Novel method for producing poly-4-hydroxybutyrate and 1,4-butanediol

Abstract

The present application relates to novel methods for producing poly-4-hydroxybutyrate and / or 1,4-butanediol and microorganisms that utilize a pathway for producing poly-4-hydroxybutyrate.

Description

[Technical Field]

[0001] The present application relates to a novel method for producing poly-4-hydroxybutyrate and / or 1,4-butanediol and a microorganism that utilizes a poly-4-hydroxybutyrate production pathway. [Background technology]

[0002] Various studies have been conducted to develop highly efficient microorganisms and fermentation process technologies for producing 1,4-butanediol. Microbial production of 1,4-butanediol generally involves the production of 4-hydroxybutyraldehyde (Patent Document 1). However, as a type of aldehyde, 4-hydroxybutyraldehyde has the disadvantage of being harmful to microorganisms.

[0003] In addition, one of the currently known bio-based 1,4-butanediol production technologies is 1,4-butanediol direct fermentation, which is a method of directly producing 1,4-butanediol from microorganisms through fermentation of glucose, but productivity is limited due to the toxicity of 1,4-butanediol itself to microorganisms. Therefore, research is still needed to effectively increase the productivity of poly-4-hydroxybutyrate and / or 1,4-butanediol. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] U.S. Patent No. 9,121,042 [Patent Document 2] U.S. Patent No. 9,084,467 [Patent Document 3] International Publication No. 2014058655 [Patent Document 4] Korean Patent Publication No. 10-2020-0136813 [Patent Document 5] U.S. Patent No. 7,662,943 [Patent Document 6] U.S. Patent No. 10584338 [License 7] U.S. Patent No. 10273491 [Non-licensed literature]

[0005] [Non-licensed Document 1] Pearson et al(1988)[Proc.Natl.Acad.Sci.USA 85]:2444 [Non-licensed Document 2] Rice et al.,2000,Trends Genet.16:276-277 [Non-licensed Document 3] Needleman and Wunsch,1970,J.Mol.Biol.48:443-453 [Non-licensed Document 4] Devereux,J.,et al,Nucleic Acids Research 12:387(1984) [Non-licensed Document 5] Atschul,[S.][F.,][ET AL,J MOLEC BIOL 215]:403(1990) [Non-licensed Document 6] Guide to Huge Computers,Martin J.Bishop,[ED.,]Academic Press,San Diego,1994 [Non-licensed Document 7] [CARILLO ETA / .](1988)SIAM J Applied Math 48:1073 [Non-licensed Document 8] Smith and Waterman,Adv.Appl.Math(1981)2:482 [Non-licensed Document 9] Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979) [Non-licensed Document 10] Gribskov et al(1986) Nucl. Acids Res.14:6745

Non-licensed Document 11

Non-licensed Document 12

Non-licensed Document 13

Non-licensed Document 14

Non-licensed Document 15

Non-licensed Document 16

Non-licensed Document 17

Non-licensed Document 18

[0006] An object of the present application is to provide a novel method for producing poly-4-hydroxybutyrate and 1,4-butanediol, and a microorganism for producing poly-4-hydroxybutyrate and / or 1,4-butanediol. [Means for solving the problem]

[0007] One object of the present application is to provide a method for producing 1,4-butanediol. One object of the present application is to provide a microorganism for producing poly-4-hydroxybutyrate and / or 1,4-butanediol. One object of the present application is to provide a method for producing poly-4-hydroxybutyrate. [Effects of the Invention]

[0008] When the method or microorganism of the present application is used, efficient production of poly-4-hydroxybutyrate and 1,4-butanediol is possible. [Brief explanation of the drawings]

[0009] [Figure 1] FIG. 1 shows a production pathway for poly-4-hydroxybutyrate and 1,4-butanediol using the oxidative TCA pathway. [Figure 2] FIG. 1 shows a pathway for producing poly-4-hydroxybutyrate and 1,4-butanediol using a reduced TCA pathway. [Figure 3]FIG. 1 shows a production pathway for poly-4-hydroxybutyrate and 1,4-butanediol using the glyoxylate pathway. [Figure 4] FIG. 1 shows a method for enhancing the phosphoenolpyruvate-oxaloacetate pathway in a poly-4-hydroxybutyrate and 1,4-butanediol production pathway using a reduced TCA pathway. [Figure 5] FIG. 1 shows a method for enhancing the phosphoenolpyruvate-oxaloacetate pathway in a poly-4-hydroxybutyrate and 1,4-butanediol production pathway using a reduced TCA pathway. [Figure 6] FIG. 1 shows a method for enhancing the phosphoenolpyruvate-oxaloacetate pathway in a poly-4-hydroxybutyrate and 1,4-butanediol production pathway using a reduced TCA pathway. [Figure 7] FIG. 1 shows the results of poly-4-hydroxybutyrate production using the reduced TCA pathway. [Figure 8] FIG. 1 shows the results of poly-4-hydroxybutyrate production using the glyoxylate pathway. DETAILED DESCRIPTION OF THE INVENTION

[0010] This will be explained in more detail as follows. Meanwhile, each description and embodiment disclosed in this application may also be applied to different descriptions and embodiments. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the following specific description is not intended to limit the scope of this application. Furthermore, numerous papers and patent documents are referenced throughout this specification, and citations thereof are provided. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to more clearly explain the state of the art to which the present invention pertains and the content of the present invention.

[0011] One aspect of the present application provides a method for producing 1,4-butanediol, including the following steps (1) to (5): (1) Converting succinyl-coA (SuCoA) to succinate semialdehyde (SSA); (2) converting succinate semialdehyde (SSA) to 4-hydroxybutyrate (4HB); (3) converting 4-hydroxybutyrate (4HB) to 4-hydroxybutyryl coA (4HBCoA); (4) polymerizing two or more 4-hydroxybutyryl coA (4HBCoA) to produce poly-4-hydroxybutyrate (P4HB); and (5) Decomposing poly-4-hydroxybutyrate into 1,4-butanediol.

[0012] The above (1) to (4) may each utilize one or more polypeptides selected from the group consisting of succinate semialdehyde dehydrogenase, 4-hydroxybutyric acid dehydrogenase, 4-hydroxybutyryl-CoA transferase, and poly(3-hydroxyalkanoate) polymerase; microorganisms containing the polypeptides, polynucleotides encoding the polypeptides, vectors containing the polynucleotides, or combinations thereof; and cultures thereof, but are not limited thereto.

[0013] Any one or more selected from the group consisting of succinate semialdehyde dehydrogenase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, and poly(3-hydroxyalkanoate) polymerase may be enhanced by a microorganism containing an exogenous polypeptide, a polynucleotide encoding the same, or a vector containing the same, but is not limited thereto.

[0014] When 1,4-butanediol is directly produced by glucose fermentation, productivity is limited due to the toxicity of 1,4-butanediol to microorganisms. However, since the present application preferentially produces cell-compatible poly-4-hydroxybutyrate, the production method of the present application may result in increased poly-4-hydroxybutyrate productivity. Furthermore, the present application may result in increased poly-4-hydroxybutyrate productivity by introducing a gene in the poly-4-hydroxybutyrate production step to activate the reductive TCA pathway using oxaloacetate; a highly productive fermentation process; and / or by recycling carbon dioxide generated during fermentation through the reductive TCA pathway. Furthermore, such increased poly-4-hydroxybutyrate productivity may further increase 1,4-butanediol productivity.

[0015] The method for producing 1,4-butanediol of the present application may further include one or more pathways selected from the group consisting of a TCA cycle, a reductive TCA cycle, and a glyoxylate cycle. The pathway may convert 1,4-butanediol to succinyl-coA.

[0016] In one embodiment, the method for producing 1,4-butanediol of the present application may include a TCA pathway, in which pyruvate produced through the glycolysis pathway is converted into succinyl-coA via the TCA pathway.

[0017] The TCA pathway may include one or more steps selected from the group consisting of: (a1) converting pyruvate to acetyl-coA; (b1) converting acetyl-coA and oxaloacetate to citrate; (c1) converting citrate to isocitrate; (d1) converting isocitrate to α-ketoglutarate; (e1) converting α-ketoglutarate to succinyl-coA; and (f1) converting pyruvate to oxaloacetate.

[0018] The above (d1) may be a step in which isocitrate is converted into α-ketoglutarate and carbon dioxide, and the above (e1) may be a step in which α-ketoglutarate is converted into succinyl-coA and carbon dioxide.

[0019] In one embodiment, each of (a1) to (f1) may utilize, but is not limited to, one or more polypeptides selected from the group consisting of pyruvate dehydrogenase, citrate synthase, aconitase, isocitrate dehydrogenase, α-ketoglutarate dehydrogenase, and pyruvate carboxylase; a microorganism containing the polypeptide, a polynucleotide encoding the polypeptide, a vector containing the polynucleotide, or a combination thereof; and a culture thereof.

[0020] The above production method may further include, but is not limited to, the step (g1) of converting phosphoenolpyruvate to oxaloacetate.

[0021] In one embodiment, (g1) may utilize any one or more selected from the group consisting of: a phosphoenolpyruvate carboxylase polypeptide; a microorganism containing the polypeptide, a polynucleotide encoding the polypeptide, a vector containing the polynucleotide, or a combination thereof; and a culture thereof, but is not limited thereto.

[0022] In one embodiment, the production method of the present application may be, but is not limited to, a method in which transcription of the phosphoenolpyruvate carboxylase gene (ppc) is not inhibited under one or more limiting conditions selected from the group consisting of nitrogen, sulfur, phosphorus, and magnesium.

[0023] In one embodiment, the production method of the present application may include, but is not limited to, limiting any one or more selected from the group consisting of nitrogen, phosphorus, sulfur, and magnesium.

[0024] In one embodiment, the production method of the present application may include a step of limiting any one or more selected from the group consisting of nitrogen, phosphorus, sulfur, and magnesium, but the production of poly-4-hydroxybutyrate and / or 1,4-butanediol may not be reduced compared to a method that does not include the limiting step, but is not limited thereto.

[0025] In one embodiment, the transcription may be uninhibited by a promoter, but is not limited thereto. The promoter may be a polynucleotide having promoter activity as set forth in SEQ ID NO: 45, and the target gene of the nucleotide sequence having promoter activity as set forth in SEQ ID NO: 45 may be a polynucleotide encoding phosphoenolpyruvate carboxylase. When a promoter that does not inhibit ppc transcription under nitrogen-limited conditions is used, the rTCA pathway may be enhanced, resulting in increased production of poly-4-hydroxybutyrate and / or 1,4-butanediol. When a promoter that does not inhibit the transcription of the phosphoenolpyruvate carboxylase gene (ppc) under nitrogen-limited conditions but has activity equal to or greater than that of the wild-type ppc promoter is used, it is effective in producing poly-4-hydroxybutyrate and / or 1,4-butanediol.

[0026] In one embodiment, the production method may be one in which step (g1) is strengthened, but is not limited thereto.

[0027] In one embodiment, the method for producing 1,4-butanediol of the present application may include a reductive TCA pathway, in which oxaloacetate is converted to succinyl-CoA via malate, fumarate, and succinate without the decarboxylation step involved in the oxidative TCA pathway, and thus without the generation of additional carbon dioxide.

[0028] The reduced TCA pathway may include, but is not limited to, one or more steps selected from the group consisting of: (a2) converting oxaloacetate to malate; (b2) converting malate to fumarate; (c2) converting fumarate to succinate; and (d2) converting succinate to succinyl-coA.

[0029] The production method of the present application may further include a step (e2) of converting phosphoenolpyruvate to oxaloacetate prior to the reduced TCA pathway. (e2) may be the same as (g1) above.

[0030] In one embodiment, the production method of the present application may be one in which the reductive TCA pathway is enhanced, and the enhanced reductive TCA pathway may include, but is not limited to, the enhancement of the step of converting (e2) phosphoenolpyruvate to oxaloacetate.

