Metabolic improvers
Intravenous administration of anti-NRDC siRNA formulations to hepatocytes reduces nardilysin expression, enhancing heat dissipation and heat production in brown adipose tissue, addressing the lack of effective drugs for obesity and related diseases by improving energy balance.
Patent Information
- Application Number
- JP2022539545
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-07-30
- Filing Date
- 2021-07-29
- Publication Date
- 2026-01-16
- Estimated Expiration
- 2041-07-29
AI Technical Summary
There are no effective drugs that target nardilysin, a metalloprotease implicated in obesity and obesity-related diseases, and existing methods for measuring nardilysin in body fluids lack sensitivity and specificity.
Intravenous administration of lipid nanoparticle anti-NRDC siRNA formulations to hepatocytes, reducing nardilysin expression, enhances heat dissipation from the skin and increases heat production in brown adipose tissue, thereby improving energy balance.
This approach increases energy expenditure, effectively treating and preventing obesity and related conditions such as type 2 diabetes, non-alcoholic fatty liver disease, and hypertension by shifting energy balance to a negative state.
Smart Images

Figure 0007800911000001 
Figure 0007800911000002 
Figure 0007800911000003
Abstract
Description
[Technical Field]
[0001] The present invention relates to a metabolism improver. [Background technology]
[0002] Obesity-related diseases are on the rise, and it is estimated that approximately 20% of the world's population will be obese by 2025. Obesity is a condition in which excess fat accumulates in the body, and it is known that obesity increases the risk of various diseases such as impaired glucose tolerance, type 2 diabetes, non-alcoholic steatohepatitis (NASH), and hypertension.
[0003] Regarding the energy balance between energy intake through dietary intake and energy expenditure through physical activity, thermogenesis, and basal metabolism, shifting the energy balance to a negative one (energy intake < energy expenditure) is essential for the treatment of obesity, type 2 diabetes, NASH, and other conditions. However, achieving this goal through lifestyle modification (diet and exercise therapy) is not easy. Furthermore, NASH has been increasing in recent years and is an important cause of liver cirrhosis and liver cancer, but there are no drugs that can clearly prevent its progression.
[0004] Nardilysin (N-arginine dibasic convertase, hereafter referred to as "NRDC") is a metalloprotease belonging to the M16 family. It lacks a clear signal peptide or nuclear localization signal in its primary structure, but is secreted extracellularly via an unknown pathway and shuttled between the nucleocytoplasm and the nucleocytoplasm. NRDC was identified as a cell surface binding protein for the growth factor HB-EGF. It has been shown to enhance the shedding of extracellular domains of membrane proteins such as HB-EGF and TNF-α extracellularly, to act in cooperation with various partner molecules as a transcriptional coregulator in the nucleus, and to be involved in antigen processing in the cytoplasm. Nardilysin is known to be expressed in many tissues in the body.
[0005] Although qualitative detection of nardilysin has been possible in the past, there has been no method for quantitatively measuring nardilysin, and the presence of nardilysin in body fluids such as blood was unknown. In response to this, the present inventors have reported in Patent Document 1 a new method for collecting data that can serve as an indicator of disease, using a highly sensitive immunoassay that can measure nardilysin in body fluids. The present invention then clarifies for the first time the presence of nardilysin in body fluids such as blood, and describes that this method is useful for identifying diseases because it exhibits higher specificity (positive rate, etc.) than conventional indicators for disease.
[0006] Furthermore, the present inventors have reported in Patent Document 2 that nardilysin can be used as a specific biomarker for intrahepatic bile duct cancer, and that this has higher sensitivity and specificity than conventional biomarkers for intrahepatic bile duct cancer. Patent Document 2 and Non-Patent Document 1 also describe predicting the prognosis of a patient based on an evaluation of the magnitude of the quantitative value of nardilysin.
