Highly thermostable reverse transcriptase
A mutated reverse transcriptase with specific amino acid modifications addresses the low thermostability issue of conventional enzymes, enabling efficient cDNA synthesis from mRNA with secondary structures at elevated temperatures.
Patent Information
- Application Number
- JP2021205526
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2021-12-17
- Publication Date
- 2026-01-23
- Estimated Expiration
- 2041-12-17
AI Technical Summary
Conventional reverse transcriptases, such as Moloney murine leukemia virus and avian myeloblastosis virus, exhibit low thermostability at high temperatures, hindering efficient cDNA synthesis from mRNA with secondary structures.
A novel reverse transcriptase with specific amino acid mutations, such as L67, D175, L229, A308, A437, A592, and P476, enhancing thermostability and maintaining reverse transcription activity even at elevated temperatures.
The novel reverse transcriptase synthesizes a larger amount of cDNA from RNA with higher order structures and maintains activity after heat treatment, improving cDNA synthesis efficiency.
Smart Images

Figure 0007804933000003 
Figure 0007804933000004 
Figure 0007804933000005
Abstract
Description
[Technical Field]
[0001] The present invention relates to a reverse transcriptase. More specifically, the present invention relates to a reverse transcriptase having excellent thermostability, a reverse transcription method using the reverse transcriptase, a polynucleotide encoding the reverse transcriptase, a kit containing the reverse transcriptase, and the like. [Background technology]
[0002] Reverse transcriptases generally have the activity of synthesizing cDNA using RNA as a template (hereinafter referred to as "RNA-dependent DNA polymerase activity") and the activity of degrading the RNA strand in an RNA:DNA hybrid (hereinafter referred to as "RNase H activity"). Reverse transcriptases are used, for example, in analyzing the base sequence of mRNA, which directly reflects the amino acid sequence of a protein expressed in a living organism, constructing a cDNA library, and performing RT-PCR. Moloney murine leukemia virus reverse transcriptase (MMLV) and avian myeloblastosis virus reverse transcriptase (AMV) are known reverse transcriptases used for such purposes.
[0003] When mRNA contains a base sequence that is prone to secondary structure formation, the synthesis of cDNA by reverse transcriptase is hindered by the secondary structure. Therefore, it is desirable to synthesize cDNA while suppressing the formation of secondary structures by increasing the reaction temperature. However, Moloney murine leukemia virus reverse transcriptase and avian myeloblastosis virus reverse transcriptase often have low thermostability and may be inactivated at high temperatures that suppress the formation of RNA secondary structures. Therefore, in recent years, various reverse transcriptases have been developed that have higher thermostability than wild-type reverse transcriptases and improved reactivity even at temperatures between 42 and 60°C, where they are usually poorly stable, through innovations such as the introduction of multiple amino acid mutations into reverse transcriptases (Patent Documents 1 and 2, Non-Patent Document 1). However, reverse transcriptases with even improved stability remain desirable.
[0004] Conventional methods for improving reverse transcriptase typically involve introducing mutations into one or several amino acids, or at most a dozen or so, and then evaluating the results. However, this method requires a huge number of experiments to select the best combination of mutations. Therefore, in practice, researchers often narrow down the mutations to a certain extent based on their experience and intuition, and then select and evaluate them. As a result, many of the reverse transcriptase mutants discovered to date have relatively high homology to the amino acid sequence of wild-type reverse transcriptase. Furthermore, mutations often target amino acids in helices or sheet structures that contact the template. Even when mutating loop structures, mutations are almost always targeted at amino acid residues in the parts that contact the template. [Prior art documents] [Patent documents]
[0005] [Patent Document 1] Japanese Patent Application Laid-Open No. 2000-139457 [Patent Document 2] Patent No. 6180002 [Non-patent literature]
[0006] [Non-Patent Document 1] Journal of Biotechnology, Vol. 150, Issue 3, Pages 299-306, (Published in 2010) Summary of the Invention [Problem to be solved by the invention]
[0007] One objective is to provide a novel reverse transcriptase with improved thermostability. [Means for solving the problem]
[0008] In view of the above problems, the present inventors have conducted extensive research and discovered a reverse transcriptase that has reverse transcriptase activity (hereinafter also referred to as reverse transcription activity) and exhibits improved thermostability, thereby arriving at the present invention. [Item 1] A reverse transcriptase consisting of the following amino acid sequence: (a) an amino acid sequence having 94% or more identity to the amino acid sequence set forth in SEQ ID NO: 2; or (b) An amino acid sequence having one or several amino acid deletions, substitutions, insertions, or additions in the amino acid sequence shown in SEQ ID NO: 2. [Item 2] The reverse transcriptase according to Item 1, wherein the amino acid sequence of (a) or (b) has the following amino acid residues (i) to (vi): (i) the amino acid at the position corresponding to position 67 is L or M; (ii) the amino acid at the position corresponding to position 175 is D; (iii) the amino acid at the position corresponding to position 229 is L or I; (iv) the amino acid at the position corresponding to position 308 is A; (v) the amino acid at the position corresponding to position 437 is A or T; and (vi) The amino acid at the position corresponding to position 592 is A. [Item 3] The reverse transcriptase according to Item 1 or 2, wherein the amino acid sequence of (a) or (b) has at least one amino acid residue selected from the group consisting of the following (1) to (4): (1) The amino acid at the position corresponding to the 63rd position is R. (2) The amino acid at the position corresponding to position 217 is Q. (3) the amino acid at the position corresponding to position 476 is P; and (4) The amino acid at the position corresponding to position 478 is I. [Item 4] The reverse transcriptase according to any one of Items 1 to 3, wherein the amino acid sequence of (a) or (b) has the following amino acid residue (3): (3) The amino acid at the position corresponding to position 476 is P. [Item 5] The reverse transcriptase according to any one of Items 1 to 4, wherein the amino acid sequences (a) and (b) have at least one amino acid residue selected from the group consisting of the following (5) to (10), (3), or (11) to (13): (5) The amino acid at the position corresponding to the 47th amino acid is P. (6) The amino acid at the position corresponding to position 62 is V. (7) The amino acid at the position corresponding to the 144th amino acid is R. (8) The amino acid at the position corresponding to position 233 is T. (9) The amino acid at the position corresponding to position 354 is S. (10) The amino acid at the position corresponding to position 429 is L. (3) The amino acid at the position corresponding to position 476 is P. (11) The amino acid at the position corresponding to position 495 is D. (12) the amino acid at the position corresponding to position 542 is V; and (13) The amino acid at the position corresponding to position 662 is L. [Section 6] A reverse transcriptase having 80% or more identity to the amino acid sequence shown in SEQ ID NO: 1 and having at least one amino acid residue selected from the group consisting of the following (1) to (4): (1) The amino acid at the position corresponding to the 63rd position is R. (2) The amino acid at the position corresponding to position 217 is Q. (3) the amino acid at the position corresponding to position 476 is P; and (4) The amino acid at the position corresponding to position 478 is I. [Section 7] Item 7. The reverse transcriptase according to Item 6, which has 80% or more identity to the amino acid sequence shown in SEQ ID NO: 1 and has the following amino acid residues (3): (3) The amino acid at the position corresponding to position 476 is P. [Section 8] Item 6 or 7, which has 80% or more identity to the amino acid sequence shown in SEQ ID NO: 1 and has at least one amino acid residue selected from the group consisting of the following (5) to (10), (3), and (11) to (13): (5) The amino acid at the position corresponding to the 47th amino acid is P. (6) The amino acid at the position corresponding to position 62 is V. (7) The amino acid at the position corresponding to the 144th amino acid is R. (8) The amino acid at the position corresponding to position 233 is T. (9) The amino acid at the position corresponding to position 354 is S. (10) The amino acid at the position corresponding to position 429 is L. (3) The amino acid at the position corresponding to position 476 is P. (11) The amino acid at the position corresponding to position 495 is D. (12) the amino acid at the position corresponding to position 542 is V; and (13) The amino acid at the position corresponding to position 662 is L. [Item 9] The reverse transcriptase according to any one of Items 1 to 8, wherein the amino acid sequence of one or more regions selected from the group consisting of (A) a region corresponding to positions 91 to 105, (B) a region corresponding to positions 109 to 120, (C) a region corresponding to positions 125 to 138, (D) a region corresponding to positions 146 to 157, (E) a region corresponding to positions 182 to 205, (F) a region corresponding to positions 220 to 228, (G) a region corresponding to positions 251 to 263, (H) a region corresponding to positions 302 to 319, (I) a region corresponding to positions 351 to 358, and (J) a region corresponding to positions 391 to 404 of the amino acid sequence shown in SEQ ID NO: 1 or 2 has an identity of 90% or more to the amino acid sequence of the corresponding region in the amino acid sequence of SEQ ID NO: 1 or 2. [Item 10] The reverse transcriptase according to any one of Items 1 to 9, wherein the amino acid sequence of (a) is an amino acid sequence having 97% or more identity to the amino acid sequence shown in SEQ ID NO:2. [Item 11] The reverse transcriptase according to any one of Items 1 to 10, which lacks RNase H activity. [Item 12] The reverse transcriptase according to any one of Items 1 to 11, which exhibits a residual activity rate of 70% or more when heat-treated at 50°C for 10 minutes. [Item 13] A polynucleotide encoding the reverse transcriptase according to any one of Items 1 to 12. [Item 14] A vector comprising the polynucleotide described in Item 13. [Item 15] A cell transformed with the vector according to Item 14. [Item 16] A reagent comprising the reverse transcriptase according to any one of Items 1 to 12, the polynucleotide according to Item 13, the vector according to Item 14, and / or the cell according to Item 15. [Item 17] A method for producing the reverse transcriptase according to any one of Items 1 to 12, using the polynucleotide according to Item 13, the vector according to Item 14, the cell according to Item 15, and / or the reagent according to Item 16. [Item 18] A method for synthesizing cDNA from an RNA template using the reverse transcriptase according to any one of Items 1 to 12. [Item 19] A kit comprising the reverse transcriptase according to any one of Items 1 to 12. [Item 20] The kit according to Item 19, which is used to synthesize cDNA using RNA as a template. [Effects of the Invention]
[0009] The present invention provides a novel and useful reverse transcriptase with improved thermostability. The improved thermostability reverse transcriptase synthesizes a larger amount of cDNA than wild-type reverse transcriptase, even when reverse transcription is performed from RNA with higher order structures, and can synthesize cDNA from a variety of templates. [Brief explanation of the drawings]
[0010] [Figure 1] FIG. 1 shows the results of electrophoresis performed in Example 5. [Figure 2] FIG. 1 shows the results of alignment of the amino acid sequence of mutant reverse transcriptase G7 with the amino acid sequences of wild-type reverse transcriptases (MMLV and HIV). [Figure 3] FIG. 10 shows the results of electrophoresis performed in Example 7. [Figure 4] FIG. 1 shows highly conserved regions in the alignment of the amino acid sequences of mutant reverse transcriptases G7, G2, and G6 with the amino acid sequence of wild-type reverse transcriptase (MMLV). DETAILED DESCRIPTION OF THE INVENTION
[0011] The present invention will be described in detail below, but the present invention is not limited thereto.
[0012] The present invention provides novel reverse transcriptases with improved thermostability.
[0013] As used herein, "reverse transcriptase" refers to an enzyme that has the activity of synthesizing cDNA using RNA as a template (hereinafter also referred to as "RNA-dependent DNA polymerase activity," or "reverse transcription activity," "reverse transcriptase activity," etc.), and may or may not have RNase H activity. The presence or absence of RNA-dependent DNA polymerase activity can be confirmed by the method for measuring reverse transcription activity described below. Reverse transcriptases may include wild-type reverse transcriptases and mutant reverse transcriptases in which mutations have been artificially introduced into the amino acid sequence of the wild-type reverse transcriptase.
[0014] As used herein, "wild-type reverse transcriptase" (hereinafter also referred to as "WT") refers to a reverse transcriptase into which no artificial mutations have been introduced. An example of such a wild-type reverse transcriptase is a reverse transcriptase consisting of the amino acid sequence set forth in SEQ ID NO: 1. Here, "the amino acid sequence set forth in SEQ ID NO: 1" refers to the amino acid sequence set forth in SEQ ID NO: 1 in the Sequence Listing (the amino acid sequence of Moloney murine leukemia virus reverse transcriptase). Furthermore, "Moloney murine leukemia virus reverse transcriptase" is sometimes referred to as "MMLV reverse transcriptase."
[0015] The novel reverse transcriptase of the present invention has an amino acid sequence different from that of conventionally known wild-type reverse transcriptases. Therefore, herein, the reverse transcriptase of the present invention may be referred to as a mutant reverse transcriptase or modified reverse transcriptase. As used herein, the terms "mutant" and "modified" when referring to a "mutant reverse transcriptase" or a "modified reverse transcriptase" are used interchangeably and refer to an amino acid sequence different from that of conventionally known reverse transcriptases, without distinguishing between mutations due to artificial mutations and mutations occurring in nature. Thus, the mutant reverse transcriptase of the present invention is a reverse transcriptase in which one or more amino acids have been modified in the amino acid sequence set forth in SEQ ID NO: 1, which represents the wild-type reverse transcriptase sequence, and thus has an amino acid sequence different from that of SEQ ID NO: 1, regardless of whether the mutant reverse transcriptase is a reverse transcriptase obtained by artificial mutation or mutation occurring in nature.
[0016] In this specification, simplified alphabetical symbols may be used to denote nucleotide sequences, amino acid sequences, and their individual components, but all follow the conventions of molecular biology and genetic engineering. In this specification, a notation such as "K63R" is used to concisely indicate mutations in amino acid sequences. "K63R" indicates a substitution of lysine (K) at position 63 with arginine (R). This indicates the type and location of the amino acid residue before the substitution, and the type of amino acid residue after the substitution. Unless otherwise specified, SEQ ID NOs correspond to those listed in the Sequence Listing. Multiple mutants can be represented by connecting the above notations with a " / " (e.g., K63R / D217Q / V476P / A478I). In this specification, a position corresponding to a certain position (position X) in SEQ ID NO: 2 in an amino acid sequence that is not completely identical to the amino acid sequence set forth in SEQ ID NO: 2 refers to the position corresponding to the corresponding position in SEQ ID NO: 2 when the primary structures of the sequences are compared (aligned).