[0031] In one embodiment, the reductive TCA pathway may be enhanced by one or more selected from the group consisting of the following (I) to (XII), but is not limited thereto: (I) pyruvate kinase weakening; (II) phosphoenolpyruvate carboxylase (PEP carboxylase) enhancement; (III) carbonic anhydrase enhancement; (IV) citrate synthase regulation; (V) pyruvate carboxylase enhancement; (VI) NAD + NAD-dependent malate dehydrogenase (NAD + -dependent malate dehydrogenase) weakened; (VII)NADP + Dependent malate dehydrogenase (NADP +(VIII) weakened phosphogluconate dehydratase; (IX) weakened 2-keto-4-hydroxyglutarate:2-keto-3-deoxygluconate 6-phosphate aldolase (KHG / KDPG aldolase); (X) weakened aspartate aminotransferase; (XI) weakened glucose-specific PTS enzyme IIBC component; and (XII) strengthened bicarbonate transporter.

[0032] In one embodiment, the step of converting phosphoenolpyruvate to oxaloacetate may be enhanced by weakening pyruvate kinase and enhancing carbonic anhydrase; weakening pyruvate kinase and enhancing phosphoenolpyruvate carboxylase; modulating citrate synthase and enhancing phosphoenolpyruvate carboxylase; modulating citrate synthase and enhancing carbonic anhydrase; and weakening pyruvate kinase, enhancing phosphoenolpyruvate carboxylase, and enhancing pyruvate carboxylase, and optionally enhancing carbonic anhydrase, NAD + Dependent malate dehydrogenase weakened, NADP + The enzyme may be enhanced by one or more of the following, but is not limited to: weakened glucose-dependent malate dehydrogenase, weakened phosphogluconate dehydratase, weakened KHG / KDPG aldolase, weakened aspartate aminotransferase, weakened glucose-specific PTS enzyme IIBC component; and / or strengthened bicarbonate transporter.

[0033] In one embodiment, the reduced TCA pathway comprises: (II) phosphoenolpyruvate carboxylase enrichment; (VI) NAD + Dependent malate dehydrogenase weakening; (VII)NADP + Dependent malate dehydrogenase attenuation; and / or (X) Aspartate aminotransferase attenuation may also be included.

[0034] In one embodiment, the reduced TCA pathway may be enriched for (II) phosphoenolpyruvate carboxylase.

[0035] In one embodiment, the reduced TCA pathway is (VI) NAD + Dependent malate dehydrogenase and (VII)NADP + The enzyme may have a weakened dependent malate dehydrogenase.

[0036] In one embodiment, the reduced TCA pathway may be one in which (X) aspartate aminotransferase is weakened.

[0037] In one embodiment, the carbon dioxide generated during fermentation may be recycled through the rTCA pathway of the present application to increase the yield of poly-4-hydroxybutyrate and / or 1,4-butanediol production.

[0038] In one embodiment, the method for producing 1,4-butanediol of the present application may include a glyoxylate pathway.

[0039] The glyoxylate pathway may further include, but is not limited to, one or more of the following steps: (a3) ​​converting isocitrate to glyoxylate and succinate; (b3) converting glyoxylate and acetyl-CoA to malate and CoA; (c3) converting citrate to isocitrate; (d3) converting pyruvate to oxaloacetate; (e3) converting phosphoenolpyruvate to oxaloacetate; (f3) converting oxaloacetate and acetyl-CoA to citrate; (g3) converting malate to fumarate; (h3) converting fumarate to succinate; and (i3) converting succinate to succinyl-CoA. The above (f3) may be the same as (b1), the above (g3) may be the same as (b2), the above (h3) may be the same as (c2), and the above (i3) may be the same as (d2).

[0040] In one embodiment, the glyoxylate pathway may be mediated by one or more of the following, but is not limited to: (i) enhanced citrate synthase; (ii) weakened isocitrate dehydrogenase; (iii) enhanced isocitrate lyase; (iv) enhanced isocitrate dehydrogenase kinase / phosphatase; (v) enhanced malate synthase G; and (vi) enhanced malate synthase A.

[0041] In one embodiment, the method of the present application including the glyoxylate pathway may further weaken the step (j3) of converting α-ketoglutarate to succinyl-CoA and / or the step (k3) of converting oxaloacetate to malate, but is not limited thereto.

[0042] Both succinate and malate, products of the glyoxylate pathway, may be converted to succinyl-coA using the reduced TCA pathway.

[0043] In this application, "succinate semialdehyde dehydrogenase" refers to an enzyme that catalyzes the conversion of succinyl-coA (SuCoA) to succinate semialdehyde (SSA). The succinate semialdehyde dehydrogenase may be referred to interchangeably with SucD.

[0044] In one embodiment, the SucD protein of the present application may be derived from Clostridium kluyveri and is included in SucD as long as it has the same sequence or activity as SucD. In one embodiment, the SucD protein of the present application may comprise, have, consist of, or essentially consist of SEQ ID NO: 1 or an amino acid sequence having 80% or more homology or identity thereto.

[0045] In the present application, the succinate semialdehyde dehydrogenase gene may be used in combination with sucD, a polynucleotide encoding succinate semialdehyde dehydrogenase, etc. The sucD gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 2, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0046] In this application, "4-hydroxybutyric acid dehydrogenase" refers to an enzyme that catalyzes the conversion of succinate semialdehyde (SSA) to 4-hydroxybutyrate (4HB). The term "4-hydroxybutyric acid dehydrogenase" may be used interchangeably with "succinate semialdehyde reductase" and "4HbD."

[0047] In one embodiment, the 4HbD protein of the present application may be derived from Arabidopsis thaliana and is included in 4HbD as long as it has the same sequence or activity as SEQ ID NO: 3. In one embodiment, the 4HbD protein of the present application may comprise, have, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence having 80% or more homology or identity thereto.

[0048] In the present application, the 4-hydroxybutyrate dehydrogenase gene may be used interchangeably with 4hbD, a polynucleotide encoding 4-hydroxybutyrate dehydrogenase, etc. The 4hbD gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 4, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0049] In this application, "4-hydroxybutyryl-CoA transferase" refers to an enzyme that can catalyze the reaction in which 4-hydroxybutyrate (4HB) is converted to 4-hydroxybutyryl-coA (4HBCoA). The 4-hydroxybutyryl-coA transferase can be used in combination with OrfZ.

[0050] In one embodiment, the OrfZ protein of the present application may be derived from Clostridium kluyveri and is included in OrfZ as long as it has the same sequence or activity as that of Clostridium kluyveri. In one embodiment, the OrfZ protein of the present application may comprise, have, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 5 or an amino acid sequence having 80% or more homology or identity thereto.

[0051] In the present application, the 4-hydroxybutyryl-coA transferase gene may be used in combination with orfZ, a polynucleotide encoding 4-hydroxybutyryl-coA transferase, etc. The orfZ gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 6, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0052] In one embodiment, the amino acid and gene sequences of SucD, 4HbD, and / or OrfZ can be obtained from, but are not limited to, US 9084467 B2.

[0053] In this application, "poly(3-hydroxyalkanoate) polymerase" refers to an enzyme that can catalyze the polymerization of two or more 4-hydroxybutyryl coA (4HBCoA) molecules into poly-4-hydroxybutyrate (P4HB). The poly(3-hydroxyalkanoate) polymerase may be used in combination with PhaC.

[0054] In one embodiment, the PhaC protein of the present application may be derived from various microorganisms, specifically, from Pseudomonas putida or Ralstonia eutropha, or may be a fusion protein derived from these, and is included in PhaC as long as it has the same sequence or activity as the PhaC protein.

[0055] In one embodiment, the PhaC protein of the present application may comprise, have, consist of, or essentially consist of SEQ ID NO: 7 or an amino acid sequence having 80% or more homology or identity thereto.

[0056] In one embodiment, the amino acid sequence and gene sequence of PhaC can be obtained from, but are not limited to, WO 2014058655 A1.

[0057] In the present application, the poly(3-hydroxyalkanoate) polymerase gene may be used in combination with phaC, a polynucleotide encoding poly(3-hydroxyalkanoate) polymerase, etc. The phaC gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 8, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0058] In this application, pyruvate dehydrogenase is an enzyme capable of catalyzing the reaction in which pyruvate is converted to acetyl-coA; citrate synthase is an enzyme capable of catalyzing the reaction in which oxaloacetate and acetyl-coA are condensed to produce citrate; aconitase is an enzyme capable of catalyzing the reaction in which citrate is converted to isocitrate; isocitrate dehydrogenase is an enzyme capable of catalyzing the reaction in which isocitrate is converted to α-ketoglutarate; α-ketoglutarate dehydrogenase is an enzyme capable of catalyzing the reaction in which α-ketoglutarate is converted to succinyl-coA; succinyl-coA synthetase By succinyl-coA synthetase is meant an enzyme capable of catalyzing the reaction in which succinyl-coA is converted to succinate; and by pyruvate carboxylase is meant an enzyme capable of catalyzing the reaction in which pyruvate is converted to oxaloacetate.

[0059] The pyruvate dehydrogenase or pyruvate carboxylase may be an enzyme involved in the TCA pathway, may be endogenous to the microorganism or production method, or may be an enzyme that has been enhanced compared to the wild-type enzyme.

[0060] In this application, "pyruvate kinase" refers to an enzyme that can catalyze the reaction in which phosphoenolpyruvate (PEP) is converted to pyruvate. The above-mentioned pyruvate kinase may be referred to interchangeably with Pyk.

[0061] In one embodiment, the Pyk protein of the present application may be endogenous or derived from the genus Escherichia, Escherichia coli, and is included in Pyk as long as it has the same sequence or activity as the Pyk protein.

[0062] In one embodiment, the Pyk protein of the present application may be an attenuated version, as long as it has the same sequence or activity as the Pyk protein of the present application. In one embodiment, the Pyk protein of the present application may comprise, have, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 9, SEQ ID NO: 11, or an amino acid sequence having 80% or more homology or identity thereto.

[0063] In the present application, the pyruvate kinase gene may be used interchangeably with polynucleotides encoding pykA, pykF, and pyruvate kinase. The pykA and pykF genes may, for example, comprise the nucleotide sequence of SEQ ID NO: 10 or SEQ ID NO: 12, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but are not limited thereto.

[0064] In this application, "phosphoenolpyruvate carboxylase (PEP carboxylase)" refers to an enzyme that catalyzes the reaction in which phosphoenolpyruvate is converted to oxaloacetate. The above-mentioned phosphoenolpyruvate carboxylase may be referred to as PPC.

[0065] In one embodiment, the PPC protein of the present application may be endogenous or derived from the genus Escherichia, Escherichia coli, and is included in the PPC as long as it has the same sequence or activity as the PPC protein.

[0066] In one embodiment, the PPC protein of the present application may be an enhanced version and be included in PPC as long as it has the same sequence or activity as the PPC protein of the present application. In one embodiment, the PPC protein of the present application may comprise, have, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 13 or an amino acid sequence having 80% or more homology or identity thereto.

[0067] In the present application, the term "phosphoenolpyruvate carboxylase gene" may be used interchangeably with "ppc" and a polynucleotide encoding phosphoenolpyruvate carboxylase. The ppc gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 14, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0068] In one embodiment, the microorganism of the present application may be capable of producing poly-4-hydroxybutyrate even under conditions limited by one or more nutrients selected from the group consisting of nitrogen, sulfur, phosphorus, and magnesium, and may particularly have increased productivity, but is not limited thereto.

[0069] In one embodiment, the microorganism of the present application may further include a promoter that does not inhibit transcription of the phosphoenolpyruvate carboxylase gene (ppc) under nitrogen-, sulfur-, phosphorus-, and / or magnesium-limited conditions. The promoter may be a polynucleotide having promoter activity as set forth in SEQ ID NO: 45, and the target gene of the nucleotide sequence having promoter activity as set forth in SEQ ID NO: 45 may be a polynucleotide encoding phosphoenolpyruvate carboxylase. When a promoter that does not inhibit ppc transcription under nitrogen-limited conditions is used, production of poly-4-hydroxybutyrate and / or 1,4-butanediol can be increased. While ppc expression in existing E. coli is inhibited under nitrogen-limited conditions, a microorganism that uses a promoter that does not inhibit transcription of the phosphoenolpyruvate carboxylase gene (ppc) under nitrogen-limited conditions and has activity equal to or greater than that of the wild-type ppc promoter is effective in producing poly-4-hydroxybutyrate and / or 1,4-butanediol.

