotides of the invention to non-nucleotide functional groups, e.g., conjugates, may be phosphodiesters. In some embodiments, all of the internucleoside linkages of the oligonucleotide or its contiguous nucleotide sequence are nuclease-resistant internucleoside linkages.

[0033] The modified internucleoside linkage can be selected from the group consisting of phosphorothioate, diphosphorothioate, and boranophosphate. In some embodiments, the modified internucleoside linkage is compatible with RNase H recruitment of the oligonucleotides of the invention, such as phosphorothioate, diphosphorothioate, or boranophosphate.

[0034] In some embodiments, the internucleoside linkage, such as a phosphorothioate internucleoside linkage, comprises sulfur (S).

[0035] Phosphorothioate internucleoside linkages are particularly useful due to their nuclease resistance, favorable pharmacokinetics, and ease of manufacture. In some embodiments, at least 50% of the internucleoside linkages of an oligonucleotide or its consecutive nucleotide sequence are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 75%, such as at least 80%, or such as at least 90% of the internucleoside linkages of an oligonucleotide or its consecutive nucleotide sequence are phosphorothioate. In some embodiments, all of the internucleoside linkages of an oligonucleotide or its consecutive nucleotide sequence are phosphorothioate. In some embodiments, at least one of the phosphorothioate internucleoside linkages is stereodefined, such as at least 20%, 30%, 40%, 50%, 60%, such as at least 70%, such as at least 75%, such as at least 80%, or such as at least 90% of the internucleoside linkages in the oligonucleotide are stereodefined. The synthesis of stereodefined phosphorothioate linkages is described, for example, in WO2014 / 012081 and WO2016 / 079181.

[0036] In some embodiments, the oligonucleotide comprises one or more neutral internucleoside linkages, particularly internucleoside linkages selected from phosphotriester, methylphosphonate, MMI, amide-3, formacetal, or thioformacetal.

[0037] Further internucleoside linkages are disclosed in WO2009 / 124238 (hereby incorporated by reference). In one embodiment, the internucleoside linkage is selected from the linkers disclosed in WO2007 / 031091 (hereby incorporated by reference). In particular, the internucleoside linkage is selected from the linkers -OP(O)2-O-, -OP(O,S)-O-, -OP(S)2-O-, -SP(O)2-O-, -SP(O,S)-O-, -SP(S)2-O-, -OP(O)2-S-, -OP(O,S)-S-, -SP(O)2-S-, -O-PO(R H)-O-, O-PO(OCH3)-O-, -O-PO(NR H )-O-, -O-PO(OCH2CH2S-R)-O-, -O-PO(BH3)-O-, -O-PO(NHR H )-O-, -OP(O)2-NR H -, -NR H -P(O)2-O-, -NR H -CO-O-, -NR H -CO-NR H and / or the internucleoside linker may be selected from -O-CO-O-, -O-CO-NR H -, -NR H -CO-CH2-, -O-CH2-CO-NR H -, -O-CH2-CH2-NR H -, -CO-NR H -CH2-, -CH2-NR H CO-, -O-CH2-CH2-S-, -S-CH2-CH2-O-, -S-CH2-CH2-S-, -CH2-SO2-CH2-, -CH2-CO-NR H -, -O-CH2-CH2-NR H -CO-, -CH-NCH-O-CH-, where R H is selected from hydrogen and C1-4 alkyl.

[0038] Nuclease-resistant linkages, such as phosphothioate linkages, are particularly useful in regions of antisense oligonucleotides that can recruit nucleases when duplexed with a target nucleic acid, such as region G of a gapmer or the unmodified nucleoside regions of a headmer or tailmer, although phosphorothioate linkages are also useful in non-nuclease recruiting and / or affinity-enhancing regions, such as regions F and F' of a gapmer or the modified nucleoside regions of a headmer or tailmer.

[0039] However, each of the design regions may also include internucleoside linkages other than phosphorothioates, such as phosphodiester linkages, particularly in regions where modified nucleosides, such as LNAs, protect the linkage from nuclease degradation. Inclusion of phosphodiester linkages, such as one or two linkages, particularly between or adjacent to modified nucleoside units (generally within non-nuclease recruitment regions), can modify the bioavailability and / or biodistribution of the oligonucleotide (see WO2008 / 113832, incorporated herein by reference).

[0040] In one embodiment, all internucleoside linkages in the antisense oligonucleotide are phosphorothioate and / or boranophosphate linkages. Preferably, all internucleoside linkages in the oligonucleotide are phosphorothioate linkages.

[0041] Stereorandom phosphorothioate linkages A phosphorothioate linkage is an internucleoside phosphate linkage in which one of the non-bridging oxygens has been replaced with sulfur. Substitution of one non-bridging oxygen with sulfur introduces a chiral center, so within a single phosphorothioate oligonucleotide, each phosphorothioate internucleoside linkage can be either the S (Sp) or R (Rp) stereoisomer. Such internucleoside linkages are called "chiral internucleoside linkages." In comparison, phosphodiester internucleoside linkages are achiral because they have two non-terminal oxygen atoms.

[0042] The chirality assignment of stereocenters is determined by the standard Cahn-Ingold-Prelog priority rule (CIP priority rule), first published in Cahn, RS; Ingold, CK; Prelog, V. (1966). "Specification of Molecular Chirality". Angewandte Chemie International Edition. 5 (4): 385-415. doi:10.1002 / anie.196603851.

[0043] During standard oligonucleotide synthesis, the stereoselectivity of coupling and subsequent sulfurization is not controlled. Therefore, the stereochemistry of each phosphorothioate internucleoside linkage is randomly Sp or Rp, and therefore, phosphorothioate oligonucleotides produced by conventional oligonucleotide synthesis are actually 2 X The oligonucleotides may exist in as many as 2 different phosphorothioate diastereoisomers (X being the number of phosphorothioate internucleoside linkages). Such oligonucleotides are referred to herein as stereorandom phosphorothioate oligonucleotides and do not contain stereodefined internucleoside linkages. Thus, stereorandom phosphorothioate oligonucleotides are mixtures of individual diastereoisomers derived from non-stereodefined synthesis. In this context, the mixture may contain up to 2 X are defined as three different phosphorothioate diastereoisomers.

[0044] Stereodefined internucleoside linkages A stereodefined internucleoside linkage is an internucleoside linkage that introduces a chiral center into an oligonucleotide and exists predominantly in one stereoisomer, either R or S, within a population of individual oligonucleotide molecules.

[0045] It should be recognized that stereoselective oligonucleotide synthesis methods used in the art typically provide at least about 90% or at least about 95% stereoselectivity at each internucleoside bond stereocenter, and thus up to about 10%, e.g., about 5%, of the oligonucleotide molecules may possess alternative stereoisomeric forms.

[0046] In some embodiments, the stereoselectivity of each stereodefined phosphorothioate stereocenter is at least about 90%. In some embodiments, the stereoselectivity of each stereodefined phosphorothioate stereocenter is at least about 95%.

[0047] Stereodefined phosphorothioate linkages Stereodefined phosphorothioate linkages are phosphorothioate linkages chemically synthesized in either the Rp or Sp configuration within a population of individual oligonucleotide molecules, providing at least about 90% or at least about 95% stereoselectivity at each stereocenter, such that up to about 10%, e.g., about 5%, of the oligonucleotide molecules may have alternative stereoisomeric forms.

[0048] The configuration of the phosphorothioate internucleoside linkage is shown below. [ka] Here, the 3'R group represents the 3' position of consecutive nucleosides (5' nucleosides), and the 5'R group represents the 5' position of consecutive nucleosides (3' nucleosides).

[0049] An Rp internucleoside linkage may also be designated as srP, and an Sp internucleoside linkage may also be designated herein as ssP.

[0050] In some embodiments, the stereoselectivity of each stereodefined phosphorothioate stereocenter is at least about 97%. In some embodiments, the stereoselectivity of each stereodefined phosphorothioate stereocenter is at least about 98%. In some embodiments, the stereoselectivity of each stereodefined phosphorothioate stereocenter is at least about 99%.

[0051] In some embodiments, the stereoselective internucleoside linkages are of the same stereoisomeric form in at least 97%, such as at least 98%, such as at least 99%, or (essentially) all, of the oligonucleotide molecules present in the population of oligonucleotide molecules.

[0052] Stereoselectivity can be measured in a model system containing only the achiral backbone (i.e., phosphodiester). For example, the stereoselectivity of each monomer can be measured by coupling a stereodefined monomer to the following model system: 5't-po-t-po-t-po-t-po 3'. This results in 5'DMTr-t-srp-t-po-t-po-t-po 3' or 5'DMTr-t-ssp-t-po-t-po-t-po 3', which can be separated using HPLC. Stereoselectivity is determined by integrating the UV signal from the two possible compounds to give a ratio, e.g., 98:2, 99:1, or >99:1.

[0053] It is understood that the percent stereopurity of a particular single diastereoisomer (a single stereodefined oligonucleotide molecule) is a function of the linkage selectivity of the defined stereocenter at each internucleoside position and the number of stereodefined internucleoside linkages introduced. For example, if the linkage selectivity at each position is 97%, the resulting purity of a stereodefined oligonucleotide having 15 stereodefined internucleoside linkages will be 0.97%. 15 , i.e., 63% of the desired diastereoisomer compared to 37% of the other diastereoisomer. The purity of the defined diastereoisomers can be improved after synthesis by purification, for example, by HPLC, such as ion exchange chromatography or reverse phase chromatography.

[0054] In some embodiments, stereodefined oligonucleotides refers to a population of oligonucleotides where at least about 40%, eg, at least about 50%, of the population are the desired diastereoisomer.

[0055] Stated another way, in some embodiments, a stereodefined oligonucleotide refers to a population of oligonucleotides, wherein at least about 40%, e.g., at least about 50%, of the population consists of a desired (specific) stereodefined internucleoside linkage motif (also called a stereodefined motif).

[0056] For stereodefined oligonucleotides containing both stereorandom and stereodefined internucleoside stereocenters, the purity of the stereodefined oligonucleotide is determined in terms of the % of the population of oligonucleotides that retain the defined stereodefined internucleoside linkage motif, with the stereorandom linkages being ignored in the calculation.

[0057] Nucleic acid bases The term "nucleobase" includes purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides that form hydrogen bonds during nucleic acid hybridization. In the context of the present invention, the term "nucleobase" also encompasses modified nucleobases that may differ from naturally occurring nucleobases but are functional in nucleic acid hybridization. In this context, "nucleobase" refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, in Hirao et al. (2012) Accounts of Chemical Research, Vol. 45, page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Suppl. 37, 1.4.1.

[0058] In some embodiments, the nucleobase moiety is modified by changing the purine or pyrimidine to a modified purine or pyrimidine, e.g., a substituted purine or pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiozolocytosine, 5-propynylcytosine, 5-propynyluracil, 5-bromouracil, 5-thiazolauracil, 2-thiouracil, 2'thiothymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0059] The nucleobase moieties can be represented by the letter code of the corresponding nucleobase, for example, A, T, G, C, or U (each letter can optionally include a modified nucleobase having an equivalent function). For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methylcytosine. Optionally, 5-methylcytosine LNA nucleosides can be used in LNA gapmers.

[0060] Modified Oligonucleotides The term modified oligonucleotide or modified nucleic acid molecule refers to an oligonucleotide or nucleic acid molecule containing one or more sugar-modified nucleosides and / or modified internucleoside linkages. The term "chimeric" is a term used in the literature to describe oligonucleotides or nucleic acid molecules having modified nucleosides, particularly gapmer oligonucleotides.

[0061] Stereodefined oligonucleotides A stereodefined oligonucleotide is an oligonucleotide in which at least one of the internucleoside linkages is a stereodefined internucleoside linkage. A stereodefined phosphorothioate oligonucleotide is an oligonucleotide in which at least one of the internucleoside linkages is a stereodefined phosphorothioate internucleoside linkage.

[0062] Stereodefined internucleoside motifs A stereodefined internucleoside motif, also referred to herein as a stereodefined motif, refers to a pattern of stereodefined R and S internucleoside linkages in a stereodefined oligonucleotide, designated 5'-3'. For example, a stereodefined oligonucleotide 5'-T srP C ssP A ssP a srP c srP t ssP t srP t srP c ssP a srP c ssP t srP t ssP C ssP A ssP G-3' (SEQ ID NO: 18) has a stereodefined internucleoside motif of RSSRRSRRSRSRSRSSS.

[0063] With regard to the sub-libraries of stereodefined oligonucleotides, these will contain a common stereodefined internucleoside motif in an essentially stereorandom background (optionally containing one or more non-chiral internucleoside linkages, e.g., phosphodiester linkages).

[0064] For example, oligonucleotides 5'-T s C s A s a s c srP t ssP t ssP t srP c s a s c s t s t s C s A s G-3 (SEQ ID NO: 18) has a stereodefined internucleoside motif of XXXXRSSRXXXXXXX, where X represents a stereorandom phosphorothioate internucleoside linkage (denoted in the compound as subscript s). Note that in this example, the first 5' stereodefined internucleoside linkage is the fifth internucleoside linkage from the 5' end (between nucleosides at positions 4 and 5), and therefore the above motif is also referred to as "RSSR" at (internucleoside linkage) position 5.

[0065] When a stereodefined internucleoside motif (stereodefined motif) is composed of a series of consecutive stereodefined internucleoside linkages (i.e., located between consecutive nucleosides), it is referred to herein as a consecutive stereodefined internucleoside motif (consecutive stereodefined motif). It will be understood that a consecutive stereodefined motif must contain two or more consecutive stereodefined internucleoside linkages.

[0066] In the sublibrary mixture, the stereodefined internucleoside motifs may also not be contiguous, ie, the stereodefined internucleoside linkages are interspersed with one or more stereorandom internucleoside linkages.

[0067] For example, the compound 5'-T s C ssP A s a s c srP t ssP t s t s c s a s c s t s t ssP C srP A ssP G-3 (SEQ ID NO: 18) has the non-sequential motif XSXXRSXXXXXXSRS.

[0068] Parent oligonucleotide A parent oligonucleotide is an oligonucleotide having a defined nucleobase sequence (motif sequence). In the method of the present invention, the parent oligonucleotide is an oligonucleotide that is improved using the method of the present invention, typically by generating one or more libraries.

[0069] Typically, the library allows for varying nucleoside modifications (design libraries) while maintaining the parent nucleobase sequence and stereochemistry (usually stereorandom).

[0070] Alternatively, libraries can alter the stereochemistry of the parent oligonucleotide while maintaining the nucleobase sequence (motif sequence) and nucleoside modification pattern (design). In such libraries, the stereochemistry of one or more (2+) internucleoside linkages is stereodefined and different from that of the parent oligonucleotide.

[0071] In some embodiments, the parent oligonucleotides are stereorandom phosphorothioate oligonucleotides. In some embodiments, the parent oligonucleotides are stereorandom phosphorothioate oligonucleotide gapmers.

[0072] In some embodiments, the parent oligonucleotides can be sub-libraries that contain a common stereo-defining motif.

[0073] Stereodefining variants (child oligonucleotides) A stereodefined variant of an oligonucleotide is an oligonucleotide that retains the same sequence and nucleoside modifications (i.e., the same sequence and nucleoside modification chemistry and design) as the parent oligonucleotide, but differs in one or more stereodefined internucleoside linkages, e.g., one or more stereodefined phosphorothioate internucleoside linkages (stereodefined phosphorothioate variants).

[0074] The stereodefined variants can be sub-libraries or completely stereodefined oligonucleotides.

[0075] Stereodefined oligonucleotide sublibraries Oligonucleotides, including both stereo-random and stereo-defined oligonucleotides, are referred to herein as sub-libraries. Sub-libraries are less complex mixtures of diastereomeric mixtures of completely stereo-random oligonucleotides, and therefore represent a subset of all possible diastereoisomers. For example, theoretically, a completely phosphorothioate stereo-random 16-mer can be 2 15 A sublibrary that is a mixture of (32,768) diastereoisomers but in which one of the phosphorothioate internucleoside linkages is stereodefined would have half the complexity of the library (16,384 diastereoisomers), assuming 100% stereoselective coupling efficiency (2 stereodefined linkages = 8,192 diastereoisomers; 3 stereodefined linkages = 4,096 diastereoisomers; 4 stereodefined linkages = 2,048 diastereoisomers; 5 stereodefined linkages = 1,024 diastereoisomers).

[0076] Fully stereodefined oligonucleotides A fully stereodefined oligonucleotide is an oligonucleotide in which all chiral internucleoside linkages present in the oligonucleotide are stereodefined. A fully stereodefined phosphorothioate oligonucleotide is an oligonucleotide in which all chiral internucleoside linkages present in the oligonucleotide are stereodefined phosphorothioate internucleoside linkages.

[0077] It will be appreciated that in some embodiments, a fully stereodefined oligonucleotide contains one or more non-chiral internucleoside linkages, such as phosphodiester internucleoside linkages, e.g., phosphodiester linkages can be used within the flanking regions of a gapmer and / or, when linking terminal nucleosides, between the short region of DNA nucleosides (biocleavable linker) joining the gapmer sequence and the conjugate group.

[0078] In some embodiments of a fully stereodefined oligonucleotide, all internucleoside linkages present in the oligonucleotide or in a region of consecutive nucleotides thereof, e.g., an FG-F' gapmer, are stereodefined internucleoside linkages, such as stereodefined phosphorothioate internucleoside linkages.

[0079] Complementarity The term "complementarity" refers to the ability of nucleosides / nucleotides to form Watson-Crick base pairs. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). Oligonucleotides may contain nucleosides with modified nucleobases; for example, 5-methylcytosine is often used instead of cytosine; therefore, the term "complementarity" will be understood to include Watson-Crick base pairs between unmodified and modified nucleobases (see, for example, Hirao et al. (2012) Accounts of Chemical Research vol. 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).

[0080] As used herein, the term "% complementarity" refers to the percent number of nucleotides in a contiguous nucleotide sequence in a nucleic acid molecule (e.g., an oligonucleotide) that is complementary (i.e., Watson-Crick base paired) at a given position to a contiguous nucleotide sequence at a given position in another nucleic acid molecule (e.g., a target nucleic acid). The percentage is calculated by dividing the number of aligned bases that form pairs between the two sequences (when the target sequence is aligned 5'-3' and the oligonucleotide sequence is aligned 3'-5') by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison, non-aligned (non-base paired) nucleobases / nucleotides are referred to as mismatches. Preferably, insertions and deletions are not taken into account in calculating the % complementarity of a contiguous nucleotide sequence.

[0081] The term "fully complementary" refers to 100% complementarity.

[0082] Below is an example of an oligonucleotide (SEQ ID NO: 12) that is perfectly complementary to a region of a target nucleic acid. 759 ctgtggatgcagatctgggaga 781 (positions 759-781 of SEQ ID NO: 1) |||||||||||||||| 1 -3'-ACCTACGTCTAGACCC-5'--- 16 (SEQ ID NO: 12)

[0083] identity The term "identity," as used herein, refers to the percent number of nucleotides of a contiguous nucleotide sequence in a nucleic acid molecule (e.g., an oligonucleotide) that is identical (i.e., in its ability to Watson-Crick base pair with complementary nucleosides) at a given position to a contiguous nucleotide sequence at a given position in another nucleic acid molecule (e.g., a target nucleic acid). The percent is calculated by dividing the number of aligned bases that are identical between the two sequences by the total number of nucleotides in the oligonucleotide and multiplying by 100. Percent identity = (number of matches x 100) / length of aligned region. Preferably, insertions and deletions are not taken into account in calculating the percent complementarity of contiguous nucleotide sequences.

[0084] Hybridization As used herein, the term "hybridizing" or "hybridizing" refers to the formation of hydrogen bonds between base pairs on opposing strands of two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid), thus forming a duplex. The binding affinity between two nucleic acid strands is the strength of hybridization. This is often described in terms of the melting temperature (Tm), defined as the temperature at which half of the oligonucleotide forms a duplex with the target nucleic acid. Under physiological conditions, Tm is not strictly proportional to affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The Gibbs free energy ΔG° under standard conditions is a more accurate expression of binding affinity and is related to the dissociation constant (Kd) of the reaction by ΔG° = -RTln(Kd), where R is the gas constant and T is the absolute temperature. Therefore, a very small ΔG° of the reaction between an oligonucleotide and a target nucleic acid reflects strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction in which the aqueous solution has a concentration of 1M, pH 7, and temperature 37°C. The hybridization of oligonucleotide to target nucleic acid is a spontaneous reaction, and in the case of spontaneous reaction, ΔG° is less than zero. ΔG° can be experimentally measured using isothermal titration calorimetry (ITC) method, for example, as described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discovery Today. Those skilled in the art will be familiar with the availability of commercially available equipment for measuring ΔG°. ΔG° can also be estimated numerically using the nearest neighbor model described in SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465, using appropriately derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405.To allow for the possibility of modulating a nucleic acid target of interest through hybridization, the oligonucleotides of the present invention hybridize to a target nucleic acid with an estimated ΔG° value of less than -10 kcal for oligonucleotides 10 to 30 nucleotides in length. In some embodiments, the degree or strength of hybridization is measured by the standard Gibbs free energy ΔG°. The oligonucleotides may hybridize to a target nucleic acid with an estimated ΔG° value of less than -10 kcal, e.g., less than -15 kcal, less than -20 kcal, or less than -25 kcal for oligonucleotides 8 to 30 nucleotides in length. In some embodiments, the oligonucleotides hybridize to a target nucleic acid with an estimated ΔG° value of -10 to -60 kcal, e.g., -12 to -40 kcal, e.g., -15 to -30 kcal, or -16 to -27 kcal, e.g., -18 to -25 kcal.

[0085] target nucleic acid According to the present invention, there are two target nucleic acids to be regulated by the same oligonucleotide. These target nucleic acids are i) a nucleic acid encoding a mammalian PAPD5 (target nucleic acid 1) and ii) a nucleic acid encoding a mammalian PAPD7 (target nucleic acid 2). The target nucleic acid may be, for example, a gene, RNA, mRNA, pre-mRNA, mature mRNA, or cDNA sequence. Suitably, the target nucleic acid encodes a PAPD5 or PAPD7 protein, in particular a mammalian PAPD5 or PAPD7, such as human PAPD5 or PAPD7, which provide the pre-mRNA sequences of human, monkey, and mouse PAPD5 and PAPD7 (see, for example, Tables 1 and 2).

[0086] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NOs: 1, 3, and / or 5, or naturally occurring variants thereof (eg, sequences encoding mammalian PAPD5).

[0087] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NO: 2, 4, and / or 6, or 11, or a naturally occurring variant thereof (eg, a sequence encoding a mammalian PAPD7). [Table 1A]

[0088] [Table 1B]

[0089] When using the oligonucleotides of the invention in research or diagnostics, the target nucleic acid can be cDNA or synthetic nucleic acid derived from DNA or RNA.

[0090] For in vivo or in vitro applications, the oligonucleotides of the present invention are typically capable of inhibiting the expression of PAPD5 and PAPD7 target nucleic acids in cells expressing the PAPD5 and PAPD7 target nucleic acids. The contiguous sequence of nucleobases of the oligonucleotides of the present invention is typically complementary to conserved regions of the PAPD5 and PAPD7 target nucleic acids measured over the length of the oligonucleotide, optionally excluding one or two mismatches, and optionally excluding a nucleotide-based linker region that may link the oligonucleotide to any functional group, such as a conjugate, or other non-complementary terminal nucleotide (e.g., region D' or D''). Further information regarding exemplary target nucleic acids is provided in Table 2. [Table 2]

[0091] Target sequence As used herein, the term "target sequence" refers to a sequence of nucleotides present in a target nucleic acid that comprises a nucleobase sequence complementary to an oligonucleotide or nucleic acid molecule of the present invention. In some embodiments, the target sequence consists of a region (i.e., a subsequence) on the target nucleic acid that is complementary to a contiguous nucleotide sequence of an oligonucleotide of the present invention.