[0007] However, there are no drugs that target nardilysin. [Prior art documents] [Patent documents]
[0008] [Patent Document 1] Japanese Patent Application Publication No. 2011-17554 [Patent Document 2] Japanese Patent Application Publication No. 2018-128378 [Non-patent literature]
[0009] [Non-Patent Document 1] Clin Cancer Res 2019; 25:619-628. Summary of the Invention [Problem to be solved by the invention]
[0010] An object of the present invention is to provide a metabolism improver that can improve energy balance by increasing energy consumption. [Means for solving the problem]
[0011] As a result of extensive research aimed at achieving the above objectives, the inventors have discovered that intravenous administration of lipid nanoparticle anti-NRDC siRNA formulations reduces NRDC expression in hepatocytes, thereby enhancing heat dissipation from the skin, which in turn increases heat production in brown adipose tissue (BAT) to compensate, thereby improving energy balance. This is because, in warm-blooded animals, increased heat dissipation requires increased heat production to maintain body temperature, and excessive heat dissipation leads to improved metabolism (increased energy consumption). Thus, the present invention is an unprecedented method for improving metabolism based on a new concept.
[0012] The present invention was completed based on these findings and through further investigation, and provides the following metabolism improvers.
[0013] Item 1. A metabolic improver comprising a hepatocyte delivery carrier containing the following (a) or (b): (a) Double-stranded RNA having an RNAi effect on the nardilysin gene, (b) DNA capable of expressing double-stranded RNA having an RNAi effect on the nardilysin gene. Item 2. The metabolic improver according to Item 1, wherein the hepatocyte delivery carrier comprises (a) above. Item 3. The metabolism improving agent according to Item 1 or 2, wherein the double-stranded RNA is siRNA. Item 4. The metabolic improver according to any one of Items 1 to 3, which is used for the treatment and / or prevention of at least one condition selected from the group consisting of obesity, impaired glucose tolerance, type 2 diabetes, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), hypertension, and chronic kidney disease.
[0014] The present invention also provides the following: Item 5. A method for improving metabolism, comprising administering to a mammal in need thereof a hepatocyte delivery carrier containing the following (a) or (b): (a) Double-stranded RNA having an RNAi effect on the nardilysin gene, (b) DNA capable of expressing double-stranded RNA having an RNAi effect on the nardilysin gene. Item 6. Use of a hepatocyte delivery carrier containing the following (a) or (b) in the manufacture of a metabolic improver: (a) Double-stranded RNA having an RNAi effect on the nardilysin gene, (b) DNA capable of expressing double-stranded RNA having an RNAi effect on the nardilysin gene. Item 7. The method according to Item 5 or the use according to Item 6, wherein the hepatocyte delivery carrier contains (a) above. Item 8. The method according to Item 5 or 7, or the use according to Item 6 or 7, wherein the double-stranded RNA is siRNA. Item 9. The method according to Item 5, 7, or 8, which is a method for treating and / or preventing at least one condition selected from the group consisting of obesity, impaired glucose tolerance, type 2 diabetes, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), hypertension, and chronic kidney disease. Item 10. The use according to any one of Items 6 to 8, wherein the metabolic improver is used for the treatment and / or prevention of at least one condition selected from the group consisting of obesity, impaired glucose tolerance, type 2 diabetes, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), hypertension, and chronic kidney disease. [Effects of the Invention]
[0015] The metabolic improver of the present invention has the excellent property of enhancing heat dissipation from the skin by reducing the expression of nardilysin in hepatocytes, thereby increasing heat production in brown adipose tissue (BAT) to compensate for this, thereby improving energy balance. Therefore, the metabolic improver of the present invention is an unprecedented one based on a new concept.