[0070] In this application, "carbonic anhydrase" refers to an enzyme that can catalyze the conversion of hydrogen carbonate to carbon dioxide and water. The carbonic anhydrase may be an enzyme that acts as a support for phosphoenolpyruvate carboxylase. For smooth performance of PPC, bicarbonate (HCO3-) must be supplied. The carbonic anhydrase may also be an enzyme that can produce HCO3- from carbon dioxide. The carbonic anhydrase may be used in combination with EcaA.

[0071] In one embodiment, the EcaA protein of the present application may be derived from Nostoc sp., and is included in EcaA as long as it has the same sequence or activity as the EcaA protein of the present application.

[0072] In one embodiment, the EcaA protein of the present application may be an enhanced version, and is included in EcaA as long as it has the same sequence or activity as the EcaA protein of the present application. In one embodiment, the EcaA protein of the present application may comprise, have, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 15 or an amino acid sequence having 80% or more homology or identity thereto.

[0073] In the present application, the carbonic anhydrase gene may be used in combination with a polynucleotide encoding ecaA and carbonic anhydrase, etc. The ecaA gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 16, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0074] In this application, "citrate synthase" refers to an enzyme that can catalyze the condensation of oxaloacetate and acetyl-coA to produce citrate. The citrate synthase may be referred to interchangeably with GltA.

[0075] In one embodiment, the GltA protein of the present application may be endogenous or derived from the genus Escherichia, Escherichia coli, and is included in GltA as long as it has the same sequence or activity as the GltA protein.

[0076] In one embodiment, the GltA protein of the present application may be a regulated one, and is included in GltA as long as it has the same sequence or activity as SEQ ID NO: 17. In one embodiment, the GltA protein of the present application may comprise, have, consist of, or essentially consist of SEQ ID NO: 17 or an amino acid sequence having 80% or more homology or identity thereto.

[0077] In the present application, the citrate synthase gene may be used in combination with polynucleotides encoding gltA and citrate synthase, etc. The gltA gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 18, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0078] In this application, "pyruvate carboxylase" refers to an enzyme that can catalyze the reaction in which pyruvate and carbon dioxide are converted to oxaloacetate. The pyruvate carboxylase may be used interchangeably with Pyc.

[0079] In one embodiment, the Pyc protein of the present application may be derived from Rhizobium etli, and is included in Pyc as long as it has the same sequence or activity as the Pyc protein.

[0080] In one embodiment, the Pyc protein of the present application may be an enhanced or foreign protein, and may be included in Pyc as long as it has the same sequence or activity as the Pyc protein of the present application. In one embodiment, the Pyc protein of the present application may comprise, have, consist of, or essentially consist of the amino acid sequence set forth in SEQ ID NO: 19 or an amino acid sequence having 80% or more homology or identity thereto.

[0081] In the present application, the pyruvate carboxylase gene may be used interchangeably with polynucleotides encoding pyc and pyruvate carboxylase. The pyc gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 20, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0082] In this application, "NAD + NAD-dependent malate dehydrogenase (NAD + NAD-dependent malate dehydrogenase is an enzyme that can catalyze the reaction of converting malate to pyruvate. + Dependent malate dehydrogenase can be conflated with MaeA.

[0083] In one embodiment, the MaeA protein of the present application may be endogenous or derived from the genus Escherichia, Escherichia coli, and is included in MaeA as long as it has the same sequence or activity as the MaeA protein.

[0084] In one embodiment, the MaeA protein of the present application may be an attenuated version, as long as it has the same sequence or activity as the MaeA protein. In one embodiment, the MaeA protein of the present application may comprise, have, consist of, or essentially consist of the amino acid sequence set forth in SEQ ID NO: 21 or an amino acid sequence having 80% or more homology or identity thereto.

[0085] In this application, NAD + The malate dehydrogenase genes are maeA and NAD + The maeA gene may be used in combination with a polynucleotide encoding a nucleotide-dependent malate dehydrogenase. The maeA gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 22, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0086] In this application, "NADP + Dependent malate dehydrogenase (NADP + NADP-dependent malate dehydrogenase is an enzyme that can catalyze the reaction of converting malate to pyruvate. + Dependent malate dehydrogenase can be mixed with MaeB.

[0087] In one embodiment, the MaeB protein of the present application may be endogenous or derived from the genus Escherichia, Escherichia coli, and is included in MaeB as long as it has the same sequence or activity as the MaeB protein.

[0088] In one embodiment, the MaeB protein of the present application may be an attenuated version, as long as it has the same sequence or activity as the MaeB protein. In one embodiment, the MaeB protein of the present application may comprise, have, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 23 or an amino acid sequence having 80% or more homology or identity thereto.

[0089] In this application, NADP + The malate dehydrogenase genes are maeB and NADP +The maeB gene may be used in combination with a polynucleotide encoding a malate dehydrogenase-dependent malate dehydrogenase. The maeB gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 24, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0090] In this application, the term "phosphogluconate dehydratase" refers to an enzyme that catalyzes the conversion of 6-phospho-D-gluconate to 2-dehydro-3-deoxy-6-phospho-D-gluconate. The above-mentioned phosphogluconate dehydratase may be used in combination with an EDD.

[0091] In one embodiment, the EDD protein of the present application may be endogenous or derived from the genus Escherichia, Escherichia coli, and is included in the EDD as long as it has the same sequence or activity as the EDD protein.

[0092] In one embodiment, the EDD protein of the present application may be an attenuated version, and is included in the EDD as long as it has the same sequence or activity as the EDD. In one embodiment, the EDD protein of the present application may comprise, have, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 25 or an amino acid sequence having 80% or more homology or identity thereto.

[0093] In the present application, the phosphogluconate dehydratase gene may be used in combination with a polynucleotide encoding edd and phosphogluconate dehydratase, etc. The edd gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 26, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0094] In this application, "2-keto-4-hydroxyglutarate:2-keto-3-deoxygluconate 6-phosphate aldolase (KHG / KDPG aldolase)" is an enzyme that can catalyze the conversion of 4-hydroxy-2-oxoglutarate to glyceraldehyde-3-phosphate and pyruvate. The above-mentioned phosphogluconate dehydratase can be used in combination with KHG / KDPG aldolase, Eda.

[0095] In one embodiment, the Eda protein of the present application may be endogenous or derived from the genus Escherichia, Escherichia coli, and is included in Eda as long as it has the same sequence or activity as the Eda protein.

[0096] In one embodiment, the Eda protein of the present application may be an attenuated version, as long as it has the same sequence or activity as the Eda protein. In one embodiment, the Eda protein of the present application may comprise, have, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 27 or an amino acid sequence having 80% or more homology or identity thereto.

[0097] In the present application, the KHG / KDPG aldolase gene may be used in combination with a polynucleotide encoding eda and KHG / KDPG aldolase. The eda gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 28, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0098] In this application, "aspartate aminotransferase" refers to an enzyme that can catalyze the reaction of converting 2-oxoglutarate and aspartate to glutamate and oxaloacetate. The above aspartate aminotransferase may be referred to interchangeably as AspC.

[0099] In one embodiment, the AspC protein of the present application may be endogenous or derived from the genus Escherichia, Escherichia coli, and is included in the AspC as long as it has the same sequence or activity as the AspC protein.

[0100] In one embodiment, the AspC protein of the present application may be an attenuated version, as long as it has the same sequence or activity as the AspC protein. In one embodiment, the AspC protein of the present application may comprise, have, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 29 or an amino acid sequence having 80% or more homology or identity thereto.

[0101] In the present application, the aspartate aminotransferase gene may be used interchangeably with aspC, a polynucleotide encoding aspartate aminotransferase, etc. The aspC gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 30, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0102] In this application, a "glucose-specific PTS enzyme IIBC component" refers to a portion of a PTS, an enzyme involved in glucose transport. In one embodiment, the glucose-specific PTS enzyme IIBC component can increase the phosphoenolpyruvate pool and enhance the reduced TCA pathway. The glucose-specific PTS enzyme IIBC component can be used in combination with IIBC.

[0103] In one embodiment, the IIBC protein of the present application may be endogenous or derived from the genus Escherichia, Escherichia coli, and is included in the IIBC as long as it has the same sequence or activity as the IIBC protein.

[0104] In one embodiment, the IIBC protein of the present application may be an attenuated version, and is included in IIBC as long as it has the same sequence or activity as the IIBC protein of the present application. In one embodiment, the IIBC protein of the present application may comprise, have, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 31 or an amino acid sequence having 80% or more homology or identity thereto.

[0105] In the present application, the glucose-specific PTS enzyme IIBC component gene may be used in combination with ptsG, a polynucleotide encoding a glucose-specific PTS enzyme IIBC component, etc. The ptsG gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 32, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0106] In this application, a "bicarbonate transporter" refers to a carrier that transports bicarbonate and increases the influx of carbon dioxide into cells. The bicarbonate transporter may be referred to as SbtA.

[0107] In one embodiment, the SbtA protein of the present application may be derived from Synechocystis sp., and is included in SbtA as long as it has the same sequence or activity as the SbtA protein.

[0108] In one embodiment, the SbtA protein of the present application may be enhanced, foreign, or derived from cyanobacteria, but is included in the SbtA as long as it has the same sequence or activity as the SbtA protein. In one embodiment, the SbtA protein of the present application may comprise, have, consist of, or essentially consist of SEQ ID NO: 33 or an amino acid sequence having 80% or more homology or identity thereto.

[0109] In the present application, the SbtA gene may be used interchangeably with sbtA, a polynucleotide encoding a bicarbonate transporter, etc. The sbtA gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 34, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0110] In this application, "isocitrate dehydrogenase" refers to an enzyme that can catalyze the reaction of converting isocitrate to 2-oxoglutarate. The above isocitrate dehydrogenase may be used interchangeably with Icd.

[0111] In one embodiment, the Icd protein of the present application may be endogenous or derived from the genus Escherichia, Escherichia coli, and is included in Icd as long as it has the same sequence or activity as the Icd protein.

[0112] In one embodiment, the Icd protein of the present application may be attenuated, but is included in Icd as long as it has the same sequence or activity as the Icd protein. In one embodiment, the Icd protein of the present application may comprise, have, consist of, or essentially consist of SEQ ID NO: 35 or an amino acid sequence having 80% or more homology or identity thereto.

[0113] In the present application, the Icd gene may be used interchangeably with icd, a polynucleotide encoding isocitrate dehydrogenase, etc. The icd gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 36, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0114] In this application, "isocitrate lyase" refers to an enzyme that can catalyze the reaction of converting isocitrate to glyoxylate and succinate. The above isocitrate lyase may be referred to interchangeably with AceA.

[0115] In one embodiment, the AceA protein of the present application may be endogenous or derived from the genus Escherichia, Escherichia coli, and is included in AceA as long as it has the same sequence or activity as the AceA protein.

[0116] In one embodiment, the AceA protein of the present application may be an enhanced version, but is included in AceA as long as it has the same sequence or activity as SEQ ID NO: 37. In one embodiment, the AceA protein of the present application may comprise, have, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 37 or an amino acid sequence having 80% or more homology or identity thereto.

[0117] In the present application, the AceA gene may be used interchangeably with a polynucleotide encoding aceA, isocitrate lyase, etc. The aceA gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 38, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0118] In this application, "isocitrate dehydrogenase kinase / phosphatase" refers to an enzyme that can catalyze the phosphorylation or dephosphorylation of isocitrate dehydrogenase. In one embodiment, the isocitrate dehydrogenase kinase / phosphatase can attenuate Icd, and the isocitrate dehydrogenase kinase / phosphatase can be used in combination with AceK.

[0119] In one embodiment, the AceK protein of the present application may be endogenous or derived from the genus Escherichia, Escherichia coli, and is included in AceK as long as it has the same sequence or activity as the AceK protein.