[0092] In the present invention, the target sequence is present in both human PAPD5 and human PAPD7 target nucleic acids. Thus, the target sequence may be referred to as a dual-specific target sequence present in both PAPD5 and PAPD7 target nucleic acids. In a preferred embodiment, the target sequence is also present in at least one additional species, such as PAPD5 and PAPD7 from cynomolgus monkeys and / or PAPD5 and PAPD7 from mice.

[0093] An oligonucleotide or nucleic acid molecule of the invention comprises a contiguous nucleotide sequence that is complementary to or hybridizes to a region on a target nucleic acid, such as the target sequences described herein.

[0094] The target nucleic acid sequence to which the oligonucleotide is complementary or hybridizes generally comprises a stretch of contiguous nucleobases of at least 10 nucleotides, where the contiguous nucleotide sequence is 10 to 50 nucleotides, such as 12 to 30, for example 13 to 25, such as 14 to 20, for example 15 to 18 contiguous nucleotides.

[0095] Naturally occurring variants The term "naturally occurring variant" refers to a variant of the PAPD5 or PAPD7 gene or transcript that originates from the same genetic locus as the target nucleic acid, but may differ, for example, due to degeneracy of the genetic code resulting in a variety of codons encoding the same amino acid, or due to alternative splicing of pre-mRNA, or due to the presence of polymorphisms, such as single nucleotide polymorphisms, and allelic variants. Thus, the oligonucleotides of the invention may target the target nucleic acid and its naturally occurring variants based on the presence of a sufficient complementary sequence to the oligonucleotide.

[0096] In some embodiments, the naturally occurring variant has at least 95%, e.g., at least 98%, or at least 99% homology to a mammalian PAPD5 target nucleic acid, such as a target nucleic acid selected from the group consisting of SEQ ID NO: 1, 3, or 5. In some embodiments, the naturally occurring variant has at least 99% homology to the human PAPD5 target nucleic acid of SEQ ID NO: 1. In some embodiments, the naturally occurring variant is a polymorphism listed in Table 3A.

[0097] In some embodiments, the naturally occurring variant has at least 95%, e.g., at least 98%, or at least 99% homology to a mammalian PAPD5 target nucleic acid, such as a target nucleic acid selected from the group consisting of SEQ ID NO: 2, 4, or 6. In some embodiments, the naturally occurring variant has at least 99% homology to a human PAPD7 target nucleic acid of SEQ ID NO: 2. In some embodiments, the naturally occurring variant is a polymorphism listed in Table 3B.

[0098] A number of single nucleotide polymorphisms are known in the PAPD5 or PAPD7 gene, such as those disclosed in Table 3A (human PAPD5 pre-mRNA start / reference sequence is SEQ ID NO: 1) and Table 3B (human PAPD7 pre-mRNA start / reference sequence is SEQ ID NO: 2). [Table 3A] [Table 3B]

[0099] Regulation of expression As used herein, the term "modulation of expression" is understood as a general term for the ability of a nucleic acid molecule to alter the amount of PAPD5 and PAPD7 compared to the amount of PAPD5 and PAPD7 before administration of the nucleic acid molecule. Alternatively, modulation of expression can be determined by reference to a control experiment. A control is generally understood to be an individual or target cells treated with a saline composition, or an individual or target cells treated with a non-target molecule or nucleic acid molecule (mock). However, it can also be an individual treated with standard medical care.

[0100] One type of modulation is the ability of nucleic acid molecules, such as antisense oligonucleotides, to inhibit, downregulate, reduce, eliminate, stop, prevent, alleviate, decrease, avoid or terminate expression of PAPD5 and PAPD7, for example by degrading mRNA or blocking transcription.

[0101] High-affinity modified nucleosides High-affinity modified nucleosides are modified nucleotides that, when incorporated into an oligonucleotide, increase the affinity of the oligonucleotide for its complementary target, e.g., as measured by melting temperature (Tm). The high-affinity modified nucleosides of the present invention preferably result in an increase in melting temperature of +0.5 to +12°C per modified nucleoside, more preferably +1.5 to +10°C, and most preferably +3 to +8°C. Numerous high-affinity modified nucleosides are known in the art, including many 2'-sugar modified nucleosides, such as 2'-substituted nucleosides, e.g., Ome and MOE, and 2'-to-4'-bridged nucleic acids, e.g., locked nucleic acids (LNA) (e.g., Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).

[0102] Sugar modifications Nucleic acid molecules of the present invention may contain one or more nucleosides having modified sugar moieties, ie, modifications in the sugar moiety compared to the ribose sugar moiety found in DNA and RNA.

[0103] A number of nucleosides have been created with modifications to the ribose sugar moiety, primarily with the aim of improving some property of the nucleic acid molecule, such as affinity and / or nuclease resistance.

[0104] Such modifications include those in which the ribose ring structure has been modified, for example, by substitution with a hexose ring (HNA) or bicyclic ring, typically having a biradical bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring (e.g., UNA), typically lacking a bond between the C2 and C3 carbons. Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (WO 2011 / 017521) or tricyclic nucleic acids (WO 2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety has been replaced with a non-sugar moiety, for example, in the case of peptide nucleic acids (PNAs) or morpholino nucleic acids.

[0105] Sugar modifications also include modifications made by changing the substituents on the ribose ring to groups other than hydrogen or to the -OH groups naturally found in RNA or DNA nucleosides, for example, at the 2', 3', 4', or 5' position.

[0106] 2' sugar-modified nucleosides A 2' sugar modified nucleoside is a nucleoside that has a substituent other than H or -OH at the 2' position (2' substituted nucleoside) or that contains a 2' linked biradical that can form a bridge between the 2' carbon and the second carbon in the ribose ring, e.g., an LNA (2'-4' biradical bridge) nucleoside.

[0107] Indeed, much focus has been placed on the development of 2'-substituted nucleosides, and many 2'-substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, 2'-modified sugars may provide enhanced binding affinity to oligonucleotides and / or increased nuclease resistance. Examples of 2'-substituted modified nucleosides include 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. For further examples, see, e.g., Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are diagrams of 2'-substituted modified nucleosides. [ka]

[0108] In the context of the present invention, 2' substitutions do not include 2' bridging molecules such as LNA.

[0109] Locked Nucleoside (LNA) An "LNA nucleoside" is a 2'-sugar modified nucleoside that contains a biradical (also called a "2'-4' bridge") linking the C2' and C4' ends of the ribose sugar ring of the nucleoside, or restricting or locking the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNAs). Locking the conformation of the ribose results in enhanced hybridization affinity (duplex stabilization) when LNAs are incorporated into oligonucleotides of complementary RNA or DNA molecules. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complement duplex.

[0110] In some embodiments, the 2'-sugar modified nucleoside or LNA nucleoside of the oligomer of the invention has the general structure of Formula I or II: [ka] In the formula, W is -O-, -S-, -N(R a )-, -C(R a R b )-, for example, in some embodiments, selected from -O-; B represents a nucleobase or a modified nucleobase moiety; Z represents an internucleoside linkage to an adjacent nucleoside or the 5'-terminus; Z * indicates an internucleoside linkage to an adjacent nucleoside or the 3'-terminal group; X is -C(R a R b )-, -C(R a )=C(R b )-, -C(R a )=N-, -O-, -Si(R a )2-, S-, -SO2-, -N(R a )-, and >C=Z.

[0111] In some embodiments, X is —O—, —S—, NH—, NR a R b , -CH2-, CR a R b , -C(=CH2)-, and -C(=CR a R b )-. In some embodiments, X is —O—.

[0112] Y is -C(R a R b )-, -C(R a )=C(R b )-, -C(R a )=N-, -O-, -Si(R a)2-, -S-, -SO2-, -N(R a )-, and >C=Z.

[0113] In some embodiments, Y is —CH—, —C(R a R b )-, -CH2CH2-, -C(R a R b )-C(R a R b )-, -CH2CH2CH2-, -C(R a R b )C(R a R b )C(R a R b )-, -C(R a )=C(R b )- and -C(R a )=N-.

[0114] In some embodiments, Y is -CH2-, -CHR a -, -CHCH3-, CR a R b - selected from the group consisting of or -XY- together represent a divalent linker group (also called a radical), and together form -C(R a R b )-, -C(R a )=C(R b )-, -C(R a )=N-, -O-, -Si(R a )2-, -S-, -SO2-, -N(R a )-, and >C=Z.

[0115] In some embodiments, -X-Y- represents a biradical selected from the group consisting of: -X-CH2-, -X-CR a R b -, -X-CHR a-, -XC(HCH3)-, -OY-, -O-CH2-, -S-CH2-, -NH-CH2-, -O-CHCH3-, -CH2-O-CH2, -O-CH(CH3CH3)-, -O-CH2-CH2-, OCH2-CH2-CH2- , -O-CH2OCH2-, -O-NCH2-, -C(=CH2)-CH2-, -NR a -CH2-, NO-CH2, -S-CR a R b -, and -S-CHR a -.

[0116] In some embodiments, -XY- represents -O-CH2- or -O-CH(CH3)-; In the formula, Z is —O—, —S—, and —N(R a )-selected from R a and if present, R b are each independently hydrogen, optionally substituted C 1-6 -alkyl, optionally substituted C 2-6 -alkenyl, optionally substituted C 2-6 -alkynyl, hydroxy, optionally substituted C 1-6 -alkoxy, C 2-6 -alkoxyalkyl, C 2-6 -Alkenyloxy, carboxy, C 1-6 -alkoxycarbonyl, C 1-6 -alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono-, and di(C 1-6 -alkyl)amino, carbamoyl, mono- and di(C 1-6 -alkyl)-amino-carbonyl, amino-C 1-6 -Alkyl-aminocarbonyl, mono- and di(C 1-6 -alkyl)amino-C 1-6 -Alkyl-aminocarbonyl, C1-6-Alkyl-carbonylamino, Carbamide, C 1-6 -Alkanoyloxy, sulfonyloxy, C 1-6-Alkyl sulfonyloxy, nitro, azido, sulfanyl, C 1-6 -alkylthio, halogen, wherein aryl and heteroaryl are optionally substituted, and two geminal substituents R a and R b may together represent an optionally substituted methylene (=CH2), where the asymmetric groups may be in either the R or S orientation for all chiral centers.

[0117] In the formula, R 1 , R 2 , R 3 , R 5 , and R 5* are independently hydrogen, optionally substituted C 1-6 -alkyl, optionally substituted C 2-6 -alkenyl, optionally substituted C 2-6 -alkynyl, hydroxy, C 1-6 -alkoxy, C 2-6 -alkoxyalkyl, C 2-6 -Alkenyloxy, carboxy, C 1-6 -alkoxycarbonyl, C 1-6 -alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono-, and di(C 1-6 -alkyl)amino, carbamoyl, mono- and di(C 1-6 -alkyl)-amino-carbonyl, amino-C 1-6 -Alkyl-aminocarbonyl, mono- and di(C 1-6 -alkyl)amino-C 1-6 -Alkyl-aminocarbonyl, C1-6-Alkyl-carbonylamino, Carbamide, C 1-6 -Alkanoyloxy, sulfonyloxy, C 1-6 -Alkyl sulfonyloxy, nitro, azido, sulfanyl, C 1-6-alkylthio, halogen, wherein the aryl and heteroaryl may be optionally substituted, and wherein the two geminal substituents together may represent oxo, thioxo, imino, or optionally substituted methylene.

[0118] In some embodiments, R 1 , R 2 , R 3 , R 5 , and R 5* is C such as methyl 1-6 alkyl, and hydrogen. In some embodiments, R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. In some embodiments, R 1 , R 2 , R 3 are all hydrogen, and R 5 and R 5* is hydrogen, and R 5 and R 5* The other is a non-hydrogen group, such as methyl. 1-6 It is alkyl.

[0119] In some embodiments, R a is hydrogen or methyl. In some embodiments, when present, R b is hydrogen or methyl. In some embodiments, R a and R b One or both of the groups are hydrogen. In some embodiments, R a and R b One of the groups is hydrogen and the other is other than hydrogen. In some embodiments, R a and R b One of the groups is methyl and the other is hydrogen. In some embodiments, R a and R b Both of the are methyl.

[0120] In some embodiments, the biradical -XY- is -O-CH2-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. Such LNA nucleosides are disclosed in WO99 / 014226, WO00 / 66604, WO98 / 039352, and WO2004 / 046160 (all of which are incorporated herein by reference) and include what are commonly known as beta-D-oxy LNA and alpha-L-oxy LNA nucleosides.

[0121] In some embodiments, the biradical -XY- is -S-CH2-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. Such thioLNA nucleosides are disclosed in WO99 / 014226 and WO2004 / 046160, all of which are incorporated herein by reference.

[0122] In some embodiments, the biradical -XY- is -NH-CH2-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. Such amino LNA nucleosides are disclosed in WO99 / 014226 and WO2004 / 046160, all of which are incorporated herein by reference.

[0123] In some embodiments, the biradical -XY- is -O-CH-CH- or -O-CH-CH-CH-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5*are all hydrogen. Such LNA nucleosides are disclosed in WO00 / 047599 and Morita et al, Bioorganic & Med. Chem. Lett. 12 73-76 (all of which are incorporated herein by reference) and include those commonly known as 2'-O-4'C-ethylene-bridged nucleic acids (ENA).

[0124] In some embodiments, the biradical -XY- is -O-CH2-, W is O, and R 1 , R 2 , R 3 All of the above, as well as R5 and R 5* One of R5 and R6 is hydrogen. 5* The other is a non-hydrogen group, such as methyl. 1-6 Such 5'-substituted LNA nucleosides are disclosed in WO2007 / 134181, which is incorporated herein by reference.

[0125] In some embodiments, the biradical -X-Y- is -O-CR a R b - where R a and R b is other than hydrogen, e.g., methyl; W is O; and R 1 , R 2 , R 3 All of the above and R5 and R 5* is hydrogen, and R 5 and R 5* The other is a non-hydrogen group, such as methyl. 1-6 Such bis-modified LNA nucleosides are disclosed in WO2010 / 0077578, which is incorporated herein by reference.

[0126] In some embodiments, the biradical -XY- represents the bivalent linker group -O-CH(CHOCH)-2'O-methoxyethylbicyclicnucleic acid- (Seth at al., 2010, J. Org. Chem. Vol 75(5) pp. 1569-81). In some embodiments, the biradical -XY- represents the bivalent linker group -O-CH(CHCH)-2'O- ...R a - and W is O and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. Such 6' substituted LNA nucleosides are disclosed in WO10036698 and WO07090071, which are incorporated herein by reference.

[0127] In some embodiments, the biradical -XY- is -O-CH(CHOCH)-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. Such LNA nucleosides, also known in the art as cyclic MOE (cMOE), are disclosed in WO07090071.

[0128] In some embodiments, the biradical -XY- represents the divalent linker group -O-CH(CH)- in either the R or S orientation. In some embodiments, the biradicals -XY- together represent the divalent linker group -O-CH-O-CH- (Seth at al., 2010, J. Org. Chem). In some embodiments, the biradical -XY- is -O-CH(CH)-, W is O, and R 1 , R 2 , R 3 , R 5 , and R5* are all hydrogen. Such 6' methyl LNA nucleosides are also known in the art as cET nucleosides and can be either the (S)cET or (R)cET stereoisomers, as disclosed in WO07090071 (beta-D) and WO2010 / 036698 (alpha-L), which are incorporated herein by reference.

[0129] In some embodiments, the biradical -X-Y- is -O-CR a R b - and R a MoR b is not hydrogen, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. In some embodiments, R a and R b are both methyl. Such 6' disubstituted LNA nucleosides are disclosed in WO2009006478, which is incorporated herein by reference.

[0130] In some embodiments, the biradical -X-Y- is -S-CHR a - and W is O and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. Such 6'-substituted thio LNA nucleosides are disclosed in WO11156202, which is incorporated herein by reference. In some 6'-substituted thio LNA embodiments, R a is methyl.

[0131] In some embodiments, the biradical -XY- is -C(=CH2)-C(R a R b )-, for example -C(=CH2)-CH2-, or -C(=CH2)-CH(CH3), W is O, and R 1 , R 2 , R3 , R5, R 5* are all hydrogen. Such vinyl carbo LNA nucleosides are disclosed in WO08154401 and WO09067647, both of which are incorporated herein by reference.

[0132] In some embodiments, the biradical -XY- is -N(-OR a )-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. In some embodiments, R a is C such as methyl 1-6 Such LNA nucleosides are also known as N-substituted LNAs and are disclosed in WO2008 / 150729, which is incorporated herein by reference. In some embodiments, the biradical -X-Y- together form a divalent linker group -O-NR a (Seth at al., 2010, J. Org. Chem). In some embodiments, the biradical -XY- is -N(R a )-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. In some embodiments, R a is C such as methyl 1-6 It is alkyl.

[0133] In some embodiments, R 5 and R 5* One or both of R 5 and R 5* The other is C such as methyl 1-6 In such embodiments, R 1 , R 2 , R 3 may all be hydrogen, and the biradical -XY- may be -O-CH2- or -OC(HCRa )-, for example -OC(HCH3)-.

[0134] In some embodiments, the biradical is -CR a R b -O-CR a R b -, for example CH2-O-CH2-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. In some embodiments, R a is C such as methyl 1-6 Such LNA nucleosides, also known as conformationally restricted nucleotides (CRNs), are disclosed in WO20130366868, which is incorporated herein by reference.

[0135] In some embodiments, the biradical is -O-CR a R b -O-CR a R b -, for example, O-CH2-O-CH2-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. In some embodiments, R a is C such as methyl 1-6 Such LNA nucleosides, also known as COC nucleotides, are disclosed in Mitsuoka et al., Nucleic Acids Research 2009 37(4), 1225-1238, which is incorporated herein by reference. Unless specified, it will be appreciated that LNA nucleosides can be beta-D or alpha-L stereoisomers.

[0136] Non-limiting examples of LNA nucleosides include those described in WO99 / 014226, WO00 / 66604, WO98 / 039352, WO2004 / 046160, WO00 / 047599, WO2007 / 134181, WO2010 / 077578, WO2010 / 036698, WO2007 / 090071, WO2009 / 006478, WO2011 / 156202, WO2008 / 154401, WO2009 / 067647, WO2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81, and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238.

[0137] Specific examples of LNA nucleosides are shown in Scheme 1.

[0138] Scheme 1 [ka]

[0139] As shown in the Examples, in some embodiments of the present invention, the LNA nucleosides in the oligonucleotides are beta-D-oxy-LNA nucleosides.

[0140] Nuclease-mediated degradation Nuclease-mediated degradation refers to an oligonucleotide that, when duplexed with a complementary nucleotide sequence, is capable of mediating the degradation of such sequence.

[0141] In some embodiments, oligonucleotides may function via nuclease-mediated degradation of target nucleic acids, and the oligonucleotides of the invention are capable of recruiting nucleases, particularly endonucleases, preferably endoribonucleases (RNases), such as RNase H. Examples of oligonucleotide designs that function via a nuclease-mediated mechanism are oligonucleotides that generally contain a region of at least five or six consecutive DNA nucleosides and are flanked on one or both sides by affinity-enhancing nucleosides, such as gapmers, headmers, and tailmers.

[0142] RNase H activity and recruitment The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when duplexed with a complementary RNA molecule. WO 01 / 23613 provides an in vitro method for measuring RNase H activity that can be used to determine its ability to recruit RNase H. Typically, an oligonucleotide is considered capable of recruiting RHase H if, when provided with a complementary target nucleic acid sequence, it has an initial rate (measured in pmol / l / min) of at least 5%, e.g., at least 10%, or even 20% or more of the initial rate (measured in pmol / l / min) measured using the methodology provided in Examples 91-95 of WO 01 / 23613 (incorporated herein by reference) using an oligonucleotide that has the same base sequence as the modified oligonucleotide being tested but contains only DNA monomers with phosphorothioate linkages between all monomers in the oligonucleotide. Recombinant human RNase H1 is available from Lubio Science GmbH, Lucerne, Switzerland, for use in measuring RHase H activity.

[0143] Gapmar The antisense oligonucleotide of the present invention or its contiguous nucleotide sequence may be a gapmer. Antisense gapmers are generally used to inhibit target nucleic acids through RNase H-mediated degradation. Gapmer oligonucleotides contain at least three distinct structural regions: a 5'-flank, a gap, and a 3'-flank, FG-F', arranged in a "5→3" orientation. The "gap" region (G) contains a stretch of contiguous DNA nucleotides that enable the oligonucleotide to recruit RNase H. The gap region is flanked by a 5'-flanking region (F) containing one or more sugar-modified nucleosides, preferably high-affinity sugar-modified nucleosides, and a 3'-flanking region (F') containing one or more sugar-modified nucleosides, preferably high-affinity sugar-modified nucleosides. The one or more sugar-modified nucleosides in regions F and F' increase the affinity of the oligonucleotide for the target nucleic acid (i.e., are affinity-enhancing sugar-modified nucleosides). In some embodiments, one or more sugar-modified nucleosides in regions F and F' are 2' sugar-modified nucleosides, such as high affinity 2' sugar modifications independently selected from LNA and 2' sugar-MOE.

[0144] In a gapmer design, the 5'- and 3'-most nucleosides of the gap region are DNA nucleosides, positioned adjacent to sugar-modified nucleosides in the 5' (F) or 3' (F') regions, respectively. Flanks can be further defined as having at least one sugar-modified nucleoside at the ends furthest from the gap region, i.e., at the 5'-end of a 5' flank and the 3'-end of a 3' flank.

[0145] The region FG-F' forms a contiguous nucleotide sequence. The antisense oligonucleotide of the present invention or the contiguous nucleotide sequence thereof may comprise a gapmer region of the formula FG-F'.

[0146] The total length of the gapmer design FG-F' can be, for example, 12 to 32 nucleosides, such as 13 to 24, such as 14 to 22 nucleosides, such as 14 to 17, such as 16 to 18 nucleosides.

[0147] For example, a gapmer oligonucleotide of the invention may have the following formula: F 1-8 -G 5-16 -F' 1-8 , e.g., F 1-8 -G 7-16 -F' 2-8 with the proviso that the total length of the gapmer region FG-F' must be at least 12 nucleotides, for example at least 14 nucleotides in length. Regions F, G, and F' are further defined below and can be incorporated into the formula FG-F'.

[0148] Gapmer - Gap, region G The region G (gap region) of a gapmer is a region of nucleosides (usually DNA nucleosides) that allows the oligonucleotide to recruit RNase H, such as human RNase H1. RNase H is a cellular enzyme that recognizes the duplex between DNA and RNA and enzymatically cleaves the RNA molecule. Suitably, a gapmer may have a length of at least 5 or 6 consecutive DNA nucleosides, such as 5 to 16 consecutive DNA nucleosides, such as 6 to 15 consecutive DNA nucleosides, such as 7 to 14 consecutive DNA nucleosides, such as 8 to 12 consecutive DNA nucleotides, such as 8 to 12 consecutive DNA nucleotides. The gap region G may, in some embodiments, consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive DNA nucleosides. Cytosine (C) DNA in the gap region may be methylated, and such residues may be 5-methylcytosine ( me The gap is annotated with an e instead of a C or c). Methylation of cytosine DNA within the gap is favored when a cg dinucleotide is present in the gap to reduce potential toxicity, and the modification is not expected to significantly affect the efficacy of the oligonucleotide.

[0149] In some embodiments, the gap region G can consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive phosphorothioate-linked DNA nucleosides. In some embodiments, all internucleoside linkages within the gap are phosphorothioate linkages.

[0150] While traditional gapmers have a DNA gap region, there are many examples of modified nucleosides that allow for RNase H recruitment when used within the gap region. Modified nucleosides reported to be capable of recruiting RNase H when contained within the gap region include, for example, alpha-L-LNA, C4'-alkylated DNA (described in PCT / EP2009 / 050349 and Vester et al., Bioorg. Med. Chem. Lett. 18 (2008) 2296-2300, both of which are incorporated herein by reference), arabinose-derived nucleosides such as ANA and 2'-sugar F-ANA (Mangos et al. 2003 J. AM. CHEM. SOC. 125, 654-661), and UNA (unlocked nucleic acid) (described in Fluiter et al., Mol. Biosyst., 2009, 10, 1039, which is incorporated herein by reference). UNA is an unlocked nucleic acid, typically in which the bond between C2 and C3 of the ribose has been removed to form an unlocked "sugar" residue. The modified nucleosides used in such gapmers may be nucleosides that adopt a 2' sugar-terminal (DNA-like) structure when introduced into the gap region, thus enabling recruitment of RNase H. In some embodiments, the DNA gap region (G) described herein may optionally contain one to three sugar-modified nucleosides that adopt a 2' sugar-terminal (DNA-like) structure when introduced into the gap region.