[0016] Increasing energy expenditure leads to the treatment and prevention of obesity and many obesity-related diseases (e.g., impaired glucose tolerance, type 2 diabetes, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), hypertension, and chronic kidney disease), and therefore the metabolism-improving agent of the present invention can be used for the treatment and prevention of these diseases. [Brief explanation of the drawings]
[0017] [Figure 1] This is a graph showing the NRDC mRNA expression level in primary cultured hepatocytes 24 hours after siRNA transfection in Test Example 1 (the vertical axis shows the relative value when the NRDC mRNA expression level in cells transfected with negative control siRNA is set to 1). [Figure 2] 1 is a diagram showing an outline of the experimental plan for Test Example 2. N=5-6 [Figure 3] 1 is a graph showing changes in mouse body weight in Test Example 2. Values are mean ± standard error, * P<0.05. [Figure 4] 1 is a graph showing the oxygen consumption of mice in Test Example 2. Values are mean ± standard error, ** P<0.01. [Figure 5] 1 is a graph showing the results of an intraperitoneal glucose tolerance test (IPGTT) in Test Example 2. Values are mean ± standard error, * P<0.05, ** P<0.01. [Figure 6] 1 is a graph showing the results of measuring the blood flow rate in the mouse sole skin in Test Example 2. Values are mean ± standard error, * P<0.05. DETAILED DESCRIPTION OF THE INVENTION
[0018] Hereinafter, embodiments of the present invention will be described in detail.
[0019] In this specification, the term "comprise" includes the meanings of "essentially consist of" and "consist of only."
[0020] In this specification, the gene encoding nardilysin is referred to as the nardilysin gene, and when simply referred to as nardilysin, it means the protein.
[0021] In the present invention, unless otherwise specified, the term "gene" includes double-stranded DNA, single-stranded DNA (sense strand or antisense strand), and fragments thereof. Furthermore, in the present invention, unless otherwise specified, the term "gene" refers to regulatory regions, coding regions, exons, and introns without distinction.
[0022] The metabolism improving agent of the present invention is characterized by comprising a carrier for hepatocyte delivery containing the following (a) or (b). Among these, a carrier for hepatocyte delivery containing the following (a) is preferred: (a) Double-stranded RNA having an RNAi effect on the nardilysin gene, (b) DNA capable of expressing double-stranded RNA having an RNAi effect on the nardilysin gene.
[0023] In the present invention, "metabolic improvement" means improving energy metabolism. The term "metabolic improvement" means bringing the energy balance between energy intake through dietary intake and energy consumption through physical activity, heat production, and basal metabolism closer to normal, and particularly means shifting the energy balance to a negative state (energy intake < energy consumption). Metabolic improvement can be determined by the presence or absence of changes in body weight, organ weight, oxygen consumption, and other indicators.
[0024] Nardilysin (EC 3.4.24.61) is a polypeptide-hydrolyzing enzyme. It is also called N-arginine dibasic convertase (NRD convertase). It was initially reported to hydrolyze the N-terminus of arginine at the dibasic site (-Xaa- / -Arg-Arg, -Xaa-Arg- / -Arg, -Xaa- / -Arg-Lys, -Xaa-Lys- / -Arg). However, it has since been reported to hydrolyze the N-terminus of Lys, and even the N-terminus of monobasic sites, depending on the type of Xaa (Xaa is any amino acid other than arginine or lysine). The nucleotide sequence of the nardilysin gene has been registered on the NCBI website under RefSeq Accession No. NM_002525 (human) (SEQ ID NO: 1), NM_001101662 (human) (SEQ ID NO: 2), NM_001242361 (human) (SEQ ID NO: 3), NM_001347169 (mouse) (SEQ ID NO: 4), NM_146150 (mouse) (SEQ ID NO: 5), NM_001346554 (mouse) (SEQ ID NO: 6), etc., and the amino acid sequence has been registered under RefSeq Accession No. They are registered as NP_002516 (human) (SEQ ID NO: 7), NP_001095132 (human) (SEQ ID NO: 8), NP_001229290 (human) (SEQ ID NO: 9), NP_001334098 (mouse) (SEQ ID NO: 10), NP_666262 (mouse) (SEQ ID NO: 11), NP_001333483 (mouse) (SEQ ID NO: 12), etc. When the proteins indicated by the above RefSeq IDs contain a signal sequence, the mature protein is also included.
[0025] The nardilysin gene of the present invention includes degenerates and mutants thereof, even if the nucleotide sequence is not registered in the database as described above, and the mutant preferably encodes a protein having biological activity equivalent to that of the protein consisting of the above amino acid sequence. Examples of proteins having equivalent biological activity include proteins derived from other organisms.