[0120] In one embodiment, the AceK protein of the present application may be an enhanced version, but is included in the AceK as long as it has the same sequence or activity as the AceK protein of the present application. In one embodiment, the AceK protein of the present application may comprise, have, consist of, or essentially consist of SEQ ID NO: 39, or an amino acid sequence having 80% or more homology or identity thereto.

[0121] In the present application, the AceK gene may be used interchangeably with a polynucleotide encoding aceK, isocitrate dehydrogenase kinase / phosphatase, etc. The aceK gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 40, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0122] In this application, "malate synthase G" refers to an enzyme that can catalyze the reaction of converting glyoxylate and acetyl-coA to malate. The malate synthase G may be used in combination with GlcB.

[0123] In one embodiment, the GlcB protein of the present application may be endogenous or derived from the genus Escherichia, Escherichia coli, and is included in GlcB as long as it has the same sequence or activity as the GlcB protein.

[0124] In one embodiment, the GlcB protein of the present application may be an enhanced version, but is included in GlcB as long as it has the same sequence or activity as SEQ ID NO: 41. In one embodiment, the GlcB protein of the present application may comprise, have, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 41 or an amino acid sequence having 80% or more homology or identity thereto.

[0125] In the present application, the term "GlcB gene" may be used interchangeably with other polynucleotides such as those encoding glcB and malate synthase G. The glcB gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 42, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0126] In this application, "malate synthase A" refers to an enzyme that can catalyze the reaction of converting glyoxylate and acetyl-coA to malate. The malate synthase A may be used interchangeably with AceB.

[0127] In one embodiment, the AceB protein of the present application may be endogenous or derived from the genus Escherichia, Escherichia coli, and is included in AceB as long as it has the same sequence or activity as the AceB protein.

[0128] In one embodiment, the AceB protein of the present application may be an enhanced version, but is included in AceB as long as it has the same sequence or activity as SEQ ID NO: 43. In one embodiment, the AceB protein of the present application may comprise, have, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 43 or an amino acid sequence having 80% or more homology or identity thereto.

[0129] In the present application, the AceB gene may be used interchangeably with a polynucleotide encoding aceB or malate synthase A. The aceB gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 44, or may consist of a nucleotide sequence having 80% or more homology or identity thereto, but is not limited thereto.

[0130] The amino acid sequences of the enzymes (eg, SucD, etc.) can be obtained from various publicly known databases, such as GenBank of NCBI, but are not limited thereto.

[0131] Although the present application refers to a "polypeptide or protein comprising an amino acid sequence set forth in a specific SEQ ID NO," "a polypeptide or protein consisting of an amino acid sequence set forth in a specific SEQ ID NO," or "a polypeptide or protein having an amino acid sequence set forth in a specific SEQ ID NO," it is clear that proteins having an amino acid sequence in which a portion of the sequence has been deleted, modified, substituted, conservatively substituted, or added are also used in the present application, so long as they have the same or corresponding activity as a polypeptide consisting of the amino acid sequence of the SEQ ID NO. For example, proteins having an addition of a sequence that does not change the function of the protein at the N-terminus, internally, and / or C-terminus of the above amino acid sequence, a naturally occurring mutation, a silent mutation, or a conservative substitution thereof.

[0132] Specifically, the protein of the present application may comprise an amino acid sequence of a specific SEQ ID NO, or an amino acid sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology or identity to the amino acid sequence of a specific SEQ ID NO. It is also clear that the scope of the present application includes amino acid sequences with partial deletions, modifications, substitutions, or additions, as long as the amino acid sequence has the above homology or identity and exhibits the efficacy corresponding to the protein.

[0133] The term "conservative substitution" refers to the substitution of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions are generally made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions have little or no effect on the activity of a polypeptide.

[0134] As used herein, the terms "homology" or "identity" refer to the degree of identity or similarity between two given amino acid or nucleotide sequences, and can be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0135] Sequence homology or identity of conserved polynucleotides or polypeptides can be determined using standard sequence algorithms, with default gap penalties established by the program used. Substantially homologous or identical sequences generally hybridize to the entire sequence or at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence under moderately or highly stringent conditions. Hybridization obviously includes hybridization to polynucleotides containing common codons or codons that take codon degeneracy into account.

[0136] Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]:2444. Alternatively, it can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453), as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (version 5.0.0 or later), as implemented in the GCG program package (Devereux, J., et al., Nucleic Acids Research 12:387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.] [ET AL, J MOLEC BIOL 215]:403 (1990); Guide to Huge Computers, Martin J. Bishop, [Ed.] Academic Press, San Diego, 1994, and [CARILLO ETA / .] (1988) SIAM J Applied Math 48:1073. For example, BLAST from the National Database Center for Biotechnology Information, or ClustalW can be used to determine homology, similarity, or identity.

[0137] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information using the GAP computer program, e.g., as known in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or as described in, e.g., Needleman et al. (1970), J Mol Biol. 48:443. Briefly, the GAP program defines a match as the total number of symbols in the shorter of the two sequences divided by the number of similar aligned symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include: (1) a binary comparison matrix (containing a value of 1 for identity and 0 for non-identity) and the weighted comparison matrix of Gribskov et al. (1986) Nucl. Acids Res. 14:6745 (or the EDNAFULL (the EMBOSS version of NCBI NUC4.4) substitution matrix) as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap open penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.

[0138] Furthermore, whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be confirmed by comparing the sequences in a Southern hybridization experiment under defined stringent conditions. Suitable defined hybridization conditions are within the skill of the art and can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York). The sequences of the genes (eg, sucD) of the present application can be obtained from various databases, including, but not limited to, GenBank of NCBI, which is a publicly known database.

[0139] As examples, the sucD gene from Clostridium kleiberi is SEQ ID NO: 2; the 4hbD gene from Arabidopsis thaliana is SEQ ID NO: 4; the orfZ gene from Clostridium kleiberi is SEQ ID NO: 6; the poly(3-hydroxyalkanoate) polymerase fusion protein phaC3 / C1 gene from Pseudomonas putida / Rustonia eutropha is SEQ ID NO: 8; and pykA, pykF, ppc, gltA, maeA, and maeB from Escherichia coli. The edd, eda, ptsG, icd, aceA, aceK, glcB, and aceB genes may comprise, have, or consist of the nucleotide sequences of SEQ ID NOs: 10, 12, 14, 18, 22, 24, 26, 28, 30, 32, 36, 38, 40, 42, and 44, respectively; the ecaA gene from Nostoc genus may comprise, have, or consist of the nucleotide sequences of SEQ ID NO: 16; the pyc gene from Rhizobium etori genus may comprise, have, or consist of the nucleotide sequences of SEQ ID NO: 34, but are not limited thereto.

[0140] In one embodiment, the gene of the present application may be codon-optimized to be suitable for Escherichia or Corynebacterium microorganisms, but is not limited thereto.

[0141] In this application, the term "polynucleotide" refers to a nucleotide polymer in which nucleotide units are linked in a long chain by covalent bonds, and is a DNA chain of a certain length or more.

[0142] The polynucleotide or gene of the present application may have various modifications in the coding region within a range that does not change the amino acid sequence of the polypeptide, taking into consideration codon degeneracy or codons preferred in an organism in which a particular polypeptide is to be expressed. The polynucleotide or gene may, for example, comprise the nucleotide sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, and / or 44, or may consist of a nucleotide sequence that is 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homologous or identical thereto, but is not limited thereto.

[0143] Furthermore, the polynucleotides or genes of the present application may include, without limitation, probes prepared from known gene sequences, for example, sequences that hybridize under stringent conditions with a complementary sequence to the entire or partial base sequence of the present application and encode the amino acid sequence of the present application. The term "stringent conditions" refers to conditions that allow specific hybridization between polynucleotides. Such conditions are specifically described in the literature (e.g., J. Sambrook et al., supra). For example, conditions include those under which polynucleotides with high homology or identity of 40% or more, specifically 90% or more, more specifically 95% or more, 96% or more, 97% or more, 98% or more, and even more specifically 99% or more, hybridize with each other, but polynucleotides with lower homology or identity do not hybridize with each other; or those under which washing is performed once, specifically 2 to 3 times, at a salt concentration and temperature equivalent to the washing conditions for conventional Southern hybridization: 60°C, 1X SSC, 0.1% SDS, specifically 60°C, 0.1X SSC, 0.1% SDS, more specifically 68°C, 0.1X SSC, 0.1% SDS.

[0144] Hybridization requires that two nucleic acids have complementary sequences, even though mismatches between bases are possible depending on the stringency of the hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that are capable of hybridizing to one another. For example, with respect to DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Thus, the polynucleotides of the present application can include isolated nucleic acid fragments that are complementary to entire sequences, as well as substantially similar nucleic acid sequences.

[0145] Specifically, polynucleotides having homology or identity can be detected using the hybridization conditions described above, including a hybridization step at a Tm value of 55° C. The Tm value may be, but is not limited to, 60° C., 63° C., or 65° C., and can be appropriately adjusted by those skilled in the art depending on the purpose.

[0146] The appropriate stringency for hybridizing polynucleotides depends on the length of the polynucleotides and the degree of complementation, variables well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

[0147] In the present application, the use of any one or more selected from the group consisting of a microorganism containing a polypeptide, a polynucleotide encoding the polypeptide, or a combination thereof; and a culture thereof may mean, but is not limited to, culturing a microorganism containing the polypeptide, a polynucleotide encoding the polypeptide, or a combination thereof and / or recovering a specific substance (e.g., succinate semialdehyde, 4-hydroxybutyrate, or 4-hydroxybutyryl-coA, etc.) from the cultured microorganism or medium.

[0148] "Attenuation" in the production method of the present application may refer to attenuation of a specific pathway or step, or to attenuation of an enzyme involved in the pathway or step. The term "attenuation" may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduction, and attenuation. Attenuation of the enzyme may involve the decrease, deletion, or inactivation of any one or more selected from the group consisting of the enzyme polypeptide; a microorganism containing the polypeptide, a polynucleotide encoding the polypeptide, a vector containing the polynucleotide, or a combination thereof; and a culture thereof. Because the production method of the present application can utilize a microorganism, "attenuation" in the production method of the present application also includes "attenuation of polypeptide activity."

[0149] "Enhancement" in the production method of the present application may refer to the enhancement of a specific pathway or step, or to the enhancement of an enzyme involved in the pathway or step. The term "enhancement" may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. The enhancement of the enzyme may be the increase, activation, or overexpression of any one or more selected from the group consisting of the enzyme polypeptide; a microorganism containing the polypeptide, a polynucleotide encoding the polypeptide, a vector containing the polynucleotide, or a combination thereof; and a culture thereof. Because the production method of the present application can utilize a microorganism, the term "enhancement" in the production method of the present application also includes the "enhancement" of polypeptide activity.

[0150] In the present application, the term "modulation" may refer to, but is not limited to, the above-mentioned "strengthening" and / or "weakening."

[0151] In the present application, the step (5) of decomposing poly-4-hydroxybutyrate into 1,4-butanediol may be carried out by a chemical method, thermal decomposition, hydrogenation, or a combination thereof, but is not limited thereto as long as poly-4-hydroxybutyrate can be decomposed into 1,4-butanediol.

[0152] Another aspect of the present application provides a microorganism comprising succinate semialdehyde dehydrogenase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, and poly(3-hydroxyalkanoate) polymerase polypeptides, polynucleotides encoding the same, vectors containing the polynucleotides, or combinations thereof.

[0153] The succinate semialdehyde dehydrogenase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, and poly(3-hydroxyalkanoate) polymerase polypeptides, polynucleotides, and vectors described above, as well as the 1,4-butanediol, TCA pathway, reduced TCA pathway, pyruvate dehydrogenase, citrate synthase, aconitase, isocitrate dehydrogenase, α-ketoglutarate dehydrogenase, pyruvate carboxylase, (I) to (XII), (i) to (vi), and related enzymes, are as described in other aspects.