[0151] Area G - "Gap Breaker" Alternatively, numerous reports have addressed the insertion of modified nucleosides to confer a 3'-end conformation to the gap region of a gapmer while retaining some RNase H activity. Such gapmers, with a gap region containing one or more 3'-end modified nucleosides, are referred to as "gap breaker" or "gap-disrupting" gapmers. See, for example, WO2013 / 022984. Gap breaker oligonucleotides retain a sufficient region of DNA nucleosides within the gap region to allow RNase H recruitment. The ability of gap breaker oligonucleotide designs to recruit RNase H is typically sequence- or compound-specific. See Rukov et al., 2015 Nucl. Acids Res. Vol. 43 pp. 8476-8487, which discloses "gap breaker" oligonucleotides that recruit RNase H, potentially providing more specific cleavage of target RNA. The modified nucleoside used within the gap region of the gap breaker oligonucleotide can be a modified nucleoside that confers a 3'-end conformation, such as a 2' sugar-O-methyl (OMe) or 2' sugar-O-MOE (MOE) nucleoside, or a beta-D LNA nucleoside (in which the bridge between C2' and C4' of the ribose sugar ring of the nucleoside is in a beta conformation), such as a beta-D-oxy LNA or ScET nucleoside.

[0152] Similar to gapmers containing region G above, the gap region of a gap breaker or gap disrupting gapmer has a DNA nucleoside at the 5' end of the gap (adjacent to the 3' nucleoside of region F) and a DNA nucleoside at the 3' end of the gap (adjacent to the 5' nucleoside of region F'). Gapmers containing a disrupted gap typically retain a region of at least three or four contiguous DNA nucleosides at either the 5' or 3' end of the gap region.

[0153] Exemplary designs of gap breaker oligonucleotides include: F 1-8 -[D 3-4-E1- D 3-4 ] - F' 1-8 F 1-8 - [D 1-4 -E1- D 3-4 ]-F' 1-8 F 1-8 - [D 3-4 -E1- D 1-4 ]-F' 1-8 where the region G is the bracket [D n -E r -D m ], D is a consecutive sequence of DNA nucleosides, E is a modified nucleoside (gap breaker or gap disrupting nucleoside), and F and F' are flanking regions as defined herein, provided that the total length of the gapmer region FG-F' must be at least 12 nucleotides, e.g., at least 14 nucleotides in length.

[0154] In some embodiments, region G of the gap-breaking gapmer comprises at least six DNA nucleosides, e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 DNA nucleosides. As noted above, the DNA nucleosides may be contiguous or, optionally, interspersed with one or more modified nucleosides, provided that gap region G is capable of mediating RNase H recruitment.

[0155] Gapmer-flanking regions, F and F' Region F is located immediately adjacent to the 5' DNA nucleoside of region G. The 3'-most nucleoside of region F is a sugar-modified nucleoside, e.g., a high-affinity sugar-modified nucleoside, e.g., a 2' sugar-substituted nucleoside, e.g., an MOE nucleoside, or an LNA nucleoside.

[0156] Region F' is located immediately adjacent to the 3' DNA nucleoside of region G. The 5'-most nucleoside of region F' is a sugar-modified nucleoside, e.g., a high-affinity sugar-modified nucleoside, e.g., a 2' sugar-substituted nucleoside, e.g., an MOE nucleoside, or an LNA nucleoside.

[0157] Region F is 1 to 8 contiguous nucleotides in length, for example, 1 to 6, for example, 2 to 6, for example, 3 to 4 contiguous nucleotides in length. Advantageously, the 5'-most nucleoside of region F is a sugar-modified nucleoside. In some embodiments, the two 5'-most nucleosides of region F are sugar-modified nucleosides. In some embodiments, the two 5'-most nucleosides of region F are LNA nucleosides. In some embodiments, the two 5'-most nucleosides of region F are LNA nucleosides. In some embodiments, the two 5'-most nucleosides of region F are 2'-sugar-substituted nucleosides, for example, two 3'-MOE nucleosides. In some embodiments, the 5'-most nucleoside of region F is a 2'-sugar-substituted nucleoside, for example, an MOE nucleoside.

[0158] Region F' is 2 to 8 contiguous nucleotides in length, for example, 3 to 6, for example, 4 to 5 contiguous nucleotides in length. Advantageously, the 3'-most nucleosides of region F' are sugar-modified nucleosides. In some embodiments, the two 3'-most nucleosides of region F' are sugar-modified nucleosides. In some embodiments, the two 3'-most nucleosides of region F' are LNA nucleosides. In some embodiments, the 3'-most nucleosides of region F' are LNA nucleosides. In some embodiments, the two 3'-most nucleosides of region F' are 2'-sugar-substituted nucleosides, for example, two 3'-MOE nucleosides. In some embodiments, the 3'-most nucleosides of region F' are 2'-sugar-substituted nucleosides, for example, MOE nucleosides.

[0159] Note that if region F or F' has a length of 1, it is advantageously an LNA nucleoside.

[0160] In some embodiments, regions F and F' independently consist of or comprise a contiguous sequence of sugar-modified nucleosides. In some embodiments, the sugar-modified nucleosides of region F can be independently selected from 2' sugar-O-alkyl-RNA units, 2' sugar-O-methyl-RNA, 2' sugar-amino-DNA units, 2' sugar-fluoro-DNA units, 2' sugar-alkoxy-RNA, MOE units, LNA units, arabinonucleic acid (ANA) units, and 2' sugar-fluoro-ANA units.

[0161] In some embodiments, regions F and F' independently comprise both LNA and 2' sugar substitution modified nucleosides (mixed wing design).

[0162] In some embodiments, regions F and F' consist of only one type of sugar-modified nucleoside, for example, only MOE, or only beta-D-oxy LNA, or only ScET. Such designs are also referred to as uniform flank or uniform gapmer designs.

[0163] In some embodiments, all nucleosides of regions F or F', or of F and F', are LNA nucleosides, e.g., independently selected from beta-D-oxyLNA, ENA, or ScET nucleosides. In some embodiments, region F consists of 1 to 5, e.g., 2 to 4, e.g., 3 to 4, e.g., 1, 2, 3, 4, or 5 contiguous LNA nucleosides. In some embodiments, all nucleosides of regions F and F' are beta-D-oxyLNA nucleosides.

[0164] In some embodiments, all nucleosides in regions F or F', or in F and F', are 2' sugar-substituted nucleosides, e.g., OMe or MOE nucleosides. In some embodiments, region F consists of 1, 2, 3, 4, 5, 6, 7, or 8 consecutive OMe or MOE nucleosides. In some embodiments, only one of the flanking regions consists of 2' sugar-substituted nucleosides, e.g., OMe or MOE nucleosides. In some embodiments, the 5' (F) flanking region consists of 2' sugar-substituted nucleosides, e.g., OMe or MOE nucleosides, while the 3' (F') flanking region comprises at least one LNA nucleoside, e.g., a beta-D-oxyLNA nucleoside or a cET nucleoside. In some embodiments, the 3' (F') flanking region consists of 2' sugar-substituted nucleosides, such as OMe or MOE nucleosides, while the 5' (F') flanking region comprises at least one LNA nucleoside, such as a beta-D-oxy LNA nucleoside or a cET nucleoside.

[0165] In some embodiments, all modified nucleosides in regions F and F' are LNA nucleosides, e.g., independently selected from beta-D-oxy LNA, ENA, or ScET nucleosides, while regions F or F', or F and F', optionally comprise DNA nucleosides (alternating flanks, see these definitions for details). In some embodiments, all modified nucleosides in regions F and F' are beta-D-oxy LNA nucleosides, while regions F or F', or F and F', optionally comprise DNA nucleosides (alternating flanks, see these definitions for details).

[0166] In some embodiments, the 5'-most and 3'-most nucleosides of regions F and F' are LNA nucleosides, such as beta-D-oxyLNA nucleosides or ScET nucleosides.

[0167] In some embodiments, the internucleoside linkage between region F and region G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkage between region F' and region G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkage between the nucleosides of regions F or F', F and F' is a phosphorothioate internucleoside linkage.

[0168] Further gapmer designs are disclosed in WO2004 / 046160, WO2007 / 146511, and WO2008 / 113832, which are incorporated herein by reference.

[0169] LNA gapmers An LNA gapmer is a gapmer in which one or both of regions F and F' comprise or consist of LNA nucleosides. A beta-D-oxy gapmer is a gapmer in which one or both of regions F and F' comprise or consist of beta-D-oxy LNA nucleosides.

[0170] In some embodiments, the LNA gapmer has the formula: [LNA] 1-5 -[Area G]-[LNA] 1-5 where region G is as defined in the definition of gapmer region G.

[0171] In some embodiments, the LNA is beta-D-oxy-LNA and the gapmer has the formula: F 2-5 LNA, 0-2 DNA -G 7-11 DNA -F' 3-5 LNA, 0-2 DNA .

[0172] MOE Gapmar An MOE gapmer is a gapmer in which regions F and F' consist of MOE nucleosides. In some embodiments, an MOE gapmer has the design [MOE] 1-8 -[Area G]-[MOE] 1-8 , e.g. [MOE] 2-7 -[Area G] 5-16 -[MOE] 2-7 , e.g. [MOE] 3-6 -[Area G]-[MOE] 3-6 where region G is as defined in the gapmer definition. MOE gapmers with a 5-10-5 design (MOE-DNA-MOE) are widely used in the art.

[0173] Mixed Wing Gappa In mixed-wing gapmers, one or both of regions F and F' comprise 2' sugar-substituted nucleosides, e.g., MOE nucleosides, independently selected from the group consisting of 2' sugar-O-alkyl-RNA units, 2' sugar-O-methyl-RNA, 2' sugar-amino-DNA units, 2' sugar-fluoro-DNA units, 2' sugar-alkoxy-RNA, MOE units, arabinonucleic acid (ANA) units, and 2' sugar-fluoro-ANA units. In some embodiments in which at least one of regions F and F' or both of regions F and F' comprise at least one LNA nucleoside, the remaining nucleosides in regions F and F' are independently selected from the group consisting of MOE and LNA. In some embodiments in which at least one of regions F and F' or both of regions F and F' comprise at least two LNA nucleosides, the remaining nucleosides in regions F and F' are independently selected from the group consisting of MOE and LNA. In some mixed wing embodiments, one or both of regions F and F' may further comprise one or more DNA nucleosides.

[0174] Mixed winged gapmer designs are disclosed in WO2008 / 049085 and WO2012 / 109395, both of which are incorporated herein by reference.

[0175] Alternating Flank Gap Mar Oligonucleotides with alternating flanks are LNA gapmer oligonucleotides in which at least one of the flanks (F or F') comprises DNA in addition to LNA nucleosides. In some embodiments, at least one of regions F or F', or both regions F and F', comprises both LNA and DNA nucleosides. In such embodiments, flanking regions F or F', or both F and F', comprise at least three nucleosides, wherein the 5'- and 3'-most nucleosides of the F and / or F' regions are LNA nucleosides.

[0176] In some embodiments, at least one of regions F or F', or both regions F and F', comprises both LNA and DNA nucleosides. In such embodiments, flanking regions F or F', or both F and F', comprise at least three nucleosides, wherein the 5'-most and 3'-most nucleosides of the F or F' region are LNA nucleosides. Flanking regions comprising both LNA and DNA nucleosides are referred to as alternating flanks because they comprise an alternating motif of LNA-DNA-LNA nucleosides. Alternating flank LNA gapmers are disclosed in WO2016 / 127002.

[0177] The alternating flanking regions may include up to three consecutive DNA nucleosides, for example, 1 to 2 or 1 or 2 or 3 consecutive DNA nucleosides.

[0178] The alternating flanks can be annotated as a series of integers, which represent, for example, a number of DNA nucleosides (D) followed by a number of LNA nucleosides (L), such as: [L] 1-3 -[D] 1-4 -[L] 1-3 [L] 1-2 -[D] 1-2 -[L] 1-2 -[D] 1-2 -[L]1-2 .

[0179] In oligonucleotide design, these are often represented by numbers, e.g., 2-2-1 represents 5'[L]2-[D]2-[L]3', and 1-1-1-1-1 represents 5'[L]-[D]-[L]-[D]-[L]3'. The length of the flanks (regions F and F') of an oligonucleotide with alternating flanks can independently be 3 to 10 nucleosides, e.g., 4 to 8, 5 to 6 nucleosides, e.g., 4, 5, 6, or 7 modified nucleosides. In some embodiments, only one flank of a gapmer oligonucleotide is alternating, while the other is composed of LNA nucleotides. To confer additional exonuclease resistance, it may be advantageous to have at least two LNA nucleosides at the 3' end of the 3' flank (F'). Some examples of oligonucleotides with alternating flanks are as follows: [L] 1-5 -[D] 1-4 -[L] 1-3 -[G] 5-16 -[L] 2-6 [L] 1-2 -[D] 1-2 -[L] 1-2 -[D] 1-2 -[L] 1-2 -[G] 5-16 -[L] 1-2 -[D] 1-3 -[L] 2-4 [L] 1-5 -[G] 5-16 -[L]-[D]-[L]-[D]-[L]2

[0180] However, the total length of the gapmer must be at least 12 nucleotides, for example at least 14 nucleotides.

[0181] Region D' or D" of the oligonucleotide The oligonucleotides of the invention may, in some embodiments, comprise or consist of a contiguous nucleotide sequence of an oligonucleotide that is complementary to a target nucleic acid, such as a gapmer FG-F', plus additional 5' and / or 3' nucleosides. The additional 5' and / or 3' nucleosides may or may not be fully complementary to the target nucleic acid. Such additional 5' and / or 3' nucleosides may be referred to herein as regions D' and D".

[0182] The addition of region D' or D" may be used to attach a contiguous nucleotide sequence, such as a gapmer, to a conjugate moiety or another functional group. When used to attach a conjugate moiety to a conjugate moiety, it may function as a biocleavable linker. Alternatively, it may be used to provide exonuclease protection or to facilitate synthesis or manufacturing.

[0183] Regions D' and D" can be attached to the 5' end of region F or the 3' end of region F', respectively, to generate designs of the following formula: D'-FG-F', FG-F'-D", or D'-FG-F'-D", where FG-F' is the gapmer portion of the oligonucleotide and region D' or D" constitutes a separate portion of the oligonucleotide.

[0184] Region D' or D" may independently comprise or consist of 1, 2, 3, 4, or 5 additional nucleotides, which may be complementary or non-complementary to the target nucleic acid. The nucleotides adjacent to the F or F' region are not sugar-modified nucleotides, e.g., DNA or RNA, or base-modified versions thereof. The D' or D' region may function as a nuclease-sensitive biocleavable linker (see definition of linker). In some embodiments, the additional 5' and / or 3' terminal nucleotides are linked by phosphodiester bonds and are DNA or RNA. Nucleotide-based biocleavable linkers suitable for use as region D' or D" are disclosed in WO2014 / 076195, including, for example, phosphodiester-linked DNA dinucleotides. The use of biocleavable linkers in polyoligonucleotide constructs is disclosed in WO2015 / 113922, where they are used to link multiple antisense constructs (e.g., gapmer regions) within a single oligonucleotide.

[0185] In one embodiment, the oligonucleotide of the present invention comprises regions D' and / or D" in addition to the contiguous nucleotide sequence that constitutes the gapmer.

[0186] In some embodiments, the oligonucleotides of the invention can be represented by the following formula: FG-F'; especially F 1-8 -G 5-16 -F' 2-8 D'-FG-F', especially D' 1-3 -F 1-8 -G 5-16 -F' 2-8 FG-F'-D”, especially F 1-8 -G 5-16 -F' 2-8 -D” 1-3 D'-FG-F'-D”, especially D' 1-3 -F 1-8 -G 5-16 -F' 2-8 -D”1-3 .

[0187] In some embodiments, the internucleoside linkage between region D' and region F is a phosphodiester bond. In some embodiments, the internucleoside linkage between region F' and region D" is a phosphodiester bond.

[0188] Conjugates The term conjugate, as used herein, refers to an oligonucleotide covalently attached to a non-nucleotide moiety (conjugate moiety or region C or third region).

[0189] Conjugation of the oligonucleotides of the present invention to one or more non-nucleotide moieties may improve the pharmacology of the oligonucleotide by affecting the activity, cellular distribution, cellular uptake, or stability of the oligonucleotide. In some embodiments, the conjugate moiety modifies or enhances the pharmacokinetic properties of the oligonucleotide by improving the cellular distribution, bioavailability, metabolism, excretion, permeability, and / or cellular uptake of the oligonucleotide. In particular, the conjugate can target the oligonucleotide to a specific organ, tissue, or cell type, thereby increasing the efficacy of the oligonucleotide in that organ, tissue, or cell type. At the same time, the conjugate can serve to reduce the activity of the oligonucleotide in non-target cell types, tissues, or organs, e.g., target activity or activity in non-target cell types, tissues, or organs.

[0190] WO93 / 07883 and WO2013 / 033230 (which are incorporated herein by reference) provide suitable conjugate moieties. Further suitable conjugate moieties are those capable of binding to the asialoglycoprotein receptor (ASGPR). Trivalent N-acetylgalactosamine conjugate moieties are particularly suitable for binding to ASGPR; see, for example, WO2014 / 076196, WO2014 / 207232, and WO2014 / 179620 (which are incorporated herein by reference). Such conjugates serve to enhance the uptake of oligonucleotides into the liver while reducing the presence of the oligonucleotide in the kidney, thereby increasing the liver / kidney ratio of the conjugated oligonucleotide compared to the unconjugated version of the same oligonucleotide.

[0191] In some embodiments, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of a carbohydrate, a cell surface receptor ligand, a drug substance, a hormone, a lipophilic substance, a polymer, a protein, a peptide, a toxin (e.g., a bacterial toxin), a vitamin, a viral protein (e.g., a capsid), or a combination thereof.

[0192] Conjugate Linker A bond or linker is a connection between two atoms that connects one chemical group or segment of interest to another chemical group or segment of interest through one or more covalent bonds. The conjugate moiety can be attached directly to the oligonucleotide or via a linking moiety (e.g., a linker or tether). The linker serves to covalently attach one region, such as the conjugate moiety, to another region, such as the oligonucleotide (e.g., the end of region A or C).

[0193] In some embodiments of the present invention, the conjugate or oligonucleotide conjugate of the present invention can optionally include a linker region located between the oligonucleotide and the conjugate moiety. In some embodiments, the linker between the conjugate and the oligonucleotide is biocleavable. The linker and the oligonucleotide are often linked via a phosphodiester bond.

[0194] The biocleavable linker (region B) comprises or consists of a physiologically labile bond that is cleavable under conditions normally encountered or similar to those encountered in the mammalian body. Conditions under which a physiologically labile linker undergoes chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidizing or reducing conditions, or drugs, and salt concentrations similar to or encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzymatic activities normally present in mammalian cells, such as proteolytic or hydrolytic enzymes or nucleases. In one embodiment, the biocleavable linker is susceptible to S1 nuclease cleavage. In preferred embodiments, the nuclease-sensitive linker comprises 1 to 10 nucleosides, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides, more preferably 2 to 6 nucleosides, and most preferably 2 to 4 linked nucleosides containing at least two consecutive phosphodiester bonds, e.g., at least 3, or 4, or 5 consecutive phosphodiester bonds. Preferably, the nucleosides are DNA or RNA.

[0195] In one embodiment, the linker between the oligonucleotide and the conjugate moiety is a physiologically labile linker consisting of 2 to 5 consecutive phosphodiester-linked nucleosides at the 5' or 3' end of the consecutive nucleotide sequence of the antisense compound. In some embodiments, the consecutive phosphodiester bonds are dinucleotides having a sequence selected from the group consisting of the sequences AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG. In some embodiments, the consecutive phosphodiester bonds are a trinucleotide of the sequence AAA, AAT, AAC, AAG, ATA, ATT, ATC, ATG, ACA, ACT, ACC, ACG, AGA, AGT, AGC, AGG, TAA, TAT, TAC, TAG, TTA, TTT, TTC, TAG, TCA, TCT, TCC, TCG, TGA, TGT, TGC, TGG, CAA, CAT, CAC, CAG, CTA, CTG, CTC, CTT, CCA, CCT, CCC, CCG, CGA, CGT, CGC, CGG, GAA, GAT, GAC, CAG, GTA, GTT, GTC, GTG, GCA, GCT, GCC, GCG, GGA, GGT, GGC, or GGG. In certain instances, a phosphodiester-linked CA dinucleotide having three consecutive phosphodiester bonds has been used as a biocleavable linker between the consecutive nucleotide sequence and the conjugate moiety. Phosphodiester containing biocleavable linkers are described in more detail in WO2014 / 076195 (incorporated herein by reference). In conjugate compounds having a biocleavable linker, at least about 50% of the conjugated moieties are cleaved from the oligonucleotide, for example, at least about 60% are cleaved, for example, at least about 70% are cleaved, for example, at least about 80% are cleaved, for example, at least about 90% are cleaved, for example, at least about 95% of the conjugated moieties are cleaved from the oligonucleotide, when compared to a standard.

[0196] The conjugate may also be attached to the oligonucleotide via a non-biodegradable linker, or in some embodiments, the conjugate may include a non-cleavable linker covalently bonded to the biodegradable linker. The non-biodegradable linker primarily serves to covalently link the conjugate moiety to the oligonucleotide or biodegradable linker, potentially creating some distance between the conjugate moiety and the oligonucleotide. Some exemplary linkers (region Y) include 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), 6-aminohexanoic acid (AHEX or AHA), 6-aminohexyloxy, 4-aminobutyric acid, 4-aminocyclohexylcarboxylic acid, succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxy-(6-amido-caproate) (LCSMCC), succinimidyl m-maleimidobenzoate (MBS), succinimidyl Ne- Examples include maleimidocaproylate (EMCS), succinimidyl 6-(beta-maleimido-propionamido)hexanoate (SMPH), succinimidyl N-(α-maleimidoacetate) (AMAS), succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB), beta-alanine (beta-ALA), phenylglycine (PHG), 4-aminocyclohexanoic acid (ACHC), beta-(cyclopropyl)alanine (beta-CYPR), aminododecanoic acid (ADC), arylene diol, polyethylene glycol, amino acids, and the like. Non-cleavable linkers may also include chain structures or oligomers of repeating units such as ethylene glycol, amino acid units, or aminoalkyl groups. In some embodiments, the linker (region Y) may be, for example, a C6-C6 12 C2-C containing aminoalkyl groups 36The linker (region Y) is an aminoalkyl, such as an aminoalkyl group. In some embodiments, the linker (region Y) is a C6 aminoalkyl group (also referred to as a C6 linker). The conjugate linker group can be routinely attached to the oligonucleotide via the use of an amino-modified oligonucleotide and an activated ester group on the conjugate group. The linking group between the aminoalkyl and the oligonucleotide can be, for example, a phosphorothioate or phosphodiester, or one of the other nucleoside linking groups mentioned herein. The conjugate compounds of the present invention may be composed of the following regions: CBA (conjugate moiety-biocleavable linker-oligonucleotide / contiguous nucleotide sequence) or CYBA (conjugate moiety-non-cleavable linker-biocleavable linker-oligonucleotide / contiguous nucleotide sequence).