[0017] In one embodiment, the mutant reverse transcriptase preferably has a certain level of amino acid sequence identity with the amino acid sequence shown in SEQ ID NO: 2. Such a mutant reverse transcriptase exhibits improved thermostability while retaining reverse transcription activity.
[0018] In one embodiment, the mutant reverse transcriptase has the amino acid sequence of (a) and / or (b) below: (a) an amino acid sequence having 94% or more identity to the amino acid sequence set forth in SEQ ID NO: 2; or (b) An amino acid sequence having one or several amino acid substitutions, deletions, insertions, or additions in the amino acid sequence shown in SEQ ID NO: 2. In one embodiment, the mutant reverse transcriptase has the amino acid sequence described above and exhibits reverse transcriptase activity and thermostability (e.g., exhibits 70% or more residual activity after heat treatment at 50°C for 10 minutes).
[0019] The reverse transcriptase having the amino acid sequence shown in SEQ ID NO: 2 has 93% amino acid sequence identity to the wild-type reverse transcriptase (MMLV). Although it has a relatively high amino acid sequence identity with the wild-type reverse transcriptase, the results of the test examples described below have revealed that it exhibits high thermal stability not found in the wild-type reverse transcriptase. The reverse transcriptase of the present invention is not limited to one consisting of the amino acid sequence shown in SEQ ID NO: 2, but may also be one in which this amino acid sequence has been further modified.
[0020] In one embodiment, the mutant reverse transcriptase may have a certain percentage of alterations in the amino acid sequence set forth in SEQ ID NO: 2. In one embodiment, the mutant reverse transcriptase preferably has 80% or more identity to the amino acid sequence set forth in SEQ ID NO: 1. The mutant reverse transcriptase is not particularly limited as long as it does not lose its reverse transcription activity and / or thermostability. For example, it is preferable that the mutant reverse transcriptase has an amino acid sequence that is 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identical to the amino acid sequence set forth in SEQ ID NO: 1, or that is 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identical to the amino acid sequence set forth in SEQ ID NO: 2. Here, amino acid sequence identity can be evaluated by any means known in the art. For example, the amino acid sequence identity can be calculated using commercially available analytical tools or those available via telecommunications lines (Internet). For example, the National Center for Biotechnology Information (NCBI) homology algorithm BLAST (Basic Local Alignment Search Tool) http: / / www.ncbi.nlm.nih.gov / BLAST / can be used to calculate amino acid sequence identity using default (initial setting) parameters. Furthermore, the amino acid sequence of the modified reverse transcriptase may be an amino acid sequence obtained by deleting, substituting, inserting, and / or adding one or several amino acids in the amino acid sequence set forth in SEQ ID NO: 2. Here, "one or several" is not particularly limited as long as the reverse transcription activity and / or thermostability are not lost, but may refer to, for example, 1 to 30, or even 1 to 20, preferably 1 to 10, more preferably 1 to 5, and even more preferably 1 to 3 amino acids. Such amino acid sequences may be artificially produced by genetic engineering techniques, or may be the amino acid sequence of a naturally occurring protein.
[0021] In one embodiment, when the mutant reverse transcriptase has a substitution in the amino acid sequence set forth in SEQ ID NO: 1 or 2, the substitution is preferably between structurally and / or chemically similar amino acids (so-called conservative substitutions). Examples of conservative substitutions include, but are not limited to, substitutions between basic amino acids (H, K, R), substitutions between acidic amino acids (D and E), substitutions between neutral nonpolar amino acids (A, V, L, I, P, F, M, W), substitutions between neutral polar amino acids (G, N, Q, S, T, V, C), substitutions between aromatic amino acids (W, F, H, Y), substitutions between nitrogen-containing amino acids (K, R, N, Q, P), substitutions between sulfur-containing amino acids (C and M), substitutions between oxygen-containing amino acids (S and T), substitutions between β-branched amino acids (V, L, I), and substitutions between amino acids with linear alkyl or hydrogen side chains (A and G).
[0022] In one embodiment, the mutant reverse transcriptase preferably has the amino acid residues identified in the Examples below as amino acid residues that characterize reverse transcriptases. Specific examples of such amino acid residues include the following amino acid residues (i) to (vi). The reverse transcriptase of the present invention may have any one of the following amino acid residues (i) to (vi), but preferably has two or more, three or more, four or more, five or more, and particularly preferably all six of the amino acid residues (i) to (vi). [Examples of amino acid residues that characterize reverse transcriptase] (i) the amino acid at the position corresponding to position 67 is L or M; (ii) the amino acid at the position corresponding to position 175 is D; (iii) the amino acid at the position corresponding to position 229 is L or I; (iv) the amino acid at the position corresponding to position 308 is A; (v) the amino acid at the position corresponding to position 437 is A or T; (vi) The amino acid at the position corresponding to position 592 is A.
[0023] In a particularly preferred embodiment, the mutant reverse transcriptase may have six amino acid residues, LDLAAA, MDIAAA, MDIATA, MDLAAA, or MDLATA, at positions 67, 175, 229, 308, 437, and 592, in this order, as amino acid residues that characterize the above-described reverse transcriptase. Among these, those having any of the amino acid residues LDLAAA, MDIATA, or MDLAAA are preferred, and those having the amino acid residue MDLAAA are particularly preferred. By having such six amino acid residues, the enzyme can more reliably have reverse transcription activity.
[0024] In one embodiment, the mutant reverse transcriptase preferably has amino acid residues characteristic of the amino acid sequence of the reverse transcriptase shown in SEQ ID NO: 2. Such amino acid residues include amino acid residues that are commonly found in the amino acid sequences of wild-type reverse transcriptases (MMLV, HIV) but that differ in the amino acid sequence shown in SEQ ID NO: 2. By having such amino acid residues characteristic of the amino acid sequence of SEQ ID NO: 2, excellent thermostability different from that of wild-type reverse transcriptase can be more reliably exhibited. Examples of such amino acid residues include the amino acid residues (1) to (4) below. [Amino acid residues characteristic of the reverse transcriptase shown in SEQ ID NO: 2] (1) The amino acid at the position corresponding to the 63rd position is R. (2) The amino acid at the position corresponding to position 217 is Q. (3) The amino acid at the position corresponding to position 476 is P. (4) The amino acid at the position corresponding to position 478 is I. The mutant reverse transcriptase preferably has one of the amino acid residues (1) to (4) above, more preferably has two or more or three or more of (1) to (4), and particularly preferably has all four of the amino acid residues above.
[0025] Reverse transcriptase (MMLV) is generally known to have a three-dimensional structure formed by the intricate intertwining of two-dimensional protein structures, such as α-helices, β-sheets, and loops, and to be composed of five domains (Fingers, Palm, Thumb, Connection, and RNase H domains). The amino acid residues (1) to (4) characteristic of the reverse transcriptase represented by SEQ ID NO: 2 are known to be concentrated in the loop region. Conventional mutant reverse transcriptases often involve mutations of amino acids in the helices or sheet structures in contact with the template, and few mutants in the loop region are known. It is presumed that the reverse transcriptase of the present invention exhibits high thermostability by altering the flexibility and chemical properties of the three-dimensional structure in the loop region, thereby maintaining or improving its binding strength to template RNA and increasing structural stability.