[0154] In the present application, the microorganism preferentially produces poly-4-hydroxybutyrate, which is compatible with the cell, and therefore the microorganism of the present application may have increased poly-4-hydroxybutyrate production ability, and therefore may have further increased 1,4-butanediol production ability. Furthermore, the microorganism of the present application may have increased poly-4-hydroxybutyrate production ability by introducing a gene into the poly-4-hydroxybutyrate production step to activate the reductive TCA pathway using oxaloacetate; a highly productive fermentation process; and / or by recycling carbon dioxide generated from fermentation through the reductive TCA pathway.

[0155] In one embodiment, the microorganism may have enhanced activity of one or more polypeptides selected from the group consisting of succinate semialdehyde dehydrogenase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-coA transferase, and poly(3-hydroxyalkanoate) polymerase:

[0156] In one embodiment, the genes encoding succinate semialdehyde dehydrogenase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, and / or poly(3-hydroxyalkanoate) polymerase may be exogenously introduced, but are not limited thereto.

[0157] As an example, the gene encoding the succinate semialdehyde dehydrogenase and / or 4-hydroxybutyryl-coA transferase may be derived from Clulostridium kluyveri, and the gene encoding 4-hydroxybutyrate dehydrogenase may be derived from Arabidopsis thaliana, but is not limited thereto.

[0158] By way of example, the gene encoding the poly(3-hydroxyalkanoate) polymerase may be derived from, but is not limited to, Pseudomonas putida or Ralstonia eutropha.

[0159] In one embodiment, the microorganism may comprise a TCA pathway.

[0160] In one embodiment, the microorganism may include, but is not limited to, one or more polypeptides selected from the group consisting of pyruvate dehydrogenase, citrate synthase, aconitase, isocitrate dehydrogenase, α-ketoglutarate dehydrogenase, and pyruvate carboxylase, polynucleotides encoding the same, or combinations thereof.

[0161] In one embodiment, the microorganism of the present application may comprise or be enhanced in a reduced TCA pathway.

[0162] In one embodiment, the microorganism of the present application may include, but is not limited to, any one or more selected from the group consisting of the following (I) to (XII): (I) pyruvate kinase weakening; (II) phosphoenolpyruvate carboxylase enhancement; (III) carbonic anhydrase enhancement; (IV) citrate synthase regulation; (V) pyruvate carboxylase enhancement; (VI)NAD + Dependent malate dehydrogenase weakening; (VII)NADP + Dependent malate dehydrogenase weakening; (VIII) phosphogluconate dehydratase attenuation; (IX) 2-keto-4-hydroxyglutarate KDPG: 2-keto-3-deoxygluconate 6-phosphate aldolase weakened; (X) aspartate aminotransferase weakening; (XI) glucose-specific PTS enzyme IIBC component weakening; and (XII) Bicarbonate transporter enhancement

[0163] In one embodiment, the microorganism of the present application has (II) enhanced phosphoenolpyruvate carboxylase; (VI)NAD +Dependent malate dehydrogenase weakening; (VII)NADP + Dependent malate dehydrogenase attenuation; and / or (X) Aspartate aminotransferase may be weakened.

[0164] In one embodiment, the microorganism of the present application may include (II) an enhancement of phosphoenolpyruvate carboxylase.

[0165] In one embodiment, the microorganism of the present application is (VI) NAD + Dependent malate dehydrogenase attenuation and (VII)NADP + Dependent malate dehydrogenase attenuation may also be included.

[0166] In one embodiment, the microorganism of the present application may comprise an attenuated (X) aspartate aminotransferase.

[0167] In one embodiment, the gene encoding the pyruvate carboxylase may be a foreign gene, specifically, but not limited to, derived from Rhizobium etli.

[0168] In one embodiment, the regulation of citrate synthase may be, but is not limited to, through genetic mutation.

[0169] In one embodiment, the microorganisms of the present application may comprise or be enhanced in a glyoxylate pathway.

[0170] In one embodiment, the microorganism of the present application may include, but is not limited to, any one or more selected from the group consisting of the following (i) to (vi): (i) citrate synthase enhancement; (ii) isocitrate dehydrogenase attenuation; (iii) isocitrate lyase enhancement; (iv) isocitrate dehydrogenase kinase / phosphatase enhancement; (v) malate synthase G enhancement; and (vi) Malate synthase A enrichment.

[0171] The succinate semialdehyde dehydrogenase and the like are as described in other embodiments.

[0172] In one embodiment, the microorganism of the present application may be capable of producing poly-4-hydroxybutyrate even under conditions limited by one or more nutrients selected from the group consisting of nitrogen, sulfur, phosphorus, and magnesium, but is not limited thereto.

[0173] In one embodiment, the microorganism of the present application may be one in which transcription of the phosphoenolpyruvate carboxylase gene (ppc) is not inhibited under one or more limiting conditions selected from the group consisting of nitrogen, sulfur, phosphorus, and magnesium, but is not limited thereto.

[0174] In one embodiment, the microorganism of the present application may maintain or not decrease its ability to produce poly-4-hydroxybutyrate even under conditions where one or more nutrients selected from the group consisting of nitrogen, phosphorus, sulfur, and magnesium are limited, compared to conditions where the nutrients are not limited, but is not limited thereto.

[0175] In one embodiment, a microorganism containing or enriched in a polypeptide of interest (e.g., SucD, PhaC, OrfZ) in this application may contain the polypeptide of interest, a polynucleotide encoding the polypeptide, or a vector containing the polypeptide.

[0176] The vector of the present application can comprise a DNA construct comprising a base sequence of a polynucleotide encoding a polypeptide of interest operably linked to an expression control region (or expression control sequence) suitable for expressing the polypeptide of interest in a suitable host. The expression control region can comprise a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating the termination of transcription and translation. After being transformed into an appropriate host cell, the vector can replicate and function independently of the host genome, or can be integrated into the genome itself.

[0177] The vectors used in the present application are not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include naturally occurring or recombinant plasmids, cosmids, viruses, and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage or cosmid vectors, and pDZ, pBR, pUC, pBluescriptII, pGEM, pTZ, pCL, and pET can be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2 (Korean Patent Publication No. 10-2020-0136813), pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pIMR53 vectors, etc. can be used.

[0178] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome using a vector for intracellular chromosomal insertion. The polynucleotide can be inserted into a chromosome by any method known in the art, including, but not limited to, homologous recombination. A selection marker for confirming the presence or absence of the chromosomal insertion can also be included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the presence or absence of the target nucleic acid molecule. A marker that confers a selectable phenotype, such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of a surface polypeptide, is used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypes, allowing the selection of transformed cells.

[0179] As used herein, the term "transformation" refers to the introduction of a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism, thereby enabling the expression of the polypeptide encoded by the polynucleotide in the host cell. A transformed polynucleotide can include any polynucleotide that can be expressed in the host cell, regardless of whether it is located intrachromosomally or extrachromosomally. The polynucleotide also includes DNA and / or RNA encoding the target polypeptide. The polynucleotide can be introduced in any form that can be introduced and expressed in the host cell. For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette typically contains a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal operably linked to the polynucleotide. The expression cassette may be in the form of an expression vector capable of self-replication. The polynucleotide may also be introduced into the host cell in its own form and operably linked to sequences necessary for expression in the host cell, but is not limited thereto.

[0180] In addition, the term "operably linked" as used above means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target polypeptide of the present application.

[0181] In one embodiment, a microorganism containing the succinate semialdehyde dehydrogenase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, and poly(3-hydroxyalkanoate) polymerase polypeptides of the present application, polynucleotides encoding the same, vectors containing the polynucleotides, or combinations thereof may have enhanced succinate semialdehyde dehydrogenase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, and poly(3-hydroxyalkanoate) polymerase activities compared to a microorganism not containing these polypeptides, but is not limited thereto.

[0182] In this application, the term "microorganism" or "strain" includes all wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification, and may also include microorganisms in which a specific mechanism has been enhanced by inserting an exogenous gene or enhancing the activity of an endogenous gene.

[0183] In one embodiment, the microorganism of the present application may be a microorganism of the genus Escherichia or the genus Corynebacterium, specifically, Escherichia coli or Corynebacterium glutamicum, but is not limited thereto.

[0184] The microorganism of the present application may be used for producing poly-4-hydroxybutyrate, and the poly-4-hydroxybutyrate produced therefrom produces 1,4-butanediol through a chemical process, and the microorganism of the present application can be used for producing 1,4-butanediol, but is not limited thereto.

[0185] The microorganisms of the present application may be, but are not limited to, microorganisms containing one or more of the polypeptides to be enhanced or introduced in the present application (e.g., SucD, 4HbD, OrfZ, PhaC, PPC, EcaA, Glta, Pyc, AceK, and / or AceA, etc.), polynucleotides encoding the same, or vectors containing the polynucleotides; microorganisms that have been modified to express the polypeptides or genes to be enhanced or introduced in the present application; microorganisms that express the polypeptides or genes to be enhanced or introduced in the present application; microorganisms that have the activity of the polypeptides or genes of the present application; microorganisms that have been modified to attenuate the polypeptides to be attenuated in the present application (e.g., Pyk, GltA, MaeA, MaeB, Edd, Eda, and / or AspC, etc.); and / or microorganisms (e.g., recombinant strains) in which the polypeptides or genes to be attenuated in the present application or their activity have been attenuated.

[0186] The microorganism of the present application may be, but is not limited to, a microorganism that naturally has the ability to produce the polypeptide of the present application (e.g., SucD, MaeA, etc.), 1,4-butanediol, and / or poly-4-hydroxybutyrate; or a microorganism to which the polypeptide, gene, polynucleotide, or vector containing the same to be enhanced or introduced of the present application has been introduced into a parent strain that does not have the ability to produce the polypeptide, 1,4-butanediol, and / or poly-4-hydroxybutyrate, or to which the gene or polynucleotide to be attenuated, or its activity has been attenuated, thereby enhancing or attenuating the polypeptide, or enhancing or imparting the ability to produce 1,4-butanediol and / or poly-4-hydroxybutyrate.

[0187] For example, the microorganisms of the present application may include any microorganisms that have been transformed (thereby strengthened, weakened, introduced, etc.) with the polypeptides, genes, polynucleotides, or vectors containing the same of the present application, and are capable of producing 1,4-butanediol and / or poly-4-hydroxybutyrate or have increased production capacity.

[0188] For example, the microorganism of the present application may be a naturally occurring wild-type microorganism or a recombinant microorganism that produces 1,4-butanediol and / or poly-4-hydroxybutyrate, in which the polypeptide of the present application is expressed or attenuated, thereby increasing the ability to produce 1,4-butanediol and / or poly-4-hydroxybutyrate. The recombinant microorganism with increased ability to produce 1,4-butanediol and / or poly-4-hydroxybutyrate may be, but is not limited to, a naturally occurring wild-type microorganism or a microorganism that is not modified with the polypeptide of the present application (i.e., a microorganism containing a wild-type gene, a microorganism in which the gene of the present application has not been enhanced or introduced, or a microorganism in which the gene of the present application has not been attenuated).

[0189] For example, a recombinant microorganism with increased production capacity may have an increased production capacity of 1,4-butanediol and / or poly-4-hydroxybutyrate of at least about 0.001% or at least 0.01% compared to the 1,4-butanediol and / or poly-4-hydroxybutyrate production capacity of the parent strain or unmodified microorganism before mutation, but is not limited thereto as long as it has an increased production capacity compared to the parent strain or unmodified microorganism before mutation. The term "about" refers to a range that includes ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all numerical values ​​in a range that is equal to or similar to the numerical value following the term "about," but is not limited thereto.

[0190] In this application, the term "unaltered microorganism" does not exclude microorganisms containing mutations that may occur naturally in microorganisms, but refers to a wild-type or naturally occurring microorganism itself, or a microorganism before its characteristics are changed due to genetic mutation caused by natural or artificial factors. For example, the unaltered microorganism refers to a microorganism before a polypeptide described herein is expressed, attenuated, or introduced. The term "unaltered microorganism" may be used interchangeably with "pre-altered strain," "pre-altered microorganism," "non-mutated strain," "non-mutated strain," "non-mutated microorganism," or "reference microorganism."

