Baculovirus Expression System

Abstract

The present disclosure relates to a heterologous recombinant baculovirus (rBV) expression system for the production of foreign heterologous proteins in insect cells. The system comprises a recombinant baculovirus backbone genome with a deletion of a cathepsin gene into which a foreign gene cassette can be integrated, and an insect cell that can be infected with Δv-cath-rBV and into which the foreign protein and / or viral vector or particle is expressed.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 62 / 866,741, filed June 26, 2019, and U.S. Provisional Application No. 63 / 012,568, filed April 20, 2020, each of which is incorporated by reference in its entirety.

[0002] The present invention is in the fields of molecular biology, virology and gene therapy. More specifically, the present invention relates to a baculovirus system for recombinant protein synthesis in insect cells. [Background technology]

[0003] Gene therapy has been developed to treat a number of disorders, such as cancer and gene-related diseases, and involves the use of recombinant proteins produced in mammalian systems using viral vectors.

[0004] Currently, several technologies exist in the field of recombinant protein and viral vector production that use different means to introduce foreign genes into host cells. For example, the traditional method of introducing AAV genes utilizes the transfection of mammalian cell lines, such as HEK-293 or HeLa cells, with triple or double plasmids (Xiao et al., 2003). , et al.(1998)J.Virol.72(3):2224-2232; Grimm , et al.(2003)Mol.Ther.7(6):839-850 Another technique utilizes herpes simplex virus (HSV) to infect mammalian cells, for example, for AAV production (Zhang et al., 2004). , et al.(1999)Hum.Gene Ther.10(15):2527-2537 ).

[0005] Unfortunately, AAV production yields in these systems have been low. For example, AAV vector production is hindered by the difficulty of generating sufficient HSV seed stocks. In addition, AAV vector production is difficult to scale up due to the inherent properties of adherent mammalian cells and the low yield of AAV production. Therefore, large-scale AAV production in these systems sufficient to obtain sufficient material for clinical trials is problematic.

[0006] Other recombinant protein and virus production systems include the use of baculovirus in insect cells (Chen (2008) Mol. Ther. 16(5): 924-930; Kotin (2011)Hum.Mol.Genet.20(R1):R2-6 The baculovirus expression vector (or bacmid) system (BEVS) is an established method for the production of recombinant proteins to be used as vaccines, therapeutic molecules, or diagnostic reagents (van Oers (2015)J.Gen.Virol.96(Pt 1):6-23 This system provides increased AAV production yields compared to other AAV production technologies (Galibert et al. (2011) J. Invertebr. Pathol. 107 Suppl:S80-93) However, this method resulted in degradation of the AAV capsid. It has been reported that removal of the baculovirus chitinase (chiA) and cathepsin (v-cath) genes improves the integrity of secreted recombinant proteins and prevents degradation of the AAV8 capsid (Galibert et al., 2011). et al.(2018)PLoS One 13(11):e0207414 However, removal of the chiA gene also eliminates the chitinase activity required to degrade chitin, a high molecular weight linear polymer of N-acetyl-D-glucosamine units synthesized in insect cells (Ishimwe et al.(2015)Virol.479-480:637-649 Without chiA activity, AAV particles produced in these insect cells are difficult to isolate from sticky cell lysates, which reduces the recovery rate of AAV particles.

[0007] Therefore, there is a need for improved expression systems that produce useful quantities of recombinant viral vectors and proteins that are not degraded and have useful levels of activity. Summary of the Invention

[0008] It has been discovered that recombinant baculovirus (rBV) with a genome lacking the v-cath gene allows expression of AAV capsid proteins with higher structural integrity from a cassette integrated into the rBV genome. Thus, rAAV isolated from insect cells infected with rBV lacking cathepsins has higher infectivity than rAAV isolated from insect cells infected with rBV containing cathepsins.

[0009] These discoveries were utilized to develop the present disclosure, which is directed, in part, to recombinant baculovirus systems, their components, and methods using specifically cured rBV for foreign protein expression.

[0010] In one aspect, the present disclosure provides a recombinant baculovirus (rBV) DNA backbone that includes a deletion of a chitinase gene and a v-cath gene and a DNA fragment that allows for the integration of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than when they are expressed from an rBV backbone without the deletion.

[0011] In some embodiments, the DNA fragment comprises DNA sequences homologous to two sequences flanking one or more foreign protein expression cassettes of the donor plasmid. In certain embodiments, the DNA fragment is derived from bMON14272. In some embodiments, the DNA fragment comprises an origin of replication. In certain embodiments, the origin of replication is mini-F replicon, ColE1, oriC, OriV, OriT, or OriS. In certain embodiments, the DNA fragment further comprises a reporter gene. In certain embodiments, the reporter gene is LacZα.

[0012] In some embodiments, the rBV DNA backbone further comprises a selectable marker expression gene cassette integrated into the cath-v deletion. In certain embodiments, the selectable marker expression gene cassette comprises an antibiotic resistance gene, and in certain embodiments, the antibiotic resistance gene is a kanamycin resistance gene, an ampicillin resistance gene, a tetracycline resistance gene, a gentamicin resistance gene, a blasticidin resistance gene, a chloramphenicol resistance gene, a streptomycin resistance gene, or a geneticin resistance gene. In other embodiments, the selectable marker expression gene cassette comprises a selectable marker gene encoding a visually detectable protein. In some embodiments, the selectable marker gene encodes a colorimetric protein, a fluorescent protein, a chromatographic protein, a chemiluminescent protein, or a luminescent protein.

[0013] The present disclosure also provides a recombinant baculovirus (rBV) genome comprising an rBV DNA backbone and a foreign protein expression cassette. The rBV DNA backbone contains a chitinase gene, a deletion of the v-cath gene, and a DNA fragment that allows for the integration of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than when they are expressed from an rBV backbone without the deletion. The foreign protein gene cassette contains at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow the foreign protein expression cassette to be integrated into the rBV DNA backbone.

[0014] In some embodiments, the at least one foreign protein gene in the foreign expression cassette comprises at least one viral protein gene and / or at least one mammalian protein gene. In certain embodiments, the viral protein gene encodes an AAV protein, an adenoviral protein, a retroviral protein, an SV40 protein, or a herpes simplex virus protein. In certain embodiments, the foreign protein expression cassette comprises a sequence encoding at least one AAV capsid protein. In certain embodiments, the at least one AAV protein is a VP1, VP2, VP3, and / or Rep protein, and in certain embodiments, the at least one SV40 protein is a VP1 major capsid protein.

[0015] In some embodiments, the foreign protein expression cassette comprises an insect promoter, such as a polyhedrin, p10, or p6.9 insect promoter, operably linked to at least one foreign protein gene.

[0016] In some embodiments, the two DNA sequences that allow the foreign protein expression cassette to be integrated into the DNA backbone are homologous to DNA sequences in the rBV DNA backbone. In certain embodiments, the two DNA sequences that allow the foreign protein expression cassette to be integrated into the DNA backbone are transposable elements. In certain embodiments, the two DNA sequences that allow the foreign protein expression cassette to be integrated into the DNA backbone are Tn7R and Tn7L.

[0017] In another aspect, the present disclosure provides a recombinant baculovirus (rBV) genome comprising an rBV DNA backbone and a foreign protein cassette. The rBV backbone comprises a chitinase gene, a deletion of the v-cath gene, a selectable marker gene cassette integrated into the cath-v deletion, and a DNA fragment that allows for integration of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than when they are expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow for integration of the foreign protein expression cassette into the rBV DNA backbone.

[0018] In yet another aspect, the present disclosure provides a recombinant baculovirus (rBV) vector or particle comprising an rBV genome and at least one baculovirus capsid protein. The rBV genome comprises an rBV DNA backbone and a foreign protein expression cassette, wherein the rBV DNA backbone comprises a chitinase gene, a deletion of the v-cath gene, and a DNA fragment that allows for integration of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than when they are expressed from an rBV backbone without the deletion, and the foreign protein gene cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow for integration of the foreign protein expression cassette into the rBV DNA backbone. In some embodiments, the rBV genome comprises an rBV backbone containing a foreign protein expression cassette encoding at least one AAV capsid protein.

[0019] In yet another aspect, the present disclosure provides a recombinant baculovirus (rBV) vector or particle comprising an rBV genome and at least one baculovirus capsid protein. The rBV genome comprises an rBV DNA backbone containing a chitinase gene, a deletion of the v-cath gene, a selectable marker gene cassette incorporated into the cath-v deletion, and a DNA fragment that allows for the incorporation of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than when they are expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow the incorporation of the one or more foreign protein expression cassettes into the rBV DNA backbone. In some embodiments, the rBV genome comprises an rBV backbone containing a foreign protein expression cassette encoding at least one AAV capsid protein.

[0020] The present disclosure also provides insect cells containing a recombinant baculovirus (rBV) vector or particle comprising an rBV genome and at least one baculovirus capsid protein. The rBV genome comprises an rBV DNA backbone containing a chitinase gene, a deletion of the v-cath gene, and a DNA fragment that allows for the integration of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than when they are expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow the foreign protein expression cassette to be integrated into the rBV DNA backbone.

[0021] In some embodiments, the insect cell is an Sf9, Sf21, S2, Trichoplusia ni, E4a, or BTI-TN-5B1-4 cell. In certain embodiments, the insect cell further comprises at least one foreign protein expressed from a foreign protein expression cassette in the rBV backbone of the rBV genome of the rBV vector or particle, and in certain embodiments, the at least one foreign protein is at least one AAV capsid protein.

[0022] Also provided herein are insect cells containing recombinant baculovirus vectors or particles comprising an rBV genome and at least one baculovirus capsid protein. The rBV genome comprises an rBV DNA backbone containing a chitinase gene, a deletion of the v-cath gene, a selectable marker gene incorporated into the cath-v deletion, and a DNA fragment that allows for the integration of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than when they are expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow the foreign protein expression cassette to be integrated into the rBV DNA backbone.