[0026] In one embodiment, the mutant reverse transcriptase preferably has highly conserved regions (A) to (J) in the amino acid sequence of SEQ ID NO: 1 or 2: (A):91st~105th (Top of Thumb) (B):109th~120th (Top 2 of Thumb) (C):125th~138th (Thumb-Palm) (D):146th~157th position (Palm active center) (E):182nd~205th (Thumb Chubu) (F): 220th to 228th position (beside Palm active center) (G):251st~263rd (beside Palm active center) (H):302nd~319th (Finger) (I):351st~358th (Finger) (J):391st~404th (Finger-RNaseH) These regions share an amino acid sequence common to the wild-type reverse transcriptase (SEQ ID NO: 1) and the mutant reverse transcriptases (SEQ ID NOs: 2 to 4) ( FIG. 4 ). In one embodiment, the mutant reverse transcriptase has a certain level of identity to the amino acid sequence of SEQ ID NO: 1 or 2, and the amino acid sequence of one or more regions corresponding to one or more selected from the group consisting of (A) to (J) preferably has 90% or more, 95% or more, 96% or more, 98% or more, 99% or more, or 100% identity to the amino acid sequence of SEQ ID NO: 1 or 2. Here, “one or more” preferably means 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10.
[0027] In a more specific embodiment, the mutant reverse transcriptase preferably contains, among the amino acid residues (1) to (4) characteristic of the amino acid sequence of the reverse transcriptase shown in SEQ ID NO: 2, amino acid residues whose structural and / or chemical properties are significantly different from those of the amino acid residues at the corresponding positions in the wild-type reverse transcriptase. It is presumed that such amino acid residues whose properties are significantly different from those of the wild-type reverse transcriptase contribute significantly to the high thermostability of the reverse transcriptase of the present invention, which is not observed in the wild-type reverse transcriptase. Such amino acid residues may be (3) below. [Amino acid residues characteristic of the reverse transcriptase shown in SEQ ID NO: 2 and different in properties from the wild type] (3) The amino acid at the position corresponding to position 476 is P.
[0028] Furthermore, as shown in the Examples below, it has been confirmed that the amino acid sequence of a reverse transcriptase (reverse transcriptase having the amino acid sequence of SEQ ID NO: 3 or 4) that has been shown to have similar thermostability to the reverse transcriptase of the present invention and the amino acid sequence of SEQ ID NO: 2 share characteristic amino acid residues that are not present in wild-type MMLV reverse transcriptase. Therefore, in certain embodiments, the reverse transcriptase of the present invention preferably has amino acid residues that are common to SEQ ID NOs: 2, 3, and 4. Such amino acid residues may be any of the following (5) to (10), (3), or (11) to (13). [Amino acid residues characteristic of reverse transcriptases shown in SEQ ID NOS: 2, 3, and 4] (5) The amino acid at the position corresponding to the 47th amino acid is P. (6) The amino acid at the position corresponding to position 62 is V. (7) The amino acid at the position corresponding to the 144th amino acid is R. (8) The amino acid at the position corresponding to position 233 is T. (9) The amino acid at the position corresponding to position 354 is S. (10) The amino acid at the position corresponding to position 429 is L. (3) The amino acid at the position corresponding to position 476 is P. (11) The amino acid at the position corresponding to position 495 is D. (12) The amino acid at the position corresponding to position 542 is V. (13) The amino acid at the position corresponding to position 662 is L. In one preferred embodiment, the reverse transcriptase of the present invention may have 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, and particularly preferably all 10, of the 10 amino acid residues (5) to (10), (3), and (11) to (13) above in an amino acid sequence that has a certain level of identity to the amino acid sequence of SEQ ID NO: 1 or 2. In particular, it is preferable that the reverse transcriptase of the present invention has one or more amino acid residues selected from (5), (6), (7), and (8) above that are present in the Fingers domain, Palm domain, or loop regions nearby these.
[0029] The reverse transcriptase of the present invention can be composed of an amino acid sequence containing the amino acid residues described above. Those skilled in the art can produce a reverse transcriptase protein of a desired amino acid sequence by any genetic engineering technique known in the art, for example, by appropriately designing a nucleotide sequence encoding the desired amino acid sequence, incorporating the nucleotide sequence into an expression vector, transforming the vector into a host cell, and expressing the vector.
[0030] In certain embodiments, the reverse transcriptase of the present invention may lack RNase activity. Examples of reverse transcriptases lacking RNase activity include, but are not limited to, those in which the aspartic acid at position 524 is substituted with alanine and / or those in which the aspartic acid at position 583 is substituted with asparagine. The RNase activity generally possessed by wild-type reverse transcriptases can degrade RNA, which serves as a template for the reverse transcription reaction, which can be particularly problematic when synthesizing cDNA using long-chain RNA (e.g., full-length RNA) as a template. Reverse transcriptases modified to lack RNase activity are preferred because they can prevent the RNA template from being degraded during the reverse transcription reaction using long-chain RNA as a template.
[0031] The reverse transcriptase of the present invention is characterized by having both reverse transcription activity and high thermostability. Specifically, reverse transcription activity and thermostability can be confirmed by the following measurement methods. Those skilled in the art can evaluate the presence or absence of reverse transcription activity and thermostability for a mutant reverse transcriptase that has a predetermined relationship with the amino acid sequence shown in SEQ ID NO: 1 or 2, and obtain the mutant by following the methods described below.
[0032] [Method for measuring reverse transcription activity] In this specification, the reverse transcription activity of reverse transcriptase can be measured by the following procedure. In this measurement method, if the enzyme activity is high, the sample containing the target to be measured may be appropriately diluted before measurement.
[0033] First, 10 μL of the following pre-prepared solution A, 22 μL of solution B, 1 μL of solution C, and 12 μL of sterile water were added to a reaction vessel such as a microtube and stirred. Then, 5 μL of the sample solution containing the target substance or its diluted solution was added and incubated at 42°C for 10 minutes. After cooling, 150 μL of the following solution D was added, stirred, and then cooled on ice for an additional 10 minutes. This solution was filtered through a glass filter (Whatman GF / C filter) and thoroughly washed with 0.1 N hydrochloric acid and 100% ethanol. The radioactivity of the filter was measured using a liquid scintillation counter (Packard Tri-Carb 2810 TR) to determine the amount of nucleotide incorporation. One unit of enzyme activity is the amount of enzyme that incorporates 1 nmole of nucleotide into the acid-insoluble fraction per 10 minutes under these conditions.
[0034] (Reagent for measuring reverse transcriptase activity) Solution A: 250 mM Tris-HCl (pH 8.3), 375 mM potassium chloride, 15 mM magnesium chloride, 50 mM dithiothreitol, ·B solution: 1mg / mL polyA, 1pmol / μL dT20, 10mM dTTP, ·C liquid: [3H]-dTTP, Solution D: 0.07M sodium pyrophosphate, 0.7M trichloroacetic acid.