[0026] Examples of mutants include: (1) genes encoding proteins consisting of amino acid sequences registered in the aforementioned databases in which one or more, for example, 1 to 50, 1 to 25, 1 to 12, 1 to 9, or 1 to 5 amino acids have been substituted, deleted, or added; and (2) genes consisting of nucleotide sequences that share 70% or more, 80% or more, 90% or more, or 95% or more identity with nucleotide sequences registered in the aforementioned databases.
[0027] The identity of the nucleotide sequence can be calculated using analytical tools that are commercially available or available via telecommunications lines (Internet). The identity (%) of the nucleotide sequence can be determined using a program commonly used in the field (e.g., BLAST, FASTA, etc.) with the default settings.
[0028] By knocking down the expression of the nardilysin gene in hepatocytes using the above (a) and (b), heat dissipation from the skin is enhanced, and heat production in BAT is increased to compensate for this, thereby improving metabolism. The above (a) and (b) are explained below.
[0029] By using double-stranded RNA that has an RNAi effect on the nardilysin gene, the expression of the nardilysin gene can be inhibited or suppressed.
[0030] RNAi (RNA interference) refers to the phenomenon in which double-stranded RNA (dsRNA) consisting of a sense RNA with a sequence identical to the mRNA sequence of a target gene and an antisense RNA with a complementary sequence is introduced into cells, resulting in the destruction of the target gene's mRNA and the inhibition of its translation into protein, thereby inhibiting target gene expression. Although the details of the RNAi mechanism remain unclear, it is believed that an enzyme called DICER (a member of the RNase III nuclease family) contacts the double-stranded RNA and degrades it into small fragments called small interfering RNAs (siRNAs). The siRNAs are incorporated into Argonaute (Ago), and the sense strand (passenger strand) is removed, forming a mature RNA-induced silencing complex (RISC) in which only the antisense strand (guide strand) is incorporated into Ago. This complex then binds to and cleaves the target mRNA, which has a sequence completely complementary to the guide strand. In the present invention, the double-stranded RNA with RNAi effect also includes such siRNAs.
[0031] The double-stranded RNA having the RNAi effect in the present invention also includes molecules in which one end of the double-stranded RNA is closed, such as siRNA (shRNA) having a hairpin structure. That is, the above RNA also includes molecules that can form a double-stranded RNA structure within the molecule.
[0032] The RNA used for RNAi in the present invention does not need to be completely identical to the nardilysin gene or a partial region of said gene, but it is preferable that it has complete identity.
[0033] The double-stranded RNA having the RNAi effect of the present invention is typically a double-stranded RNA consisting of a sense RNA with a sequence identical to a contiguous RNA region in the mRNA of the nardilysin gene, and an antisense RNA with a sequence complementary to the sense RNA. The length of the "contiguous RNA region" is typically 20 to 30 bases. However, since even long RNAs that do not have the RNAi effect in their original length can be degraded into siRNAs with the RNAi effect in cells, the length of the double-stranded RNA of the present invention is not particularly limited. Alternatively, a long double-stranded RNA corresponding to a full-length or nearly full-length region of the mRNA of the nardilysin gene can be degraded in advance using, for example, DICER, and the degradation products can be used as the double-stranded RNA of the present invention. These degradation products may include double-stranded RNA molecules (siRNAs) with the RNAi effect.
[0034] Furthermore, since double-stranded RNA having an overhang of several bases at its end is generally known to have a high RNAi effect, it is desirable that the double-stranded RNA of the present invention have an overhang of several bases at its end. The length of the bases forming this overhang is not particularly limited, and a two-base overhang is preferred. In the present invention, for example, double-stranded RNA having an overhang such as TT (thymine x 2) or UU (uracil x 2) can be used, and particularly preferred is a molecule having a 19-base double-stranded RNA and a TT overhang. The double-stranded RNA of the present invention also includes molecules in which the bases forming the overhang are DNA.