[0023] In some embodiments, the insect cell is an Sf9, Sf21, S2, Trichoplusia ni, E4a, or BTI-TN-5B1-4 cell. In certain embodiments, the insect cell further comprises at least one foreign protein expressed from a foreign protein expression cassette in the rBV backbone of the rBV genome of the rBV vector or particle, and in certain embodiments, the at least one foreign protein is at least one AAV capsid protein.

[0024] In another aspect, the present disclosure provides a heterologous expression system comprising an rBV vector or particle and an insect cell. The rBV vector or particle comprises an rBV genome and at least one baculovirus capsid protein. The rBV genome comprises an rBV DNA backbone that contains a chitinase gene, a deletion of the v-cath gene, and a DNA fragment that allows for the integration of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than when they are expressed from the rBV backbone without the deletion, and a foreign protein expression cassette that contains at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow the foreign protein expression cassette to be integrated into the rBV DNA backbone. The insect cells in the system are susceptible to infection and are capable of expressing at least one foreign protein encoded by the rBV backbone in the rBV vector or particle.

[0025] In some embodiments, the rBV vector or particle comprises an rBV backbone containing a foreign protein expression cassette, wherein the foreign protein expression cassette comprises a sequence encoding at least one AAV capsid protein. In some embodiments, the insect cell is an Sf9, Sf21, S2, Trichoplusia ni, E4a, or BTI-TN-5B1-4 cell.

[0026] In yet another aspect, the present disclosure provides a heterologous expression system comprising an rBV vector or particle and an insect cell. The recombinant baculovirus vector or particle comprises an rBV genome and at least one baculovirus capsid protein. The rBV genome comprises an rBV DNA backbone containing a chitinase gene, a deletion of the v-cath gene, a selectable marker cassette incorporated into the cath-v deletion, and a DNA fragment that allows for the integration of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than when they are expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow the foreign protein expression cassette to be integrated into the rBV DNA backbone. The insect cells of the system are susceptible to infection and are capable of expressing at least one foreign protein encoded by the rBV backbone in the rBV vector or particle.

[0027] In some embodiments, the rBV vector or particle comprises an rBV backbone containing a foreign protein expression cassette, wherein the foreign protein expression cassette comprises a sequence encoding at least one AAV capsid protein. In some embodiments, the insect cell is an Sf9, Sf21, S2, Trichoplusia ni, E4a, or BTI-TN-5B1-4 cell.

[0028] The present disclosure also provides a non-adhesive insect cell lysate comprising a recombinant baculovirus (rBV) genome and at least one foreign protein encoded by the rBV genome and expressed in the lysate. The rBV genome comprises an rBV DNA backbone containing a chitinase gene, a deletion of the v-cath gene, and a DNA fragment that allows for the integration of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than if they were expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow the foreign protein expression cassette to be integrated into the rBV DNA backbone.

[0029] In some embodiments, the at least one foreign protein encoded by the rBV genome is at least one AAV capsid protein. In some embodiments, the insect cell lysate is derived from Sf9, Sf21, S2, Trichoplusia ni, E4a, or BTI-TN-5B1-4 insect cells infected with the rBV genome.

[0030] In another aspect, the present disclosure also provides a non-adhesive insect cell lysate comprising a recombinant baculovirus (rBV) genome and at least one foreign protein encoded by the rBV genome and expressed in the lysate. The rBV genome comprises an rBV DNA backbone containing a chitinase gene, a deletion of the v-cath gene, a selectable marker gene cassette incorporated into the cath-v deletion, and a DNA fragment that allows for the integration of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than if they were expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow the foreign protein expression cassette to be integrated into the rBV DNA backbone.

[0031] In some embodiments, the at least one foreign protein encoded by the rBV genome is at least one AAV capsid protein. In some embodiments, the insect cell lysate is derived from Sf9, Sf21, S2, Trichoplusia ni, E4a, or BTI-TN-5B1-4 insect cells infected with the rBV genome.

[0032] In yet another aspect, the disclosure provides a method for producing a foreign protein in insect cells, comprising infecting insect cells with a recombinant baculovirus (rBV) vector or particle, culturing the infected cells under conditions conducive to expression of at least one foreign protein gene, and isolating foreign protein particles comprising the rBV genome and at least one baculovirus capsid protein. The rBV vector or particle comprises an rBV DNA backbone that includes a chitinase gene, a deletion of the v-cath gene, and a DNA fragment that allows for the integration of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than if they were expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow the foreign protein expression cassette to be integrated into the rBV DNA backbone.

[0033] In some embodiments, the insect cells are lysed to isolate the foreign protein. In certain embodiments, the foreign protein is at least one recombinant AAV capsid protein.

[0034] The present disclosure also provides a recombinant AAV capsid protein produced by this method.

[0035] In another aspect, the present disclosure provides a method for producing a foreign protein in insect cells, comprising infecting insect cells with a recombinant baculovirus (rBV) vector or particle, culturing the infected cells under conditions conducive to expression of at least one foreign protein gene, and isolating the foreign protein. The rBV vector or particle comprises an rBV DNA backbone containing a chitinase gene, a deletion of the v-cath gene, a selectable marker gene cassette incorporated into the cath-v deletion, and a DNA fragment that allows for the integration of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than when they are expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow the foreign protein expression cassette to be integrated into the rBV DNA backbone.

[0036] In some embodiments, the insect cells are lysed to isolate the foreign protein. In certain embodiments, the foreign protein is at least one recombinant AAV capsid protein.

[0037] The present disclosure also provides a recombinant AAV capsid protein produced by this method.

[0038] The foregoing and other objects of the present disclosure, its various features, as well as the disclosure itself, may be more fully understood from the following description when read in conjunction with the accompanying drawings in which: [Brief explanation of the drawings]