[0197] treatment As used herein, the terms "treatment," "treating," "treat," and the like generally refer to obtaining a desired pharmacological and / or physiological effect. This effect is therapeutic in that it partially or completely cures the disease and / or the adverse effects caused by the disease. The term "treatment" as used herein encompasses any treatment of a disease in a subject, including: (a) inhibiting the disease, i.e., halting its growth, such as inhibiting the increase of HBsAg and / or HBeAg; or (b) ameliorating (i.e., alleviating) the disease, i.e., causing regression of the disease, such as suppressing HBsAg and / or HBeAg production. Thus, a compound that ameliorates and / or inhibits HBV infection is a compound that treats HBV infection. Preferably, the term "treatment" as used herein relates to medical intervention of an already-existing disorder, such as the treatment of an already-existing HBV infection as defined and described above.

[0198] prevention As used herein, the terms "preventing," "prevention," or "prevent" refer to prophylactic treatment, i.e., a measure or operation aimed at preventing, rather than curing, a disease. Prevention means achieving a desired pharmacological and / or physiological effect that is preventative in that a disease or its symptoms are completely or partially prevented. Thus, "prevention of HBV infection" herein includes the prevention of the onset of HBV infection in a subject, as well as the prevention of the onset of symptoms of HBV infection. The present invention particularly contemplates the prevention of HBV infection in children of HBV-infected mothers.

[0199] patient For the purposes of the present invention, a "subject" (or "patient") may be a vertebrate. In the context of the present invention, the term "subject" includes both humans and other animals, particularly mammals, and other organisms. That is, the means and methods provided herein are applicable to both human therapy and veterinary use. Thus, as used herein, a subject may be an animal such as a mouse, rat, hamster, rabbit, guinea pig, ferret, cat, dog, chicken, sheep, bovine species, horse, camel, or primate. Preferably, the subject is a mammal. More preferably, the subject is a human.

[0200] HBV infection The terms "hepatitis B virus infection" or "HBV infection" are commonly known in the art and refer to an infection caused by the hepatitis B virus (HBV) and affecting the liver. HBV infection can be acute or chronic. Some infected individuals have no symptoms at initial infection, while others rapidly develop illness with vomiting, yellow skin, fatigue, dark urine, and abdominal pain ("Hepatitis B Fact Sheet No. 204", who.int. July 2014. Retrieved 4 November 2014). In many cases, these symptoms last for several weeks and can lead to death. It can take 30 to 180 days for symptoms to begin. Of those infected around the time of birth, 90% develop chronic hepatitis B infection, while fewer than 10% of those infected after age 5 develop the disease ("Hepatitis B FAQs for the Public - Transmission", US Centers for Disease Control and Prevention (CDC), retrieved 2011-11-29, retrieved November 29, 2011). Most people with chronic disease have no symptoms. However, cirrhosis and liver cancer can eventually develop (Chang, 2007, Semin Fetal Neonatal Med, 12: 160-167). These complications result in the death of 15-25% of chronically ill patients ("Hepatitis B Fact Sheet No. 204", who.int. July 2014, retrieved November 4, 2014). As used herein, the term "HBV infection" includes acute and chronic hepatitis B infection. The term "HBV infection" also includes the asymptomatic phase of primary infection, the symptomatic phase, and the asymptomatic chronic phase of HBV infection.

[0201] compound The term "compound" as used herein refers to a nucleic acid molecule, such as an RNAi molecule or an antisense oligonucleotide according to the present invention, or any conjugate containing such a nucleic acid molecule. For example, in this specification, the compound may be a nucleic acid molecule, particularly an antisense oligonucleotide, targeting PAPD5 and PAPD7.

[0202] composition The term "composition" can also be used to describe a nucleic acid molecule compound. A nucleic acid molecule composition has less than 20% impurities, preferably less than 15% or 10% impurities, more preferably less than 9, 8, 7, or 6% impurities, and most preferably less than 5% impurities. The impurities are typically nucleic acid molecules that are one or two nucleotides shorter (n-1 or n-2) than the primary nucleic acid molecule component.

[0203] The invention will be further illustrated by reference to the non-limiting figures and examples.

[0204] Detailed Description of the Invention PAPD5 and PAPD7 are non-canonical poly(A) polymerases belonging to the polymerase β-like nucleotidyl transferase superfamily. In PCT / EP2017 / 064981, PAPD5 and PAPD7 were identified as targets relevant to the inhibition of HBV infection by the inhibition of HBV surface antigen (HBsAg) production and HBV RNA expression during HBV infection with two small molecules, followed by validation with a pool of siRNA compounds. In PCT / EP2017 / 064980, antisense oligonucleotides targeting either PAPD5 or PAPD7 were described and combined to achieve in vitro inhibition of HBV infection.

[0205] The present invention identifies target sequences of 12 to 22 nucleotides in length shared between human PAPD5 and human PAPD7 mRNAs, enabling inhibition of both targets with a single nucleic acid molecule. There are approximately 4,500 shared target sites between human PAPD5 and human PAPD7 pre-mRNAs. Regarding the generation of pharmaceutically acceptable molecules, other parameters must be considered, including the number of off-targets, protection of other species to enable in vivo proof-of-concept, and significant pharmacokinetic / pharmacodynamic (PK / PD) modeling.

[0206] Oligonucleotides of the Invention The present invention identifies novel antisense oligonucleotides that can inhibit the expression of both PAPD5 and PAPD7 in vitro and in vivo. The oligonucleotides are complementary to one of three target sites, between 16 and 22 nucleotides in length, present in both human PAPD5 and human PAPD7.

[0207] Inhibition is achieved by hybridizing an antisense oligonucleotide to a target nucleic acid encoding PAPD5 and a target nucleic acid encoding PAPD7, it being understood that the same molecule need not hybridize to the two targets simultaneously to be effective.

[0208] Target nucleic acid 1 can be a mammalian PAPD5 sequence, such as a sequence selected from the group consisting of SEQ ID NOs: 1, 3, and 5. Target nucleic acid 2 can be a mammalian PAPD7 sequence, such as a sequence selected from the group consisting of SEQ ID NOs: 2, 4, and 6.

[0209] In some embodiments, the antisense oligonucleotides of the present invention can modulate the expression of target 1 and target 2 by inhibiting or downregulating them. Preferably, such modulation results in at least 50% inhibition of expression compared to the normal expression level of the target, more preferably at least 60%, 70%, 80%, 90%, 95%, or 98% inhibition compared to the normal expression level of the target. In some embodiments, the oligonucleotides of the present invention can inhibit the expression levels of PAPD5 and PAPD7 mRNA by at least 65% to 98%, e.g., 70% to 95%, in vitro using HeLa cells. This range of target reduction is useful in terms of selecting oligonucleotides that correlate well with reduction of HBV antigens, such as HBsAg and / or HBeAg. In some embodiments, the compounds of the present invention can inhibit the expression levels of PAPD5 and PAPD7 proteins by at least 50% in vitro using HeLa cells. The "Materials and Methods" section and Examples herein provide assays that can be used to measure target RNA inhibition in HeLa cells. Target modulation is caused by hybridization between a consecutive nucleotide sequence, such as a gapmer region of the oligonucleotide, and the target nucleic acid. In some embodiments, the oligonucleotides of the present invention contain mismatches between the oligonucleotide or consecutive nucleotide sequence and one or both of the target nucleic acids. Despite the mismatches, hybridization to the target nucleic acid may still be sufficient to demonstrate the desired modulation of PAPD5 and PAPD7 expression. The decrease in binding affinity due to the mismatches can be advantageously compensated for by increasing the length of the oligonucleotide and / or by increasing the number of modified nucleosides in the oligonucleotide sequence, which can increase the binding affinity to the target. Advantageously, the oligonucleotides of the present invention contain modified nucleosides, such as 2' sugar-modified nucleosides containing LNA, which can increase the binding affinity.

[0210] An embodiment of the present invention relates to an antisense oligonucleotide of 12 to 32 nucleotides in length, comprising a contiguous nucleotide sequence of 12 to 22 nucleotides in length, which is capable of inhibiting the expression of both PAPD5 and PAPD7.

[0211] In some embodiments, the oligonucleotide comprises a contiguous sequence that is at least 90%, such as at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, such as at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, or 100% complementary to the target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2 or a naturally occurring variant thereof.

[0212] In one embodiment, the antisense oligonucleotides of the present invention or their contiguous nucleotide sequences are fully complementary (100% complementary) to a region of the target nucleic acid, or in some embodiments, may contain one or two mismatches between the oligonucleotide and the target nucleic acid.

[0213] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 12 to 22 nucleotides in length that is at least 93% complementary, e.g., completely (i.e., 100%) complementary, to a target nucleic acid region present in SEQ ID NO:1 and SEQ ID NO:2.

[0214] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence of the present invention is at least 93% complementary, e.g., completely (i.e., 100%) complementary, to the target nucleic acids of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

[0215] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence of the present invention is at least 93% complementary, e.g., completely (i.e., 100%) complementary, to the target nucleic acids of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:5, and SEQ ID NO:6.

[0216] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence is 100% complementary to positions 64669 to 69429 of SEQ ID NO:1 and positions 29514 to 29530 of SEQ ID NO:2.

[0217] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence is 100% complementary to positions 64670 to 64685 of SEQ ID NO:1 and positions 29515 to 29530 of SEQ ID NO:2.

[0218] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence is 100% complementary to positions 69414 to 69429 of SEQ ID NO:1 and positions 30731 to 30746 of SEQ ID NO:2.

[0219] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence is 100% complementary to positions 759-781 of SEQ ID NO:1 and positions 1032-1054 of SEQ ID NO:2.

[0220] In some embodiments, the antisense oligonucleotides of the invention comprise or consist of 12 to 32 nucleotides in length, such as 14 to 25, such as 15 to 22, such as 16 to 20 contiguous nucleotides.

[0221] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide complementary to the target nucleic acid comprises or consists of 12 to 22, such as 14 to 20, for example 16 to 20, such as 15 to 18, for example 16 to 18, for example 16 to 17 contiguous nucleotides in length.

[0222] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises or consists of 22 or fewer nucleotides, e.g., 20 or fewer nucleotides, e.g., 17 or fewer nucleotides. Ranges given herein should be understood to include the endpoints of the range. Thus, when an oligonucleotide is said to comprise 12 to 32 nucleotides, both 12 nucleotides and 32 nucleotides are included.

[0223] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 12 to 32 nucleotides in length and has at least 93% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 7 to 16.

[0224] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 12 to 32 nucleotides in length and has at least 93% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 17 to 19.

[0225] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 12 to 32 nucleotides having at least 93% identity, preferably 100% identity, to the sequence of SEQ ID NO: 17 or 18.

[0226] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 12 to 32 nucleotides having at least 93% identity, preferably 100% identity, to the sequence of SEQ ID NO:19.

[0227] In a further embodiment, the present invention relates to an siRNA molecule, wherein the antisense strand has at least 93% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 17-19.

[0228] In a further embodiment, the present invention relates to shRNA molecules, wherein a region of the molecule has at least 93% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 17-19.

[0229] It is understood that the consecutive nucleobase sequence (motif sequence) can be modified, for example, to increase nuclease resistance and / or binding affinity to the target nucleic acid.

[0230] The pattern by which high-affinity modified nucleotides are incorporated into an oligonucleotide sequence is commonly referred to as the oligonucleotide design.

[0231] The oligonucleotides of the invention are designed using modified nucleosides and DNA nucleosides. Advantageously, high affinity modified nucleosides are used.

[0232] In some embodiments, the oligonucleotide comprises at least one modified nucleoside, e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 modified nucleosides. In some embodiments, the oligonucleotide comprises 1 to 10 modified nucleosides, e.g., 2 to 9 modified nucleosides, e.g., 3 to 8 modified nucleosides, e.g., 4 to 7 modified nucleosides, e.g., 6 or 7 modified nucleosides. Suitable modifications are described in the "Definitions" sections under "Modified Nucleosides," "High-Affinity Modified Nucleosides," "Sugar Modifications," "2' Sugar Modifications," and "Locked Nucleic Acids (LNA)."

[0233] In some embodiments, the oligonucleotide comprises one or more sugar-modified nucleosides, such as 2' sugar-modified nucleosides. Preferably, the oligonucleotide of the present invention comprises one or more 2' sugar-modified nucleosides independently selected from the group consisting of 2' sugar-O-alkyl-RNA, 2' sugar-O-methyl-RNA, 2' sugar-alkoxy-RNA, 2' sugar-O-methoxyethyl-RNA, 2' sugar-amino-DNA, 2' sugar-fluoro-DNA, arabinonucleic acid (ANA), 2' sugar-fluoro-ANA, and LNA nucleosides. Advantageously, one or more modified nucleosides are locked nucleic acids (LNA). Frequently used LNA nucleosides are oxy-LNA or cET.

[0234] In a further embodiment, the oligonucleotide comprises at least one modified internucleoside linkage. Suitable internucleoside modifications are described in the "Definitions" section under "Modified Internucleoside Linkages." It is advantageous if at least 75%, for example all, of the internucleoside linkages in a contiguous nucleotide sequence are phosphorothioate or boranophosphate internucleoside linkages. In some embodiments, all internucleoside linkages in a contiguous sequence of the oligonucleotide are phosphorothioate linkages.

[0235] In some embodiments, the oligonucleotide of the present invention comprises at least one LNA nucleoside, for example, 1, 2, 3, 4, 5, 6, 7, or 8 LNA nucleosides, for example, 2 to 6 LNA nucleosides, for example, 3 to 7 LNA nucleosides, 4 to 8 LNA nucleosides, or 3, 4, 5, 6, 7, or 8 LNA nucleosides. In some embodiments, at least 75% of the modified nucleosides in the oligonucleotide are LNA modified nucleosides, for example, 80%, for example, 85%, for example, 90% of the modified nucleosides are LNA nucleosides. In yet other embodiments, all modified nucleosides in the oligonucleotide are LNA nucleosides. In further embodiments, the oligonucleotide may contain both beta-D-oxy-LNA and one or more of the following LNA nucleosides: thio-LNA, amino-LNA, oxy-LNA, ScET, and / or ENA in either beta-D or alpha-L orientation, or a combination thereof. In further embodiments, all LNA cytosine units are 5-methyl-cytosine. Nuclease stability of an oligonucleotide or a contiguous nucleotide sequence is advantageously enhanced by having at least one LNA nucleoside at the 5'-end and at least two LNA nucleosides at the 3'-end of the nucleotide sequence.

[0236] In one embodiment of the present invention, the oligonucleotide of the present invention is capable of recruiting RNaseH.

[0237] In the present invention, advantageous structural designs are those described in the "Definitions" section, such as "Gapmer," "LNA Gapmer," "MOE Gapmer," "Mixed Wing Gapmer," and "Alternating Flank Gapmer." Gapmer designs include gapmers with uniform flanks, mixed wing flanks, alternating flanks, and gap breaker designs. In the present invention, it is advantageous if the oligonucleotide of the present invention is a gapmer with an FG-F' design. In addition to the FG-F' design described in the "Definitions" section, one design can be a gap region of 5 to 16 internucleosides in which the F and F' wing regions independently contain 1 to 8 2' sugar-modified nucleosides, with G capable of recruiting RNase H.

[0238] In some embodiments, the gapmer is an LNA gapmer with uniform or alternating flanks.

[0239] In some embodiments of the invention, the LNA gapmer is selected from the following uniform flank designs: 2-11-3, 2-11-4, 2-12-2, 2-12-3, 2-13-2, 2-9-6, 3-10-3, 3-10-4, 3-11-2, 3-11-3, 3-12-2, 3-9-4, 4-10-2, 4-10-3, 4-11-2, 4-7-5, 4-8-4, 4-9-3, 5-10-2, 5-6-5, 5-7-4, 5-7-5, 5-8-3, 5-8-4, 5-9-2, or 6-9-2.

[0240] In some embodiments of the invention, the LNA gapmer is selected from the following alternating flank designs: 4-7-1-1-3, 4-9-1-1-2, 1-1-3-7-1-1-2, 1-1-3-9-2, 2-1-1-9-2, 2-1-1-9-3.

[0241] Tables 5 and 7 ("Materials and Methods" column) list the preferred designs for each motif sequence.

[0242] In all cases, the FG-F' design further includes regions D' and / or D" as described in the "Definitions" section under "Region D' or D" of the Oligonucleotide." In some embodiments, oligonucleotides of the invention have one, two, or three phosphodiester-linked nucleoside units, such as DNA units, at the 5' or 3' end of the gapmer region. In some embodiments, oligonucleotides of the invention consist of two 5' phosphodiester-linked DNA nucleosides followed by an FG-F' gapmer region as defined in the "Definitions" section. In addition to the D'-FG-F'-D" design described in the "Definitions" section, one design is an antisense oligonucleotide in which a) the F region is 1-6 nucleotides in length and consists of 2-5 identical LNA nucleosides, e.g., beta-D-oxyLNA or cET, and 0-3 DNA nucleosides; b) the F' region is 2-6 nucleotides in length and consists of 2-5 identical LNA nucleosides, e.g., beta-D-oxyLNA or cET, and 0-3 DNA nucleosides; c) the G region is composed of 5-11, e.g., 7-10, DNA nucleotides; and d) optionally, the D' region is composed of 1-3 phosphodiester-linked DNA nucleosides. Oligonucleotides containing phosphodiester-linked DNA units at the 5' or 3' end are suitable for conjugation and may further comprise a conjugate moiety as described herein. For delivery to the liver, an ASGPR targeting moiety is particularly advantageous as a conjugate moiety. For more details, see the "Conjugates" section below.

[0243] In certain embodiments of the present invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having compound numbers 7_1 to 7_83 (see the oligonucleotides listed in Table 5) or pharmaceutically acceptable salts thereof.

[0244] In certain embodiments of the present invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having compound numbers 8_1 to 8_81 (see the oligonucleotides or pharmaceutically acceptable salts thereof listed in Table 5) or pharmaceutically acceptable salts thereof.

[0245] In certain embodiments of the present invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having compound numbers 9_1 to 9_12 (see the oligonucleotides listed in Table 5) or pharmaceutically acceptable salts thereof.

[0246] In certain embodiments of the present invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having compound numbers 10_1 to 10_18 (see the oligonucleotides listed in Table 5) or pharmaceutically acceptable salts thereof.

[0247] In certain embodiments of the present invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having compound numbers 11_1 to 11_26 (see the oligonucleotides listed in Table 5) or pharmaceutically acceptable salts thereof.

[0248] In certain embodiments of the present invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having compound numbers 12_1 to 12_15 (see the oligonucleotides listed in Table 5) or pharmaceutically acceptable salts thereof.

[0249] In certain embodiments of the invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having compound numbers 13_1 or 13_2 (see the oligonucleotides listed in Table 5).

[0250] In certain embodiments of the present invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having compound numbers 14_1 to 14_13 (see the oligonucleotides listed in Table 5) or pharmaceutically acceptable salts thereof.

[0251] In certain embodiments of the present invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having compound numbers 15_1 to 15_21 (see the oligonucleotides listed in Table 5) or pharmaceutically acceptable salts thereof.

[0252] In certain embodiments of the invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having compound numbers 16_1 to 16_5 (see the oligonucleotides listed in Table 5).

[0253] In certain embodiments of the present invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having compound numbers 17_1 to 17_183 (see the oligonucleotides listed in Table 7) or pharmaceutically acceptable salts thereof.

[0254] In certain embodiments of the present invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having compound numbers 18_1 to 18_31 or 18_250 to 18_361 (see the oligonucleotides listed in Table 7) or pharmaceutically acceptable salts thereof.

[0255] In certain embodiments of the present invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having compound numbers 18_32 to 18_249 or 18_362 to 18_610 (see the oligonucleotides listed in Table 7) or pharmaceutically acceptable salts thereof.

[0256] In certain embodiments of the present invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having compound numbers 19_1 to 19_22 (see the oligonucleotides listed in Table 7) or pharmaceutically acceptable salts thereof.

[0257] In one embodiment of the invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having compound numbers 18_1, 18_5, 18_10, 18_15, 18_18, 18_19, 18_24, 18_27, 18_30, 18_346, 18_347, 18_357, 17_10, 17_137, and 17_139.

[0258] In one embodiment of the invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having compound numbers 18_1, 18_15, 18_30, 17_10, 17_137, and 17_139.

[0259] In a further embodiment of the invention, the oligonucleotide may comprise at least one stereodefined internucleoside linkage, such as a stereodefined phosphorothioate internucleoside linkage.

[0260] The main advantage of generating stereodefined oligonucleotide variants is the ability to increase diversity across sequence motifs and select stereodefined oligonucleotides containing sub-libraries of stereodefined oligonucleotides with improved medicinal and chemical properties compared to the parent oligonucleotide.

[0261] In some embodiments, the improved medicamentochemical property (or improved property) is selected from one or more of: enhanced efficacy, enhanced specific activity, enhanced tissue uptake, enhanced cellular uptake, enhanced efficacy, altered biodistribution, reduced off-target effects, enhanced mismatch discrimination, reduced toxicity, reduced immunogenicity, altered serum protein binding, improved duration of action, and stability. The improvement in one or more properties is assessed relative to a parent oligonucleotide, such as a stereorandom parent oligonucleotide.

[0262] In some embodiments, it may be the ability of the oligonucleotide to regulate target expression through improved interaction with cellular machinery involved in regulating target expression, such as, for example, enhanced RNase H activity, improved splice regulatory activity, or improved microRNA inhibition.

[0263] In some embodiments, the improved property is RNase H specificity, RNase H allelic discrimination (i.e., discrimination between single nucleotide polymorphisms (SNPs) and / or RNase H activity). In some embodiments, the improved property is other than RNase H specificity, RNase H allelic discrimination, and / or RNase H activity. In some embodiments, the improved property is improved cellular uptake. In some embodiments, the improved property is reduced toxicity, such as cytotoxicity or hepatotoxicity.

[0264] Stereodefined oligonucleotides that exhibit one or more improved properties compared to a parent oligonucleotide, or other stereodefined oligonucleotides, are referred to as improved phosphorothioate variants.

[0265] In one embodiment of the present invention, the oligonucleotide is selected from the group of oligonucleotides having compounds with compound numbers 18_223, 18_36, 18_196, 18_188, 18_243.

[0266] In a further embodiment of the invention, nucleic acid molecules such as antisense oligonucleotides of the invention can be targeted directly to the liver by covalently linking them to a conjugate moiety capable of binding to the asialoglycoprotein receptor (ASGPr), such as a divalent or trivalent GalNAc cluster.

[0267] Conjugates Because HBV infection primarily affects hepatocytes in the liver, it is advantageous to conjugate the antisense oligonucleotides of the present invention to a conjugate moiety that increases delivery of the oligonucleotide to the liver compared to unconjugated oligonucleotides. In one embodiment, the liver-targeting moiety is selected from a moiety containing cholesterol or other lipids, or a conjugate moiety capable of binding to the asialoglycoprotein receptor (ASGPR).

[0268] In some embodiments, the present invention provides a conjugate comprising an antisense oligonucleotide of the present invention covalently attached to a conjugate moiety.

[0269] The asialoglycoprotein receptor (ASGPR) conjugate moiety comprises one or more carbohydrate moieties capable of binding to the asialoglycoprotein receptor (ASPGR targeting moiety) with an affinity equal to or greater than that of galactose. The affinity of numerous galactose derivatives for the asialoglycoprotein receptor has been studied (see, e.g., Jobst, ST and Drickamer, K. JB.C. 1996, 271, 6686) or is readily determined using methods common in the art.

[0270] In one embodiment, the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-isobutanoylgalactosamine. Advantageously, the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc).

[0271] To generate an ASGPR conjugate moiety, an ASPGR targeting moiety (preferably GalNAc) can be attached to the conjugate scaffold. Typically, the ASPGR targeting moiety can be on the same side as the scaffold. In one embodiment, the conjugate moiety consists of two to four terminal GalNAc moieties linked to a spacer, which links each GalNAc moiety to a branched molecule that can be attached to an antisense oligonucleotide.

[0272] In further embodiments, the conjugate moiety is monovalent, divalent, trivalent, or tetravalent with respect to the asialoglycoprotein receptor targeting moiety. Advantageously, the asialoglycoprotein receptor targeting moiety comprises an N-acetylgalactosamine (GalNAc) moiety.