[0035] [Measurement of thermal stability (remaining activity rate of reverse transcription activity after heat treatment)] Each mutant reverse transcriptase to be measured is diluted to 100 U / μL with a storage buffer (50 mM Tris-HCl (pH 7.5), 300 mM KCl, 50% glycerol, 0.1 mM EDTA), and the reverse transcription activity value before storage is measured according to the procedure described in the reverse transcription activity measurement method described above. Next, each mutant reverse transcriptase to be measured diluted in the storage buffer is stored under specified storage conditions (e.g., storage in an incubator at 45°C to 55°C for 5 to 15 minutes, or in a preferred embodiment, storage in an incubator at 50°C for 10 minutes). After a predetermined time has elapsed since the start of storage (e.g., 5 to 15 minutes, or in a preferred embodiment, 10 minutes), the reverse transcription activity value after storage is measured according to the procedure described in the reverse transcription activity measurement method described above, similar to that before storage. Next, the remaining activity rate can be calculated by dividing the reverse transcription activity value after storage by the reverse transcription activity value before storage, as shown in the following formula I. Residual activity rate (%) = (reverse transcription activity value after storage / reverse transcription activity value before storage) × 100 (Equation I)
[0036] The reverse transcriptase of the present invention exhibits higher thermostability than wild-type reverse transcriptases. In a preferred embodiment, the reverse transcriptase of the present invention may be a reverse transcriptase that exhibits a residual activity of 50% or more, or even 60% or more, and preferably 70% or more, after heat treatment at 50°C for 10 minutes.
[0037] From yet another perspective, the reverse transcriptase of the present invention may be a mutant reverse transcriptase that exhibits a higher residual activity rate than that of a wild-type reverse transcriptase, for example, when heat-treated at 50° C. for 10 minutes. Specifically, the reverse transcriptase may be a reverse transcriptase that exhibits a residual activity rate that is at least about 1.5 times, preferably at least about 2.0 times, higher than that of a wild-type reverse transcriptase, for example, when heat-treated at 50° C. for 10 minutes.
[0038] In a further embodiment, the present invention provides a polynucleotide encoding the reverse transcriptase of the present invention as described above. Here, a polynucleotide encoding a reverse transcriptase refers to a polynucleotide that, when expressed by a conventional method, yields a reverse transcriptase protein of the present invention. In other words, it refers to a polynucleotide composed of a nucleotide sequence corresponding to the amino acid sequence of the reverse transcriptase protein of the present invention. Those skilled in the art can easily determine the nucleotide sequence corresponding to a given amino acid sequence using codon tables well known in the art. Furthermore, polynucleotides encoding the reverse transcriptase of the present invention also include polynucleotides that differ due to codon degeneracy. The polynucleotide may be any nucleic acid polymer, such as DNA or RNA.
[0039] In a further embodiment, the present invention provides a vector comprising the polynucleotide. Specifically, the polynucleotide encoding the reverse transcriptase is transferred into a vector (e.g., an expression vector, a cloning vector, etc.) as needed. The vector may be any vector that allows for the cloning and / or expression of the reverse transcriptase of the present invention, and examples thereof include plasmids. Examples of plasmids include, but are not limited to, pUC118, pUC18, pBR322, pBluescript, pLED-M1, p73, pGW7, pET3a, pET8c, and pET23b.
[0040] In a further embodiment, the present invention provides a cell transformed with the vector. Such a cell can be suitably used to express a protein encoding the reverse transcriptase of the present invention. In a particularly preferred embodiment, the recombinant host cell of the present invention is obtained by transforming a host cell with the expression vector. Examples of the host cell include Escherichia coli and yeast, with Escherichia coli being particularly preferred. Examples of Escherichia coli include Escherichia coli DH5α, JM109, HB101, XL1Blue, PR1, HS641(DE3), and BL21(DE3). That is, in the present invention, it is preferable to insert a gene encoding the reverse transcriptase into the vector to form an expression vector, and then transform a host cell with the expression vector.
[0041] In one embodiment, the expression vector of the present invention may contain elements that facilitate purification of the reverse transcriptase, such as an extracellular secretion signal, a His tag, and the like.
[0042] In a further embodiment, a method for producing the reverse transcriptase using the polynucleotide, the vector, the transformed cell, and / or a reagent containing one or more of these is also provided. For example, host cells are transformed with the expression vector and then plated on an agar medium containing a drug such as ampicillin to form colonies. The colonies are inoculated into a nutrient medium, such as LB medium or 2xYT medium, and cultured at 37°C for 12 to 20 hours. The cells are then disrupted and a crude enzyme solution is extracted. Any known method for disrupting the cells may be used, including physical disruption methods such as sonication, French press, or glass bead disruption, as well as the use of lytic enzymes such as lysozyme. The purified reverse transcriptase may be isolated from the resulting crude enzyme solution by any method, including centrifugation, ultracentrifugation, ultrafiltration, salting out, dialysis, ion exchange column chromatography, adsorption column chromatography, affinity chromatography, and gel filtration column chromatography.
[0043] The present invention further provides a reverse transcription method characterized by using the reverse transcriptase of the present invention. The reverse transcription method of the present invention is characterized by synthesizing cDNA from an RNA template using the reverse transcriptase of the present invention. The reverse transcriptase of the present invention has higher thermostability than wild-type reverse transcriptase. Therefore, the reverse transcription method of the present invention can perform a reverse transcription reaction over a wide temperature range (e.g., up to approximately 50°C), including temperatures high enough to suppress the formation of RNA secondary structures. Therefore, the reverse transcription method of the present invention is highly versatile, as it can efficiently perform reverse transcription reactions using, for example, RNA that easily forms secondary structures as a template, regardless of the type of RNA.
[0044] In one preferred embodiment, in the reverse transcription method of the present invention, the reverse transcription reaction can be carried out by incubating the reverse transcriptase, template RNA, an oligonucleotide primer complementary to a portion of the RNA, and four types of deoxyribonucleoside triphosphates in a reverse transcription reaction buffer.
[0045] The reaction temperature in the reverse transcription reaction varies depending on the type of RNA used, the type of reverse transcriptase used, and other factors, and is therefore preferably set appropriately depending on the type of RNA used, the type of reverse transcriptase used, and other factors. For example, when the RNA used is RNA that does not readily form secondary structures, the reaction temperature can be set to 37 to 42°C. Furthermore, when the RNA used is RNA that readily forms secondary structures, the reaction temperature can be set to a temperature higher than the reaction temperature suitable for wild-type reverse transcriptase, for example, 42 to 50°C. The reverse transcriptase of the present invention has high thermostability, and therefore has the advantage of being able to sufficiently carry out the reverse transcription reaction even under such high reaction temperatures. The reaction time can be, for example, about 1 minute to 1 hour, preferably about 3 to 30 minutes, and more preferably about 5 to 10 minutes, but is not limited thereto.
[0046] The reverse transcription buffer used in the reverse transcription method of the present invention may contain divalent cations, such as magnesium ions and manganese ions. The concentration of the divalent cations is preferably set appropriately depending on the type of reverse transcriptase and other components contained in the reverse transcription buffer. For example, the divalent cation concentration in the reverse transcription buffer is set to 1 to 30 mM. Furthermore, the reverse transcription buffer may contain components such as a reducing agent (e.g., dithiothreitol), a stabilizer (e.g., glycerol, trehalose), and an organic solvent (e.g., dimethyl sulfoxide, formamide), as needed, within limits that do not interfere with the object of the present invention.