[0039] [Figure 1A]FIG. 1 is a diagrammatic representation of a recombinant baculovirus (rBV) DNA backbone or bacmid according to the present disclosure showing the deletion of the v-cath gene between nucleotides 107,034 and 107,904 and replacement of the deletion with a CAT expression cassette and a green fluorescent protein (GFP) expression cassette flanked by two FRTs. [Figure 1B] 1 is a diagrammatic representation of a recombinant baculovirus (rBV) DNA backbone or bacmid according to the present disclosure, showing the deletion of the v-cath gene between nucleotides 107,034 and 107,904 and replacement of the deletion with a CAT expression cassette and a green fluorescent protein (GFP) expression cassette flanked by two FRTs. Foreign protein expression cassette(s) can be integrated into the rBV DNA backbone by homologous recombination. [Figure 2A] Schematic diagram of a representative junction DNA sequence between v-cath, the CAT expression cassette, and the GFP expression cassette in the Δv-cath rBV backbone, where bases 51 to 1066 are the CAT expression cassette, 1067 to 3223 are the GFP expression cassette, and bases 1 to 50 and 3224 to 3275 are the remaining v-cath sequence, the sequence of which is shown in SEQ ID NO: 12. [Figure 2B] Schematic diagram of a representative junction DNA sequence between v-cath, the CAT expression cassette, and the GFP expression cassette in the Δv-cath rBV backbone, where bases 51 to 1066 are the CAT expression cassette, 1067 to 3223 are the GFP expression cassette, and bases 1 to 50 and 3224 to 3275 are the remaining v-cath sequence, the sequence of which is shown in SEQ ID NO: 12. [Figure 2C] Schematic diagram of a representative junction DNA sequence between v-cath, the CAT expression cassette, and the GFP expression cassette in the Δv-cath rBV backbone, where bases 51 to 1066 are the CAT expression cassette, 1067 to 3223 are the GFP expression cassette, and bases 1 to 50 and 3224 to 3275 are the remaining v-cath sequence, the sequence of which is shown in SEQ ID NO: 12. [Figure 3]FIG. 1 is a diagrammatic representation of an exemplary foreign protein expression cassette design, comprising an insect polyhedrin promoter (polh), AAV Rep and Cap (foreign protein) genes, and a gentamicin selectable marker gene (Genta) flanked by Tn7R and Tn7L sites for integration of the cassette into the recombinant baculovirus Δv-cath rBV DNA backbone. [Figure 4A] 4 is a schematic diagram of the DNA sequence of the foreign protein expression cassette described in FIG. 3, including a representative polh insect promoter and Tn7L and Tn7R sites for integration of the foreign protein expression cassette into the recombinant baculovirus Δv-cath rBV DNA backbone, where the sequence is shown in SEQ ID NO: 13. [Figure 4B] 4 is a schematic diagram of the DNA sequence of the foreign protein expression cassette described in FIG. 3, including a representative polh insect promoter and Tn7L and Tn7R sites for integration of the foreign protein expression cassette into the recombinant baculovirus Δv-cath rBV DNA backbone, where the sequence is shown in SEQ ID NO: 13. [Figure 4C] 4 is a schematic diagram of the DNA sequence of the foreign protein expression cassette described in FIG. 3, including a representative polh insect promoter and Tn7L and Tn7R sites for integration of the foreign protein expression cassette into the recombinant baculovirus Δv-cath rBV DNA backbone, where the sequence is shown in SEQ ID NO: 13. [Figure 4D] 4 is a schematic diagram of the DNA sequence of the foreign protein expression cassette described in FIG. 3, including a representative polh insect promoter and Tn7L and Tn7R sites for integration of the foreign protein expression cassette into the recombinant baculovirus Δv-cath rBV DNA backbone, where the sequence is shown in SEQ ID NO: 13. [Figure 4E]4 is a schematic diagram of the DNA sequence of the foreign protein expression cassette described in FIG. 3, including a representative polh insect promoter and Tn7L and Tn7R sites for integration of the foreign protein expression cassette into the recombinant baculovirus Δv-cath rBV DNA backbone, where the sequence is shown in SEQ ID NO: 13. [Figure 4F] 4 is a schematic diagram of the DNA sequence of the foreign protein expression cassette described in FIG. 3, including a representative polh insect promoter and Tn7L and Tn7R sites for integration of the foreign protein expression cassette into the recombinant baculovirus Δv-cath rBV DNA backbone, where the sequence is shown in SEQ ID NO: 13. [Figure 4G] 4 is a schematic diagram of the DNA sequence of the foreign protein expression cassette described in FIG. 3, including a representative polh insect promoter and Tn7L and Tn7R sites for integration of the foreign protein expression cassette into the recombinant baculovirus Δv-cath rBV DNA backbone, where the sequence is shown in SEQ ID NO: 13. [Figure 4H] 4 is a schematic diagram of the DNA sequence of the foreign protein expression cassette described in FIG. 3, including a representative polh insect promoter and Tn7L and Tn7R sites for integration of the foreign protein expression cassette into the recombinant baculovirus Δv-cath rBV DNA backbone, where the sequence is shown in SEQ ID NO: 13. [Figure 5A]5A-5C are diagrammatic representations of exemplary Δv-cath rBV genomes, each containing a selectable marker CAT expression cassette and a GFP expression cassette inserted at the position of the v-cath deletion, further comprising a gentamicin selectable marker gene (Genta) and a general foreign protein expression cassette carrying foreign gene 1 and foreign gene 2, each inserted into the bMON14272 bacmid (FIG. 5A); a general foreign protein expression cassette carrying Genta, AAV Rep, and Cap AAV genes (FIG. 5B); a general foreign protein expression cassette carrying Genta, an AAV genome consisting of the luciferase gene (FIG. 5C); and a general foreign protein expression cassette carrying Genta and mammalian protein (human antibody heavy chain and human antibody light chain) genes (FIG. 5D). [Figure 5B] 5A-5C are diagrammatic representations of exemplary Δv-cath rBV genomes, each containing a selectable marker CAT expression cassette and a GFP expression cassette inserted at the position of the v-cath deletion, further comprising a gentamicin selectable marker gene (Genta) and a general foreign protein expression cassette carrying foreign gene 1 and foreign gene 2, each inserted into the bMON14272 bacmid (FIG. 5A); a general foreign protein expression cassette carrying Genta, AAV Rep, and Cap AAV genes (FIG. 5B); a general foreign protein expression cassette carrying Genta, an AAV genome consisting of the luciferase gene (FIG. 5C); and a general foreign protein expression cassette carrying Genta and mammalian protein (human antibody heavy chain and human antibody light chain) genes (FIG. 5D). [Figure 5C]5A-5C are diagrammatic representations of exemplary Δv-cath rBV genomes, each containing a selectable marker CAT expression cassette and a GFP expression cassette inserted at the position of the v-cath deletion, further comprising a gentamicin selectable marker gene (Genta) and a general foreign protein expression cassette carrying foreign gene 1 and foreign gene 2, each inserted into the bMON14272 bacmid (FIG. 5A); a general foreign protein expression cassette carrying Genta, AAV Rep, and Cap AAV genes (FIG. 5B); a general foreign protein expression cassette carrying Genta, an AAV genome consisting of the luciferase gene (FIG. 5C); and a general foreign protein expression cassette carrying Genta and mammalian protein (human antibody heavy chain and human antibody light chain) genes (FIG. 5D). [Figure 5D] 5A-5C are diagrammatic representations of exemplary Δv-cath rBV genomes, each containing a selectable marker CAT expression cassette and a GFP expression cassette inserted at the position of the v-cath deletion, further comprising a gentamicin selectable marker gene (Genta) and a general foreign protein expression cassette carrying foreign gene 1 and foreign gene 2, each inserted into the bMON14272 bacmid (FIG. 5A); a general foreign protein expression cassette carrying Genta, AAV Rep, and Cap AAV genes (FIG. 5B); a general foreign protein expression cassette carrying Genta, an AAV genome consisting of the luciferase gene (FIG. 5C); and a general foreign protein expression cassette carrying Genta and mammalian protein (human antibody heavy chain and human antibody light chain) genes (FIG. 5D). [Figure 6] 1 is a flow chart showing the process of v-cath removal and AAV vector production in insect cells using the rBV system according to the present disclosure. [Figure 7A] 1 is a diagrammatic representation of the integration of a foreign expression cassette into the Δv-cath rBV DNA backbone by homologous recombination. [Figure 7B] 1 is a diagrammatic representation of the integration of a foreign expression cassette into the Δv-cath rBV DNA backbone by the transposase. [Figure 8]1 is a graphical representation of the titers of WT-rBV and Δv-cath rBV according to the present disclosure, each containing a Cap6-rep expression cassette, a GFP expression cassette, or a Cap2-7m8-rep expression cassette. [Figure 9] A representation of an SDS-PAGE gel stained with Simply Blue showing AAV capsid proteins expressed from different recombinant baculovirus vectors carrying the capsid VP1, VP2, and VP3 genes of different AAV serotypes, both with and without the v-cath gene, where M is a protein ladder, lanes 1 and 5 are AAV9 control, lanes 2 and 6 are AAV7m8-GFP, lanes 3 and 7 are AAV8-GFP, lanes 4 and 8 are AAV6-GFP, lanes 6-8 are AAV vectors, and arrows indicate degradation products. [Figure 10A] Figures 10A to 10F are a series of fluorescent images of HEK-293 (mammalian) cells transduced with the same amount of AAV vector containing a GFP expression cassette produced by rBV both with and without the v-cath gene, where Figures 10A to 10C show the AAV vector expressing GFP produced by WT-rBV, Figures 10D to 10F show the AAV vector expressing GFP produced by rBV lacking v-cath, 10A and 10D are AAV7m8-GFP, 10B and 10E are AAV8-GFP, and 10C and 10F are AAV6-GFP. [Figure 10B] Figures 10A to 10F are a series of fluorescent images of HEK-293 (mammalian) cells transduced with the same amount of AAV vector containing a GFP expression cassette produced by rBV both with and without the v-cath gene, where Figures 10A to 10C show the AAV vector expressing GFP produced by WT-rBV, Figures 10D to 10F show the AAV vector expressing GFP produced by rBV lacking v-cath, 10A and 10D are AAV7m8-GFP, 10B and 10E are AAV8-GFP, and 10C and 10F are AAV6-GFP. [Figure 10C]Figures 10A to 10F are a series of fluorescent images of HEK-293 (mammalian) cells transduced with the same amount of AAV vector containing a GFP expression cassette produced by rBV both with and without the v-cath gene, where Figures 10A to 10C show the AAV vector expressing GFP produced by WT-rBV, Figures 10D to 10F show the AAV vector expressing GFP produced by rBV lacking v-cath, 10A and 10D are AAV7m8-GFP, 10B and 10E are AAV8-GFP, and 10C and 10F are AAV6-GFP. [Figure 10D] Figures 10A to 10F are a series of fluorescent images of HEK-293 (mammalian) cells transduced with the same amount of AAV vector containing a GFP expression cassette produced by rBV both with and without the v-cath gene, where Figures 10A to 10C show the AAV vector expressing GFP produced by WT-rBV, Figures 10D to 10F show the AAV vector expressing GFP produced by rBV lacking v-cath, 10A and 10D are AAV7m8-GFP, 10B and 10E are AAV8-GFP, and 10C and 10F are AAV6-GFP. [Figure 10E] Figures 10A to 10F are a series of fluorescent images of HEK-293 (mammalian) cells transduced with the same amount of AAV vector containing a GFP expression cassette produced by rBV both with and without the v-cath gene, where Figures 10A to 10C show the AAV vector expressing GFP produced by WT-rBV, Figures 10D to 10F show the AAV vector expressing GFP produced by rBV lacking v-cath, 10A and 10D are AAV7m8-GFP, 10B and 10E are AAV8-GFP, and 10C and 10F are AAV6-GFP. [Figure 10F]Figures 10A to 10F are a series of fluorescent images of HEK-293 (mammalian) cells transduced with the same amount of AAV vector containing a GFP expression cassette produced by rBV both with and without the v-cath gene, where Figures 10A to 10C show the AAV vector expressing GFP produced by WT-rBV, Figures 10D to 10F show the AAV vector expressing GFP produced by rBV lacking v-cath, 10A and 10D are AAV7m8-GFP, 10B and 10E are AAV8-GFP, and 10C and 10F are AAV6-GFP. [Figure 11] FIG. 1 is a diagrammatic representation of the Δv-cath recombinant baculovirus backbone containing only the CAT expression cassette flanked by two FRTs. [Figure 12] FIG. 1 is a diagrammatic representation of the baculovirus backbone, Δv-cath rBV, after removal of the CAT expression cassette, leaving the GFP expression cassette and a single FRT site. [Figure 13] 1 is a diagrammatic representation of the Δv-cath rBV backbone after removal of the CAT expression cassette, leaving one FRT site. [Figure 14A] 1 is a photographic representation of an agarose gel electrophoresis image showing removal of the CAT expression cassette from the Δv-cath rBV backbone. The smaller PCR fragment (2,345 bp) in lanes 1-11 compared to lanes 12 and 13 (3,245 bp) shows removal of the CAT expression cassette from the Δv-cath rBV backbone containing both the CAT and GFP expression cassettes. [Figure 14B] 1 is a photographic representation of an agarose gel electrophoresis image showing removal of the CAT expression cassette from the Δv-cath rBV backbone. A 651 bp PCR fragment is shown in lanes 1, 5, and 7, indicating the correct fragment size after removal of the CAT expression cassette from the Δv-cath rBV backbone, leaving only one FRT site. [Figure 15A](Figure 15A; SEQ ID NO: 14) Schematic of DNA sequencing analysis showing removal of the CAT expression cassette from a Δv-cath rBV backbone containing CAT and GFP expression cassettes, and (Figure 15B; SEQ ID NO: 15) a Δv-cath rBV backbone containing only the CAT expression cassette. [Figure 15B] (Figure 15A; SEQ ID NO: 14) Schematic of DNA sequencing analysis showing removal of the CAT expression cassette from a Δv-cath rBV backbone containing CAT and GFP expression cassettes, and (Figure 15B; SEQ ID NO: 15) a Δv-cath rBV backbone containing only the CAT expression cassette. [Figure 16A] 16A-16D are a series of diagrammatic representations of an exemplary Δv-cath rBV genome, further comprising: a general foreign protein expression cassette carrying a gentamicin selectable marker gene (Genta) and foreign gene 1 and foreign gene 2, each inserted into the bMON14272 bacmid, leaving only one FRT site in place of the v-cath deletion after removal of the CAT expression cassette (Figure 16A); a general foreign protein expression cassette carrying Genta, AAV Rep, and Cap AAV genes (Figure 16B); a general foreign protein expression cassette carrying an AAV genome consisting of Genta, a luciferase gene (Figure 16C); and a general foreign protein expression cassette carrying Genta and mammalian protein (human antibody heavy chain and human antibody light chain) genes (Figure 16D). [Figure 16B]16A-16D are a series of diagrammatic representations of an exemplary Δv-cath rBV genome, further comprising: a general foreign protein expression cassette carrying a gentamicin selectable marker gene (Genta) and foreign gene 1 and foreign gene 2, each inserted into the bMON14272 bacmid, leaving only one FRT site in place of the v-cath deletion after removal of the CAT expression cassette (Figure 16A); a general foreign protein expression cassette carrying Genta, AAV Rep, and Cap AAV genes (Figure 16B); a general foreign protein expression cassette carrying an AAV genome consisting of Genta, a luciferase gene (Figure 16C); and a general foreign protein expression cassette carrying Genta and mammalian protein (human antibody heavy chain and human antibody light chain) genes (Figure 16D). [Figure 16C] 16A-16D are a series of diagrammatic representations of an exemplary Δv-cath rBV genome, further comprising: a general foreign protein expression cassette carrying a gentamicin selectable marker gene (Genta) and foreign gene 1 and foreign gene 2, each inserted into the bMON14272 bacmid, leaving only one FRT site in place of the v-cath deletion after removal of the CAT expression cassette (Figure 16A); a general foreign protein expression cassette carrying Genta, AAV Rep, and Cap AAV genes (Figure 16B); a general foreign protein expression cassette carrying an AAV genome consisting of Genta, a luciferase gene (Figure 16C); and a general foreign protein expression cassette carrying Genta and mammalian protein (human antibody heavy chain and human antibody light chain) genes (Figure 16D). [Figure 16D]16A-16D are a series of diagrammatic representations of an exemplary Δv-cath rBV genome, further comprising: a general foreign protein expression cassette carrying a gentamicin selectable marker gene (Genta) and foreign gene 1 and foreign gene 2, each inserted into the bMON14272 bacmid, leaving only one FRT site in place of the v-cath deletion after removal of the CAT expression cassette (Figure 16A); a general foreign protein expression cassette carrying Genta, AAV Rep, and Cap AAV genes (Figure 16B); a general foreign protein expression cassette carrying an AAV genome consisting of Genta, a luciferase gene (Figure 16C); and a general foreign protein expression cassette carrying Genta and mammalian protein (human antibody heavy chain and human antibody light chain) genes (Figure 16D). DETAILED DESCRIPTION OF THE INVENTION