[0273] The ASPGR targeting scaffold constituting the conjugate moiety can be generated by linking the GalNAc moiety to a spacer, for example, via the CI carbon. A preferred spacer is a flexible hydrophilic spacer (U.S. Pat. No. 5,885,968; Biessen et al. J. Med. Chern. 1995 Vol. 39 pp. 1538-1546). A preferred flexible hydrophilic spacer is a PEG spacer. A preferred PEG spacer is a PEG3 spacer. The branch point can be any small molecule that allows for the attachment of two to three GalNAc moieties or other asialoglycoprotein receptor targeting moieties and further allows for the attachment of the branch point to an oligonucleotide; such a construct is called a GalNAc cluster or GalNAc conjugate moiety. An exemplary branch point group is di-lysine. A di-lysine molecule contains three amine groups to which three GalNAc moieties or other asialoglycoprotein receptor targeting moieties can be attached, and a carboxyl-reactive group through which the di-lysine can be attached to an oligomer. Khorev, et al 2008 Bioorg. Med. Chem. Vol 16, pp. 5216 also describes the synthesis of suitable trivalent branches.Other commercially available branched compounds include 1,3-bis-[5-(4,4'-dimethoxytrityloxy)pentylamido]propyl-2-[(2-cyanoethyl)-(N,N-diisopropyl)]phosphoramidite (Glen Research Catalogue Number: 10-1920-xx); tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propyloxymethyl]ethyl-[(2-cyanoethyl)-(N,N-diisopropyl)]phosphoramidite (Glen Research Catalogue Number: 10-1922-xx); and tris-2,2,2-1-[3-(4,4'-dimethoxytrityloxy)propyloxymethyl]methyleneoxypropyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite; and 1-[5-(4,4'-dimethoxy-trityloxy)pentylamido]-3-[5-fluorenomethoxy-carbonyl-oxy-pentylamido]-propyl-2-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (Glen Research Catalogue Number: 10-1925-xx).

[0274] Other GalNAc-conjugated moieties include, for example, those described in WO2014 / 179620 and WO2016 / 055601 and PCT / EP2017 / 059080 (incorporated herein by reference), as well as small peptides with GalNAc moieties attached, such as Tyr-Glu-Glu-(aminohexylGalNAc)3 (YEE(ahGalNAc)3; a glycotripeptide that binds to the asialoglycoprotein receptor on hepatocytes (see, e.g., Duff, et al., Methods Enzymol, 2000, 313, 297); lysine-based galactose clusters (e.g., L3G4; Biessen, et al., Cardovasc. Med., 1999, 214); and cholan-based galactose clusters (e.g., the carbohydrate recognition motif of the asialoglycoprotein receptor).

[0275] The ASGPR-conjugate moiety, particularly the trivalent GalNAc-conjugate moiety, can be attached to the 3' or 5' end of the oligonucleotide using methods known in the art. In one embodiment, the ASGPR-conjugate moiety is linked to the 5' end of the oligonucleotide.

[0276] One or more linkers can be inserted between the conjugate moiety (such as a branched molecule) and the oligonucleotide. It is advantageous to have a biocleavable linker between the conjugate moiety and the antisense oligonucleotide, optionally in combination with a non-cleavable linker such as a C6 linker. The linker can be selected from those listed under "Conjugate Linkers" in the "Definitions" section, with biocleavable region D' or D" linkers being particularly advantageous.

[0277] In one embodiment, the conjugate moiety is a trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 1, particularly Figure ID.

[0278] In one embodiment of the present invention, the conjugate compound is selected from the group of compounds in Table 9 in the "Materials and Methods" section.

[0279] In one embodiment of the present invention, the conjugate compounds are Compound Nos. 20-12. In one embodiment of the present invention, the conjugate compounds are Compound Nos. 20-13. In one embodiment of the present invention, the conjugate compounds are Compound Nos. 20-14. In one embodiment of the present invention, the conjugate compounds are Compound Nos. 20-15. In one embodiment of the present invention, the conjugate compounds are Compound Nos. 20-16. In one embodiment of the present invention, the conjugate compounds are Compound Nos. 20-18. In one embodiment of the present invention, the conjugate compound is compound no. 20-20. In one embodiment of the present invention, the conjugate compounds are Compound Nos. 20-21. In one embodiment of the present invention, the conjugate compounds are Compound Nos. 20-22. In one embodiment of the present invention, the conjugate compounds are Compound Nos. 20-30. In one embodiment of the present invention, the conjugate compounds are Compound Nos. 20-35. In one embodiment of the present invention, the conjugate compounds are Compound Nos. 20-36. In one embodiment of the present invention, the conjugate compounds are Compound Nos. 21-2. In one embodiment of the present invention, the conjugate compounds are Compound Nos. 21-33. In one embodiment of the present invention, the conjugate compounds are Compound Nos. 21-34.

[0280] Manufacturing method In a further aspect, the present invention provides a method for producing an antisense oligonucleotide of the present invention, comprising reacting nucleotide units to form covalently linked consecutive nucleotide units contained in the oligonucleotide. Preferably, the method uses phosphoramidite chemistry (see, e.g., Caruthers et al., 1987, Methods in Enzymology, vol. 154, pages 287-313). In a further embodiment, the method further comprises reacting the consecutive nucleotide sequence with a conjugate moiety (ligand) to covalently link the conjugate moiety to the oligonucleotide. In a further aspect, a method for producing a composition of the present invention is provided, comprising mixing an oligonucleotide or conjugated oligonucleotide of the present invention with a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or auxiliary agent.

[0281] Pharmaceutical Composition In a further aspect, the present invention provides a pharmaceutical composition comprising an antisense oligonucleotide and / or conjugate compound of the invention or a salt thereof, and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant. A typical pharmaceutical composition is prepared by mixing the antisense oligonucleotide or conjugate compound of the invention with a diluent, carrier, or excipient.

[0282] Pharmaceutically acceptable diluents include phosphate buffered saline (PBS). In some embodiments, the pharmaceutically acceptable diluent is sterile phosphate buffered saline. In some embodiments, the oligonucleotide is used in the pharmaceutically acceptable diluent at a concentration of 50 to 300 μM solution.

[0283] For nucleic acid molecules, conjugate compounds, including antisense oligonucleotides and suitable formulations thereof, can be found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985. For a brief review of drug delivery methods, see, for example, Langer (Science 249:1527-1533, 1990). WO2007 / 031091 provides further suitable and preferred examples of pharmaceutically acceptable diluents, carriers, and adjuvants (incorporated herein by reference). Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, and prodrug formulations are also provided in WO2007 / 031091.

[0284] The compounds of the present invention can exist in the form of their pharmaceutically acceptable salts. The term "pharmaceutically acceptable salt" refers to conventional acid or base addition salts that retain the biological effectiveness and properties of the compounds of the present invention and are formed from suitable non-toxic organic or inorganic acids or organic or inorganic bases. Acid addition salts include those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, sulfamic acid, phosphoric acid, and nitric acid, and those derived from organic acids such as p-toluenesulfonic acid, salicylic acid, methanesulfonic acid, oxalic acid, succinic acid, citric acid, malic acid, lactic acid, and fumaric acid. Base addition salts include those derived from ammonium, potassium, sodium, and quaternary ammonium hydroxides, such as tetramethylammonium hydroxide. Chemical modification of pharmaceutical compounds into salts is a technique known to pharmaceutical chemists to improve the physical and chemical stability, hygroscopicity, flowability, and solubility of the compounds. For example, this is described in Bastin, Organic Process Research & Development 2000, 4, 427-435 or in Ansel, In: Pharmaceutical Dosage Forms and Drug Delivery Systems, 6th ed. (1995), pp. 196 and 1456-1457. For example, pharmaceutically acceptable salts of the compounds provided herein can be sodium or potassium salts.

[0285] Purpose The oligonucleotides of the present invention can be utilized, for example, as research reagents for diagnostic, therapeutic, and prophylactic agents.

[0286] In research, such oligonucleotides can be used to specifically regulate the synthesis of PAPD5 and PAPD7 proteins in cells (e.g., in vitro cell cultures) and experimental animals, thereby facilitating functional analysis of the target or evaluation of its usefulness as a target for therapeutic intervention. Generally, target regulation is achieved by degrading or inhibiting the mRNA that produces the protein, thereby preventing the formation of the protein, or by degrading or inhibiting a modulator of the gene or mRNA that produces the protein.

[0287] When using the oligonucleotides of the invention in research or diagnostics, the target nucleic acid can be cDNA or synthetic nucleic acid derived from DNA or RNA.

[0288] The present invention also includes an in vivo or in vitro method for regulating the expression of PAPD5 and PAPD7 in target cells expressing PAPD5 and PAPD7, which method comprises administering to the cells an effective amount of an antisense oligonucleotide, conjugate compound, or pharmaceutical composition of the present invention.

[0289] In some embodiments, the target cells are mammalian cells, particularly human cells. The target cells may be in vitro cell cultures or in vivo cells that form part of mammalian tissue. In a preferred embodiment, the target cells are located in the liver. The target cells may be hepatocytes.

[0290] One aspect of the present invention relates to the antisense oligonucleotide, conjugated compound, or pharmaceutical composition of the present invention for use as a medicament.

[0291] In one embodiment of the present invention, the antisense oligonucleotide, conjugate compound, or pharmaceutical composition of the present invention can inhibit the proliferation of HBV. In particular, the antisense oligonucleotide can affect one or more of the following parameters: i) reducing the expression of viral RNA; ii) reducing the production of viral DNA (HBV DNA) derived from viral RNA (HBV RNA); iii) reducing the production of new viral particles (HBV particles); and iv) reducing the production of HBV antigens, particularly HBsAg and / or HBeAg.

[0292] For example, an antisense oligonucleotide that inhibits HBV proliferation may: i) reduce the expression of viral RNA (HBV RNA) by at least 40%, e.g., 50%, 60%, 70%, 80%, or 90% compared to a control; ii) reduce the production of viral DNA (HBV DNA) by at least 40%, e.g., 50%, 60%, 70%, 80%, or 90% compared to a control; iii) reduce the production of new virus particles (HBV particles) by at least 40%, e.g., 50%, 60%, 70%, 80%, or 90% compared to a control; or iv) reduce the production and / or secretion of HBsAg and / or HBeAg by at least 50%, e.g., at least 60%, 70%, 80%, 90%, or even to complete depletion of one or both antigens compared to a control. The control may be untreated cells or animals, or cells or animals treated with an appropriate control.

[0293] Inhibition of HBV proliferation can be measured in vitro using HBV-infected dHepaRG or ASGPR-dHepaRG cells, or in vivo using the AAV / HBV mouse model described in the "Materials and Methods" section for oligonucleotides complementary to murine PAPD5 and PAPD7. Inhibition of HBsAg and / or HBeAg secretion can be measured by ELISA, e.g., using a CLIA ELISA kit (Autobio Diagnostic) according to the manufacturer's instructions. Inhibition of intracellular HBV mRNA production can be measured by real-time PCR, e.g., as described in the "Materials and Methods" section. Further methods for assessing whether a test compound inhibits HBV proliferation include measuring HBV DNA secretion by RT-qPCR; Northern blotting, in situ hybridization, or immunofluorescence, e.g., as described in WO 2015 / 173208 or the "Materials and Methods" section.

[0294] By reducing HBsAg secretion, the antisense oligonucleotides, conjugate compounds, or pharmaceutical compositions of the present invention can be used to inhibit the onset of HBV infection or treat the infection. In particular, by inhibiting HBeAg secretion, the antisense oligonucleotides, conjugate compounds, or pharmaceutical compositions of the present invention more efficiently inhibit the onset of chronic HBV infection or treat the infection compared to compounds that only reduce HBsAg secretion. Furthermore, reducing HBeAg in pregnant women may also inhibit the onset of chronic HBV infection in their children. Thus, by reducing HBeAg secretion, the antisense oligonucleotides, conjugate compounds, or pharmaceutical compositions of the present invention inhibit the onset of chronic HBV infection (such as the onset of chronic HBV infection in children of HBV-infected mothers) and reduce the infectivity of HBV-infected individuals.

[0295] Thus, one aspect of the present invention relates to the use of an antisense oligonucleotide, conjugate compound, or pharmaceutical composition of the present invention to reduce the secretion of HBsAg and HBeAg in an HBV-infected individual. Advantageously, the antisense oligonucleotide, conjugate compound, or pharmaceutical composition of the present invention can reduce the expression of HBsAg from HBV DNA integrated into the host genome.

[0296] A further aspect of the present invention relates to the use of the antisense oligonucleotide, conjugated compound or pharmaceutical composition of the present invention to inhibit the development of chronic HBV infection or to treat the infection.

[0297] A further aspect of the present invention relates to the use of an antisense oligonucleotide, conjugate compound, or pharmaceutical composition of the present invention to reduce infectivity in an HBV-infected individual. In a specific aspect of the present invention, the antisense oligonucleotide, conjugate compound, or pharmaceutical composition of the present invention inhibits the development of chronic HBV infection in children of HBV-infected mothers, who are preferably HBeAg-positive.

[0298] The subject to be treated with the antisense oligonucleotide, conjugate compound, or pharmaceutical composition of the invention (or the subject to be prophylactically administered the antisense oligonucleotide, conjugate compound, or pharmaceutical composition of the invention) is preferably a human, more preferably an HBsAg-positive and / or HBeAg-positive human patient, even more preferably an HBsAg-positive and HBeAg-positive human patient. The human patient is a pregnant woman, for example, an HBeAg-positive and / or HBsAg-positive pregnant woman, more preferably an HBeAg-positive and HBsAg-positive pregnant woman.

[0299] Thus, the present invention relates to a method for treating and / or preventing HBV infection, comprising administering an effective amount of an antisense oligonucleotide, conjugated compound, or pharmaceutical composition of the present invention.

[0300] The present invention also provides the use of a nucleic acid molecule, antisense oligonucleotide, conjugate compound, or pharmaceutical composition of the present invention for the manufacture of a medicament, particularly a medicament for use in the treatment or prevention of HBV infection or chronic HBV infection, or for reducing the infectivity of HBV-infected individuals. In a preferred embodiment, the medicament is prepared in a dosage form for subcutaneous administration.

[0301] The present invention also provides the use of the nucleic acid molecules, antisense oligonucleotides, conjugated compounds and pharmaceutical compositions of the present invention for the manufacture of a medicament, wherein the medicament is in a dosage form for intravenous administration.

[0302] The nucleic acid molecules, antisense oligonucleotides, or pharmaceutical compositions of the present invention can be used in combination therapy. For example, the nucleic acid molecules, antisense oligonucleotides, or pharmaceutical compositions of the present invention can be used in combination therapy with other anti-HBV agents, such as interferon alpha-2b, interferon alpha-2a, and interferon alfacon-1 (pegylated and non-pegylated), ribavirin, lamivudine (3TC), entecavir, tenofovir, telbivudine (LdT), adefovir, or emerging anti-HBV agents, such as HBV It may be combined with an RNA replication inhibitor, an HBsAg secretion inhibitor, an HBV capsid inhibitor, an antisense oligomer (e.g., as described in WO2012 / 145697 and WO2014 / 179629), an siRNA (e.g., as described in WO2005 / 014806, WO2012 / 024170, WO2012 / 2055362, WO2013 / 003520, WO2013 / 159109, WO2017 / 027350, and WO2017 / 015175), an HBV therapeutic vaccine, an HBV prophylactic vaccine, an HBV antibody therapy (monoclonal or polyclonal), or a TLR2, 3, 7, 8, or 9 agonist for the treatment and / or prevention of HBV.

[0303] Administration The antisense oligonucleotides, conjugate compounds, or pharmaceutical compositions of the present invention are formulated, dosed, and administered in a manner consistent with good medical practice. Factors to consider in this regard include the specific mammal being treated, the individual patient's clinical condition, the site of drug delivery, the method of administration, the administration schedule, the patient's age and sex, and other factors known to medical professionals. As used herein, an "effective amount" (also known as a "therapeutically effective dose") refers to the amount of compound that elicits the biological or medical response in a subject sought by a physician or other clinician. The "effective amount" of the antisense oligonucleotides, conjugate compounds, or pharmaceutical compositions of the present invention is governed by such considerations and is the minimum amount necessary to inhibit HBsAg and / or HBeAg. For example, such an amount may be less than an amount that is toxic to the recipient's cells or to the whole mammal.

[0304] In some embodiments, the oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition of the invention is administered at a dose of 0.1 to 15 mg / kg, e.g., 0.2 to 10 mg / kg, e.g., 0.25 to 5 mg / kg, and may be administered once a week, once every two weeks, once every three weeks, or once a month.

[0305] The nucleic acid molecules or pharmaceutical compositions of the invention can be administered topically (e.g., to the skin, by inhalation, to the eye, or to the ear), enterally (e.g., orally or through the gastrointestinal tract), or parenterally (e.g., intravenously, subcutaneously, intramuscularly, intracerebrally, intraventricularly, or intrathecally).

[0306] In preferred embodiments, the nucleic acid molecule, antisense oligonucleotide, conjugate compound or pharmaceutical composition of the present invention is administered by parenteral route, including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion.In one embodiment, active oligonucleotide or oligonucleotide conjugate is administered intravenously.For GalNAc conjugate compound, it may be advantageous to administer subcutaneously to delay saturation of ASGP receptor.

[0307] Combination therapy In some embodiments, the oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition of the invention is used in combination therapy with another therapeutic agent, which may be, for example, a standard of care for the disease or disorder described above.

[0308] For example, the oligomers or oligomer conjugates of the invention can be used in combination with other active agents, such as antisense (including other LNA oligomers), siRNA (such as ARC520), aptamers, morpholinos, or other oligonucleotide-based antiviral agents (such as sequence-specific oligonucleotide-based antivirals) that act via an antiviral nucleotide sequence-dependent mechanism of action.

[0309] Further for example, the oligomer or oligomer conjugate of the invention may be used in combination with other active agents, such as interferons (e.g., pegylated interferon alpha), TLR7 agonists (e.g., GS-9620), or immunostimulatory antiviral compounds, such as therapeutic vaccines.

[0310] Further for example, the oligomers or oligomer conjugates of the invention can be used in combination with other active agents, such as small molecules with antiviral activity, which can be, for example, nucleoside / nucleotide inhibitors (e.g., entecavir or tenofovir disoproxil fumarate), encapsidation inhibitors, entry inhibitors (e.g., Myrcludex B).

[0311] In certain embodiments, the additional therapeutic agent can be an HBV agent, a hepatitis C virus (HCV) agent, a chemotherapeutic agent, an antibiotic, an analgesic, a nonsteroidal anti-inflammatory (NSAID), an antifungal agent, an antiparasitic agent, an anti-nausea agent, an anti-diarrheal agent, or an immunosuppressant.

[0312] In certain related embodiments, the additional HBV agent can be interferon alfa-2b, interferon alfa-2a, and interferon alfacon-1 (pegylated and non-pegylated), ribavirin; an HBV RNA replication inhibitor; a second antisense oligomer; an HBV therapeutic vaccine; an HBV prophylactic vaccine; lamivudine (3TC); entecavir (ETV); tenofovir diisoproxil fumarate (TDF); telbivudine (LdT); adefovir; or an HBV antibody therapy (monoclonal or polyclonal).

[0313] In other specific related embodiments, the additional HCV agent can be interferon alpha-2b, interferon alpha-2a, and interferon alfacon-1 (pegylated and non-pegylated); ribavirin; Pegasys; HCV RNA replication inhibitors (e.g., ViroPharma's VP50406 series); HCV antisense agents; HCV therapeutic vaccines; HCV protease inhibitors; HCV helicase inhibitors; or HCV monoclonal or polyclonal antibody therapy.

[0314] Embodiments of the present invention The following embodiments of the present invention may be used in combination with other embodiments described herein.

[0315] 1. A nucleic acid molecule of 12 to 32 nucleotides in length, comprising a contiguous nucleotide sequence of 12 to 22 nucleotides in length, which is capable of inhibiting the expression of both PAPD5 and PAPD7. 2. The nucleic acid molecule of embodiment 1, wherein the contiguous nucleotide sequence is at least 93% complementary to the target nucleic acids of SEQ ID NO: 1 and SEQ ID NO: 2. 3. A nucleic acid molecule according to embodiment 1 or 2, wherein the contiguous nucleotide sequence is at least 100% complementary to the target nucleic acids of SEQ ID NO: 1 and SEQ ID NO: 2. 4. A nucleic acid molecule described in embodiment 1 or 3, wherein the contiguous nucleotide sequence is complementary to target nucleic acids of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4. 5. A nucleic acid molecule described in embodiment 1 or 3, wherein the contiguous nucleotide sequence is complementary to target nucleic acids of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, and SEQ ID NO: 6.

[0316] 6. A nucleic acid molecule according to any one of embodiments 1 to 3 or 5, wherein the nucleic acid molecule is complementary to positions 759 to 781 of SEQ ID NO: 1 and positions 1032 to 1054 of SEQ ID NO: 2. 7. A nucleic acid molecule according to any one of embodiments 1 to 4, wherein the nucleic acid molecule is complementary to positions 64669 to 69429 of SEQ ID NO: 1 and positions 29514 to 29530 of SEQ ID NO: 2. 8. A nucleic acid molecule according to any one of embodiments 1 to 4, wherein the nucleic acid molecule is complementary to positions 69414 to 69429 of SEQ ID NO: 1 and positions 30731 to 30746 of SEQ ID NO: 2. 9. The nucleic acid molecules according to embodiments 1 to 8 are capable of hybridizing to the target nucleic acids of SEQ ID NO: 1 and SEQ ID NO: 2 with a ΔG° of less than −15 kcal. 10. A nucleic acid molecule according to any one of embodiments 2 to 9, wherein the target nucleic acid is RNA.

[0317] 11. The nucleic acid molecule of embodiment 10, wherein the RNA is pre-mRNA. 12. A nucleic acid molecule described in embodiments 1 to 11, wherein the nucleic acid molecule is selected from an antisense oligonucleotide, an siRNA, or an shRNA. 13. The nucleic acid molecule of any one of embodiments 1 to 11, wherein the nucleic acid molecule is a single-stranded antisense oligonucleotide. 14. The antisense oligonucleotide according to embodiment 12 or 13, wherein the contiguous nucleotide sequence comprises or consists of at least 14 contiguous nucleotides, in particular 15, 16, 17, 18, 19, or 20 contiguous nucleotides. 15. The antisense oligonucleotide of embodiment 12 or 13, wherein the contiguous nucleotide sequence comprises or consists of 14 to 20 nucleotides.

[0318] 16. The antisense oligonucleotide of embodiment 15, wherein the contiguous nucleotide sequence comprises or consists of 16 to 18 nucleotides. 17. The antisense oligonucleotide of any one of embodiments 1 to 16, wherein the oligonucleotide comprises or consists of 14 to 25 nucleotides in length. 18. The antisense oligonucleotide of embodiment 17, wherein the antisense oligonucleotide comprises or consists of 15 to 22 nucleotides in length. 19. The antisense oligonucleotide of embodiment 17 or 18, wherein the antisense oligonucleotide comprises or consists of 16 to 20 nucleotides in length. 20. The antisense oligonucleotide of embodiments 12 to 19, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19.

[0319] 21. The antisense oligonucleotide of any one of embodiments 12 to 20, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 7, 8, 9, 10, 11, 12, 13, 14, 15, and 16. 22. The antisense oligonucleotide of any one of embodiments 12 to 20, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from SEQ ID NO: 17 or SEQ ID NO: 18. 23. The antisense oligonucleotide of any one of embodiments 12 to 20, wherein the contiguous nucleotide sequence comprises or consists of SEQ ID NO: 19. 24. An antisense oligonucleotide according to any one of embodiments 12 to 23, wherein the contiguous nucleotide sequence has 0 to 3 mismatches compared to the target nucleic acid to which it is complementary. 25. The antisense oligonucleotide of embodiment 24, wherein the contiguous nucleotide sequence has one mismatch compared to the target nucleic acid.