[0047] In a further embodiment, the present invention provides a reagent comprising the reverse transcriptase, the polynucleotide, the vector, and / or the cell. These reagents may contain other optional components (e.g., optional additives such as stabilizers and preservatives) depending on the intended use. For example, a reagent comprising the reverse transcriptase may further comprise the reverse transcription reaction buffer. The use of the reagent of the present invention is not particularly limited, and it can be suitably used, for example, in a reverse transcription reaction in which cDNA is synthesized using RNA as a template. Furthermore, the reagent of the present invention can be suitably used to produce the reverse transcriptase of the present invention.
[0048] In a further embodiment, the present invention provides a kit comprising the reverse transcriptase, the polynucleotide, the vector, the cell, and / or a reagent containing one or more of these. The kit of the present invention may be, for example, a kit for performing a reverse transcription reaction to synthesize cDNA using RNA as a template, a kit for producing the reverse transcriptase of the present invention, etc., but is preferably a kit used to synthesize cDNA using RNA as a template (also referred to as a reverse transcription reaction kit, etc.).
[0049] In one embodiment, the reverse transcription kit of the present invention is a kit for performing a reverse transcription reaction, characterized in that it contains the reverse transcriptase of the present invention (including when it is provided as a reagent containing the reverse transcriptase). Because the reverse transcription kit of the present invention contains the highly thermostable reverse transcriptase of the present invention, it can be suitably used for reverse transcription reactions over a wide temperature range, including temperatures high enough to suppress the formation of RNA secondary structures. Furthermore, its improved thermostability allows detection of low concentrations of template, making it highly convenient. The kit of the present invention may further include instructions for use when performing a reverse transcription reaction using the reverse transcriptase of the present invention. The kit of the present invention can be provided in a form in which the reverse transcriptase and other components are packaged in a single package, for example, and information on how to use the kit is included.
[0050] In a specific embodiment, for example, in a reverse transcription reaction kit, the reagents necessary for performing the reverse transcription reaction may be sealed in a container different from the container containing the reverse transcriptase, or may be sealed in the same container as the reverse transcriptase, as long as the progress of the reverse transcription reaction is stopped during storage of the reagents. The reagents may be sealed in a container in an amount suitable for performing the reverse transcription reaction. This eliminates the need to mix each reagent to obtain an amount suitable for the reverse transcription reaction, making handling easier. [Example]
[0051] The present invention will be specifically described below with reference to examples, although the present invention is not particularly limited to these examples.
[0052] Example 1: Screening for reverse transcriptase genes using bioinformatics In this example, we attempted to design the gene for an enzyme using bioinformatics technology based on big data on a huge number of known protein groups. Specifically, we used sequence alignment of protein amino acid sequences to create a library of proteins from an existing database that have amino acid sequences similar to those of known proteins with the target enzyme activity, identified at least two correlated residues between the proteins, and selected and evaluated proteins with the correlated residues to screen for novel reverse transcriptases. In this example, 5,000 similar sequences were selected using BLASTp, using the amino acid sequence of wild-type reverse transcriptase shown in SEQ ID NO: 1 as an index. These sequences were then curated to remove extremely long or short sequences, narrowing the list to 450 sequences. The selected amino acid sequences were then analyzed using the statistical methods described in JP 2018-88864 A (the entirety of which is incorporated herein by reference). Classification was performed based on the results obtained, and six amino acid residues (positions 67, 175, 229, 308, 437, and 529 of SEQ ID NO: 1) that can classify reverse transcriptases were identified as LDLAAA, MDIAAA, MDIATA, MDLAAA, and MDLATA. Only similar sequences containing these six amino acid residues were then selected, and several candidate amino acid sequences were obtained by substituting amino acids that are relatively conserved in the amino acid sequence of wild-type reverse transcriptase.
[0053] Example 2: Construction of a vector for protein expression of the reverse transcriptase gene One of the amino acid sequences obtained in Example 1 above was selected to create a protein expression vector. Specifically, a DNA sequence (SEQ ID NO: 5) was obtained from one candidate amino acid sequence (G7) based on the codon usage of Escherichia coli. This was cloned into pET-23b(+) to create a plasmid (pG7) incorporating the candidate reverse transcriptase sequence. The resulting plasmid was transformed into BL21-Gold Competent Cells (Agilent Technologies) and used to prepare the enzyme.
[0054] Example 3: Obtaining reverse transcriptase The bacterial cells obtained in Example 2 were cultured as follows. First, 80 mL of sterilized TB medium (Molecular cloning 2nd edition, pA2) containing 100 μg / mL ampicillin was dispensed into a 500 mL Sakaguchi flask. A plasmid-transformed strain that had been previously cultured for 16 hours at 37°C in 3 mL of LB medium (1% bactotryptone, 0.5% yeast extract, 0.5% sodium chloride) containing 100 μg / mL ampicillin was inoculated into this medium and cultured under aeration at 30°C for 16 hours. IPTG (Nacalai Tesque) was then added to a final concentration of 0.1 mM, and the culture was continued under aeration at 30°C for an additional 4 hours. The culture medium was centrifuged to collect the bacterial cells, which were then suspended in 50 mL of lysis buffer (10 mM Tris-HCl (pH 7.5), 300 mM KCl, 5% glycerol). The cells were then disrupted by sonication to obtain a cell lysate. The cell lysate was then purified using a His GraviTrap (GE Healthcare). The washing conditions were 10 mM Tris-HCl (pH 7.5), 300 mM KCl, 5% glycerol, and 50 mM imidazole, and the elution conditions were 10 mM Tris-HCl (pH 7.5), 300 mM KCl, 5% glycerol, and 300 mM imidazole. Finally, the reverse transcriptase was isolated by replacing the storage buffer (50 mM Tris-HCl (pH 7.5), 300 mM KCl, 50% glycerol, and 0.1 mM EDTA).
[0055] The activity of the purified reverse transcriptase was measured as follows: If the enzyme activity was high, the sample was diluted before measurement.
[0056] (Reagent for measuring reverse transcriptase activity) Solution A: 250 mM Tris-HCl (pH 8.3), 375 mM potassium chloride, 15 mM magnesium chloride, 50 mM dithiothreitol Solution B: 1mg / mL polyA, 1pmol / μL dT20, 10mM dTTP, Solution C: [3H]-dTTP Solution D: 0.07M sodium pyrophosphate, 0.7M trichloroacetic acid
[0057] (Method for measuring reverse transcriptase activity) 10 μL of solution A, 22 μL of solution B, 1 μL of solution C, and 12 μL of sterile water were added to a microtube and mixed with stirring. 5 μL of the purified enzyme dilution was then added and incubated at 42°C for 10 minutes. The mixture was then cooled, and 150 μL of solution D was added. After stirring, the mixture was cooled on ice for an additional 10 minutes. The solution was filtered through a glass filter (Whatman GF / C filter) and thoroughly washed with 0.1 N hydrochloric acid and ethanol. The radioactivity of the filter was measured using a liquid scintillation counter (Packard Tri-Carb 2810 TR) to determine nucleotide incorporation. One unit of enzyme activity was defined as the amount of enzyme that incorporated 1 nmole of nucleotide into the acid-insoluble fraction per 10 minutes under these conditions.