[0040] The disclosures of these patents, patent applications, and publications are hereby incorporated by reference into this application in their entireties in order to more fully describe the state of the art as known to those skilled in the art as of the date of the invention described and claimed herein. In the event of any conflict between the patents, patent applications, and publications and this disclosure, the present disclosure will control.

[0041] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The initial definition provided for a group or term herein applies to that group or term throughout this disclosure, unless otherwise stated, either individually or as part of another group.

[0042] The term "bacmid" refers to a shuttle vector that can be propagated in both E. coli and insect cells. The Δv-cath bacmid is a bacmid with a deletion of the v-cathepsin gene.

[0043] The term "recombinant baculovirus (rBV) DNA backbone" refers to a vector containing a bacterial origin of replication, an antibiotic resistance gene and a mini-att Tn7 site that allows integration of an expression cassette into the backbone, as well as a cathepsin gene, as described by Luckow et al. (1993). J. Virol. 67(8):4566 The term "bacmid" refers to a bacmid containing a baculovirus genome as described by et al.

[0044] The Δv-cath rBV backbone or Δv-cath DNA backbone is a bacmid that contains a deletion of the v-cathepsin gene and into which foreign gene cassettes containing viral and / or mammalian genes can be inserted. The terms "Δv-cath" and "v-cath (or cathepsin) gene deletion" are used interchangeably herein.

[0045] The term "recombinant baculovirus (rBV) genome" is used herein to mean a baculovirus DNA genome containing at least one expression cassette encoding at least one foreign protein. When the rBV genome contains a deleted v-cath gene, it is referred to as a "Δv-cath-rBV genome."

[0046] An rBV vector refers to a recombinant baculovirus that carries the rBV genome, is packaged in a baculovirus capsid, and is capable of infecting insect cells.

[0047] "Virus particle" refers to a biological entity that contains a shell formed by the intracellular expression and efficient assembly of capsid proteins and genetic information in the form of RNA or DNA.

[0048] "Selectable marker gene" includes genes encoding selectable marker proteins, such as, but not limited to, colorimetric proteins or antibiotic resistance proteins, that are useful for identifying or selecting E. coli cells that have been successfully transformed with the bacmid and for identifying and selecting insect or mammalian cells that have been successfully infected with rBV.

[0049] A "selectable marker gene cassette" is a DNA sequence encoding a non-native selectable marker gene operably linked to an E. coli or insect promoter and containing two insert sequences that allow for integration of the cassette into a DNA backbone.

[0050] As used herein, the term "foreign protein" refers to a protein that is not encoded by the wild-type baculovirus genome. Such proteins include, but are not limited to, viral proteins and non-insect proteins, such as mammalian proteins.

[0051] A "foreign protein expression cassette" is a DNA sequence encoding at least one non-baculoviral protein, e.g., a viral protein and / or a mammalian protein, operably linked to an insect promoter permitting expression in insect cells, and may further include a DNA sequence operably linked to a mammalian gene promoter permitting expression in mammalian cells. The foreign gene expression cassette may further be linked to a selectable marker gene and an insertion sequence permitting integration of the foreign gene expression cassette into the recombinant baculovirus DNA backbone.

[0052] A "donor plasmid" is a DNA vector or plasmid carrying a foreign protein expression cassette flanked by recombination elements, such as transposons, that can be used to transfer the foreign protein expression cassette into a bacmid to create a recombinant baculovirus (rBV) genome.

[0053] The present disclosure relates to a recombinant baculovirus (rBV) expression system for the production of foreign heterologous proteins, including mammalian proteins, in insect cells that are useful for gene therapy. The system includes a recombinant baculovirus genome (Δv-cath-rBV) with a deletion of a cathepsin gene into which a foreign gene cassette can be integrated, and an insect cell that can be infected with the Δv-cath-rBV and into which the foreign protein and / or viral vector or particle is expressed or produced.

[0054] Insect cells infected with rBV containing deletions of chitinase A and v-cathepsin are commonly used for the expression of recombinant proteins, especially AAV capsid proteins (Kab a et al. (2004)J.Virol.Meth.122(1):113-118 ;Galibert et al. (2018)PLoS One 13(11):e0207414 However, deletion of both chiA and v-cath results in a gelatinous lysate due to the absence of chitinase A, which cleaves the chitin-rich membrane of insect cells, and the gelatinous nature of the lysate reduces the isolation of proteins from this sticky lysate.

[0055] The system of the present invention unexpectedly allows for the efficient production of foreign proteins of interest and viral vectors and particles without degradation in quantities and infectivity levels sufficient to be useful for therapeutic purposes. Compared to systems that use infection of insect cells with rBVs containing both chitinase A gene deletions and v-cathepsin gene deletions, the use of the rBV system of the present invention results in higher AAV yields and higher structural integrity of the AAV capsid, particularly for certain AAV mutants. This system also allows for the direct expression of mammalian genes in insect cells.

[0056] Δv-cath-baculovirus backbone The baculovirus DNA backbone according to the present disclosure contains a deletion of the cathepsin gene. One Δv-cath DNA backbone according to the present disclosure is shown in Figure 1. A and 1BThe deletion is between nucleotides 107,034 and 107,904 based on GenBank ID: NC_001623. In one non-limiting example shown in Figure 1A, the Δv-cath-DNA backbone is a mini-amplified fragment that allows for the insertion of one or more exogenous gene cassettes for expression of exogenous proteins and nucleic acids of interest. t t Tn7 site. Another example shown in Figure 1B is GenBank ID NC DNA fragments of the Δv-cath-rBV DNA backbone from nucleotides 3272 to 4518 and 5270 to 6689 based on _001623 were cloned into the pBacPAK shuttle plasmid so that they were flanked by one or more foreign gene cassettes, so that one or more foreign gene cassettes could be inserted into the Δv-cath-rBV DNA backbone by homologous recombination.

[0057] In some rBV backbones, a selectable marker cassette is incorporated into the Δv-cath deletion. For example, the v-cath deletion can be replaced with a chloramphenicol (CAT) selectable marker expression cassette (CAT promoter-CAT ORF-polyA) flanked by two FRTs (see Figure 11). Alternatively, in Figure 1B, the Δv-cath deletion was replaced with a CAT selectable marker expression cassette flanked by two FRTs and a selectable marker, green fluorescent protein (GFP) expression cassette (CMV promoter-GFP-WPRE-polyA). The latter selectable marker expression cassette is useful for tracking successful infection of insect cells. The cassette can alternatively contain genes encoding other selectable markers, such as other colorimetric, fluorescent, or chemiluminescent marker proteins. Useful fluorescent marker proteins include, but are not limited to, red fluorescent protein, yellow fluorescent protein, blue fluorescent protein, and luciferase. Useful colorimetric marker proteins include, but are not limited to, β-galactosidase (lacZ) and secreted placental alkaline phosphatase (SEAP). Useful antibiotic resistance genes are also acceptable selectable markers. Such genes include, but are not limited to, kanamycin resistance, ampicillin resistance, tetracycline resistance, gentamicin resistance, blasticidin resistance, or chloramphenicol resistance.

[0058] Another representative Δv-cath rBV DNA backbone is shown in Figure 13. This backbone does not contain a selectable marker gene expression cassette. It can be generated from a Δv-cath rBV DNA backbone containing a CAT expression cassette by genome engineering using FLP-FRT recombination technology, which can remove the CAT expression cassette between the FRT sites, leaving only one FRT site in the Δv-cath rBV DNA backbone, as illustrated in Figure 11.