[0191] In the microorganisms of the present application, partial or complete modification of a polynucleotide may be induced by, but is not limited to, (a) homologous recombination using a vector for chromosomal insertion into the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals, such as ultraviolet light and radiation. Methods for partial or complete modification of the gene may include DNA recombination techniques. For example, a nucleotide sequence or vector containing a nucleotide sequence homologous to the target gene is injected into the microorganism, causing homologous recombination, resulting in partial or complete deletion of the gene. The injected nucleotide sequence or vector may contain, but is not limited to, a dominant selectable marker.

[0192] In the present application, the term "attenuation" of a polypeptide activity refers to a concept that includes both a decrease in activity compared to the endogenous activity and no activity. The term "attenuation" may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.

[0193] The attenuation can also include cases where the activity of a polypeptide itself is reduced or eliminated compared to the activity of the polypeptide originally possessed by the microorganism due to, for example, a mutation in the polynucleotide encoding the polypeptide; cases where the overall level and / or concentration (expression level) of polypeptide activity in the cell is lower than that of a wild-type strain due to, for example, inhibition of gene expression or translation of the encoding polynucleotide into a polypeptide; cases where the polynucleotide is not expressed at all; and / or cases where the polynucleotide is expressed but the polypeptide activity is absent. The term "endogenous activity" refers to the activity of a specific polypeptide originally possessed by a parent strain, wild-type, or untransformed microorganism before transformation, in cases where a trait is changed due to genetic mutation caused by natural or artificial factors. This term may be used interchangeably with "activity before transformation." The term "inactivation, deficiency, reduction, down-regulation, decrease, or attenuation" of a polypeptide activity compared to its endogenous activity means that the activity of a specific polypeptide is lower than that originally possessed by the parent strain or untransformed microorganism before transformation.

[0194] The activity of such a polypeptide can be attenuated by any method known in the art, including, but not limited to, by applying a variety of methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014; 15(2): 2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).

[0195] Specifically, the attenuation of the activity of the polypeptide of the present application is 1) Deletion of all or part of the gene encoding the polypeptide; 2) modification of the expression control region (or expression control sequence) so that expression of the gene encoding the polypeptide is reduced; 3) modification of the amino acid sequence constituting the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence) so as to eliminate or weaken the activity of the polypeptide; 4) modification of the gene sequence encoding the polypeptide so as to eliminate or attenuate the activity of the polypeptide (e.g., deletion / substitution / addition of one or more nucleic acid bases in the nucleic acid base sequence of the polypeptide gene so as to encode a polypeptide altered so as to eliminate or attenuate the activity of the polypeptide); 5) a modification of the nucleotide sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide; 6) introduction of antisense oligonucleotides (e.g., antisense RNA) that are complementary to and bind to the transcripts of the above-mentioned genes encoding the polypeptides; 7) Addition of a sequence complementary to the Shine-Dalgarno sequence to the front end of a gene encoding a polypeptide in order to form a secondary structure to which ribosomes cannot attach; 8) Addition of a promoter that transcribes in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (reverse transcription engineering, RTE); or 9) It may be a combination of two or more selected from the above 1) to 8), but is not particularly limited thereto.

[0196] for example, The deletion of a part or the whole of the gene encoding the polypeptide (1) above may be removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide lacking some nucleotides, or replacement with a marker gene.

[0197] Furthermore, the above-mentioned 2) modification of the expression regulatory region (or expression regulatory sequence) may be mutation of the expression regulatory region (or expression regulatory sequence) by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or replacement with a sequence having weaker activity. The expression regulatory region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0198] Furthermore, the above 5) modification of the base sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another start codon that has a lower polypeptide expression rate than the endogenous start codon, but is not limited thereto.

[0199] Furthermore, the modifications of the amino acid sequence or polynucleotide sequence in 3) and 4) above may include, but are not limited to, mutations in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to attenuate the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence that has been improved to have even weaker activity or to have no activity. For example, but not limited to, introducing a mutation into the polynucleotide sequence to form a stop codon can inhibit or attenuate gene expression.

[0200] Introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the polypeptide (6) above can be carried out by referring to, for example, the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].

[0201] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence to the front end of a gene encoding a polypeptide to form a secondary structure that prevents ribosome attachment may disable or slow down mRNA translation.

[0202] 8) Addition of a promoter that transcribes in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (reverse transcription engineering, RTE) may also be used to create an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide, thereby attenuating its activity.

[0203] As used herein, the term "enhancement" of polypeptide activity refers to an increase in polypeptide activity compared to its endogenous activity. The term "enhancement" may be used interchangeably with terms such as "activation," "up-regulation," "overexpression," and "increase." Here, activation, enhancement, up-regulation, overexpression, and increase can all encompass the display of an activity not inherently possessed, or the display of an activity that is improved compared to the endogenous activity or the activity prior to transformation. The term "endogenous activity" refers to the activity of a specific polypeptide inherently possessed by a parent strain or an unaltered microorganism prior to transformation, in cases where a trait is altered due to genetic mutation caused by natural or artificial factors. This term may be used interchangeably with "activity prior to transformation." "Enhancement," "up-regulation," "overexpression," or "increase" of a polypeptide activity compared to its endogenous activity refers to an improvement in the activity and / or concentration (expression level) of a specific polypeptide relative to the activity of a parent strain or an unaltered microorganism prior to transformation.

[0204] The enhancement can be achieved by introducing an exogenous polypeptide or by enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. The enhancement of the activity of the polypeptide can be confirmed by an increase in the activity level, expression level, or amount of a product secreted from the polypeptide.

[0205] The activity of the polypeptide can be enhanced by various methods well known in the art, and is not limited thereto, as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before transformation. Specifically, the enhancement may be achieved by using genetic engineering and / or protein engineering, which are routine methods in molecular biology and well known to those skilled in the art, but is not limited thereto (e.g., Sitnicka et al., Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2, 1-16; Sambrook et al., Molecular Cloning 2012, etc.).

[0206] Specifically, the enhancement of the polypeptide activity of the present application is 1) an increase in the intracellular copy number of the polynucleotide encoding the polypeptide; 2) replacing the expression regulatory region of a gene on a chromosome that encodes a polypeptide with a sequence with strong activity; 3) a modification of the nucleotide sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide; 4) modifying the amino acid sequence of the polypeptide so that the polypeptide activity is enhanced; 5) modifying a polynucleotide sequence encoding the polypeptide so as to enhance the polypeptide's activity (e.g., modifying the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the polypeptide's activity); 6) introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same; 7) codon optimization of the polynucleotide encoding the polypeptide; 8) analyzing the tertiary structure of a polypeptide and selectively modifying or chemically modifying exposed sites; or 9) It may be a combination of two or more selected from the above 1) to 8), but is not particularly limited thereto.

[0207] More specifically, The above-mentioned 1) increase in the intracellular copy number of a polynucleotide encoding a polypeptide may be achieved by introducing into a host cell a vector operably linked to the polynucleotide encoding the polypeptide, which is capable of replicating and functioning independently of the host. Alternatively, it may be achieved by introducing one or more copies of the polynucleotide encoding the polypeptide into a chromosome in the host cell. The introduction into a chromosome can be achieved by, but is not limited to, introducing into the host cell a vector that inserts the polynucleotide into a chromosome of the host cell. The vector is as described above.

[0208] The replacement of the expression regulatory region (or expression regulatory sequence) of a gene on a chromosome encoding a polypeptide with a sequence having a stronger activity may involve, for example, mutation of the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of the expression regulatory region, or replacement with a sequence having a stronger activity. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. For example, the original promoter may be replaced with a strong promoter, but this is not limiting.

[0209] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (U.S. Pat. No. 7,662,943), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (U.S. Pat. No. 10,584,338), O2 promoter (U.S. Pat. No. 10,273,491), tkt promoter, and yccA promoter.

[0210] The modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide (3) above may be, for example, substituting a nucleotide sequence encoding another start codon that has a higher polypeptide expression rate than the endogenous start codon, but is not limited thereto.

[0211] The modification of the amino acid sequence or polynucleotide sequence in 4) and 5) above may be, but is not limited to, a mutation in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to enhance the activity of the polypeptide, or a replacement with an improved amino acid sequence or polynucleotide sequence that has been modified to have stronger activity or to increase activity. The replacement is specifically, but is not limited to, the insertion of the polynucleotide into a chromosome by homologous recombination. The vector used in this case may further contain a selection marker to confirm the presence or absence of chromosomal insertion. The selection marker is as described above.

[0212] The introduction of an exogenous polynucleotide exhibiting the activity of the polypeptide (6) above may be the introduction of an exogenous polynucleotide encoding a polypeptide exhibiting the same or similar activity as the polypeptide into a host cell. The exogenous polynucleotide is not limited in its origin or sequence, as long as it exhibits the same or similar activity as the polypeptide. The method used for the introduction can be any publicly known transformation method appropriately selected by those skilled in the art, and the introduced polynucleotide can be expressed in the host cell to produce the polypeptide and increase its activity.

[0213] The codon optimization of the polynucleotide encoding the polypeptide (7) above may be codon optimization of an endogenous polynucleotide to increase transcription or translation in a host cell, or codon optimization of an exogenous polynucleotide to optimize transcription or translation in a host cell.

[0214] The above 8) analyzing the tertiary structure of a polypeptide and selecting and modifying or chemically modifying exposed sites may involve, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing sequence information of known proteins, determining candidate template proteins according to the degree of sequence similarity, confirming the structure based on the candidate template proteins, and selecting and modifying exposed sites to be modified or chemically modified.

[0215] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in a wild-type or untransformed microbial strain, or an increase in the amount of a product produced from the polypeptide.

[0216] As used herein, the term "modulation" of a polypeptide activity may refer to, but is not limited to, "enhancing" the polypeptide activity and / or "attenuating" the polypeptide activity. In one embodiment, the activity of GltA may be enhanced or attenuated, but is not limited thereto.

[0217] Another aspect of the present application provides a method for producing poly-4-hydroxybutyrate (poly(4-hydroxybutyrate); P4HB), comprising culturing the microorganism of the present application.

[0218] In this application, the term "poly-4-hydroxybutyrate" refers to a polymer of 4-hydroxybutyrate, a compound belonging to the polyester family. The poly-4-hydroxybutyrate may be mixed with poly-4-hydroxybutanoate (P4HA) and may be represented by, but not limited to, the following chemical formula 1:

[0219] [ka] (n above is an integer of 1 or greater)

[0220] In the present application, the term "culturing" refers to growing the microorganism of the present application under appropriately controlled environmental conditions. In the present application, the culturing process is carried out using an appropriate medium and culture conditions known in the art. Such a culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing may be, but is not limited to, a batch, continuous, and / or fed-batch culture.

[0221] The microorganism of the present application can be cultured in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compounds, amino acids and / or vitamins under aerobic conditions by adjusting the temperature, pH, etc.

[0222] In the culture of the present application, the culture temperature may be maintained at 20 to 35°C, specifically 25 to 35°C or 28 to 35°C, and the culture may be for about 10 to 160 hours, about 20 to 130 hours, about 24 to 120 hours, about 36 to 120 hours, about 48 to 120 hours, about 48 hours, about 72 hours, or about 120 hours, but is not limited thereto.

[0223] The poly-4-hydroxybutyrate produced by the culture of the present application can be secreted into the medium or can remain within the microorganism.

[0224] The method for producing poly-4-hydroxybutyrate of the present application can further include a step of preparing the microorganism of the present application, a step of preparing a medium for culturing the microorganism, or a combination thereof (regardless of the procedure, in any order), for example, before the culturing step.

[0225] The method for producing poly-4-hydroxybutyrate of the present application may further include a step of recovering poly-4-hydroxybutyrate from the culture medium (culture medium) of the microorganism or from the microorganism of the present application. The recovery step may be further included after the culturing step.

[0226] The recovery may involve collecting the target poly-4-hydroxybutyrate using a suitable method known in the art through the microbial culture method of the present application, such as a batch, continuous, or fed-batch culture method. For example, centrifugation, filtration, treatment with a crystallized protein precipitant (salting out), extraction, cell disruption, ultrasonic disruption, ultrafiltration, dialysis, various types of chromatography such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, and affinity chromatography, HPLC, or a combination of these methods may be used, and the target poly-4-hydroxybutyrate can be recovered from the culture medium or the microorganism using a suitable method known in the art.