[0035] In addition, siRNAs containing natural nucleotides are susceptible to degradation by ribonucleases. To overcome this drawback, 2'-O-methylated siRNAs in which the 2'OH groups of uridine and cytidine in the siRNA are methylated, 2'-fluoro-substituted siRNAs in which the 2'OH groups are 2'-fluoro-substituted, and siRNAs in which the phosphodiester bond is replaced by a phosphorothioate bond may be synthesized and used in the present invention.
[0036] The "double-stranded RNA having an RNAi effect against the nardilysin gene" of the present invention can be prepared based on the base sequence of the nardilysin gene that is the target of the double-stranded RNA. For example, based on the base sequence set forth in any of SEQ ID NOS: 1 to 6, any continuous RNA region of mRNA, which is the transcription product of that sequence, is selected, and a double-stranded RNA corresponding to this region is prepared.
[0037] Specific examples of the "double-stranded RNA having RNAi effect" in the present invention include the double-stranded RNAs described in the Examples (SEQ ID NOs: 13 and 14, 15 and 16, 17 and 18).
[0038] Furthermore, in the double-stranded RNA of the present invention, all nucleotides do not need to be ribonucleotides (RNA). That is, in the present invention, one or more ribonucleotides constituting the double-stranded RNA can be replaced with the corresponding deoxyribonucleotides.
[0039] In the present invention, the nucleic acid constituting the double-stranded RNA can be a nucleic acid analog such as LNA (Locked Nucleic Acid), which is resistant to nucleases and therefore allows the RNAi effect to last for a longer period of time.
[0040] The double-stranded RNA of the present invention can be chemically synthesized, or synthesized in vitro or in vivo using DNA encoding the double-stranded RNA of the present invention.
[0041] Furthermore, the double-stranded RNA having the RNAi effect of the present invention may utilize DNA capable of expressing the double-stranded RNA in cells. Such DNA capable of expressing double-stranded RNA is usually DNA having a structure in which DNA encoding one strand of the double-stranded RNA and DNA encoding the other strand of the double-stranded RNA are linked to a promoter so that they can be expressed independently or sequentially. The DNA can be easily produced by known genetic engineering techniques. Examples of the DNA include expression vectors obtained by inserting DNA encoding the RNA of the present invention into a known expression vector.
[0042] The metabolism improving agent of the present invention knocks down the nardilaysin gene in hepatocytes, and in the present invention, it is desirable to suppress the expression of the nardilaysin gene by 50% or more, preferably 60% or more, and more preferably 70% or more.
[0043] Since the present invention aims to specifically knockdown the nardilysin gene in hepatocytes, the double-stranded RNA and DNA (a) and (b) described above must be delivered specifically to hepatocytes. Therefore, the double-stranded RNA and DNA (a) and (b) described above are contained in a hepatocyte delivery carrier for delivering them to hepatocytes (liver, liver tissue). Here, "hepatocyte delivery carrier" refers to a carrier used to deliver a substance encapsulated therein into hepatocytes. Such hepatocyte delivery carriers are not particularly limited as long as they can efficiently deliver and introduce the double-stranded RNA and DNA (a) and (b) described above into hepatocytes. Known drug delivery systems (DDS) capable of delivering and introducing nucleic acids into hepatocytes can be used. Examples of such DDS include non-viral vectors such as liposomes, polymeric micelles, and cationic carriers, as well as those whose surfaces are modified with functional molecules (which have hepatocyte selectivity). Specific examples include the lipid membrane structures described in International Publication No. WO 2018 / 230710.
[0044] The metabolism improving agent of the present invention may be mixed with a pharmaceutically acceptable carrier, such as an excipient, buffer, preservative, suspending agent, stabilizer, isotonic agent, surfactant, disintegrant, binder, colorant, flavoring, lubricant, flow enhancer, or flavoring agent.