[0059] The rBV Δv-cath DNA backbone according to the present disclosure contains the chitinase gene ( A, 1B , 11, 12, and 13 (positions 105,282-106,937). In addition, the backbone contains a DNA fragment that allows for the integration of one or more foreign protein expression cassettes into the backbone. Useful examples of this fragment include, but are not limited to, a Tn7 transposon fragment. For example, in the rBV DNA backbone shown in Figure 1A, this fragment is located within the LacZ coding sequence between the kanamycin gene and the mini-F replication sequence in the bMON14272 rBV DNA backbone.

[0060] Synthesis of Δv-cath skeleton The Δv-cath backbone can be generated from a bacmid containing a WT baculovirus genome (AcMNPV (NC_001623)) in which a composite fragment (Kan LacZ+mini-att Tn7 mini-F replicon) has been inserted into the polyhedrin region, as illustrated in bMON14272 (see Example 2), or can be synthesized de novo.

[0061] Starting from a bacmid, a CAT selectable marker expression cassette flanked by two flippase recognition targets (FRTs) can be PCR amplified using primers 2846 (5'-TAATAAATGACTGCAGTAGACGCAAGTTCGTTTCTCATACCACAGGCGTTT CCATATGAATATCCTCCTTA-3') (SEQ ID NO: 1) and 6281 (5'-ATAACTAGTCAATAATCAATGTCGTGTAGGCTGGAGCTGCTTCGAA-3') (SEQ ID NO: 2) and plasmid pKD3 as template. A GFP (or other selectable marker) expression cassette can be PCR amplified using primers 5701 (5'-GACATTGATTATTGACTAGTTATTAATAGT-3') (SEQ ID NO: 3) and 6282 (5'-GAACAAAATTTTGTTTTATTTGTTTGTGTACGGCGTTGTAAACAGCGCGGT TAGATCCAGACATGATAAGAT-3') (SEQ ID NO: 4) and plasmid V376 as template. The two PCR fragments can then be ligated to form a larger PCR fragment using primers 6298 (5'-TAATAAATGACTGCAGTAGACGCAA-3') (SEQ ID NO:5) and 6299 (5'-GAACAAAATTTTGTTTTATTTGTTTGTGTA-3') (SEQ ID NO:6) and the two PCR fragments as templates. This larger PCR fragment can be synthesized using the λred system (Datsenko et al. (2000) Proc. Nat. Acad. Sci. USA 97(12):6640-6645; and Thomason (2014)Curr.Protoc.Mol.Biol.106:1 16 11-39 ) can be recombined into the v-cath region between nucleotides 107,034 and 107,904 to disrupt the v-cath gene. The junction sequence between the CAT expression cassette and the GFP expression cassette and the remaining v-cath are shown in Figure 2. A~2C Shown below.

[0062] The Δv-cath DNA backbone without the selectable marker gene cassette can be generated from a bacmid, e.g., bMON14272, or synthesized de novo. Starting from a bacmid, a CAT selectable marker expression cassette flanked by two flippase recognition targets (FRTs) can be PCR amplified using primers 2845 (5'-GAACAAAATTTTGTTTTATTTGTTTGTGTACGGCGTTGTAAACAGCG CGGTT GTGTAGGCTGGAGCTGCT-3') (SEQ ID NO:7) and 2846 (5'-TAATAAATGACTGCAGTAGACGCAAGTTCGTTTCTCATACCACAG GCGTT TCCATATGAATATCCTCCTTA-3') (SEQ ID NO:1) and the plasmid pKD3 as template. This PCR fragment containing the CAT expression cassette flanked by two FRTs can be cloned using the λred system (Datsenko et al.(2000)Proc.Nat.l Acad.Sci.USA 97(12):6640-6645 Thomason (2014) Curr. Protoc. Mol. Biol. 106: 1 16 11-39 ) can be recombined into the v-cath region between nucleotides 107,034 and 107,904 to disrupt the v-cath gene. After selection of the bacmid DNA and confirmation of the cathepsin deletion, the CAT expression cassette can be removed by FLP-FRT recombination technology, leaving only one FRT site in the bacmid, as shown in Figure 13.

[0063] Δv-cath rBV genome The rBV genome of the present disclosure can replicate in E. coli cells and in insect cells. It comprises a Δv-cath DNA backbone and a foreign protein expression cassette integrated into the Δv-cath rBV genome, as described above. The foreign protein expression cassette comprises a gene or genes encoding a foreign protein of interest to be expressed in insect cells, as well as a gene or genes encoding other proteins of interest to be expressed in mammalian cells. Useful genes encoding foreign proteins of interest for expression in insect cells include, but are not limited to, viral and / or mammalian proteins.

[0064] Useful expressed viral proteins can form the structural portion or capsid of a vector carrying a mammalian gene of interest and capable of delivery to mammalian cells. For example, a foreign protein expression cassette can include genes encoding AAV viral proteins, such as Rep and capsid (Cap) proteins (Figure 5B). Other viral proteins useful in gene therapy methods include, but are not limited to, hexon, penton complex, fiber protein from adenovirus, matrix, capsid, nucleocapsid proteins from retroviruses, including, but not limited to, lentivirus, VP5, VP23, VP19C, VP26, and capsid-vertex-specific component proteins from herpes simplex virus (HSV), and the VP1 major protein from SV40.

[0065] Useful mammalian proteins that can be expressed directly in insect cells include, but are not limited to, human immunoglobulins, human serum albumin, erythropoietin-α, and Factor VIII.

[0066] The foreign protein cassette also contains regulatory elements, including, but not limited to, an insect cell promoter that allows the expression of an operably linked gene in insect cells. Useful insect promoters include, but are not limited to, the polyhedrin (polh), p10, OpIE2, or p6.9 insect promoter. If the cassette contains a mammalian gene that is to be expressed in mammalian cells, a promoter that allows the expression of the mammalian gene in mammalian cells is operably linked to the gene. Useful mammalian promoters include, but are not limited to, the CMV, SV40, pGK, EF1a, synapsin, chicken β-actin, and CamKII promoters.

[0067] The foreign protein expression cassette may also be linked to one or more additional selectable marker genes, which are expressed upon infection of insect cells and are different from the selectable marker gene in the selectable marker expression cassette described above (if present in the rBV backbone).

[0068] The foreign protein expression cassette is flanked by DNA transposable elements that allow it to be integrated into the rBV DNA backbone at a specific nucleic acid site or position. Useful DNA transposable elements include, but are not limited to, Tn7L and Tn7R (Figure 1A). Alternatively, the foreign protein expression cassette is flanked by sequences homologous to the rBV genome, e.g., sequences between 3,272 and 4,518 and between 5,270 and 6,689, that allow it to be integrated into the rBV DNA backbone by the homologous recombination mechanism shown in Figure 1B.

[0069] As shown in Figure 6, integration of a cassette into the baculovirus backbone can be achieved by transformation of a donor plasmid (e.g., pFastBac-1). The donor plasmid contains an appropriate promoter, enhancer, and polyadenylation signal, as well as one or more foreign protein expression cassettes operably linked to a bacterial selectable marker gene and promoter. A transposase expressed by a helper plasmid catalyzes the transposition of Tn7L and Tn7R flanking the foreign protein expression cassette to specific sites within the mini-att Tn7 region of the bacmid, thereby integrating the foreign expression cassette into the bacmid. Alternatively, the foreign protein expression cassette can be inserted into the appropriate region of the recombinant baculovirus backbone by other methods, including, but not limited to, homologous recombination using a donor plasmid containing homologous sequences of rBV flanking the foreign protein expression cassette, as shown in Figure 1B.

[0070] A diagram of an exemplary generic rBV genome with a v-cath deletion / insertion of the CAT and GFP selection marker expression cassettes and an additional insertion of two foreign protein cassettes is shown in Figure 5A. Figure 5B shows an rBV genome with a Δv-cath deletion and insertion of the AAV Rep and Cap foreign protein expression cassettes. Figure 5C shows an rBV genome with a Δv-cath deletion / insertion of the AAV, gentamicin, and luciferase foreign protein expression cassettes. Figure 5D shows an rBV genome with a Δv-cath deletion and insertion of a gentamicin / mammalian protein expression cassette insert encoding the light and heavy chains of a human antibody. Alternatively, an rBV genome with a v-cath deletion, no insertion of the CAT and GFP selection marker expression cassettes, and an additional insertion of two foreign protein cassettes is shown in Figure 16A. Figure 16B shows an rBV genome with a Δv-cath deletion and insertion of the AAV Rep and Cap foreign protein expression cassettes. Figure 16C shows the rBV genome with the Δv-cath deletion / insertion of AAV, gentamicin, and luciferase foreign protein expression cassettes, and Figure 16D shows the rBV genome with the Δv-cath deletion and insertion of gentamicin / mammalian protein expression cassette inserts encoding the light and heavy chains of a human antibody.

[0071] cell culture Cells that can be infected with rBV vectors or transformed with bacmids include insect cells or prokaryotic cells such as E. coli. Useful E. coli cells include, but are not limited to, ToplO, DH5a, DH10B, TGI, BW23473, BW23474, MW003, Mwoo5, and BL21. Useful insect cells that can be infected with rBV vectors include, but are not limited to, Sf9, Sf21, Express Sf+, and S2 cells from the armyworm moth (Spodoptera frugiperda), or BTI-TN-5B1-4 (High Five cells) from the nettle looper (Trichoplusia ni, Lepidoptera), D. melanogaster, and other cell lines. These cells are commercially available from a number of sources (e.g., ThermoFisher Scientific, ATCC, and Expression Systems). Insect cells are cultured in a medium that promotes their maintenance and growth, such as, but not limited to, Gibco insect media: ExpiSf CD medium, Sf-900 III SFM, Express Five SFM, or SF-900 II SEM (ThermoFisher Scientific), ESF921, and ESFAF (Expression Systems).