[0227] Furthermore, the method for producing poly-4-hydroxybutyrate of the present application may further include a purification step. The purification may be carried out using any suitable method known in the art. For example, when the method for producing poly-4-hydroxybutyrate of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be carried out sequentially (or continuously) regardless of the order, simultaneously, or integrated into one step, but are not limited thereto.

[0228] Another aspect of the present application provides a method for producing 1,4-butanediol, including the steps of culturing a microorganism of the present application; recovering poly-4-hydroxybutyrate from the microorganism or the culture medium; and degrading poly-4-hydroxybutyrate to 1,4-butanediol.

[0229] The method for producing 1,4-butanediol of the present application may further include a step of decomposing poly-4-hydroxybutyrate produced by the microorganism of the present application into 1,4-butanediol. In the method for producing 1,4-butanediol of the present application, the decomposition step may be further included after the culturing step or the recovering step. The decomposition step may be carried out using an appropriate method known in the art. In one embodiment, the step of decomposing poly-4-hydroxybutyrate into 1,4-butanediol may be pyrolysis, hydrogenation, or a combination thereof.

[0230] Another aspect of the present application provides a composition for producing poly-4-hydroxybutyrate, comprising the microorganism of the present application or a culture thereof.

[0231] The microorganisms, poly-4-hydroxybutyrate, etc. are as described in other embodiments.

[0232] The compositions of the present application may further contain any suitable excipients that are commonly used, and such excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffers, stabilizers, or isotonic agents, but are not limited thereto.

[0233] Another aspect of the present application provides use of the microorganism or a culture thereof of the present application for producing poly-4-hydroxybutyrate.

[0234] Another aspect of the present application provides use of the microorganism or a culture thereof of the present application for producing 1,4-butanediol.

[0235] The microorganisms, poly-4-hydroxybutyrate, etc. are as described in other embodiments.

[0236] The present application will be described in more detail below with reference to examples. However, the following examples are merely preferred embodiments for illustrating the present application and are not intended to limit the scope of the present application. Meanwhile, technical matters not described in this specification can be fully understood and easily implemented by those of ordinary skill in the technical field of the present application or a similar technical field.

[0237] Example 1: Regulation of phosphoenolpyruvate carboxylase expression and P4HB production using the oxidative TCA pathway 1-1: P4HB production pathway using the oxidative TCA (oTCA) pathway P4HB production was evaluated using glucose in Escherichia coli. Glucose can be oxidized to one phosphoenolpyruvate (PEP), one acetyl-CoA, and carbon dioxide via the phosphotransferase system. PEP can be converted to oxaloacetate by phosphoenolpyruvate carboxylase (PEP carboxylase; PPC), with one carbon dioxide fixation. Acetyl-CoA and oxaloacetate can be oxidized to two carbon dioxides and one succinyl-CoA via citrate. Poly-4-hydroxybutyrate (P4HB) may be produced from succinyl-CoA, an intermediate in this TCA pathway. P4HB is produced from succinyl-CoA by the NADH- or NADPH-dependent succinate semialdehyde dehydrogenase (SucD) to succinyl semialdehyde, which is then converted to 4-hydroxybutyrate (4HB) by the NADH-dependent 4-hydroxybutyric acid dehydrogenase (4HbD), which can then be further converted to 4-hydroxybutyryl-CoA by 4-hydroxybutyryl-CoA transferase (OrfZ). Finally, poly(3-hydroxyalkanoate) polymerase (PhaC) was used to convert 4-hydroxybutyryl-CoA to poly-4-hydroxybutyrate (P4HB).

[0238] The above-mentioned SucD, 4HbD, OrfZ, PhaC, and PPC and their gene sequences are shown in SEQ ID NO:1 to SEQ ID NO:8, SEQ ID NO:13, and SEQ ID NO:14.

[0239] 1-2: Construction of promoter for phosphoenolpyruvate carboxylase expression regulation By limiting the nitrogen source essential for bacterial growth, we were able to suppress bacterial growth and direct carbon flow to the target substance, P4HB, thereby increasing productivity. However, since the promoter of the ppc gene, which encodes phosphoenolpyruvate carboxylase (PEP carboxylase) in E. coli, is inhibited by a regulatory factor (Nac, a DNA-binding transcriptional dual regulator) under nitrogen-limited conditions, we decided to create a promoter to overcome this.

[0240] For this purpose, a promoter was constructed that has expression strength equal to or greater than that of the wild-type promoter (Pn) and is not affected by the regulatory factor Nac. The Pn promoter sequence is as follows:

[0241] 5'-TCGCAGCATTTGACGTCACCGCTTTTACGTGGCTTTATAAAAGACGACGAAAAGCAAAGCCCGAGCATATTCGCGCCAATGCGACGTGAAGGATACAGGGCTATCAAACGATAAGATGGGGTGTCTGGGGTAAT-3' (SEQ ID NO: 60)

[0242] As a result, as shown in Table 1 below, one promoter (Psynk1) with the same strength as Pn and one promoter (PsynK2) with approximately 15 times the strength were identified.

[0243] [Table 1]

[0244] The medium used was M9-minimal medium containing glucose as a carbon source, and the cells were cultured in a 96-well plate at 800 rpm and 37°C for 48 hours, after which the absorbance was measured.

[0245] 1-3: Construction of P4HB-producing strain The three promoters constructed in Example 1-2 were introduced into the microbial strains in which the P4HB biosynthetic pathway of Example 1-1 had been constructed, to construct the following three P4HB-producing microbial strains. The following SucD, 4HbD, OrfZ, PhaC, and PPC genes and their gene sequences are shown in SEQ ID NOs: 1 to 8, 13, and 14.

[0246] [Table 2]

[0247] The promoters used for target gene expression were PuspA, PsynK1, and PsynK2, and gene information for these can be obtained from ecocyc.org and parts.igem.org. The promoter sequences used are as follows:

[0248] - PsynK1 (5'-tttacagctagctcagtcctaggtattatgctagc-3'); SEQ ID NO: 45 - PsynK2 (5'-ctgacagctagctcagtcctaggtataatgctagc-3'); SEQ ID NO: 46 PuspA (5'-AACCACTATCAATATATTCATGTCGAAAATTTGTTTATCTAACGAGTAAGCAAGGCGGATTGACGGATCATCCGGGTCGCTATAAGGTATAGTTCGCAGG ACGCGGGTGACGTAACGGCACAAGAAACG-3'); SEQ ID NO: 47

[0249] To construct the microorganisms carrying the P4HB biosynthetic pathway, commonly used techniques were used (representative reference: Sambrook et al., Molecular cloning: A Laboratory Manual, Third Ed., Cold Spring Harbor Laboratory, New York (2001)). Specifically, gene information for the target gene was obtained from a publicly known database, and the gene and corresponding primers were prepared. The target gene was then amplified by polymerase chain reaction (PCR) and introduced into the target vector (pCL) using ligase. Alternatively, a chemical synthesis method was used when codon optimization was required for smooth expression in E. coli. To express the target gene, a promoter and terminator were ligated to the target gene via PCR. The constructed vector was then introduced into the target strain using a conventional heat shock technique. When higher efficiency was required, electroporation was used.

[0250] In addition to gene expression, specific genes on chromosomes were weakened or deleted using oligomers, using the well-known Red / ET recombineering technique, as reported by Datsenko and Wanner (Proc. Natl. Acad. Sci. USA, 2000, 97, 6640-6645). The oligomers used for deletion were as follows:

[0251] pykF-Left (SEQ ID NO: 48) GAAAGCAAGTTTCTCCCATCCTTCTCAACTTAAAGACTAAGACTGTCATG pykF-right (SEQ ID NO: 49) GATATACAAATTAATTCACAAAAGCAATATTACAGGACGTGAACAGATGC pykA-Left (SEQ ID NO: 50) TTTCATGTTCAAGCAACACCTGGTTGTTTCAGTCAACGGAGTATTACATG pykA-right (SEQ ID NO: 51) TGGCGTTTTCGCCGCATCCGGCAACGTACTTACTCTACCGTTAAAATACG maeB-left (SEQ ID NO: 52) TTCAGGGTAAGCGTGAGAGTTAAAAAAAATTACAGCGGTTGGGTTTGCGC maeB-right (SEQ ID NO: 53) TTGCCCACACACTTTATTTGTGAACGTTACGTGAAAGGAACAACCAAATG maeA-left (SEQ ID NO: 54) CCCGGTAGCCTTCACTACCGGGCGCAGGCTTAGATGGAGGTACGGCGGTA maeA-right (SEQ ID NO: 55) GGCCGACGCCCTGGCGGTAAAGCAAAGACGATAAAAGCCCCCAGGGATG aspC-left (SEQ ID NO: 56) TTTTCAGCGGGCTTCATTGTTTTTAATGCTTACAGCACTGCCACAATCGC aspC-right (SEQ ID NO: 57) TACCCTGATAGCGGACTTCCCTTCTGTAACCATAATGGAACCTCGTCATG Icd-left (SEQ ID NO: 58) AACGTGGTGGCAGACGAGCAAACCAGTAGCGCTCGAAGGAGAGGTGAATG Icd-right (SEQ ID NO: 59) CCCGTTAATAAATTTAACAAACTACGGCATTACATGTTTTCGATGATCGC

[0252] 1-4: Evaluation of P4HB production ability of P4HB-producing strains A flask experiment was conducted to test the P4HB production of the three strains prepared in Examples 1-3. The culture conditions were 48 hours, 230 rpm, and 30°C. The medium was prepared based on previously published data (U.S. Patent No. 9,084,467). Specifically, the medium was prepared by adding 1x trace salt solution to 1x E2 minimal medium, and the carbon:nitrogen ratio (C / N ratio) was adjusted to 30:1.

[0253] The P4HB analysis conditions were established based on published literature (U.S. Patent No. 9,084,467). Briefly, as described above, 1 mL of each of the three bacterial strain cultures was harvested at 4,000 rpm. The harvested bacterial strains were lyophilized and then added with a preparation for butanolysis (a dioxane solution containing 99.9% butanol and 4N HCl) and heat-treated at 93°C for 6 hours. The heat-treated solution was subjected to phase separation at 600 rpm, and the organic phase was collected and analyzed by gas chromatography (GC). A standard reagent for 4-hydroxybutyrate (4HB) was prepared using 10% γ-butyrolactone.

[0254] As a result of the analysis using the above conditions, it was confirmed that the P4HB concentration was 22% higher in the strain containing PsynK1, a promoter that is not subject to nitrogen limitation, than in the strain containing Pn, as shown in Table 3 below.

[0255] [Table 3]

[0256] On the other hand, Table 3 further confirmed that when an excessively strong promoter (PsynK2) is used, P4HB productivity does not improve even when it is not affected by the nitrogen limiting factor.

[0257] Example 2: Production of P4HB using the reduced TCA (rTCA) pathway Carbon dioxide fixed by the carboxylation reaction of phosphoenolpyruvate carboxylase was introduced into the P4HB production pathway using the reduced TCA pathway. In P4HB production via the reduced TCA pathway, oxaloacetate produced from phosphoenolpyruvate by phosphoenolpyruvate carboxylase enzyme does not undergo the decarboxylation step involved in the oxidative TCA pathway. Therefore, it can be reduced to succinyl-CoA via malate, fumarate, and succinate without generating carbon dioxide. The produced succinyl-CoA can be converted to P4HB via a method similar to the pathway described in Example 1-1.

[0258] A strain (strain number 4 below) in which the pyruvate kinase gene (pykFA) was deleted was constructed for efficient activation of the rTCA pathway. The three constructed strains are shown in Table 4 below, and strain number 3 below is the same as strain number 3 in Table 2 above. The following SucD, 4HbD, OrfZ, PhaC, and PPC and their gene sequences are shown in SEQ ID NOs: 1 to 8, 13, and 14. The following MaeAB, AspC, and PykFA and their gene sequences are shown in SEQ ID NOs: 9 to 12, 21 to 24, 29, and 30.