[0045] When formulating the metabolism improving agent of the present invention, the above-mentioned carriers can be added as needed according to conventional methods. Examples of carriers that can be added include light anhydrous silicic acid, lactose, mannitol, starch, gelatin, corn starch, crystalline cellulose, carmellose sodium, carmellose calcium, hydroxypropyl cellulose, hydroxypropyl methylcellulose, polyvinylpyrrolidone, polyvinyl acetal diethylaminoacetate, medium-chain fatty acid triglycerides, polyoxyethylene hydrogenated castor oil 60, sucrose, carboxymethyl cellulose, inorganic salts, etc.
[0046] The types of dosage forms of the metabolism improving agent of the present invention include tablets, pills, powders, powders, granules, fine granules, soft or hard capsules, film-coated preparations, sublingual preparations, pellets, pastes, etc. for oral administration, and injections, transdermal preparations, ointments, plasters, suppositories, external liquid preparations, etc. for parenteral administration, and the optimal dosage form can be selected depending on the administration route, administration target, etc.
[0047] The amount of the hepatocyte delivery carrier, which is the active ingredient in the metabolism improving agent of the present invention, is selected appropriately depending on the dosage form, administration route, etc., and is usually approximately 0.0001 to 90% by mass, preferably approximately 0.001 to 70% by mass, of the total amount of the formulation.
[0048] The metabolic improver of the present invention is administered to mammals, including humans. Examples of non-human mammals include monkeys, mice, rats, guinea pigs, rabbits, cows, horses, sheep, goats, pigs, cats, and dogs. The method of administration of the metabolic improver of the present invention is not particularly limited, and can be performed by methods known to those skilled in the art, such as intraarterial injection, intravenous injection, and subcutaneous injection. The dosage of the metabolic improver of the present invention can ultimately be appropriately determined by a physician's judgment, taking into consideration the type of dosage form, administration method, the patient's age and weight, and the patient's symptoms, etc.
[0049] The metabolism-improving agent of the present invention can also be used for the treatment and prevention of obesity, impaired glucose tolerance, type 2 diabetes, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), hypertension, chronic kidney disease (CKD), and the like.
[0050] The metabolic improver of the present invention reduces (knocks down) the expression of nardilysin in hepatocytes, thereby enhancing heat dissipation from the skin and increasing heat production in brown adipose tissue (BAT) to compensate for this, thereby resulting in improved energy balance (metabolism).
[0051] Increasing energy expenditure leads to the treatment and prevention of obesity and many obesity-related diseases (e.g., impaired glucose tolerance, type 2 diabetes, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), hypertension, and chronic kidney disease), and therefore the metabolism-improving agent of the present invention can be used for the treatment and prevention of these diseases. [Example]
[0052] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.
[0053] Test Example 1: Gene expression suppression using siRNA against NRDC in primary cultured hepatocytes Hepatocytes were harvested from 8-week-old wild-type C57BL6 / J mice using the collagenase perfusion method, and primary cultures were established. Eighteen hours after the start of culture, the following three anti-NRDC siRNAs or negative control siRNAs (siRNA against the human Plk1 gene was used as a negative control) were transfected using Lipofectamine™ RNAiMAX Transfection Reagent (Thermo Fisher Scientific) to attempt NRDC gene silencing. Twenty-four hours after transfection, cells were lysed, RNA was collected, and the efficiency of gene silencing was confirmed by real-time PCR. siNrdc1 AAUCCUAGAAUUCCAGAUGUGUUCC (SEQ ID NO: 13) GGAACACAUCUGGAAUUCUAGGAUU (SEQ ID NO: 14) siNrdc2 UUUACUUCCAGGUCCUCUGUGAGCC (SEQ ID NO: 15) GGCUCACAGAGGACCUGGAAGUAAA (SEQ ID NO: 16) siNrdc3 AUAUCCAACAACAUGAACGCUGAGC (SEQ ID NO: 17) GCUCAGCGUUCAUGUUGUUGGAUAU (SEQ ID NO: 18) siControl AGAUCACCCUCCUUAAAUAUU (SEQ ID NO: 19) UAUUUAAGGAGGGUGAUCUUU (SEQ ID NO: 20)
[0054] The results are shown in Figure 1. Figure 1 shows that all three types of siRNA were able to knock down NRDC. Based on these results, we created nanoparticles of siNrdc1 and performed knockdown experiments in living mice.