[0072] rBV infection The rBV infects insect cells by contacting them under conditions conducive to virus entry into the cells, for example, by culturing the contacted cells in a medium conducive to expression of the foreign protein, for example, Gibco insect medium (ExpiSf CD medium, Sf-900 III SFM, Express Five SFM), or SF-900 II SEM (ThermoFisher Scientific), ESF921, or ESF AF medium (Expression Systems), for about 3 days at about 28° C. Successful infection can be monitored, for example, by the expression of a visually detectable selectable marker protein or the expression of a gene incorporated into the rBV genome.

[0073] Foreign Protein Expression and Isolation Foreign proteins, including those that are structural parts of viral vectors carrying mammalian genes or those that are directly expressed from mammalian genes, can be obtained from infected insect cells by lysing the cells and isolating the protein from the lysate. Lysis can be achieved by physical force (e.g., French press or sonication), lysis buffers containing detergents, or enzymatic digestion of the cellular matrix, for example, with chitinases naturally expressed by the baculovirus genome.

[0074] The expressed foreign protein or the produced viral particles can be isolated, for example, by chromatographic or electrophoretic methods, or by centrifugation, for example, on a cesium chloride gradient.

[0075] These isolated and purified proteins can then be used, for example, for therapeutic purposes or as research reagents. If the foreign protein is part of a viral vector carrying a mammalian gene, the viral vector can be isolated and then used to infect mammalian cells, for example, for gene therapy.

[0076] Effect of Δv-cath deletion on foreign protein expression To demonstrate that the deletion of the v-cath gene from the baculovirus genome did not affect baculovirus replication, the replication of wild-type rBV was compared with that of the Δv-cath-rBV of the present disclosure. Both rBVs carrying the same foreign genes (AAV capsid and rep or GFP) were used to infect insect cells (Sf9). The titers of the WT baculovirus and the Δv-cath deletion mutant rBV were then determined to be comparable. This demonstrates that the v-cath deletion does not adversely affect virus production (Figure 8).

[0077] To demonstrate that the foreign protein expressed from Δv-cath rBV was not degraded, the expression of the foreign protein in cells infected with Δv-cath rBV was compared with that in cells infected with WT-rBV. The resulting synthesized AAV vector was then purified from cell lysates. After heating both types of AAV particles, their capsid proteins were examined by SDS-PAGE.

[0078] The results shown in Figure 9 demonstrate that deletion of the v-cath gene reduced capsid protein degradation. AAV7m8 produced by WT-rBV was significantly degraded, in contrast to AAV7m8 capsids produced by Δv-cath-rBV, which showed no degradation (compare lanes 2 and 6). AAV8 (lane 3) and AAV6 (lane 4) capsid proteins were only slightly degraded.

[0079] To demonstrate that Δv-cath rBV can produce higher AAV yields than WT-rBV, AAV7m8-luciferase and AAVphpb-luciferase vectors were produced in Sf9 cells infected with Δv-cath rBV and WT-rBV, respectively. For WT-rBV-infected lysates, the protease inhibitor leupeptin was added to the lysis buffer to prevent degradation during cell lysate preparation, so that AAV production yields could be maintained. No protease inhibitor was added to Δv-cath rBV-infected lysates. After purification, AAV vectors were quantified. The results are shown in Table 1. [Table 1]

[0080] These results indicate that the expression of a foreign protein in cells transduced with Δv-cath rBV is 3 to 4 times higher than the expression of the same foreign protein in cells transduced with WT-rBV.

[0081] It was also determined that AAV vectors produced by Δv-cath rBV had higher infectivity in mammalian cells compared with those produced by WT-rBV. Tests were performed in HEK-293 cells using AAV vectors isolated from insect cells infected with either WT-rBV or the deletion mutants. GFP expression was recorded. The results, shown in Figures 10A-10F, demonstrate that AAV vectors produced by WT-rBV (Figures 10A-10C) have lower infectivity than those produced by Δv-cath rBV (Figures 10D-10F).

[0082] Reference will now be made to specific examples illustrating the present disclosure. It will be understood that the examples are provided to illustrate representative embodiments and that no limitation of the scope of the present disclosure is intended thereby. [Example]

[0083] Example 1 insect cell culture Sf9 cells (Expression Systems, Davis, CA) were cultured in Corning storage bottles in ESF921 or ESF AF medium (Expression Systems) supplemented with 100 units / mL penicillin and 100 μg / mL streptomycin (HyClone, Logan, UT) at 28°C. Cell densities of approximately 8 × 10 cells were maintained for maintenance. 6 Once cells / mL were reached, the cells were split 1:4.

[0084] Example 2 Deletion of the v-cath gene from the baculovirus backbone λred system (Thomason (2014)Curr.Protoc.Mol.Biol.106:16 11-394 ) was used to perform the deletion. Briefly, a chloramphenicol acetyltransferase (CAT) expression cassette flanked by two FRTs (Figure 2) was inserted into the CAT gene. A~2CA 1.1 kB fragment containing the GFP expression cassette (nucleotides 51 to 1066) was PCR amplified using primers 2846 (SEQ ID NO: 1) and 6281 (SEQ ID NO: 2) and the plasmid pKD3 (The ODIN, Oakland, CA) as a template. A~2C A 2.2-kb fragment containing the nucleotide sequence (nucleotides 1067 to 3223) was PCR-amplified using primers 5701 (SEQ ID NO: 3) and 6282 (SEQ ID NO: 4) and V376 as the template. After gel purification, both PCR fragments were ligated using primers 6298 (SEQ ID NO: 5) and 6299 (SEQ ID NO: 6) to form a 3275-bp PCR fragment. The PCR fragment was digested with the restriction enzyme DpnI (New England Biolabs, Ipswich, MA) to remove contaminating plasmid template. Plasmid pKD46, containing the red recombinase (The ODIN), was then electroporated into DH10Bac-competent cells (ThermoFisher Scientific) to obtain a colony of DH10Bac containing the red recombinase. One of the colonies was induced with 0.035% L-(+)-arabinose (Sigma-Aldrich, St. Louis, MO) to express the recombinase. After induction at 37°C for 45 minutes with gentle shaking, DH10Bac-competent cells containing the red recombinase were electroporated with the 3275 bp CAT-GFP PCR fragment and incubated for an additional 3 hours to allow recombination to occur. Electroporated DH10Bac-red cells were cultured overnight.

[0085] A colony containing the bacmid with the v-cath deletion was identified by DNA sequencing and designated DH10Bac-Δv-cath. One of these colonies was selected to prepare competent cells for use in generating recombinant baculovirus lacking v-cath.

[0086] Example 3 Recombinant baculovirus production A recombinant baculovirus shuttle vector (bacmid) capable of recombining with the donor plasmid was used to generate a recombinant baculovirus containing the gene of interest according to the manufacturer's protocol (Invitrogen, Carlsbad, CA). Briefly, the donor plasmid was diluted to a concentration of 2 ng / μL in sterile TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0), and 2 μL of the diluted plasmid DNA was used to transform 20 μL of DH10Bac-wild-type (wt) competent cells or DH10Bac-Δv-cath competent cells. After incubation on LB agar plates at 37°C for 2 days, white colonies were picked and miniprep bacmid DNA was prepared according to the manufacturer's protocol (Invitrogen).

[0087] To generate recombinant baculovirus, miniprep bacmid DNA was then used to transfect Sf9 cells according to a modified manufacturer's protocol (Invitrogen). Briefly, 5 μg of miniprep bacmid DNA and 5 μl of GenJet reagent (SignaGene Labs, Rockville, MD) were each diluted in 100 μl of ESF AF medium (Expression Systems) in a sterile 1.5 mL microtube. The diluted GenJet reagent was transferred to the diluted bacmid DNA tube and mixed by gently pipetting up and down three times. After approximately 30 minutes of incubation at room temperature, 0.8 mL of ESF AF medium was added to the GenJet-bacmid mixture and mixed by pipetting up and down three times. Sf9 cells were cultured at 1.5 × 10 in 2 mL of ESF AF medium in a 6-well plate. 6The cells were plated at a density of 1 cell / well and incubated in an incubator at 28°C for approximately 30 minutes to allow attachment. The medium was removed from each well, and then the GenJet-bacmid mixture was added. After overnight incubation at 28°C in an incubator, 1 mL of ESF AF medium was added, and the plate was incubated at 28°C for a total of 4 days to generate recombinant baculovirus. The recombinant baculovirus in the medium was collected and stored in the dark at 4°C.

[0088] The recombinant baculoviruses constructed from DH10Bac-wt and DH10Bac-Δv-cath were designated WT-rBV and Δv-cath rBV, respectively.

[0089] Example 4 Effect of v-cath deletion on rBV replication To determine whether deletion of the v-cath gene affected baculovirus replication, three pairs of WT-rBV and Δv-cath rBV were used. The first pair, WT-rBV-Cap6-Rep and Δv-cath-rBV-Cap6-Rep, contain the AAV6 capsid genes encoding VP1, VP2, and VP3, respectively, and the AAV2 rep genes encoding rep78 and rep52. The second pair, WT-rBV-GFP and Δv-cath rBV-GFP, contain the GFP gene encoding green fluorescent protein, respectively. The third pair, WT-rBV-Cap7m8-Rep and Δv-cath rBV-Cap7m8-Rep, contain the AAV7m8 capsid genes encoding VP1, VP2, and VP3, respectively, and the AAV2 rep genes encoding rep78 and rep52.

[0090] All generated rBVs were used to infect Sf9 cells for amplification. Briefly, 1 mL of each rBV was added to 2 × 10 Sf9 cells in a Corning culture bottle. 6The rBV was added to 200 mL of Sf9 cells at a density of 100 cells / mL, and the rBV was amplified for 3 days at 28°C and 180 rpm in a shaker incubator (New Brunswick, Hauppauge, NY). The supernatant was collected by centrifugation at 2,000 rpm for 10 minutes to remove the cell pellet. The rBV titer of the supernatant was determined by quantitative polymerase chain reaction (QPCR) as described in Example 5.