[0320] 26. The antisense oligonucleotide of embodiment 24, wherein the contiguous nucleotide sequence has two mismatches compared to the target nucleic acid. 27. The antisense oligonucleotide of embodiment 24, wherein the contiguous nucleotide sequence is perfectly complementary to both target nucleic acid sequences. 28. The antisense oligonucleotide of any one of embodiments 12 to 27, comprising one or more modified nucleosides. 29. The antisense oligonucleotide of embodiment 28, wherein the one or more modified nucleosides are high-affinity modified nucleosides. 30. The antisense oligonucleotide of embodiment 28 or 29, wherein the one or more modified nucleosides are 2' sugar-modified nucleosides.

[0321] 31. The antisense oligonucleotide of embodiment 30, wherein the one or more 2' sugar-modified nucleosides are independently selected from the group consisting of 2' sugar-O-alkyl-RNA, 2' sugar-O-methyl-RNA, 2' sugar-alkoxy-RNA, 2' sugar-O-methoxyethyl-RNA, 2' sugar-amino-DNA, 2' sugar-fluoro-DNA, 2' sugar-fluoro-ANA, and LNA nucleosides. 32. The antisense oligonucleotide of embodiments 28-31, wherein the one or more modified nucleosides are LNA nucleosides. 33. The antisense oligonucleotide of embodiment 32, wherein the modified LNA nucleoside is selected from oxy-LNA, amino-LNA, thio-LNA, cET, and ENA. 34. The antisense oligonucleotide of embodiment 32 or 33, wherein the modified LNA nucleoside is oxy-LNA having the following 2' sugar-4' bridge -O-CH2-. 35. The antisense oligonucleotide of embodiment 34, wherein the oxy-LNA is beta-D-oxy-LNA.

[0322] 36. The antisense oligonucleotide of embodiment 32 or 33, wherein the modified LNA nucleoside is cET having the following 2' sugar-4' bridge -O-CH(CH3)-. 37. The antisense oligonucleotide of embodiment 36, wherein the cET is (S)cET, i.e., 6'(S)methyl-beta-D-oxy-LNA. 38. The antisense oligonucleotide of embodiment 32 or 33, wherein the LNA is ENA and has the following 2' sugar-4' bridge -O-CH2-CH2-. 39. The antisense oligonucleotide of any one of embodiments 12 to 33, wherein the antisense oligonucleotide comprises at least one modified internucleoside linkage. 40. The antisense oligonucleotide of embodiment 39, wherein the modified internucleoside linkages are nuclease-resistant.

[0323] 41. The antisense oligonucleotide of embodiment 39 or 40, wherein at least 75% of the internucleoside linkages within said contiguous nucleotide sequence are phosphorothioate internucleoside linkages or boranophosphate internucleoside linkages. 42. The antisense oligonucleotide of embodiment 39 or 40, wherein all internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages. 43. The antisense oligonucleotide of embodiment 41 or 42, wherein at least one of the phosphorothioate internucleoside linkages is stereodefined. 44. The antisense oligonucleotide of any one of embodiments 12 to 43, wherein the antisense oligonucleotide is capable of recruiting RNase H. 45. The antisense oligonucleotide of embodiment 44, wherein the antisense oligonucleotide or the consecutive nucleotide sequence is a gapmer.

[0324] 46. ​​The antisense oligonucleotide of embodiment 45, wherein the gapmer has the formula 5'-FG-F'-3', wherein the F and F' wing regions independently comprise or consist of 1 to 7 2' sugar-modified nucleosides described in embodiments 31 to 38, and G is 5 to 16 nucleosides capable of recruiting RNase H. 47. The antisense oligonucleotide of embodiment 46, wherein each wing (F and F') has at least one 2' sugar-modified nucleoside at the 5' and 3' ends of the wing, and the G region has at least one DNA nucleoside adjacent to the wing region (e.g., at the 5' and 3' ends of the G region). 48. The antisense oligonucleotide of embodiment 46 or 47, wherein all 2' sugar-modified nucleosides within regions F and F' are the same LNA nucleoside.

[0325] 49. The oligonucleotide according to any one of embodiments 46 to 48, wherein a. the F region is 1-6 nucleotides in length and consists of 1-5 identical LNA nucleosides and 0-3 DNA nucleosides; and b. the F' region is 2-6 nucleotides in length and consists of 2-5 identical LNA nucleosides and 0-3 DNA nucleosides; and c. the G region is 5 to 11 nucleotides that can recruit RNase H; and d. Optionally, a D' region comprising 1 to 3 phosphodiester-linked DNA nucleosides is located at the 5' end of the F region. 50. The antisense oligonucleotide of embodiment 47, wherein regions F and F' consist of identical LNA nucleosides.

[0326] 51. The antisense oligonucleotide of embodiments 46 to 48, wherein all 2' sugar-modified nucleosides within regions F and F' are oxy-LNA nucleosides. 52. The antisense oligonucleotide of embodiment 46 or 47, wherein at least one of regions F or F' further comprises at least one 2' sugar-substituted modified nucleoside independently selected from the group consisting of 2' sugar-O-alkyl-RNA, 2' sugar-O-methyl-RNA, 2' sugar-alkoxy-RNA, 2' sugar-O-methoxyethyl-RNA, 2' sugar-amino-DNA, and 2' sugar-fluoro-DNA. 53. An antisense oligonucleotide described in embodiments 46 to 52, wherein the RNase H-recruiting nucleosides in region G are independently selected from DNA, alpha-L-LNA, C4' alkylated DNA, ANA, and 2' sugar F-ANA, and UNA. 54. The antisense oligonucleotide of embodiment 53, wherein the nucleosides within region G are DNA and / or alpha-L-LNA nucleosides. 55. The antisense oligonucleotide of embodiment 46, 53, or 54, wherein region G consists of at least 75% DNA nucleosides.

[0327] 56. The antisense oligonucleotide of embodiment 55, wherein all nucleosides within region G are DNA nucleosides. 57. The antisense oligonucleotide according to any one of embodiments 12 to 55, wherein the antisense oligonucleotide is selected from compound numbers 7_1 to 7_83, or a pharmaceutically acceptable salt thereof. 58. The antisense oligonucleotide according to any one of embodiments 12 to 55, wherein the antisense oligonucleotide is selected from compound numbers 8_1 to 8_81, or a pharmaceutically acceptable salt thereof. 59. The antisense oligonucleotide according to any one of embodiments 12 to 55, wherein the antisense oligonucleotide is selected from compound numbers 9_1 to 9_12, or a pharmaceutically acceptable salt thereof. 60. The antisense oligonucleotide according to any one of embodiments 12 to 55, wherein the antisense oligonucleotide is selected from compound numbers 10_1 to 10_18, or a pharmaceutically acceptable salt thereof.

[0328] 61. The antisense oligonucleotide according to any one of embodiments 12 to 55, wherein the antisense oligonucleotide is selected from compound numbers 11_1 to 11_26, or a pharmaceutically acceptable salt thereof. 62. The antisense oligonucleotide according to any one of embodiments 12 to 55, wherein the antisense oligonucleotide is selected from compound numbers 12_1 to 12_15, or a pharmaceutically acceptable salt thereof. 63. The antisense oligonucleotide of any one of embodiments 12 to 55, wherein the antisense oligonucleotide is selected from compound numbers 13_1 or 13_2, or a pharmaceutically acceptable salt thereof. 64. The antisense oligonucleotide according to any one of embodiments 12 to 55, wherein the antisense oligonucleotide is selected from compound numbers 14_1 to 14_13, or a pharmaceutically acceptable salt thereof. 65. The antisense oligonucleotide according to any one of embodiments 12 to 55, wherein the antisense oligonucleotide is selected from compound numbers 15_1 to 15_21, or a pharmaceutically acceptable salt thereof.

[0329] 66. The antisense oligonucleotide according to any one of embodiments 12 to 55, wherein the antisense oligonucleotide is selected from compound numbers 16_1 to 16_5, or a pharmaceutically acceptable salt thereof. 67. The antisense oligonucleotide according to any one of embodiments 12 to 55, wherein the antisense oligonucleotide is selected from compound numbers 17_1 to 17_183, or a pharmaceutically acceptable salt thereof. 68. The antisense oligonucleotide of any one of embodiments 12 to 55, wherein the antisense oligonucleotide is selected from compound numbers 18_1 to 18_31, or 18_250 to 18_361, or a pharmaceutically acceptable salt thereof. 69. The antisense oligonucleotide of embodiment 68, wherein the antisense oligonucleotide is selected from compound numbers 18_1, 18_5, 18_10, 18_15, 18_18, 18_19, 18_24, 18_27, 18_30, 18_346, 18_347, 18_357, 17_10, 17_137, and 17_139, or a pharmaceutically acceptable salt thereof. 70. The antisense oligonucleotide described in embodiment 69, wherein the antisense oligonucleotide is selected from compound numbers 18_1, 18_15, 18_27, 18_30, 17_10, 17_137, and 17_139.

[0330] 71. The antisense oligonucleotide of any one of embodiments 12 to 55, wherein the antisense oligonucleotide is selected from compound numbers 18_32 to 18_249 or 18_362 to 18_610, or a pharmaceutically acceptable salt thereof. 72. The antisense oligonucleotide of embodiment 71, wherein the antisense oligonucleotide is selected from compound numbers 18_223, 18_36, 18_196, 18_188, and 18_243. 73. The antisense oligonucleotide according to any one of embodiments 12 to 55, wherein the antisense oligonucleotide is selected from compound numbers 19_1 to 19_22, or a pharmaceutically acceptable salt thereof. 74. A conjugate compound comprising a nucleic acid molecule according to any one of claims 1 to 11, or an antisense oligonucleotide according to any one of claims 12 to 57, and at least one conjugate moiety covalently attached to the antisense oligonucleotide. 75. The conjugate compound of embodiment 74, wherein the conjugate moiety is selected from a carbohydrate, a cell surface receptor ligand, a drug substance, a hormone, a lipophilic substance, a polymer, a protein, a peptide, a toxin, a vitamin, a viral protein, or a combination thereof.

[0331] 76. The conjugated compound of embodiment 74 or 75, wherein the conjugated moiety is capable of binding to an asialoglycoprotein receptor. 77. The conjugate compound of embodiment 76, wherein the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-isobutanoylgalactosamine. 78. The conjugated compound of embodiment 77, wherein the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc). 79. The conjugate compound of embodiment 77 or 78, wherein the conjugate moiety is monovalent, divalent, trivalent, or tetravalent with respect to the asialoglycoprotein receptor targeting moiety. 80. The conjugate compound of embodiment 79, wherein the conjugate moiety consists of two to four terminal GalNAc moieties and a spacer linking each GalNAc moiety to a branched molecule capable of being attached to an antisense compound.

[0332] 81. The conjugate compound of embodiment 80, wherein the spacer is a PEG spacer. 82. The conjugate compound of embodiments 76-81, wherein the conjugate moiety is a trivalent N-acetylgalactosamine (GalNAc) moiety. 83. The conjugate compound of embodiments 76-82, wherein the conjugate moiety is selected from one of the trivalent GalNAc moieties of FIG. 1. 84. The conjugate compound of embodiment 83, wherein the conjugate moiety is the trivalent GalNAc moiety of Figure 1D. 85. The conjugate compound of any one of embodiments 74 to 84, comprising a linker positioned between the nucleic acid molecule or antisense oligonucleotide and the conjugate moiety.

[0333] 86. The conjugate compound of embodiment 85, wherein the linker is a physiologically labile linker. 87. The conjugate compound of embodiment 86, wherein the physiologically labile linker is a nuclease-sensitive linker. 88. The oligonucleotide conjugate of embodiment 86 or 87, wherein the physiologically labile linker consists of 2 to 5 consecutive phosphodiester bonds. 89. The conjugate compound according to embodiments 86 to 88, wherein the antisense oligonucleotide has the formula D'-FG-F' or FG-F'-D", where F, F', and G are as defined in embodiments 46 to 56, and D' or D' comprises one, two, or three DNA nucleosides having phosphodiester internucleoside linkages. 90. The oligonucleotide conjugate of embodiment 88 or 89, wherein at least two consecutive phosphodiester internucleoside linkages are linked to a CA dinucleotide.

[0334] 91. A conjugated compound according to any one of embodiments 76 to 90, which exhibits improved cellular distribution between the liver and the kidney, or improved cellular uptake of the conjugated compound into the liver, compared to the unconjugated nucleic acid molecule or antisense oligonucleotide. 92. The conjugate compound of any one of embodiments 76 to 91, wherein the conjugate compound is selected from the group consisting of compound numbers 20_12, 20_13, 20_14, 20_15, 20_16, 20_18, 20_20, 20_21, 20_22, 20_30, 20_35, 20_36, 21_2, 21_33, and 21_34. 93. A pharmaceutical composition comprising a nucleic acid molecule according to any one of embodiments 1 to 11, an antisense oligonucleotide according to embodiments 12 to 73, a conjugated compound according to embodiments 74 to 92, or an acceptable salt thereof, and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant. 94. A method for producing an antisense oligonucleotide according to any one of embodiments 12 to 73, comprising reacting nucleotide units to thereby form covalently linked consecutive nucleotide units contained in the antisense oligonucleotide. 95. The method of embodiment 94, further comprising reacting the contiguous nucleotide sequence with a non-nucleotide binding moiety described in any one of embodiments 76 to 84.

[0335] 96. A method for producing a composition according to embodiment 93, comprising mixing the antisense oligonucleotide with a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant. 97. An in vivo or in vitro method for modulating PAPD5 and PAPD7 expression in target cells expressing PAPD5 and PAPD7, comprising administering to said cells an effective amount of a nucleic acid molecule according to any one of embodiments 1 to 11, an antisense oligonucleotide according to any one of embodiments 12 to 73, or a conjugated compound according to any one of embodiments 74 to 92, or a pharmaceutical composition according to embodiment 93. 98. The method described in embodiment 97, wherein the PAPD5 and PAPD7 expression is reduced by at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95% compared to levels without treatment. 99. A method for treating or preventing a disease, comprising administering to a subject suffering from or susceptible to the disease a therapeutically or prophylactically effective amount of a nucleic acid molecule according to any one of embodiments 1 to 11, an antisense oligonucleotide according to any one of embodiments 12 to 73, or a conjugated compound according to any one of embodiments 74 to 92, or a pharmaceutical composition according to embodiment 93. 100. A nucleic acid molecule according to any one of embodiments 1 to 11, an antisense oligonucleotide according to any one of embodiments 12 to 57, or a conjugate compound according to any one of embodiments 74 to 92, or a pharmaceutical composition according to embodiment 93, for use as a medicament for the treatment or prevention of a disease in a subject.

[0336] 101. Use of a nucleic acid molecule according to any one of embodiments 1 to 11, an antisense oligonucleotide according to any one of embodiments 12 to 73, or a conjugate compound according to any one of embodiments 74 to 92 for the preparation of a medicament for the treatment or prevention of a disease in a subject. 102. The method, nucleic acid molecule or use according to embodiments 99 to 101, wherein the disease is HBV infection or chronic HBV infection. 103. The method, nucleic acid molecule or use according to embodiment 102, wherein secretion of HBsAg and / or HBeAg and / or intracellular HBV mRNA and / or HBV DNA is reduced. 104. The method, nucleic acid molecule or use according to embodiment 102 or 103, wherein HBsAg is reduced by at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95% compared to the level without treatment. 105. The method, antisense oligonucleotide, or use according to embodiments 99 to 104, wherein the subject is a mammal. 106. The method, antisense oligonucleotide, or use according to embodiment 105, wherein the mammal is a human. [Example]

[0337] The following examples illustrate the invention. Materials and Methods Oligonucleotide motif sequences and oligonucleotide compounds [Table 4] [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6] The design refers to the gapmer design FG-F'. In a classic gapmer design, such as 3-10-3, all nucleotides in the flanks (F and F') are composed of the same 2' sugar-modified nucleosides, such as LNA, cET, or MOE, and a central DNA stretch (G) that forms the gap. In gapmers with alternating flank designs, the flanks of the oligonucleotide are annotated as a series of integers, indicating the number of 2' sugar-modified nucleosides (M) followed by the number of DNA nucleosides (D). For example, a flank with a 2-2-1 motif represents 5'[M]2-[D]2-[M]3', while a 1-1-1-1-1 motif represents 5'[M]-[D]-[M]-[D]-[M]3'. Both flanks have 2' sugar-modified nucleosides at the 5' and 3' ends. A gap region (G), consisting of several DNA nucleosides (usually 5-16), is located between the flanks. The heading "Oligonucleotide Compound" in the table represents the specific design of the motif sequence. Uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C's are 5-methylcytosine, 5-methylcytosine DNA is represented by "e", and all internucleoside linkages are phosphorothioate internucleoside linkages. [Table 6] [Table 7-1] [Table 7-2] [Table 7-3] [Table 7-4] [Table 7-5] [Table 7-6] [Table 7-7] [Table 7-8] The design refers to the gapmer design FG-F'. In a classic gapmer design, such as 3-10-3, all nucleotides in the flanks (F and F') are composed of the same 2' sugar-modified nucleoside, e.g., LNA, cET, or MOE, and a central DNA stretch (G) forms the gap (G). In gapmers with alternating flank designs, the flanks of the oligonucleotide are annotated as a series of integers, indicating the number of 2' sugar-modified nucleosides (M) followed by the number of DNA nucleosides (D). For example, a flank with a 2-2-1 motif represents 5'[M]2-[D]2-[M]3', while a 1-1-1-1-1 motif represents 5'[M]-[D]-[M]-[D]-[M]3'. Both flanks have 2' sugar-modified nucleosides at the 5' and 3' ends. A gap region (G), consisting of several DNA nucleosides (usually 5-16), is located between the flanks. The heading "Oligonucleotide Compound" in the table represents the specific design of the motif sequence. Uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C's are 5-methylcytosine, 5-methylcytosine DNA is represented by "e", and all internucleoside linkages are phosphorothioate internucleoside linkages. [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4] [Table 8-5] [Table 8-6] For the parent oligonucleotide CMP: uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleotides, all LNA C's are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages. Regarding stereodefinition / stereodefined motifs: X represents a stereorandom phosphorothioate internucleoside linkage, R represents one stereoisomer as defined in the legend, S represents the other stereoisomer, and H represents the hydrogen atom at the 3' end of the oligonucleotide. The first letter (X, R, or S) in the stereodefined motif corresponds to the internucleoside linkage between nucleosides 1 and 2 from the 5' end of the oligonucleotide. [Table 9] C6 represents an aminoalkyl group having 6 carbons, uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C's are 5-methylcytosine, the subscript o represents a phosphodiester internucleoside linkage, and unless otherwise specified, other internucleoside linkages are phosphorothioate internucleoside linkages. [Table 10] GN2 represents the trivalent GalNAc cluster shown in Figure 2, C6 represents an aminoalkyl group with six carbons, uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C's are 5-methylcytosine, the subscript o represents a phosphodiester nucleoside linkage, and unless otherwise noted, the internucleoside linkages are phosphorothioate internucleoside linkages. Chemical diagrams representing portions of the molecule are shown in Figures 4-17.

[0338] AAV / HBV mouse model In the AAV / HBV mouse model, mice are infected with a recombinant adeno-associated virus (AAV) carrying the HBV genome (AAV / HBV) and maintain stable viremia and antigenemia for more than 30 weeks (Dan Yang, et al. 2014 Cellular & Molecular Immunology 11, 71-78).

[0339] Specific pathogen-free male C57BL / 6 mice (4–6 weeks old) were purchased from SLAC (Shanghai Laboratory Animal Center of Chinese Academy of Sciences) and housed in individually ventilated cages in the animal care facility. The guidelines for animal care and use outlined by the WuXi IACUC (Institutional Animal Care and Use Committee, WUXI IACUC protocol number R20131126-Mouse) were followed. Mice were allowed to acclimate to the new environment for 3 days and then grouped according to the experimental design.

[0340] The recombinant AAV-HBV was diluted in PBS to 200 µL per injection. This recombinant virus carries 1.3 copies of the HBV genome (genotype D, serotype ayw).

[0341] On day 0, all mice were inoculated via the tail vein with 200 μL of AAV-HBV (1 x 10 11Animals were injected with the vector genome. 23 days before administration (23 days after AAV-HBV injection), animals were divided into groups based on serum levels of HBV markers and body weight. Each group was housed in a polycarbonate cage (maximum of 5 animals / cage) with corncob bedding. Low, medium, and high HBV titers were distributed, with group means similar to those between groups. Animal groups could be treated with either unconjugated or GalNAc-conjugated oligonucleotides. All serum collections (0.1 ml blood / mouse) were performed by retroorbital bleeding after animals were anesthetized with isoflurane inhalation.

[0342] HeLa cell line HeLa cell lines were purchased from the European Collection of Authenticated Cell Cultures (ECACC, #93021013) and maintained in a humidified incubator at 37°C with 5% CO2 as recommended by the supplier. For the assay, 2,500 cells / well were seeded into 96-multiwell plates in Eagle's minimum essential medium (Sigma, M2279) containing 10% fetal bovine serum (FBS), 2 mM glutamine AQ, 1% NEAA, and 25 μg / ml gentamicin.

[0343] Differentiated HepaRG cell culture (HBV-free) HepaRG cells (Biopredics International, Rennes, France, Cat# HPR101) were cultured in complete HepaRG growth medium consisting of William's E medium (Sigma W4128), growth medium supplement (Biopredics, Cat# ADD710), and 1% (v / v) GlutaMAX-I (Gibco #32551) at 37°C in a humidified atmosphere of 5% CO for 2 weeks.

[0344] To initiate differentiation, cells were grown in complete HepaRG growth medium for 2 weeks until fully confluent. Half of the medium was replaced with HepaRG differentiation medium consisting of William's E medium (Sigma W4128), growth medium supplement (Biopredics, Cat# ADD710), 1% (v / v) GlutaMAX-I (Gibco #32551), and a final concentration of 0.9% (v / v) DMSO. After 3 days, the medium was completely replaced with complete differentiation medium (final concentration of DMSO: 1.8% (v / v)), and cells were maintained for approximately 2 weeks, refreshing the differentiation medium every 7 days. Differentiated HepaRG cells (dHepaRG) displayed hepatocyte-like island structures surrounded by a monolayer of bile duct-like cells. Prior to compound treatment, dHepaRG cells were seeded at 80,000 cells per well in 100 μL of complete differentiation medium onto collagen I-coated 96-well plates (Corning BioCoat REF354407). Cells were allowed to recover their differentiated phenotype in the 96-well plates approximately 1 week after seeding before oligonucleotide treatment. RNA was isolated 6 days after treatment.

[0345] HBV-infected dHepaRG cells HepaRG cells (Biopredics International, Rennes, France, Cat# HPR101) were cultured in complete HepaRG growth medium consisting of William's E medium (GIBCO), growth medium supplement (Biopredics, Cat# ADD711C), and 1% (v / v) GlutaMAX-I (Gibco #32551), and 1x Pen / Strep (Gibco, #15140) at 37°C in a humidified atmosphere of 5% CO for 2 weeks.

[0346] To initiate differentiation, 0.9% (v / v) DMSO (Sigma-Aldrich, D2650) was added to confluent cells in growth medium. After 1 week, the medium was replaced with complete differentiation medium (HepaRG growth medium supplemented with 1.8% (v / v) DMSO), where cells were maintained for approximately 4 weeks by refreshing the differentiation medium every 7 days. Differentiated HepaRG cells (dHepaRG) displayed hepatocyte-like island structures surrounded by a monolayer of bile duct-like cells.

[0347] Prior to HBV infection and compound treatment, dHepaRG cells were seeded at 60,000 cells per well in 100 μL of complete differentiation medium in a collagen I-coated 96-well plate (Gibco, Cat# A11428-03). Cells were allowed to recover their differentiated phenotype in the 96-well plate for approximately 1 week after seeding before HBV infection.