[0055] Test Example 2: Suppression of NRDC expression in mouse liver using lipid nanoparticle-encapsulated anti-NRDC siRNA <Method> Liver-targeting lipid nanoparticles were prepared using the alcohol dilution method. A total lipid concentration of 16.16 mmol / L was achieved by pumping an ethanol solution containing CL4H6 (7-(4-(dipropylamino)butyl)-7-hydroxytridecane-1,13-diyl dioleate), 1,2-distearoyl-sn-glycero-3-phosphatidylcholine (DSPC), cholesterol, and methoxyethylene glycol 2000 dimethylglycerol in a molar ratio of 60:5:35:1 into a microfluidic device (see WO 2018 / 190423) at flow rates of 125 μL / min and 375 μL / min, respectively. The lipid nanoparticle solution discharged from the flow channel was collected, placed in a dialysis membrane (MWCO: 12,000-14,000), and dialyzed in PBS(-) at 4°C for more than 2 hours to exchange the buffer and remove the alcohol. The average particle diameter of the prepared nanoparticles was approximately 80 nm, and the siRNA encapsulation rate was approximately 95%.
[0056] Nanoparticles containing siRNA against Nrdc (siNrdc) or negative control siRNA (siControl) were intravenously injected into 12-week-old C57BL6 / J mice via the tail vein. A high-fat, high-sucrose diet (HFHSD) was initiated on the same day and continued for 6 weeks. siNrdc was intravenously injected every 2 weeks. Oxygen consumption was measured using an Oxymax isoflow system starting 4 weeks after HFHSD. An intraperitoneal glucose tolerance test (IPGTT) was performed 5 weeks after HFHSD, and plantar skin blood flow was measured using a laser Doppler device immediately before sacrifice at 6 weeks. The experimental design is outlined in Figure 2.
[0057] The intraperitoneal glucose tolerance test (IPGTT) was performed by fasting overnight before the test, administering 1 g / kg of glucose intraperitoneally, and measuring blood glucose levels at 0, 30, 60, 90, and 120 minutes after administration. Skin blood flow was measured using a two-dimensional laser blood flow imaging system (OZ-1, OMEGAWAVE) under isoflurane inhalation anesthesia.
[0058] <Result> The results are shown in Figures 3-6. Figure 3 shows changes in mouse body weight, demonstrating that anti-NRDC siRNA significantly suppressed weight gain due to HFHSD loading. Figure 4 shows oxygen consumption, demonstrating a significant increase in oxygen consumption in the anti-NRDC siRNA-treated group, suggesting increased energy expenditure.
[0059] Figure 5 shows the results of an IPGTT, which demonstrated improved glucose tolerance in the anti-NRDC siRNA-treated group. Figure 6 shows the results of measurements of plantar skin blood flow, which demonstrated an increase in skin blood flow in the anti-NRDC siRNA-treated group. This suggests enhanced heat dissipation from the skin.
Claims
1. A metabolism improving agent comprising a carrier for hepatocyte delivery containing the following (a) or (b), wherein the carrier for hepatocyte delivery is a lipid membrane structure: (a) Double-stranded RNA having an RNAi effect on the nardilysin gene, (b) DNA capable of expressing double-stranded RNA having an RNAi effect on the nardilysin gene.
2. The metabolic improver according to claim 1, wherein the hepatocyte delivery carrier contains (a).
3. The metabolic improver according to claim 1 or 2, wherein the double-stranded RNA is siRNA.
4. The metabolic improver according to any one of claims 1 to 3, which is used for the treatment and / or prevention of at least one condition selected from the group consisting of obesity, impaired glucose tolerance, type 2 diabetes, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), hypertension, and chronic kidney disease.
Citation Information
Patent Citations
High sensitive immunoassay of nardilysin
JP2011017554A
Inspection method and test reagent for intrahepatic bile duct cancer
JP2018128378A
Pharmaceutical for preventing and / or treating disease caused by abnormal enhancement of extracellular domain shedding
WO2006106599A1