[0058] As a result of the above measurement, it was confirmed that the candidate reverse transcriptase (G7) prepared in this example had sufficient reverse transcription activity.
[0059] Example 4: Thermostability test of reverse transcriptase The G7 reverse transcriptase was diluted to 10 U / μL with a storage buffer (50 mM Tris-HCl (pH 7.5), 300 mM KCl, 50% glycerol, 0.1 mM EDTA) and stored at 50°C for 10 minutes. The reverse transcription activity was then measured to determine the residual activity of the mutant reverse transcriptase of the present invention after storage. The residual activity can be calculated by dividing the reverse transcription activity value after storage by the reverse transcription activity value before storage, as shown in the following formula I. Residual activity rate (%) = (reverse transcription activity value after storage / reverse transcription activity value before storage) × 100 (Equation I) [Table 1]
[0060] As shown in Table 1, the WT reverse transcriptase showed a residual activity of 32% after heat treatment at 50°C for 10 minutes, whereas the mutant reverse transcriptase G7 showed a very high residual activity of approximately 70%, indicating that the mutant reverse transcriptase G7 has significantly improved heat resistance.
[0061] Example 5: Test of the ability of reverse transcriptase to synthesize cDNA Reverse transcriptase (G7) was diluted to 10 U / μL with storage buffer (20 mM Tris-HCl (pH 7.5), 100 mM NaCl, 50% glycerol, 0.1 mM EDTA, 1 mM DTT, 0.01% NP-40). 1 μL of each was mixed with 4 μL of reverse transcription reaction solution 5x Buffer (Toyobo), 2 μL of 10 mM dNTPs, 10 ng of human total RNA, 1 μL of 10 μM each of the primers shown below, and 11 μL of sterile water, and the reverse transcription reaction was carried out at 37°C, 42°C, 50°C, and 55°C for 20 minutes. Reverse transcription primer: gttcgaccgtcttctcagcgctcc (SEQ ID NO: 6)
[0062] The resulting cDNA was heat-treated at 95°C for 5 minutes to inactivate the reverse transcriptase, and then 1 μL of the cDNA was subjected to PCR according to the KOD-Plus (Toyobo) instruction manual. 0.6 μL of a 10 μM primer set was added. The sequences are shown below. Forward: gccatgcatgtctgagtacgcacgg (SEQ ID NO: 7) Reverse: tctagaattaccacagttatccaag (SEQ ID NO: 8) The amplified products were subjected to electrophoresis on a 1.5% agarose gel to confirm whether amplification had occurred.
[0063] As shown in Figure 1, with WT, no amplification was observed when the reverse transcription temperature was 50°C or higher. In contrast, with mutant reverse transcriptase G7, a clear band was observed even at a reverse transcription temperature of 50°C, indicating that the reverse transcription reaction had proceeded satisfactorily. Furthermore, even when compared at 42°C, it was confirmed that mutant reverse transcriptase G7 maintained a clearly higher amplification activity than WT.
[0064] Example 6 Sequence comparison of mutant reverse transcriptase and wild-type reverse transcriptase (MMLV, HIV) The amino acid sequence of the mutant reverse transcriptase (G7), which was confirmed in the above Examples to possess both reverse transcription activity and high thermostability, was compared with that of the wild-type reverse transcriptase to identify amino acid residues that characterize the reverse transcriptase of the present invention. Here, wild-type MMLV reverse transcriptase and wild-type HIV reverse transcriptase were selected as wild-type reverse transcriptases for comparison. Both wild-type MMLV reverse transcriptase and wild-type HIV reverse transcriptase are known to have reverse transcription activity and share similar motifs. Therefore, it is speculated that amino acid residues common to wild-type MMLV reverse transcriptase and wild-type HIV reverse transcriptase but different in the mutant reverse transcriptase G7 contribute to the confirmed thermostability. The alignment results are shown in Figure 2. As shown in Figure 2, although the mutant reverse transcriptase shares relatively high amino acid sequence identity with the wild-type reverse transcriptase, it is clear that there are approximately 40 amino acid differences compared to the wild-type MMLV reverse transcriptase sequence, which has particularly high amino acid homology. We then identified amino acid residues that are common to wild-type MMLV reverse transcriptase and wild-type HIV reverse transcriptase but differ in the mutant reverse transcriptase (G7). As a result, four amino acid residues (K63R, D217Q, V476P, and A478I, which represent amino acid mutations from the wild-type reverse transcriptase at positions corresponding to the amino acid sequence of SEQ ID NO: 2) that characterize the reverse transcriptase of the present invention were found in positions corresponding to the loop region of MMLV. Among these amino acid residues, one amino acid residue (V476P) was substituted with an amino acid residue whose structural and chemical properties differ from those of the wild-type reverse transcriptase, and we speculated that this substitution contributes to improved thermostability.
[0065] Example 7: Obtaining additional reverse transcriptases and comparing their sequences From the multiple candidate amino acid sequences obtained in the screening of Example 1, additional candidate amino acid sequences (G2 (SEQ ID NO: 3) and G6 (SEQ ID NO: 4)) were selected, and reverse transcriptases were obtained in the same manner as in Examples 2 and 3. Specifically, DNA sequences (SEQ ID NOs: 9 and 10) were designed based on the codon usage of Escherichia coli from the candidate amino acid sequences of G2 and G6, respectively, and these were cloned into pET-23b(+) to create plasmids (pG2 and pG6) incorporating the candidate reverse transcriptase sequences. The resulting plasmids were transformed into BL21-Gold Competent Cells (Agilent Technologies). The cells were cultured under the same conditions as in Example 3, and reverse transcriptase was obtained by purification from the cell lysate recovered from the culture medium. The obtained reverse transcriptases (G2 and G6) were stored at 50°C for 10 minutes as in Example 4, and the reverse transcription activity was measured. The results are shown in Table 2 below. Furthermore, in the same manner as in Example 5, reverse transcription reaction was carried out for 20 minutes at temperatures of 37°C, 42°C, 50°C, and 55°C, and the presence or absence of an amplification product after PCR was confirmed. The results are shown in Figure 3. [Table 2]
[0066] As shown in Table 2 and Figure 3, the reverse transcriptases G2 and G6 obtained in this example were confirmed to exhibit thermostability similar to that of the mutant reverse transcriptase G7. Figure 4 shows the alignment of the reverse transcriptases G2 and G6 with the reverse transcriptase G7 and the wild-type reverse transcriptase. When the amino acid sequences of the reverse transcriptases G2 and G6 were confirmed, they contained LDLAAA or MDIATA at the six amino acid residues at positions 67, 175, 229, 308, 437, and 592, which characterize reverse transcriptases. Furthermore, the reverse transcriptase shown in SEQ ID NO:2 was confirmed to have the following amino acids in common with the amino acid sequences of the G2 and G6 reverse transcriptases but different from wild-type MMLV reverse transcriptase: (2) P at position 47, (5) V at position 62, (10) R at position 144, (14) T at position 233, (20) S at position 354, (25) L at position 429, (27) P at position 476, (29) D at position 495, (33) V at position 542, and (43) L at position 662. These amino acid residues were not found in wild-type MMLV reverse transcriptase but were found in common with the reverse transcriptases G2, G6, and G7, which exhibit similar thermostabilities, suggesting that they likely contribute to improved thermostability. On the other hand, among the amino acid sequences shown in SEQ ID NOS: 2 to 4, the amino acid sequences of (A) the region corresponding to positions 91 to 105, (B) the region corresponding to positions 109 to 120, (C) the region corresponding to positions 125 to 138, (D) the region corresponding to positions 146 to 157, (E) the region corresponding to positions 182 to 205, (F) the region corresponding to positions 220 to 228, (G) the region corresponding to positions 251 to 263, (H) the region corresponding to positions 302 to 319, (I) the region corresponding to positions 351 to 358, and (J) the region corresponding to positions 391 to 404 (the areas boxed as (A) to (J) in Figure 4) were confirmed to be highly conserved with the amino acid sequence of the corresponding region in the wild-type reverse transcriptase shown in SEQ ID NOS: 1. From these results, it is considered desirable to have fewer mutations in these regions. [Industrial Applicability]
[0067] The present invention provides a novel reverse transcriptase with excellent thermostability that is useful in the field of molecular biology, as well as reagents, kits, etc. that contain the reverse transcriptase. The present invention is particularly useful in gene expression analysis, and because it is highly versatile and convenient, it can be used not only for research purposes but also for clinical diagnosis, environmental testing, etc.