[0091] Example 5 Quantification of rBV To determine the titer of the recombinant baculovirus, we used a specific QPCR method for rBV titration developed at Virovek. Briefly, 50 μl of rBV supernatant was mixed with 50 μL of 0.2% SDS solution and heated at 95°C for 30 minutes to release the rBV DNA. rBV DNA was diluted 1:100 in QPCR dilution buffer (10 μg / mL yeast tRNA (Sigma Aldrich, Saint Louis, MO), 0.01% Tween 80, 10 mM Tris-HCl (pH 8.0), 1 mM EDTA), and the copy number of rBV was determined using a Chromo 4 Four-Color Real-time Detection System (Bio-Rad, Hercules, CA) with primers corresponding to the gentamicin gene (3065: 5'-ATTTGACTTGGTCAGGGCCG-3' (SEQ ID NO: 8) and 3066: 5'-TGTTACGCAGCAGGGCAGTC-3' (SEQ ID NO: 9)) and SYBR Green PCR Master Mix (ThermoFisher Scientific, Fremont, CA). It was empirically determined that one plaque-forming unit (pfu) contains an average of 20 copies of the rBV genome.

[0092] Example 6 AAV vector production and purification To produce AAV vectors, recombinant baculoviruses were used to infect insect cells. Briefly, 10 moi of recombinant baculovirus containing the AAV Rep and Cap genes was co-infected with 5 moi of recombinant baculovirus containing a GFP marker gene flanked by AAV ITRs at 28°C for 3 days. Cell pellets were collected by centrifugation at 3,000 rpm for 10 minutes. Cell pellets were lysed by sonication in SF9 lysis buffer (50 mM Tris-HCl (pH 7.8), 50 mM NaCl, 2 mM MgCl2, 1% sarkosyl, 1% Triton X-100, and 140 units / mL Benzonase nuclease (Sigma-Aldrich)). Cell debris was removed by centrifugation at 8,000 rpm for 20 minutes. Approximately 23 mL of the clarified lysate was transferred to an ultraclear centrifuge tube for an SW28 rotor (Beckman Coulter, Brea, CA), followed by 10 mL of 1.32 g / cc and 5 mL of 1.55 g / cc CsCl solution and centrifugation at 28,000 rpm for approximately 20 hours at 15°C. The AAV vector band was visualized under a light beam and collected with a syringe. The collected AAV vector was transferred to another centrifuge tube for a 70.1 ti rotor (Beckman Coulter), which was then filled with 1.38 g / cc CsCl solution and sealed. After approximately 20 hours of centrifugation at 65,000 rpm, the AAV vector band was visualized under a light beam and collected with a syringe. The AAV vector was buffer-exchanged using a PD-10 desalting column (GE Healthcare Bio-Sciences, Pittsburgh, PA). After filter sterilization, the AAV vector was used for further experiments.

[0093] Example 7 Quantification of AAV vectors Crude lysate AAV vectors or purified forms of AAV vectors were quantified by QPCR according to a modified protocol from that described by Aurnhamme et al. (Hum. Gene Ther. Meth. (2012) 23(1):18-28). Briefly, AAV samples were first diluted 1:100 with QPCR dilution buffer, and contaminating DNA was removed by incubating 10 μl of diluted AAV with 1 μl (2 units) of DNase I enzyme (New England Biolabs) in 39 μl of DNase I digestion buffer (10 mM Tris-HCl (pH 8.0), 2.5 mM MgCl2, 0.5 mM CaCl2) at 37°C for 1 hour. The DNase I enzyme was inactivated by mixing with 50 μl of 200 mM EDTA and heating at 95°C for 30 minutes. Treated AAV samples were further diluted 1:200, and 10 μl of each AAV sample was used to determine the copy number of AAV vector genomes on a Chromo4 QPCR instrument (Bio-Rad, Hercules, CA).

[0094] Example 8 Retention of capsid integrity in AAV vectors produced by Δv-cath rBV AAV vectors were produced by co-infection of Sf9 cells with Δv-cath rBV or WT-rBV and purified by two rounds of cesium chloride ultracentrifugation as described in Example 6. Equal volumes (1 × 10 11 vg) of purified AAV particles were heated at 95°C for 5 minutes. Capsid proteins were separated by SDS-PAGE and stained with the Simply Blue staining kit to determine the amount of capsid protein degradation (if any) produced by each type of rBV.

[0095] Example 9 Infectivity of AAV vectors produced by rBV AAV vectors produced in Sf9 cells using Δv-cath rBV or WT-rBV were purified and quantified as described above in Example 7. To compare their infectivity, these AAV vectors were used to transduce HEK-293 cells. HEK-293 cells (ATCC-CRL-1573, Manassas, VA) were cultured in Corning 12-well cell culture plates in DMEM medium (Mediatech, Manassas, VA) supplemented with 100 units of penicillin-streptomycin (Corning, NY) containing 10% FBS (Hyclone, Logan, UT) at 37°C in a CO2 incubator until approximately 70% confluent. AAV samples were each diluted in 1 mL of DMEM containing 20 μM etoposide (AG Scientific, San Diego, CA) but without FBS to obtain a concentration of 3.0e+9 vg / mL. After removing the old medium from the plate, 0.5 mL of diluted AAV sample was added to each well, and the plate was incubated overnight at 37°C in a CO2 incubator. The next morning, 0.5 mL of DMEM medium containing 20% ​​FBS and 100 units of penicillin-streptomycin was added to each well, and transduction was carried out for 2–3 days. GFP-expressing cells were recorded using a Nikon Eclipse TS100 fluorescence microscope (Nikon Instruments, Melville, NY).

[0096] Example 10 Expression of SV40 capsid protein in insect cells infected with Δv-cath rBV To express SV40 capsid protein, a recombinant baculovirus carrying the SV40 capsid gene was used to infect insect cells. Briefly, 10 moi of recombinant baculovirus was added to 300 mL of Sf9 cells and incubated at 28°C for 3 days. The cell pellet was collected by centrifugation at 3,000 rpm for 10 minutes. The cell pellet was lysed by sonication in SF9 lysis buffer (50 mM Tris-HCl (pH 7.8), 50 mM NaCl, 2 mM MgCl2, 1% sarkosyl, 1% Triton X-100, and 140 units / mL Benzonase nuclease (Sigma-Aldrich)). Cell debris was removed by centrifugation at 8,000 rpm for 20 minutes. Approximately 23 mL of the clarified lysate was transferred to an ultraclear centrifuge tube for an SW28 rotor (Beckman Coulter, Brea, CA), followed by 10 mL of 1.32 g / cc and 5 mL of 1.55 g / cc CsCl solution and centrifugation at 28,000 rpm at 15°C for approximately 20 hours. The SV40 virus-like particle band was visualized under a light beam and collected with a syringe needle. The collected SV40 virus-like particles were transferred to another centrifuge tube for a 70.1 ti rotor (Beckman Coulter), which was then filled with 1.38 g / cc CsCl solution and sealed. After approximately 20 hours of centrifugation at 65,000 rpm, the SV40 virus-like particle band was visualized under a light beam and collected with a syringe needle. The SV40 virus-like particles were buffer-exchanged using a PD-10 desalting column (GE Healthcare Bio-Sciences, Pittsburgh, PA). After filter sterilization, the SV40 virus-like particles were used for further experiments.

[0097] Example 11 Expression of human antibody heavy and light chains in insect cells infected with Δv-cath rBV For protein expression, recombinant baculoviruses carrying human antibody heavy and light chain expression cassettes were used to infect Sf9 cells. Briefly, 10 moi of rBV was used to infect 300 mL of Sf9 cells at 28°C for 3 days, and both the supernatant and cell pellet were collected. The cell pellet was lysed in Sf9 lysis buffer as described in Example 6, and the clarified lysates were collected. The expressed human antibodies in the supernatant and lysates were purified using protein A agarose and analyzed by SDS-PAGE.

[0098] Example 12 Removal of the selectable marker expression cassette by FLP / FLPe expression Two versions of the cathepsin-deleted baculovirus DNA backbone were constructed: one with a CAT expression cassette flanked by two FRTs and the other with a GFP expression cassette in addition to the CAT expression cassette flanked by two FRTs integrated into the cathepsin deletion region.

[0099] To remove the CAT expression cassette between the FRT sites from the baculovirus backbone, the following experiment was performed. A bacterial glycerol stock containing DH10Bac-Δcath was streaked onto an LB plate containing 10 μg / mL tetracycline and 25 μg / mL chloramphenicol and grown overnight (ON) at 37°C. The following night, a well-growing colony was picked and grown overnight at 37°C with agitation in 1 mL of LB medium containing 10 μg / mL tetracycline and 25 μg / mL chloramphenicol. The following morning, 30 μL of the ON culture was diluted into 1.4 mL of LB medium containing 10 μg / mL tetracycline and 25 μg / mL chloramphenicol to an OD of 0.3-0.5. 600The cells were grown at 37°C until 5 min. The cell pellet was collected by centrifugation at 11,000 rpm for 30 seconds. After removing the supernatant, the cell pellet was placed on ice and resuspended in 1 mL of ice-cold 10% glycerol. The cell pellet was centrifuged again at 11,000 rpm for 30 seconds to remove most of the supernatant, leaving 20–30 μL in the tube for resuspending the cell pellet. Plasmid pCP20 containing 1 μL (500 ng / μL) of FLP recombinase (The ODIN, Oakland, CA) was added to the resuspended cells, which were kept on ice, and mixed briefly. The cells were then transferred to a chilled electroporation cuvette (Molecular Bioproducts, Inc., Cat# 5510-11, Fischer Scientific) and electroporated using the "bacteria" setting on a BioRad MicroPulser instrument (Hercules, CA). After electroporation, the cells were added to 1 mL of LB medium without antibiotics and incubated at 30°C for 2 hours with agitation. 100 μL of the cell solution was plated onto an LB plate containing 100 μg / mL ampicillin (Thermo Fisher Scientific, Waltham, MA), 50 μg / mL kanamycin (Thermo Fisher Scientific, Waltham, MA), and 10 μg / mL tetracycline (Thermo Fisher Scientific, Waltham, MA) and grown overnight at 30°C. Eleven well-grown colonies were picked, streaked onto an LB plate without antibiotics, and grown overnight at 43°C to express the recombinase, thereby recombination-mediated removal of the chloramphenicol expression cassette located between the two FRT sites. The following morning, bacteria from each colony were removed with a pipette tip and resuspended in 20 μL of cold Milli-Q purified water (Millipore Sigma).