[0348] dHepaRG cells were infected with HBV particles at an MOI of 30. HBV particles were produced from HBV-producing HepG2.2.15 cells (Sells et al., 1987, Proc Natl Acad Sci USA 84, 1005-1009). The culture conditions, differentiation, and HBV infection of dHepaRG cells have been previously described (Hantz, 2009, J. Gen. Virol., 2009, 90: 127-135). Briefly, complete differentiation medium (HepaRG medium consisting of William's E medium (GIBCO), growth medium supplement (Biopredics, Cat. #ADD711C), 1% (v / v) GlutaMAX-I (Gibco #32551), and 1x Pen / Strep (Gibco, #15140), supplemented with 1.8% (v / v) DMSO) containing 4% PEG-8000 and virus stock (20-30 GE / cell) was added (120 μL / well). One day after infection, cells were washed four times with phosphate-buffered saline, and the medium (complete differentiation medium) was replaced on days 4 and 7 throughout the experiment.

[0349] HBV-infected ASGPR-dHepaRG We generated cell lines stably overexpressing human ASPGR1 and ASPGR2 from the HepaRG cell line (Biopredics International, Rennes, France, Cat# HPR101) using a lentiviral method. Growing HepaRG cells were transduced with a lentivirus encoding human ASGPR1 and 2 (CLV-CMV-ASGPR1-T2a_ASGPR2-IRES-Puro) produced on-demand by Sirion Biotech at an MOI of 300 under the control of the CMV promoter and puromycin resistance gene. Transduced cells were selected with 1 μg / ml puromycin for 11 days and then maintained with the same antibiotic concentration to ensure stable transgene expression. Overexpression of ASGPR1 / 2 was confirmed at both the mRNA level by RT-qPCR (ASGPR1: 8560-fold higher than untransduced; ASGPR2: 2389-fold higher than untransduced) and the protein level by flow cytometry analysis. The differentiated cells are called ASGPR-dHepaRG cells.

[0350] ASGPR-HepaRG cells were differentiated using 1.8% DMSO for at least 2 weeks before infection. HBV infection was performed as described above for dHepaRG cells.

[0351] Primary mouse hepatocytes (PMH) Primary mouse hepatocytes were isolated from the livers of pentobarbital-anesthetized C57BL / 6J mice following a two-step perfusion protocol as described previously (Berry and Friend, 1969, J. Cell Biol.; Paterna et al., 1998, Toxicol. Appl. Pharmacol.). The first step was perfusion with HBSS + 15 mM HEPES + 0.4 mM EGTA for 5 min, followed by perfusion with HBSS + 20 mM NaHCO₃ + 0.04% BSA (Sigma #A7979) + 4 mM CaCl₂ (Sigma #21115) + 0.2 mg / ml collagenase type 2 (Worthington #4176) for 12 min. Hepatocytes were trapped on ice in 5 ml of cold William's E medium (WME) (Sigma #W1878, 1x Pen / Strep / Glutamine, supplemented with 10% (v / v) FBS (ATCC#30-2030)).

[0352] The crude cell suspension was filtered through a 70 μm cell strainer followed by a 40 μm cell strainer (Falcon #352350 and #352340), filled to 25 mL with WME, and centrifuged at 50 x g for 5 minutes at room temperature to pellet the hepatocytes. The supernatant was removed, and the hepatocytes were resuspended in 25 mL WME. 25 mL of 90% Percoll solution (Sigma #P4937; pH = 8.5-9.5) was added, and the mixture was centrifuged at 50 x g for 10 minutes at 25°C. The supernatant and floating cells were then removed. To remove the remaining Percoll, the pellet was resuspended in 50 mL WME medium and centrifuged at 50 x g for 3 minutes at 25°C. The supernatant was discarded. The cell pellet was resuspended in 20 mL WME, and cell count and viability were determined (Invitrogen, Cellcount) and diluted to 250,000 cells / mL. 25,000 cells / well were seeded onto collagen-coated 96-well plates (PD Biocoat Collagen I #356407) and incubated at 37°C and 5% CO2. After 3–4 h, cells were washed with WME to remove unbound cells, and the medium was replaced. 24 h after seeding, oligonucleotides were added at the desired concentrations, and cells were incubated at 37°C and 5% CO2 for 72 h. Following RNA isolation (Qiagen, RNeasy 96), one-step RT-qPCR (Quanta Bioscience, qScript XLT 1-Step RT-qPCR ToughMix) was performed for target genes (PAPD5: Mm01244121_m1 FAM-MGB, PAPD7: Mm01349513_m1 FAM-MGB) and housekeeping genes (GusBMm_01197698_m1, VIC-MGB) using TaqMan assays according to the manufacturer's instructions.

[0353] Primary human hepatocyte (PHH) natural infection assay Primary human hepatocytes (PHHs) isolated by collagenase perfusion from chimeric uPA / SCID mice with humanized livers were obtained from PhoenixBio (Hiroshima, Japan). Cells were cultured at 7 x 10 per well in the medium provided by PhoenixBio. KdCells were seeded at a concentration of 1000 μg / ml onto a 96-well plate coated with type I collagen (see Ishida et al., 2015 Am J Pathol. Vol. 185, pp. 1275-1285, for details). HBV genotype D was obtained from HepG2.2.15 cell culture supernatant and concentrated using PEG precipitation. PHHs were infected at an MOI of 10 in PHH medium containing 4% PEG 8000, and the cells were washed four times with PBS. On day 1 postinfection, oligonucleotides were delivered to the cells in a final volume of 125 μl of PHH medium. Cells were re-treated on days 4 and 7 postinfection. On day 11 postinfection, the supernatant and cells were harvested. HBsAg and HBeAg levels in the supernatant were assessed using a CLIA ELISA assay (see "Materials and Methods"; "HBV Antigen Measurement"). mRNA was extracted from cells using the MagNA Pure robot and the MagNA Pure 96 Cellular RNA High-Capacity Kit (Roche, #05467535001) according to the manufacturer's protocol. Relative expression levels of PAPD5 and PAPD7 mRNA were analyzed using real-time PCR as described in Materials and Methods.

[0354] HBV antigen measurement Supernatants were collected on day 11 to assess the effects on HBV antigen expression and secretion. HBV proliferation parameters, HBsAg and HBeAg levels, were measured using CLIA ELISA kits (Autobio Diagnostic #CL0310-2, #CL0312-2) according to the manufacturer's protocol. Briefly, 25 μL of supernatant per well was transferred to each antibody-coated microtiter plate, and 25 μL of enzyme conjugate reagent was added. The plates were incubated on a shaker for 60 minutes at room temperature, after which the wells were washed five times with wash buffer using an automated washer. 25 μL of substrates A and B were added to each well. The plates were then incubated on a shaker for 10 minutes at room temperature, after which luminescence was measured using an Envision luminescence reader (Perkin Elmer).

[0355] Real-time PCR of intracellular HBV mRNA from HBV-infected cells HBV mRNA was quantified by qPCR in technical duplicates using a QuantStudio 12K Flex (Applied Biosystems), a TaqMan RNA-to-CT one-step kit (Applied Biosystems, #4392938), and a human ACTB internal control (Applied Biosystems, #4310881E). TaqMan reagents were used with the following commercially available ThermoFisher Scientific primers: HBV Pa03453406_s1, ACTB 4310881E. mRNA expression was analyzed using the comparative cycle threshold 2-ΔΔCt method normalized to the reference gene ACTB and PBS-treated cells.

[0356] Real-time PCR of PAPD5 and PAPD7 mRNA expression QPCR was performed on RNA extracted from treated cells or homogenized tissue samples. After denaturation of the RNA / LNA duplex (90°C, 40 seconds), real-time PCR was performed using a one-step protocol (qScript™ XLT One-Step RT-qPCR ToughMix®, Low ROX™, #95134-500 from Quanta Bioscience) with the following TaqMan primer assays (ThermoFisher Scientific) in a duplex configuration: PAPD5(Hs00223727_m1, FAM-MGB) PAPD7(Hs00173159_m1, FAM-MGB) Housekeeping gene GUSB (Hu_4326320E, VIC-MGB) according to the provider's recommendations.

[0357] HBV DNA quantification and viral particle titer HBV DNA extraction was performed using the QIAamp UltraSens Virus Kit (Qiagen, #53704) according to the manufacturer's protocol with the following optimization: 30 μL and 3 μL of virus sample were diluted in 1 mL of PBS, followed by the addition of Buffer AC. An initial centrifugation step was performed at maximum speed and 4°C for 45 minutes. HBV DNA was quantified by PCR in duplicate using a QuantStudio 12K Flex (Applied Biosystems), TaqMan Gene Expression Master Mix (Applied Biosystems, #4369016), a 1:1:0.5 premix of primers listed in Table 9, and 100 μM renatured probe. qPCR was performed using the following settings: UDG incubation (2 minutes, 50°C), enzyme activation (10 minutes, 95°C), and qPCR (15 seconds at 95°C for denaturation and 1 minute at 60°C for annealing and extension, 40 cycles). Genome equivalent calculations are based on a standard curve generated from HBV genotype D plasmid dilutions of known concentrations.

[0358] HBV particle titers can be measured by QPCR of intracellular mRNA isolated from treated cells using HBV core-specific primers (Integrated DNA Technologies) (Table 11). [Table 11]

[0359] Oligonucleotide synthesis Oligonucleotide synthesis is generally known in the art. The following are applicable protocols. The oligonucleotides of the present invention may be produced by methods that differ slightly in terms of the equipment, support, and concentration used.

[0360] Oligonucleotides are synthesized on a uridine universal support using a phosphoramidite approach for Oligomaker 48 on a 1 μmol scale. At the end of the synthesis, the oligonucleotides are cleaved from the solid support using aqueous ammonia at 60 °C for 5–16 h. The oligonucleotides are purified by reverse-phase HPLC (RP-HPLC) or solid-phase extraction, characterized by UPLC, and the molecular weight is further confirmed by ESI-MS.

[0361] Oligonucleotide extension: The coupling of β-cyanoethyl-phosphoramidites (DNA-A(Bz), DNA-G(ibu), DNA-C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA-G(dmf), or LNA-T) is carried out using a solution of 0.1 M 5'-O-DMT-protected amidite in acetonitrile and 0.25 M DCI (4,5-dicyanoimidazole) in acetonitrile as the activator. In the final cycle, the phosphoramidite with the desired modification, such as a C6 linker for attaching the conjugate group or the conjugate group itself, can be used. Thiolation for the introduction of phosphorothioate bonds is carried out using xanthan hydride (0.01 M in acetonitrile / pyridine 9:1). Phosphodiester bonds can be introduced using 0.02 M iodine in THF / pyridine / water 7:2:1. The remaining reagents are those commonly used in oligonucleotide synthesis.

[0362] For post-solid-phase synthesis conjugation, commercially available C6 amino linker phosphoramidites can be used in the final cycle of solid-phase synthesis, and after deprotection and cleavage from the solid support, the amino-linked, deprotected oligonucleotide is isolated. The conjugate is introduced via functional group activation using standard synthetic methods.

[0363] Purification by RP-HPLC: The crude compound is purified by preparative RP-HPLC on a Phenomenex Jupiter C18 (10μ, 150x10mm) column. 0.1M ammonium acetate (pH 8) and acetonitrile can be used as buffer at a flow rate of 5mL / min. The collected fractions are lyophilized to give the purified compound, usually as a white solid.

[0364] Abbreviation: DCI: 4,5-dicyanoimidazole DCM: dichloromethane DMF: dimethylformamide DMT: 4,4'-dimethoxytrityl THF: tetrahydrofuran Bz: benzoyl Eve: Isobutyryl RP-HPLC: Reversed-phase high-performance liquid chromatography

[0365] T m Assay: Dilute the oligonucleotide and RNA target (phosphate-linked, PO) duplex to 3 mM in 500 ml of RNase-free water and add to 500 ml of 2xT m Mix with buffer (200 mM NaCl, 0.2 mM EDTA, 20 mM sodium phosphate, pH 7.0). Heat the solution to 95°C for 3 min and then anneal at room temperature for 30 min. The duplex melting temperature (T m The absorbance at 260 nm is recorded as the temperature is increased from 20°C to 95°C and then decreased to 25°C. The first derivatives and maxima of both melting and annealing are used to measure the duplex T m is evaluated.

[0366] Example 1 In vitro efficacy screening of PAPD5 and PAPD7-targeted (bispecific) antisense oligonucleotides in HeLa cells Oligonucleotide screening was performed using 16- to 18-mer gapmers targeting SEQ ID NOs: 17, 18, and 19. Efficacy testing was performed in vitro in HeLa cells expressing both PAPD5 and PAPD7.

[0367] HeLa cells were cultured as described in the Materials and Methods section. After 24 h of incubation, oligonucleotides dissolved in PBS were added. The final concentrations of oligonucleotides were 5 and 25 μM, and the final culture volume was 100 μl / well. Three days after addition of the oligonucleotide compounds, cells were harvested, and RNA was extracted using the PureLink Pro 96 RNA Purification Kit (Ambion) according to the manufacturer's instructions.

[0368] PAPD5 and PAPD7 mRNA levels were analyzed by real-time PCR as described in Materials and Methods. The relative expression levels of PAPD5 mRNA and PAPD7 mRNA are shown in Table 12 as % of the control sample mean (PBS treated cells), ie, lower values ​​indicate greater inhibition. [Table 12]

[0369] Example 2 In vitro EC50 and efficacy in HBV-infected HepaRG cells All oligonucleotides from Example 1 were tested for their effect on HBV growth parameters in HBV-infected dHepaRG cells.

[0370] For comparison, the antisense oligonucleotides of the present invention were compared to antisense oligonucleotides that directly target HBV mRNA. The HBV-targeting oligonucleotides are shown in Table 13. [Table 13]

[0371] HBV-infected dHepaRG cells (described in the "Materials and Methods" section, "HBV-infected dHepaRG cells") were cultured in 96-well plates. One day after HBV infection, oligonucleotides were added to the cells in 3-fold serial dilutions (20.00, 6.67, 2.22, 0.74, 0.25, 0.08, 0.03, and 0.01 μM oligonucleotide) using unassisted uptake (gymnosis). A total of 49 oligonucleotides were tested. Experiments were performed in triplicate with a PBS control. Oligonucleotide treatment was repeated on days 4 and 7. On day 11 post-infection, supernatants and cells were harvested.

[0372] HBsAg and HBeAg levels in the supernatants were assessed using a CLIA ELISA assay (see Materials and Methods, HBV Antigen Measurement).

[0373] The HBV proliferation parameters HBsAg and HBeAg EC50 and maximum KD (efficacy) were calculated using the R function drm() in the drc package (v3.0-1). A four-parameter log-logistic function was fitted to the expression of the gene of interest as a function of oligonucleotide concentration to obtain EC50 and maximum knockdown values. The results are shown in Table 14 and are expressed as a percentage of the control sample mean (PBS control and non-infected (NIF)), calculated as follows: [(test value - mean PBS) / (mean NIF - mean PBS)]*100). [Table 14-1] [Table 14-2]

[0374] These data show that a significant number of compounds have a significant effect on HBsAg and HBeAg, and compounds with the oligonucleotide motifs of SEQ ID NOs: 17 and 18 appear to be more effective than compounds made with the motif of SEQ ID NO: 19.

[0375] FIG. 3 also shows that for oligonucleotides that reduce PAPD5 and PAPD7 by 70% or more in HeLa cells, there is a high correlation with the ability of these oligonucleotides to reduce HBsAg in HBV-infected dHepaRG cells.

[0376] Example 3 In vitro efficacy screening of antisense oligonucleotides targeting PAPD5 and PAPD7 in HeLa cells Using a different design, an additional library of 298 oligonucleotides was generated that expanded the diversity of the oligonucleotide motifs of SEQ ID NOs: 17, 18, and 19. Efficacy testing was performed in vitro as described in Example 1, however, screening was only performed at 5 μM.

[0377] The relative expression levels of PAPD5 mRNA and PAPD7 mRNA are shown in Table 15 as % of the control sample mean (PBS treated cells), ie lower values ​​indicate greater inhibition. [Table 15-1] [Table 15-2] [Table 15-3] [Table 15-4] [Table 15-5] [Table 15-6]

[0378] These data show that LNA-gapmer designs based on the motif sequence having SEQ ID NO: 19 result in very low knockdown of PAPD5 and PAPD7 (0-10%).

[0379] Example 4 In vitro EC50 and efficacy of selected antisense oligonucleotides in HeLa cells. The EC50 and potency (KD) of the best performing oligonucleotides from Examples 1 and 3 were determined using the same assay at the following oligonucleotide concentrations: 50, 15.81, 5.00, 1.58, 0.50, 0.16, 0.05, and 0.016 μM.

[0380] The EC50 and maximum KD (efficacy) of PAPD5 and PAPD7 mRNA expression were calculated using the R function drm() in the drc package (v3.0-1), and a four-parameter log-logistic function was fitted to the expression of the gene of interest as a function of oligonucleotide concentration to obtain EC50 and maximum knockdown values. The results are shown in Table 16. [Table 16]

[0381] Example 5 In vitro effects on HBV-infected ASGPR-dHepaRG cells using selected antisense oligonucleotides targeting PAPD5 and PAPD7 A selection of the oligonucleotides screened in Example 3 were screened on ASGPR-dHepaRG essentially using the assay of Example 2 with the following modifications: Screening was performed on HBV-infected ASGPR-dHepaRG at the following concentrations of oligonucleotide: 20, 6.67, and 2.22 μM, using the comparator molecules in Table 17.

[0382] For comparison, combinations of single targeted PAPD5 and single targeted PAPD7 oligonucleotides from Table 17 were tested together with oligonucleotides of the invention. [Table 17]

[0383] The reduction in HBsAg and HBeAg levels is shown in Tables 18 and 19, with higher values ​​indicating greater inhibition. [Table 18]

[0384] [Table 19]

[0385] These data show that the best performing bispecific PAPD5 / PAPD7 oligonucleotide is more effective at reducing HBsAg and HBeAg using half the oligonucleotide concentration (20 μM) when compared to the combination treatment (2×20 μM).

[0386] Example 6 In vitro efficacy screening of stereodefined antisense oligonucleotides targeting PAPD5 and PAPD7 in HeLa cells To further expand the diversity around the motif sequence of SEQ ID NO: 18, a library of stereodefined oligonucleotides was created based on a stereorandom parent compound with compound number 18_1. Efficacy testing was performed in the in vitro experiments described in Example 1, with screening at 1 μM and some at 5 μM. The relative expression levels of PAPD5 mRNA and PAPD7 mRNA are shown in Table 20 as % of the parent oligonucleotide, ie, the higher the value, the better the inhibition.

[0387] [Table 20-1] [Table 20-2] [Table 20-3] [Table 20-4] [Table 20-5]

[0388] Example 7 In vitro EC50 and efficacy of selected stereodefined antisense oligonucleotides in HeLa cells. The EC50 and potency (KD) of the best performing oligonucleotides from Example 6 were determined using the same assay at the following oligonucleotide concentrations: 33, 10.44, 3.33, 1.044, 0.33, 0.104, 0.033, and 0.01 μM.

[0389] The EC50 and maximum KD (efficacy) of PAPD5 and PAPD7 mRNA expression were calculated using the R function drm() in the drc package (v3.0-1), fitting a four-parameter log-logistic function to the expression of the gene of interest as a function of oligonucleotide concentration to obtain EC50 and maximum knockdown values. The results are shown in Table 21. [Table 21]

[0390] These data demonstrate that improved EC50 and efficacy can be achieved for knockdown of PAPD5 and PAPD7 using both stereodefined sub-libraries and fully stereodefined compounds.

[0391] Example 8 In vitro effects on HBV-infected ASGPR-dHepaRG cells using selected stereodefined antisense oligonucleotides targeting PAPD5 and PAPD7 A selection of the most effective oligonucleotides from Example 6 were tested for their effect on HBV growth parameters in HBV-infected dHepaRG-ASGPR cells. The experiment was carried out as described in Example 5. The reduction in HBsAg and HBeAg levels is shown in Tables 22 and 23, the higher the value the greater the inhibition.

[0392] [Table 22]

[0393] [Table 23]

[0394] Example 9 In vitro effects on HBV-infected ASGPR-dHepaRG cells using selected GalNAc-conjugated antisense oligonucleotides targeting PAPD5 and PAPD7 A selection of the most effective oligonucleotides from Example 1 were conjugated to a GalNAc conjugate moiety and tested for their effect on HBV growth parameters in HBV-infected ASPGR-dHepaRG cells.

[0395] Evaluation of the EC50 and potency (KD) of GalNAc-conjugated oligonucleotides against HBsAg and HBeAg was performed using HBV-infected ASGPR-dHepaRG cells, but without the control oligonucleotide, as described in Example 2. The results are shown in Table 24.

[0396] In addition to the procedures described in Example 2, harvested cells were washed once with PBS, lysed in MagNA Pure Lysis Buffer (Roche #05467535001), and stored at -80°C. RNA was extracted using the MagNA Pure "96 Cellular RNA Large Volume Kit" (Roche #05467535001), and PAPD5 and PAPD7 mRNA expression levels were measured as described in the "Materials and Methods" section, "Real-time PCR of PAPD5 and PAPD7." EC50 and efficacy (KD) were calculated using the R function drm() in the drc package (v3.0-1), fitting a four-parameter log-logistic function to the expression of the gene of interest as a function of oligonucleotide concentration to obtain EC50 and maximum knockdown values. The results are shown in Table 24A. [Table 24]

[0397] These data show that conjugating the GalNAc moiety to the oligonucleotide improves the EC50 values ​​by at least 40-fold (note that this table is in nM, while Table 14 is in μM). For example, compound 20_15 (GalNAc conjugated) reduces HBsAg by 176-fold over compound 18_05 (naked version of 20_15). [Table 24A]

[0398] These data indicate that most of the selected GalNAc-linked oligonucleotides targeting PAPD5 and PAPD7 are able to reduce mRNA levels by less than 10%.

[0399] Example 10 In vitro efficacy screening of antisense oligonucleotides targeting PAPD5 and PAPD7 in dHepaRG cells Oligonucleotides screened for knockdown of PAPD5 and PAPD7 in HeLa cells (Examples 1 and 3) were screened in dHepaRG cells to demonstrate efficient knockdown in the liver cell line.

[0400] dHepaRG cells were cultured as described in Materials and Methods. The following oligonucleotide concentrations were used in a final culture volume of 100 μl / well: 50, 15.81, 5.00, 1.58, 0.50, 0.16, 0.05, and 0.016 μM. Six days after addition of the oligonucleotide compounds, cells were harvested, and RNA was extracted using the PureLink Pro 96 RNA Purification Kit (Ambion) according to the manufacturer's instructions.

[0401] PAPD5 and PAPD7 mRNA levels were analyzed by real-time PCR as described in Materials and Methods. The EC50 and maximum KD (efficacy) of PAPD5 and PAPD7 mRNA expression were calculated using the R function drm() in the drc package (v3.0-1), fitting a four-parameter log-logistic function to the expression of the gene of interest as a function of oligonucleotide concentration to obtain EC50 and maximum knockdown values.

[0402] The results are shown in Table 25. [Table 25]

[0403] These data demonstrate that effective target depletion can also be documented in hepatocyte-derived cell lines.

[0404] Example 11 d Screening of in vitro efficacy of stereodefined antisense oligonucleotides targeting PAPD5 and PAPD7 in HepaRG cells. The stereodefined oligonucleotides screened for knockdown of PAPD5 and PAPD7 in HeLa cells (Example 7) were screened in dHepaRG cells to demonstrate efficient knockdown in the hepatic cell line.

[0405] Screening was performed as described in Example 10 using the following oligonucleotide concentrations: 33, 10.44, 3.33, 1.044, 0.33, 0.104, 0.033, and 0.01 μM.

[0406] PAPD5 and PAPD7 mRNA levels were analyzed by real-time PCR as described in Materials and Methods. The EC50 and maximum KD (efficacy) of PAPD5 and PAPD7 mRNA expression were calculated using the R function drm() in the drc package (v3.0-1), fitting a four-parameter log-logistic function to the expression of the gene of interest as a function of oligonucleotide concentration to obtain EC50 and maximum knockdown values.