Claims
1. An amino acid sequence having 94% or more identity to the amino acid sequence shown in SEQ ID NO: 2, (1) the amino acid at the position corresponding to the 63rd amino acid is R; (2) the amino acid at the position corresponding to position 217 is Q; (3) the amino acid at the position corresponding to position 476 is P; and (4) the amino acid at the position corresponding to position 478 is I; and an amino acid sequence having at least one amino acid residue selected from the group consisting of: When heat-treated at 50°C for 10 minutes, it shows a residual activity rate of 70% or more. Reverse transcriptase.
2. The reverse transcriptase of claim 1, wherein the amino acid sequence comprises the following amino acid residues (i) to (vi): (i) the amino acid at the position corresponding to position 67 is L or M; (ii) the amino acid at the position corresponding to position 175 is D; (iii) the amino acid at the position corresponding to position 229 is L or I; (iv) the amino acid at the position corresponding to position 308 is A; (v) the amino acid at the position corresponding to position 437 is A or T; and (vi) The amino acid at the position corresponding to position 592 is A.
3. The reverse transcriptase according to claim 1 or 2, wherein the amino acid sequence comprises the following amino acid residue (3): (3) The amino acid at the position corresponding to position 476 is P.
4. The reverse transcriptase according to any one of claims 1 to 3, wherein the amino acid sequence has at least one amino acid residue selected from the group consisting of the following (5) to (10), (3), and (11) to (13): (5) the amino acid at the position corresponding to the 47th amino acid is P; (6) The amino acid at the position corresponding to the 62nd amino acid is V. (7) The amino acid at the position corresponding to position 144 is R. (8) The amino acid at the position corresponding to position 233 is T. (9) The amino acid at the position corresponding to position 354 is S. (10) The amino acid at the position corresponding to position 429 is L. (3) the amino acid at the position corresponding to position 476 is P; (11) The amino acid at the position corresponding to position 495 is D. (12) The amino acid at the position corresponding to position 542 is V; and (13) The amino acid at the position corresponding to position 662 is L.
5. A reverse transcriptase having 90% or more identity to the amino acid sequence shown in SEQ ID NO: 1, showing 70% or more residual activity when heat-treated at 50°C for 10 minutes, and having at least one amino acid residue selected from the group consisting of (1) to (4) below: (1) the amino acid at the position corresponding to the 63rd amino acid is R; (2) the amino acid at the position corresponding to position 217 is Q; (3) the amino acid at the position corresponding to position 476 is P; and (4) The amino acid at the position corresponding to position 478 is I.
6. The reverse transcriptase according to claim 5, which has an identity of 90% or more to the amino acid sequence shown in SEQ ID NO: 1 and has the following amino acid residues (3): (3) The amino acid at the position corresponding to position 476 is P.
7. The reverse transcriptase according to claim 5 or 6, which has an identity of 90% or more to the amino acid sequence shown in SEQ ID NO: 1 and has at least one amino acid residue selected from the group consisting of the following (5) to (10), (3), and (11) to (13): (5) the amino acid at the position corresponding to the 47th amino acid is P; (6) The amino acid at the position corresponding to the 62nd amino acid is V. (7) The amino acid at the position corresponding to position 144 is R. (8) The amino acid at the position corresponding to position 233 is T. (9) The amino acid at the position corresponding to position 354 is S. (10) The amino acid at the position corresponding to position 429 is L. (3) the amino acid at the position corresponding to position 476 is P; (11) The amino acid at the position corresponding to position 495 is D. (12) The amino acid at the position corresponding to position 542 is V; and (13) The amino acid at the position corresponding to position 662 is L.
8. The reverse transcriptase according to any one of claims 1 to 7, wherein the amino acid sequence of one or more regions selected from the group consisting of (A) a region corresponding to positions 91 to 105, (B) a region corresponding to positions 109 to 120, (C) a region corresponding to positions 125 to 138, (D) a region corresponding to positions 146 to 157, (E) a region corresponding to positions 182 to 205, (F) a region corresponding to positions 220 to 228, (G) a region corresponding to positions 251 to 263, (H) a region corresponding to positions 302 to 319, (I) a region corresponding to positions 351 to 358, and (J) a region corresponding to positions 391 to 404 of the amino acid sequence shown in SEQ ID NO: 1 or 2 has an identity of 90% or more to the amino acid sequence of a corresponding region in the amino acid sequence of SEQ ID NO: 1 or 2.
9. A reverse transcriptase described in any one of claims 1 to 8, having an amino acid sequence that is 97% or more identical to the amino acid sequence shown in SEQ ID NO:
2.
10. The reverse transcriptase according to any one of claims 1 to 9, which lacks RNase H activity.
11. A polynucleotide encoding the reverse transcriptase according to any one of claims 1 to 10.
12. A vector comprising the polynucleotide of claim 11.
13. A cell transformed with the vector of claim 12.
14. A reagent comprising the reverse transcriptase according to any one of claims 1 to 10, the polynucleotide according to claim 11, the vector according to claim 12, and / or the cell according to claim 13.
15. A method for producing the reverse transcriptase according to any one of claims 1 to 10, using the polynucleotide according to claim 11, the vector according to claim 12, the cell according to claim 13, and / or the reagent according to claim 14.
16. A method for synthesizing cDNA from an RNA template, using the reverse transcriptase according to any one of claims 1 to 10.
17. A kit comprising the reverse transcriptase according to any one of claims 1 to 10.
18. The kit according to claim 17, which is used to synthesize cDNA using RNA as a template.
Citation Information
Patent Citations
Angle detector
JP1986080002A
Variant type reverse transcriptase
JP2000139457A
Variant reverse transcriptase
WO2012020759A1
Heat-resistant reverse transcriptase mutant
WO2018110595A1
Variant reverse transcriptase exhibiting excellent stability
WO2021020245A1