[0100] PCR reactions were performed using 2 μL of resuspended bacteria from each colony to confirm removal of the DNA sequence between the two FRT sites. Forward primer 6298 (5'-TAATAAATGACTGCAGTAGACGCAA-3') (SEQ ID NO: 5) and reverse primer 6299 (5'-GAACAAAATTTTGTTTTATTTGTTTGTGTA-3') (SEQ ID NO: 6) were used to confirm removal of the CAT expression cassette from DH10Bac-Δv-cath, which contains a GFP expression cassette in addition to the CAT expression cassette flanked by two FRTs. Forward primer 2847 (5'-CTACGAGCGCATAATTGCGA-3') (SEQ ID NO: 10) and reverse primer 2848 (5'-GTTTGGTCATGTAGTTAACTTTG-3') (SEQ ID NO: 11) were used to confirm removal of the CAT expression cassette from DH10Bac-Δv-cath, which contains only the FRT-flanked CAT expression cassette. The PCR conditions shown in Table 2 below were used. [Table 2]

[0101] After the PCR reaction, the amplified PCR fragment was electrophoresed on a 1% agarose gel. As shown in Figure 14A, the D H For 10Bac-Δv-cath, the PCR fragment from 11 colonies had a fragment size of 2346 bp, while the control colonies #12 and #13 had a fragment size of 3276 bp, indicating that the CAT expression cassette (930 bp) had been deleted from colonies 1 to 11. DNA sequencing analysis further confirmed that the CAT expression cassette had been deleted, leaving only the FRT (minimal) sequence and GFP expression cassette in the v-cath deletion region (Figure 15A). ~15B ).

[0102] For DH10Bac-Δv-cath, which contains only the CAT expression cassette flanked by two FRTs, only three colonies (#1, #5, and #7) out of eight colonies that underwent the deletion treatment showed PCR amplification of a 651-bp fragment, indicating the removal of the CAT expression cassette (Figure 14B). DNA sequencing analysis further confirmed that the CAT expression cassette had been removed and only the FRT sequence remained in the v-cath deletion region ( Figure 15A~ Figure 15B).

[0103] equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments described particularly herein which equivalents are intended to be encompassed by the scope of the following claims. In certain embodiments, for example, the following are provided: (Item 1) A recombinant baculovirus (rBV) DNA backbone comprising: A chitinase gene, Deletion of the v-cath gene and and a DNA fragment that allows for the integration of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than when they are expressed from an rBV backbone without the deletion. (Item 2) 2. The rBV DNA backbone of item 1, wherein the DNA fragment comprises DNA sequences homologous to two sequences flanking the one or more foreign protein expression cassettes in a donor plasmid. (Item 3) 2. The rBV DNA backbone of item 1, wherein the DNA fragment is derived from bMON14272. (Item 4) 4. The rBV DNA backbone of item 3, wherein the DNA fragment comprises an origin of replication. (Item 5) 4. The rBV DNA backbone of item 3, wherein the DNA fragment further comprises a reporter gene. (Item 6) 2. The rBV DNA backbone of item 1, further comprising a selectable marker expression gene cassette integrated into the cath-v deletion. (Item 7) the rBV DNA backbone described in item 1; A foreign protein expression cassette, comprising: at least one foreign protein gene; an insect cell promoter operably linked to the at least one foreign gene; and a recombinant baculovirus (rBV) genome comprising a foreign protein expression cassette, the foreign protein expression cassette comprising two DNA sequences that enable the foreign protein expression cassette to be integrated into the rBV DNA backbone; (Item 8) 8. The rBV genome of item 7, wherein the at least one foreign protein gene in the foreign expression cassette comprises at least one viral protein gene and / or at least one mammalian protein gene. (Item 9) 9. The rBV genome of item 8, wherein the viral protein gene encodes an AAV protein, an adenovirus protein, a retrovirus protein, an SV40 protein, or a herpes simplex virus protein. (Item 10) 10. The rBV genome of item 9, wherein the foreign protein expression cassette comprises a sequence encoding at least one AAV capsid protein or at least one SV40VP1 major capsid protein. (Item 11) 8. The rBV genome of item 7, wherein the two DNA sequences that enable the foreign protein expression cassette to be integrated into the DNA backbone are homologous to DNA sequences within the rBV DNA backbone or are transposable elements. (Item 12) rBV DNA backbone according to item 6, A foreign protein expression cassette, comprising: at least one foreign protein gene; an insect cell promoter operably linked to the at least one foreign gene; and a recombinant baculovirus (rBV) genome comprising a foreign protein expression cassette, the foreign protein expression cassette comprising two DNA sequences that enable the foreign protein expression cassette to be integrated into the rBV DNA backbone; (Item 13) Item 7. The rBV genome according to item 7; and at least one baculovirus capsid protein. (Item 14) 14. The recombinant baculovirus vector or particle of item 13, wherein the rBV genome comprises DNA encoding at least one AAV capsid protein. (Item 15) Item 13. The rBV genome according to Item 12; A recombinant baculovirus vector or particle comprising at least one baculovirus capsid protein. (Item 16) 14. An insect cell containing the recombinant baculovirus vector or particle according to item 13. (Item 17) 17. The insect cell of item 16, further comprising at least one foreign protein expressed from the foreign protein expression cassette in the rBV backbone of the rBV genome. (Item 18) 16. An insect cell containing the recombinant baculovirus vector or particle according to item 15. (Item 19) Item 14. The rBV vector or particle according to item 13, an insect cell susceptible to infection and capable of expressing said at least one foreign protein encoded by said rBV backbone in said rBV vector or particle. (Item 20) 20. The heterologous expression system of item 19, wherein the rBV vector or particle comprises an rBV backbone containing a foreign protein expression cassette, the foreign protein expression cassette comprising a sequence encoding at least one AAV capsid protein. (Item 21) Item 16. The rBV vector or particle according to item 15, an insect cell susceptible to infection and capable of expressing said at least one foreign protein encoded by said rBV backbone in said rBV vector or particle. (Item 22) 1. A non-adherent insect cell lysate comprising: The recombinant baculovirus (rBV) genome according to item 7; and at least one foreign protein encoded by the rBV genome and expressed in the lysate. (Item 23) 23. The non-adhesive insect cell lysate of item 22, wherein the at least one foreign protein encoded by the rBV genome is at least one AAV capsid protein. (Item 24) 1. A non-adherent insect cell lysate comprising: The recombinant baculovirus (rBV) genome according to item 12; and at least one foreign protein encoded by the rBV genome and expressed in the lysate. (Item 25) 1. A method for producing a foreign protein in an insect cell, comprising: Infecting the insect cells with the recombinant baculovirus vector or particle according to item 13; culturing the infected cells under conditions conducive to expression of the foreign protein gene; and isolating the foreign protein from the insect cells. (Item 26) 26. The method of claim 25, wherein the at least one foreign protein is at least one recombinant AAV capsid protein. (Item 27) A recombinant AAV capsid protein produced by the method described in item 26. (Item 28) 1. A method for producing a foreign protein in an insect cell, comprising: Infecting the insect cells with the recombinant baculovirus vector or particle according to item 15; culturing the infected cells under conditions that promote expression of the foreign protein gene; and isolating the foreign protein from the insect cells.

Claims

1. A recombinant baculovirus (rBV) genome, the rBV genome comprising an rBV DNA backbone and a foreign protein expression cassette, the rBV DNA backbone comprising: a baculovirus chitinase gene (chiA); A deletion of the v-cath gene, a DNA fragment that allows for the integration of one or more foreign protein expression cassettes into said backbone, such that one or more foreign proteins expressed in insect cells are less degraded than if they were expressed from an rBV backbone without said deletion; the foreign protein expression cassette at least one foreign protein gene; an insect cell promoter operably linked to the at least one foreign protein gene; and Two DNA sequences that allow the foreign protein expression cassette to be integrated into the rBV DNA backbone; wherein the at least one foreign protein gene in the foreign protein expression cassette comprises a sequence encoding at least one AAV capsid protein.

2. The rBV genome described in claim 1, wherein the DNA fragment of the backbone comprises DNA sequences homologous to two sequences adjacent to the one or more foreign protein expression cassettes in the donor plasmid.

3. The rBV genome described in claim 1, wherein the DNA fragment of the backbone is derived from bMON14272.

4. The rBV genome described in claim 3, wherein the DNA fragment of the backbone includes a replication origin.

5. The rBV genome described in claim 3, wherein the DNA fragment of the backbone further contains a reporter gene.

6. The rBV genome described in claim 1, wherein the backbone further comprises a selectable marker expression gene cassette incorporated into the v-cath deletion.

7. 2. The rBV genome of claim 1, wherein the two DNA sequences that enable the foreign protein expression cassette to be integrated into the DNA backbone are homologous to DNA sequences within the rBV DNA backbone or are transposable elements.

8. The rBV genome of claim 1; and at least one baculovirus capsid protein.

9. An insect cell comprising the recombinant baculovirus vector or particle of claim 8.

10. 10. The insect cell of claim 9, further comprising at least one AAV capsid protein expressed from the foreign protein expression cassette in the rBV backbone of the rBV genome.

11. 9. The rBV vector or particle of claim 8 ; and an insect cell susceptible to infection and capable of expressing said at least one AAV capsid protein encoded by said rBV backbone in said rBV vector or particle.

12. 1. A non-adherent insect cell lysate comprising: The recombinant baculovirus (rBV) genome of claim 1; and at least one AAV capsid protein encoded by the rBV genome and expressed in the lysate.

13. 1. A method for producing at least one AAV capsid protein in an insect cell, comprising: Infecting the insect cells with the recombinant baculovirus vector or particle of claim 8; culturing the infected cells under conditions conducive to expression of the AAV capsid proteins; and isolating the AAV capsid protein from the insect cell.

14. 2. The rBV genome of claim 1, wherein the DNA fragment that allows integration of one or more foreign protein expression cassettes into the backbone comprises a transposon fragment.

Images