[0407] The results are shown in Table 26. [Table 26]

[0408] These data demonstrate that stereodefined oligonucleotides are also effective in target depletion in hepatocyte-derived cell lines.

[0409] Example 12 In vitro effects on HBV-infected ASGPR-dHepaRG cells using selected GalNAc-conjugated antisense oligonucleotides targeting PAPD5 and PAPD7 A selection of the most effective oligonucleotides from Example 5 were conjugated to a GalNAc conjugate moiety and tested for their effect on HBV growth parameters in HBV-infected ASGPR-dHepaRG cells.

[0410] For purposes of comparison, the antisense oligonucleotides of the present invention are compared to GalNAc-linked versions of the HBV-targeting oligonucleotides shown in Table 13, which are shown in Table 13A. [Table 26A]

[0411] Evaluation of the EC50 and potency (KD) of GalNAc-conjugated oligonucleotides against HBsAg and HBeAg was performed using HBV-infected ASGPR-dHepaRG cells as described in Example 2. The results are shown in Table 27.

[0412] In addition to the procedures described in Example 2, harvested cells were washed once with PBS, lysed in MagNA Pure Lysis Buffer (Roche #05467535001), and stored at -80°C. RNA was extracted using the MagNA Pure "96 Cellular RNA Large Volume Kit" (Roche #05467535001), and PAPD5 and PAPD7 mRNA expression levels were measured as described in the "Materials and Methods" section, "Real-time PCR of PAPD5 and PAPD7." EC50 and efficacy (KD) were calculated using the R function drm() in the drc package (v3.0-1), fitting a four-parameter log-logistic function to the expression of the gene of interest as a function of oligonucleotide concentration to obtain EC50 and maximum knockdown values. The results are shown in Table 27A. [Table 27]

[0413] The compounds shown in the table have a phosphodiester bond in the ca dinucleotide following the C6 linker, as described in Table 10. [Table 27A]

[0414] As expected, the two HBV targeting molecules had only a minimal effect on PAPD5 and PAPD7, and therefore their effect on HBsAg and HBeAg is not related to their ability to reduce PAPD5 or PAPD7. The remainder of the compounds tested showed less than 85% target reduction and EC50 values ​​less than 0.09 μM, which correlates well with the effects seen on HBsAg and HBeAg in Table 27.

[0415] Example 13 In vitro effects on HBV-infected PHH cells using selected GalNAc-conjugated antisense oligonucleotides targeting PAPD5 and PAPD7 Select GalNAc-conjugated oligonucleotides were further tested in HBV-infected primary human hepatocytes (see "PHH Natural Infection Assay" in the Materials and Methods section) to demonstrate efficacy in an in vitro system with natural ASGPR expression. Oligonucleotide concentrations used were 3-fold serial dilutions (20.00, 6.67, 2.22, 0.74, 0.25, 0.08, 0.03, and 0.01 μM oligonucleotide).

[0416] The EC50 and maximum KD (efficacy) of the HBV proliferation parameters HBsAg and HBeAg were calculated using the R function drm() in the drc package (v3.0-1), fitting a four-parameter log-logistic function to the expression of the gene of interest as a function of oligonucleotide concentration to obtain EC50 values ​​and maximum reduction. The results are shown in Table 28.

[0417] The EC50, maximum KD (efficacy) of PAPD5 and PAPD7 mRNA expression were calculated using the same algorithm. The results are shown in Table 28A. [Table 28]

[0418] The compounds shown in the table have a phosphodiester bond in the ca dinucleotide following the C6 linker, as described in Table 10.

[0419] These data demonstrate that selected GalNAc-conjugated oligonucleotides targeting PAPD5 and PAPD7 can reduce HBV antigen secretion from infected primary human hepatocytes. [Table 28A]

[0420] These data indicate that selected GalNAc-linked oligonucleotides targeting PAPD5 and PAPD7 can reduce targeting to 11% or less while maintaining efficacy against PAPD7 mRNA, except for compound 20_17, which appears to have little effect on PAPD5 mRNA.

[0421] Example 14 In vitro efficacy screening of (bispecific) antisense oligonucleotides targeting human and mouse PAPD5 and PAPD7 in HeLa and PMH cells Oligonucleotide screening was performed using gapmer oligonucleotides targeting the human and mouse transcripts of PAPD5 and PAPD7 (Table 5) in the human HeLa cell line and primary mouse hepatocytes (PMH).

[0422] Screening in HeLa cells was carried out as described in Example 1 at a concentration of 25 μM. Screening in PMH cells was performed using 5 μM oligonucleotide as described under "Primary Mouse Hepatocytes" in "Materials and Methods."

[0423] Figure 11 shows the results of the screening, with each dot representing a compound from Table 5 and its ability to reduce PAPD7 mRNA (Y-axis) and PAPD5 mRNA (X-axis). In HeLa cells (human), there is a good correlation between the reduction of PAPD5 mRNA and PAPD7, but in PMH (mouse) cells, the reduction of PAPD7 mRNA appears to be less efficient compared to the reduction of PAPD5 mRNA.

[0424] A plausible explanation for the modest inhibition of PAPD7 mRNA in mouse hepatocytes is that the primary spliced ​​mRNA transcript of PAPD7 expressed in primary mouse hepatocytes has a transcription start site downstream of the oligonucleotide binding site, which was not identified until whole-transcriptome shotgun sequencing (RNA-seq) was performed in primary mouse hepatocytes.

[0425] Example 15 In vitro effects on HBV-infected ASGPR-dHepaRG cells using selected GalNAc-conjugated antisense oligonucleotides targeting PAPD5 and PAPD7 A further selection of oligonucleotides from Examples 2 and 5 were conjugated to GalNAc conjugate moieties and tested for their effect on HBV growth parameters in HBV-infected ASPGR-dHepaRG cells.

[0426] Evaluation of the EC50 and potency (KD) of GalNAc-conjugated oligonucleotides against HBsAg and HBeAg was performed using HBV-infected ASGPR-dHepaRG cells as described in Example 2. The results are shown in Table 29.

[0427] In addition to the procedures described in Example 2, harvested cells were washed once with PBS, lysed in MagNA Pure Lysis Buffer (Roche #05467535001), and stored at -80°C. RNA was extracted using the MagNA Pure "96 Cellular RNA Large Volume Kit" (Roche #05467535001), and PAPD5 and PAPD7 mRNA expression levels were measured as described in the "Materials and Methods" section, "Real-time PCR of PAPD5 and PAPD7." EC50 and efficacy (KD) were calculated using the R function drm() in the drc package (v3.0-1), fitting a four-parameter log-logistic function to the expression of the gene of interest as a function of oligonucleotide concentration to obtain EC50 and maximum knockdown values. The results are shown in Table 29A. [Table 29] [Table 29A]

[0428] Example 16 Effect of chromosomally integrated HBV DNA on HBsAg expression using selected dual-specific PAPD5 and PAPD7-targeted oligonucleotides In this experiment, we tested whether a selection of GalNAc-conjugated anti-PAPD5 / 7 oligonucleotides with potent potency against PAPD5 and PAPD7 could reduce HBsAg and mRNA expression from the human hepatocellular carcinoma cell line Hep3B, which is chromosomally integrated and secretes HBsAg from HBV DNA.

[0429] Hep3B cells (Knowles et al. 1980. Science 209 pp. 497-499) were purchased from ATCC (ATCC HB-8064) and cultured in Eagle's minimum essential medium (EMEM) supplemented with 10% FBS. Cells were plated at 1.5 x 10 per well in collagen-coated 96-well plates. 5 Cells were seeded at a concentration of 0.01% and cultured at 37°C in a humidified atmosphere of 5% CO2. One day after inoculation, oligonucleotides were added to the cells using concentrations starting at 20 μM and their threefold serial dilutions (20.00, 6.67, 2.22, 0.74, 0.25, 0.08, 0.03, and 0.01 μM oligonucleotide). The medium was changed and the treatment repeated on days 4 and 7. On day 11, supernatants were collected for HBsAg measurement (performed as described in the "HBV Antigen Measurement" section in the "Materials and Methods" section). Cells were washed once with PBS, 200 μL of MagNA Pure lysis buffer was added to each well, and the plates were stored at -80°C for RNA extraction.

[0430] Intracellular mRNA was extracted from lysed Hep3B cells using the MagNA Pure robot and the MagNA Pure 96 Cellular RNA High-Capacity Kit (Roche, #05467535001) according to the manufacturer's protocol. PAPD5 and PAPD7 mRNA were quantified by separate RT-qPCR in duplicate using a QuantStudio 12K Flex (Applied Biosystems), a TaqMan RNA-to-CT One-Step Kit (Applied Biosystems, #4392938), a human ACTB internal control (Applied Biosystems, #4310881E), and PAPD5 and PAPD7 mRNA TaqMan primers and reagents (Life Technologies, Assay ID Hs00900790_m1 (PAPD5) and Hs00173159_m1 (PAPD7) and custom Assay ID APMFW4G (Small HB)). qPCR was performed using the following settings: UDG incubation (15 min, 48°C), enzyme activation (10 min, 95°C), and qPCR (40 cycles of 15 s at 95°C for denaturation and 1 min at 60°C for annealing and extension).

[0431] The EC50 and maximum KD (maximum efficacy in % of saline) for reduction of HBsAg, HBs mRNA, PAPD5, and PAPD7 were calculated using GraphPad Prism 7.02 non-line fit. The results are shown in Tables 30 and 31. [Table 30]

[0432] [Table 31]

[0433] These data show that four of the seven oligonucleotides tested were able to reduce HBsAg and HBs mRNA expression from the incorporated HB fragment to less than 55% of the saline control.

[0434] Example 17 Efficacy of selected dual-specific PAPD5 and PAPD7-targeted oligonucleotides in non-human primates Inhibition of PAPD5 and PAPD7 mRNA expression in the livers of cynomolgus monkeys was quantified by RNA sequencing. Cynomolgus monkeys were treated with saline once a week or Compound No. 20_12 at 1, 3, or 10 mg / kg / week for 4 weeks (6 monkeys per group, a total of 5 doses on days 1, 8, 15, 22, and 29), and sacrificed on day 29 (4 weeks after treatment). In parallel, cynomolgus monkeys were treated with saline once a week or Compound No. 20_12 at 10 mg / kg / week for 4 weeks, a total of 5 doses, with a 4-week recovery period, and sacrificed on day 56 (4 weeks of treatment + 4 weeks of recovery).

[0435] Liver samples were collected within 20 minutes after exsanguination using RNA-Later (Qiagen cat. 76104). Approximately 10 mg of tissue was lysed in 800 μL of Magnapure lysis buffer (Roche) using a Tissue Lyser II (Qiagen). A 350 μL aliquot of the lysate was then transferred to a Magnapure 96-deep-well plate and processed automatically. RNA was quantified by absorbance spectroscopy (Nanodrop, ThermoFischer), and RNA integrity (according to the RNA Integrity Number, RIN) was controlled by microfluidic capillary array electrophoresis using an Agilent Bioanalyzer 2100 with an RNA 6000 Nano chip (Agilent cat. 5067-1511).

[0436] For barcode cDNA library construction, a 400 ng total RNA aliquot was used as input for the TruSeq™ Stranded Total RNA Kit (Illumina cat. 20020598) with the Ribo-Zero™ Gold rRNA Removal Kit (Illumina cat. MRZG12324). Library size distribution was estimated by electrophoresis using the Agilent High Sensitivity DNA Kit (cat. 5067-4627). Libraries were quantified using the KAPA Library Quantification qRT-PCR Kit (Kapa Biosystems cat. KK4824). Libraries were pooled at equimolar concentrations, diluted to 11 pM, and then loaded onto the flow cell of an Illumina HiSeq 4000 sequencer as follows: Libraries were expanded using the HiSeq PE Rapid Cluster Kit v2 (Illumina cat. PE-402-4002). Flow cells carrying amplified clusters were sequenced using paired-end reads (50 base pairs) with the TruSeq Rapid SBS Kit-HS (Illumina cat. FC-402-4001). Real-time image analysis and base calling were performed using HiSeq Sequencing Control software (HCS). CASAVA software version 1.8 was used to generate FASTQ files of sequence read pairs.

[0437] The minimum library size obtained was 17 million read pairs, and the maximum was 114 million read pairs. On average, there were 50 million read pairs per sample, with a median of 47 million read pairs per sample. The GSNAP program was used to assign read pairs from each library to cynomolgus monkey transcripts in the RefSeq / NCBI database to generate gene-level raw counts. These were normalized to the respective library size (for sample-to-sample comparisons), and the data for each transcript was further normalized to the respective transcript length (for transcript-to-transcript comparisons). For all samples, this generated transcript-level expression in normalized units of RPKM (reads per kilobase of transcript, per million mapped reads). PAPD5 and PAPD7 values ​​in treated animals were normalized to saline-treated animals, and the results for the corresponding time points are shown in Table 32. [Table 32]

[0438] Compared with the respective vehicle control groups, the results show downregulation of PAPD5 and PAPD7 mRNA in the liver of both main group and recovery animals at all dose levels tested for Compound No. 20_12. PAPD5 mRNA downregulation was approximately 80% at 3 and 10 mg / kg, and was saturated in the liver. PAPD7 mRNA downregulation was dose-proportional, with a 66% reduction in mRNA at 10 mg / kg. In recovery animals dosed at 10 mg / kg / week, PAPD5 mRNA downregulation was 78%. In the case of PAPD7 mRNA, downregulation reached 55%. The latter data indicate that inhibition of PAPD5 and PAPD7 mRNA persisted in the liver for at least 4 weeks after the last dose.

[0439] Example 18 Effect on HBsAg and HBeAg in HBV-infected mice after administration of PAPD5- and PAPD7-targeted oligonucleotides This study aimed to demonstrate the in vivo effects on HBV growth parameters when PAPD5 and PAPD7 transcripts were reduced in an AAV / HBV mouse model.

[0440] Example 14 and Figure 11B showed that it is difficult to target both PAPD5 and PAPD7 in mouse cell lines using a single oligonucleotide. Therefore, in this study, two oligonucleotides listed in Table 33 were used, one targeting mouse PAPD5 (Compound No. 22_1) and the other targeting mouse PAPD7 (Compound No. 22_1). [Table 33] GN2 represents the trivalent GalNAc cluster shown in Figure 2, C6 represents an aminoalkyl group having six carbons, uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C's are 5-methylcytosines, the subscript o represents a phosphodiester nucleoside linkage, and unless otherwise specified, the internucleoside linkages are phosphorothioate internucleoside linkages.

[0441] We used the AAV / HBV mouse model described in the Materials and Methods section. Mice (3 per group) received a single 10 mg / kg dose of compounds 22_1 and 23_1 (two separate injections 6 hours apart) or 5 ml / kg of saline (control) subcutaneously on day 0. Serum HBsAg and HBeAg were measured every 3 days using the method described in the Materials and Methods section. To measure target knockdown, mice from two intermediate groups were sacrificed on days 3 and 14, and the remaining mice were sacrificed on day 27. After sacrifice, the livers were removed after PBS perfusion. The perfused livers were cut into small pieces and directly frozen.

[0442] mRNA was extracted from frozen liver pieces by adding them to a 2 ml tube containing ceramic beads and 1 ml of MagNA Pure lysis buffer (Roche #05467535001). Liver pieces were homogenized using a TissueLyser (Qiagen). RNA was isolated from the tissue homogenate using the MagNA Pure "96 Cellular RNA Large Volume Kit" (Roche #05467535001). Lysates can be stored at -80°C. PAPD5 and PAPD7 mRNA were measured using qPCR essentially as described in "Materials and Methods," using the following two assays (ThermoFisher Scientific) with the following modifications to the TaqMan primer assay: [Table 33A]

[0443] GUSB and TBP are housekeeping genes used to normalize PAPD5 and PAPD7 mRNA measured with primer assays shown below the housekeeping genes.

[0444] The results are shown below in Tables 34, 35, and 36. The data in Table 34 is further illustrated in Figures 18A and B. [Table 34]

[0445] The data show that targeting PAPD5 and PAPD7 in the AAV / HBV mouse model with a single treatment results in a sustained 2-log reduction in HBsAg for up to 27 days post-treatment. [Table 35]

[0446] With respect to HBsAg, targeting PAPD5 and PAPD7 reduces serum HBeAg levels, but not as significantly as HBsAg. [Table 36]

[0447] These data demonstrate that PAPD5- and PAPD7-targeted oligonucleotides result in reduction of PAPD5 and PAPD7 mRNA levels, respectively, and are well tolerated in the AAV / HBV mouse model.

Claims

1. below: (i) TCaACtttcacttcAG (ii) TcAACtttcacttcAG (iii) TCAActttcacttCaGT (iv) TcAActttcacttCAGT (v) TcAactttcacttCAGT (In the formula, Uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides; all cytosine LNA nucleosides are 5-methylcytosine; and all internucleoside linkages are phosphorothioate internucleoside linkages. An antisense oligonucleotide selected from the group consisting of:

2. The antisense oligonucleotide of claim 1 , wherein the antisense oligonucleotide is TCaACtttcacttcAG.

3. The antisense oligonucleotide of claim 1 , wherein the antisense oligonucleotide is TcAACtttcacttcAG.

4. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide is TCAActttcacttCaGT.

5. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide is TcAActttcacttCAGT.

6. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide is TcAactttcacttCAGT.

7. A conjugate compound comprising the antisense oligonucleotide according to any one of claims 1 to 6 and a conjugate moiety bound to the antisense oligonucleotide.

8. The conjugate compound of claim 7 , wherein the conjugate moiety is capable of binding to an asialoglycoprotein receptor.

9. 9. The conjugate compound of claim 8, wherein the conjugate moiety is a trivalent N-acetylgalactosamine (GalNAc) moiety.

10. The conjugate compound of any one of claims 7 to 9, wherein the conjugate moiety is covalently attached to the antisense oligonucleotide.

11. 11. The conjugate compound of claim 7, wherein a linker is disposed between the antisense oligonucleotide and the conjugate moiety.

12. The conjugate compound of claim 11 , wherein the linker is a biocleavable linker.

13. 13. The conjugate compound of claim 12, wherein the biocleavable linker is an S1 nuclease-sensitive linker.

14. 14. The conjugate compound of claim 12 or claim 13, wherein the biocleavable linker is a phosphodiester-linked cytidine-adenosine dinucleotide with three consecutive phosphodiester bonds.

15. 15. The conjugate compound of any one of claims 12 to 14, wherein a C6 aminoalkyl group is positioned between the conjugate moiety and the biocleavable linker.

16. the conjugate moiety is capable of binding to an asialoglycoprotein receptor, the conjugate moiety is a trivalent N-acetylgalactosamine (GalNAc) moiety; the conjugate moiety is covalently attached to the antisense oligonucleotide; 16. The conjugate compound of claim 15, wherein a phosphodiester-linked cytidine-adenosine dinucleotide with three consecutive phosphodiester bonds is positioned between the antisense oligonucleotide and the conjugate moiety; and wherein a C6 aminoalkyl group is positioned between the conjugate moiety and the phosphodiester-linked cytidine-adenosine dinucleotide with three consecutive phosphodiester bonds.

17. below: (i) GN2-C6 o c o a o TCaACtttcacttcAG; (ii) GN2-C6 o c o a o TcAACtttcacttcAG; (iii) GN2-C6 o c o a o TCAActttcacttCaGT; (iv) GN2-C6 o c o a o TcAActttcacttCAGT; and (v) GN2-C6 o c o a o TcAactttcacttCAGT (In the formula, Uppercase letters represent β-D-oxy LNA nucleosides; All cytosine LNA nucleosides are 5-methylcytosines; Lowercase letters represent DNA nucleosides; Subscript o represents a phosphodiester nucleoside linkage; and all other internucleoside linkages are phosphorothioate internucleoside linkages; C 6 represents an aminoalkyl group having 6 carbon atoms; GN2 represents the trivalent GalNAc cluster shown in FIG. The wavy line in Figure 2 indicates that the trivalent GalNAc cluster is C 6 (refers to the site of conjugation to the aminoalkyl group) The conjugate compound of any one of claims 7 to 16, having a formula selected from the group consisting of:

18. A pharmaceutically acceptable salt of the antisense oligonucleotide of any one of claims 1 to 6 or the conjugate compound of any one of claims 7 to 17.

19. A pharmaceutically acceptable sodium salt of the antisense oligonucleotide of any one of claims 1 to 6 or the conjugate compound of any one of claims 7 to 17.

20. A pharmaceutically acceptable potassium salt of the antisense oligonucleotide of any one of claims 1 to 6 or the conjugate compound of any one of claims 7 to 17.

21. A pharmaceutical composition comprising an antisense oligonucleotide according to any one of claims 1 to 6, or a conjugated compound according to any one of claims 7 to 17, or a pharmaceutically acceptable salt according to any one of claims 18 to 20, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

22. 22. The pharmaceutical composition of claim 21, wherein the pharmaceutically acceptable diluent is sterile phosphate buffered saline.

23. 21. An in vitro method for modulating expression of PAPD5 and PAPD7 in a target cell expressing PAPD5 and PAPD7, said method comprising administering to said target cell an effective amount of an antisense oligonucleotide of any one of claims 1 to 6, a conjugated compound of any one of claims 7 to 17, or a pharmaceutically acceptable salt of any one of claims 18 to 20.

24. 23. The antisense oligonucleotide of any one of claims 1 to 6, the conjugated compound of any one of claims 7 to 17, or the pharmaceutically acceptable salt of any one of claims 18 to 20; or the pharmaceutical composition of claim 21 or 22, for use in treating HBV infection in a subject.

25. 23. The antisense oligonucleotide of any one of claims 1 to 6, the conjugated compound of any one of claims 7 to 17, or the pharmaceutically acceptable salt of any one of claims 18 to 20; or the pharmaceutical composition of claim 21 or 22, for use in treating chronic HBV infection in a subject.

26. 23. The antisense oligonucleotide of any one of claims 1 to 6, the conjugated compound of any one of claims 7 to 17, or the pharmaceutically acceptable salt of any one of claims 18 to 20; or the pharmaceutical composition of claim 21 or 22, for use in reducing infectivity in a subject infected with HBV.

27. A pharmaceutical composition for treating HBV infection in a subject suffering from HBV, comprising a therapeutically effective amount of the antisense oligonucleotide of any one of claims 1 to 6, the conjugate compound of any one of claims 7 to 17, or the pharmaceutically acceptable salt of any one of claims 18 to 20; or the pharmaceutical composition of claim 21 or 22.

28. A pharmaceutical composition for treating chronic HBV infection in a subject suffering from chronic HBV, comprising a therapeutically effective amount of the antisense oligonucleotide of any one of claims 1 to 6, the conjugate compound of any one of claims 7 to 17, or the pharmaceutically acceptable salt of any one of claims 18 to 20; or the pharmaceutical composition of claim 21 or 22.

29. A pharmaceutical composition for reducing infectivity in a subject infected with HBV, comprising a therapeutically effective amount of the antisense oligonucleotide of any one of claims 1 to 6, the conjugate compound of any one of claims 7 to 17, or the pharmaceutically acceptable salt of any one of claims 18 to 20; or the pharmaceutical composition of claim 21 or 22.

30. 21. Use of the antisense oligonucleotide of any one of claims 1 to 6, the conjugate compound of any one of claims 7 to 17, or the pharmaceutically acceptable salt of any one of claims 18 to 20 in the manufacture of a medicament for treating HBV infection in a subject.

31. 21. Use of the antisense oligonucleotide of any one of claims 1 to 6, the conjugate compound of any one of claims 7 to 17, or the pharmaceutically acceptable salt of any one of claims 18 to 20 in the manufacture of a medicament for treating chronic HBV infection in a subject.

32. Use of the antisense oligonucleotide of any one of claims 1 to 6, the conjugate compound of any one of claims 7 to 17, or the pharmaceutically acceptable salt of any one of claims 18 to 20 in the manufacture of a medicament for reducing infectivity in a subject infected with HBV.

Citation Information

Patent Citations

  • Oligomers and Oligomer Conjugates

    JP2017515862A