[0259] [Table 4]

[0260] Eliminating pyruvate kinase controls the flow of carbon from PEP to pyruvate, conserving the intracellular concentration of PEP and promoting activation of the PEP carboxylase pathway, which suggests that this increases the intracellular concentration of oxaloacetate, which is essential for the rTCA pathway.

[0261] Additionally, to eliminate competing pathways on the rTCA pathway, such as oxaloacetate and malate, we constructed a strain (strain 5 above) in which aminotransferase (aspartate aminotransferase; AspC) and malate dehydrogenase (malic enzyme; MaeAB) were further deleted, and evaluated rTCA-based P4HB production.

[0262] P4HB productivity was evaluated using the strains in Table 4 above in the same manner as in Examples 1-4. Activation of the rTCA pathway improved bacterial growth, and as shown in Figure 7, the P4HB yield of strains into which the rTCA pathway had been introduced (strains 4 and 5) increased from approximately 28% to a maximum of 43% compared to a strain without the rTCA pathway (strain 3). When the rTCA pathway was utilized, the theoretical maximum P4HB yield, which was previously at 48 wt%, could be increased to 58 wt%.

[0263] Example 3: Production of P4HB using the glyoxylate pathway By using the glyoxylate cycle to produce P4HB, the 2-oxoglutartate decarboxylation pathway is bypassed, reducing carbon loss to carbon dioxide and ultimately increasing the production yield of P4HB.

[0264] To activate this pathway, isocitrate dehydrogenase (icd) in the TCA pathway was removed, forcing carbon flow to the glyoxylate pathway. To activate the glyoxylate pathway, isocitrate lyase (aceA) and malate synthase (aceB) from E. coli were introduced, but the existing wild-type promoters in the microorganisms were replaced with synthetic promoters to prevent glucose-based catabolic repression. The two strains constructed are listed in Table 5 below. The following SucD, 4HbD, OrfZ, PhaC, and PPC and their gene sequences are listed in SEQ ID NOs: 1 to 8, 13, and 14. The following Icd and AceBA and their gene sequences are listed in SEQ ID NOs: 35, 36, 37, 38, 43, and 44.

[0265] [Table 5]

[0266] Both succinate and malate, products of the glyoxylate pathway, can be converted to succinyl-CoA via the reduced TCA pathway. The resulting succinyl-CoA can then be converted to P4HB via the P4HB synthesis pathway described in Example 1-1. During fermentation of the constructed strain, 50 mM monosodium glutamate (MSG) was added to supplement glutamate externally. The constructed strain was cultured in a glucose medium to confirm PHA production. As shown in Figure 8, 2.7 g / L of PHA was produced (Strain No. 7, GLU+MSG). In a strain lacking the glyoxylate pathway (Strain No. 6), PHA production was limited to 0.9 g / L. In a strain lacking the glyoxylate pathway (Strain No. 7, MSG), no PHA was observed even with the glyoxylate pathway introduced, in the absence of glucose. This method improved the theoretical yield from 48 wt% to 58 wt%.

[0267] From the above description, those skilled in the art to which the present application pertains will understand that the present application may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are merely illustrative and not limiting. The scope of the present application should be interpreted as including all modifications and variations derived from the meaning and scope of the claims below, and equivalent concepts thereof, rather than the above detailed description.

Claims

1. (1) converting succinyl-coA (SuCoA) to succinate semialdehyde (SSA); (2) converting succinate semialdehyde (SSA) to 4-hydroxybutyrate (4HB); (3) converting 4-hydroxybutyrate (4HB) to 4-hydroxybutyryl coA (4HBCoA); (4) polymerizing two or more 4-hydroxybutyryl coA (4HBCoA) molecules to produce poly-4-hydroxybutyrate (P4HB); (5) decomposing poly-4-hydroxybutyrate into 1,4-butanediol; (g1) converting phosphoenolpyruvate to oxaloacetate, wherein the step is enhanced by using a nucleotide sequence having promoter activity as set forth in SEQ ID NO: 45 operably linked to a polynucleotide encoding phosphoenolpyruvate carboxylase; and A method for producing 1,4-butanediol, comprising a TCA pathway or a reductive TCA cycle.

2. 2. The method of claim 1, wherein (1) to (4) are one or more polypeptides selected from the group consisting of succinate semialdehyde dehydrogenase, 4-hydroxybutyric acid dehydrogenase, 4-hydroxybutyryl-CoA transferase, and poly(3-hydroxyalkanoate) polymerase; microorganisms containing the polypeptides, polynucleotides encoding the polypeptides, or combinations thereof; and cultures thereof.

3. The TCA pathway (a1) converting pyruvate to acetyl-coA; (b1) converting acetyl-coA and oxaloacetate to citrate; (c1) converting citrate to isocitrate; (d1) converting isocitrate to α-ketoglutarate; (e1) converting α-ketoglutarate to succinyl-coA; and 2. The method of claim 1, further comprising one or more steps selected from the group consisting of (f1) converting pyruvate to oxaloacetate.

4. The reduced TCA pathway is (a2) converting oxaloacetate to malate; (b2) converting malate to fumarate; (c2) converting the fumarate to a succinate; and (d2) converting succinate to succinyl-coA.

5. The method according to claim 1, wherein the step (e2) of converting phosphoenolpyruvate to pyruvate is weakened.

6. The method according to claim 1, wherein the reductive TCA pathway is enhanced by any one or more selected from the group consisting of the following (I) to (XII): (I) pyruvate kinase weakening; (II) phosphoenolpyruvate carboxylase (PEP carboxylase) enhancement; (III) carbonic anhydrase enhancement; (IV) citrate synthase regulation; (V) pyruvate carboxylase enhancement; (VI) NAD ＋ NADPH-dependent malate dehydrogenase (NAD ＋ -dependent malate dehydrogenase) weakening; (VII) NADP ＋ Dependent malate dehydrogenase (NADP ＋ -dependent malate dehydrogenase) weakening; (VIII) weakened phosphogluconate dehydratase; (IX) 2-keto-4-hydroxyglutarate:2-keto-3-deoxygluconate 6-phosphate aldolase (KHG / KDPG aldolase) weakening; (X) aspartate aminotransferase weakening; (XI) glucose-specific PTS enzyme IIBC component weakening; and (XII) Bicarbonate transporter enhancement.

7. The method of claim 1 , further comprising a glyoxylate pathway.

8. The glyoxylate pathway (a3) converting isocitrates to glyoxylates and succinates; (b3) converting glyoxylate and acetyl-coA to malate and coA; (c3) converting citrate to isocitrate; (d3) converting pyruvate to oxaloacetate; (e3) converting phosphoenolpyruvate to oxaloacetate; (f3) converting oxaloacetate to citrate; (g3) converting malate to fumarate; (h3) converting the fumarate to a succinate; and The method of claim 7, further comprising one or more steps selected from the group consisting of (i3) converting succinate to succinyl-coA.

9. The method according to claim 8, wherein the step (j3) of converting α-ketoglutarate to succinyl-coA is attenuated.

10. 9. The method of claim 8, wherein the step (k3) of converting oxaloacetate to malate is attenuated.

11. The method of claim 8, wherein the glyoxylate pathway is enhanced by any one or more selected from the group consisting of (i) to (vi): (i) citrate synthase enhancement; (ii) attenuated isocitrate dehydrogenase; (iii) isocitrate lyase enhancement; (iv) Isocitrate dehydrogenase kinase / phosphatase enhancement; (v) malate synthase G enhancement; and (vi) Malate synthase A enrichment.

12. a polynucleotide encoding succinate semialdehyde dehydrogenase, a polynucleotide encoding 4-hydroxybutyrate dehydrogenase, a polynucleotide encoding 4-hydroxybutyryl-coA transferase, a polynucleotide encoding poly(3-hydroxyalkanoate) polymerase, and a polynucleotide encoding phosphoenolpyruvate carboxylase; a nucleotide sequence as set forth in SEQ ID NO:45 having promoter activity, operably linked to a polynucleotide encoding said phosphoenolpyruvate carboxylase; and A microorganism comprising the TCA pathway or the reduced TCA pathway.

13. The microorganism according to claim 12, wherein one or more polypeptides selected from the group consisting of succinate semialdehyde dehydrogenase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, and poly(3-hydroxyalkanoate) polymerase are exogenously introduced.

14. 13. The microorganism of claim 12, wherein the succinate semialdehyde dehydrogenase and 4-hydroxybutyryl-coA transferase are derived from Clostridium kluyveri, the 4-hydroxybutyrate dehydrogenase is derived from Arabidopsis thaliana, and the poly(3-hydroxyalkanoate) polymerase is derived from Pseudomonas putida or Ralstonia eutropha.

15. The microorganism according to claim 12, comprising one or more polypeptides selected from the group consisting of pyruvate dehydrogenase, citrate synthase, aconitase, isocitrate dehydrogenase, α-ketoglutarate dehydrogenase, and pyruvate carboxylase, polynucleotides encoding the same, or a combination thereof.

16. The microorganism according to claim 12, wherein the microorganism comprises any one or more selected from the group consisting of the following (I) to (XII): (I) pyruvate kinase attenuation; (II) phosphoenolpyruvate carboxylase enhancement; (III) carbonic anhydrase enrichment; (IV) citrate synthase regulation; (V) pyruvate carboxylase enhancement; (VI) NAD ＋ Dependent malate dehydrogenase weakening; (VII) NADP ＋ Dependent malate dehydrogenase weakening; (VIII) phosphogluconate dehydratase attenuation; (IX) 2-keto-4-hydroxyglutarate:2-keto-3-deoxygluconate 6-phosphate aldolase attenuated; (X) aspartate aminotransferase attenuation; (XI) glucose-specific PTS enzyme IIBC component attenuation; and (XII) Bicarbonate transporter enhancement.

17. The microorganism of claim 12 , wherein the microorganism comprises a glyoxylate pathway.

18. The microorganism according to claim 12, wherein the microorganism comprises any one or more selected from the group consisting of the following (i) to (vi): (i) citrate synthase enhancement; (ii) isocitrate dehydrogenase attenuation; (iii) isocitrate lyase enhancement; (iv) isocitrate dehydrogenase kinase / phosphatase enhancement; (v) malate synthase G enrichment; and (vi) Malate synthase A enrichment.

19. The microorganism according to claim 12, wherein the microorganism is used for producing 1,4-butanediol.

20. The microorganism according to claim 12, wherein the microorganism is for producing poly-4-hydroxybutyrate.

21. The microorganism according to claim 12, wherein the microorganism is of the genus Corynebacterium or Escherichia.

22. The microorganism according to claim 12, wherein the microorganism is capable of producing poly-4-hydroxybutyrate even under conditions of limitation of one or more nutrients selected from the group consisting of nitrogen, sulfur, phosphorus, and magnesium.

23. A method for producing poly-4-hydroxybutyrate, comprising culturing the microorganism according to any one of claims 12 to 22.

24. 24. The method for producing poly-4-hydroxybutyrate according to claim 23, further comprising recovering poly-4-hydroxybutyrate from the microorganism or the culture medium.

25. 24. The method of claim 23, wherein the step of culturing the microorganism comprises culturing the microorganism in a medium limited in any one or more nutrients selected from the group consisting of nitrogen, sulfur, phosphorus, and magnesium.

26. Cultivating the microorganism according to any one of claims 12 to 22; recovering poly-4-hydroxybutyrate from the microorganism or the culture medium; and A method for producing 1,4-butanediol, comprising the step of decomposing poly-4-hydroxybutyrate into 1,4-butanediol.

27. 27. The method for producing 1,4-butanediol according to claim 26, wherein the step of decomposing poly-4-hydroxybutyrate into 1,4-butanediol is thermal decomposition, hydrogenation, or a combination thereof.

28. A composition for producing poly-4-hydroxybutyrate, comprising the microorganism according to claim 12 or a culture thereof.

29. Use of the microorganism or a culture thereof according to claim 12 for producing poly-4-hydroxybutyrate.

Images