Nucleic acid detection system and nucleic acid detection method

Abstract

To easily detect a nucleic acid.SOLUTION: A nucleic acid detection system according to an embodiment is a nucleic acid detection system to detect a target nucleic acid in a sample and includes a thermal inactivation chamber, an amplification chamber, and a detection chamber, all of which constitute a liquid flow path. In this system, liquid flows through the thermal inactivation chamber, the amplification chamber, and the detection chamber sequentially. The thermal inactivation chamber includes a reagent to thermally inactivate and decompose the sample. The amplification chamber includes a reagent to amplify the target nucleic acid. The detection chamber includes a test strip to conduct a Cas enzyme reaction with the target nucleic acid and a lateral flow detection.SELECTED DRAWING: Figure 3

Description

[Technical Field]

[0001] SUMMARY OF THE INVENTION The embodiments disclosed in the present specification and drawings relate to nucleic acid detection systems and methods. [Background technology]

[0002] Conventional nucleic acid detection technologies are primarily PCR-based. PCR detection technology has become the gold standard in the field of nucleic acid detection. The specific nucleic acid detection flow, as shown in Figure 1, includes steps such as sampling, nucleic acid extraction, amplification, detection, and result reporting. This technology requires expensive PCR equipment, appropriate polymerase, primers, and / or probes, and also requires long overall operation times, a high level of operator expertise, and specific requirements for the experimental environment (certified PCR laboratory). Many attempts have been made by those skilled in the art to simplify the nucleic acid detection process and obtain detection results quickly. Patent Document 1, as a detection technology that integrates multiple steps, describes a system capable of amplifying multiple target nucleic acids in a single reaction chamber, which achieves the goal of "sample in, result out." However, because this technology is still PCR-based, it cannot avoid the problem of false positives. Furthermore, the detection equipment itself is expensive, and specific laboratory equipment is required for detection, making it impossible to realize point-of-care testing (POCT).

[0003] SHERLOCK (Specific High Sensitivity Enzymatic Reporter Unlocking) technology, developed by Chinese-American Zhang Feng using a new system called CRISPR-Cas, is a novel, rapid, highly sensitive, and low-cost diagnostic tool that can be used to detect diseases such as Zika virus infection and dengue fever. This technology uses the Cas13a protein, which has "collateral shearing" activity, and a special amplification technique to detect RNA in samples, creating a detection system capable of accurately detecting single nucleic acid molecules in serum, urine, and saliva (see Non-Patent Document 1). However, as shown in Figures 1 and 2, conventional SHERLOCK and other CRISPR-based IVD (in vitro diagnostic) detection technologies require multiple separate steps, including sampling, nucleic acid extraction, amplification, Cas enzyme reaction, and detection. These steps pose a risk of contamination due to manipulations such as opening the lid. Furthermore, they impose specific requirements on the experimental environment, and liquid reaction systems require storage and transportation environments, leaving room for improvement in terms of integration and automation. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] US Patent Application Publication No. 2008 / 0038737 [Patent Document 2] U.S. Patent No. 7,270,981 [Non-patent literature]

[0005] [Non-Patent Document 1] Gootenberg, Jonathan S., et al. "Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6." Science 360.6387 (2018): 439-444. [Non-patent document 2] Tsugunori Notomi et al. “Loop-mediated isothermal amplification of DNA” Nucleic Acids Res. 2000 Jun 15; 28(12): e63. Summary of the Invention [Problem to be solved by the invention]

[0006] One of the problems to be solved by the embodiments disclosed in this specification and drawings is to detect nucleic acids with high sensitivity. However, the problems to be solved by the embodiments disclosed in this specification and drawings are not limited to the above problem. Problems corresponding to the effects of each configuration shown in the embodiments described below can also be positioned as other problems. [Means for solving the problem]

[0007] A nucleic acid detection system according to an embodiment detects a target nucleic acid in a sample and includes a thermal deactivation chamber, an amplification chamber, and a detection chamber, which form a liquid flow path. The liquid flows sequentially through the thermal deactivation chamber, the amplification chamber, and the detection chamber. The thermal deactivation chamber contains reagents for thermally deactivating and decomposing the sample. The amplification chamber contains reagents for amplifying the target nucleic acid. The detection chamber contains a test strip for performing a Cas enzyme reaction with the target nucleic acid and lateral flow detection. [Brief explanation of the drawings]

[0008] [Figure 1] FIG. 1 is a schematic diagram comparing this embodiment with a conventional nucleic acid detection technique. [Figure 2] Figure 2 is a schematic diagram showing the detection flow of CRISPR-based IVD detection technology. [Figure 3] FIG. 3 is a schematic diagram showing a first embodiment of the nucleic acid detection system of the present embodiment. [Figure 4]FIG. 4 is a schematic diagram showing the specific configuration of each chamber in the disposable detection unit of the nucleic acid detection system of this embodiment. [Figure 5] FIG. 5 is a schematic diagram showing the steps of sampling using the nucleic acid detection system of this embodiment. [Figure 6] FIG. 6 is a schematic diagram showing the structure of the first chamber in the nucleic acid detection system of this embodiment. [Figure 7] FIG. 7 is a schematic diagram showing the structure of a wax valve in the nucleic acid detection system of this embodiment. [Figure 8] FIG. 8 is a schematic diagram showing a specific configuration of the fourth chamber in the nucleic acid detection system of this embodiment. [Figure 9] FIG. 9 is a schematic diagram showing the reactions that take place in each region when a positive sample and a negative sample pass through the nucleic acid detection system of this embodiment. [Figure 10A] FIG. 10A is a schematic diagram showing the color development of the test strip according to this embodiment. [Figure 10B] FIG. 10B is a schematic diagram showing the color development of the test strip according to this embodiment. [Figure 11] FIG. 11 is a schematic diagram showing a second embodiment of the nucleic acid detection system of the present embodiment. [Figure 12] FIG. 12 is a photograph of a test strip showing the detection results of Example 2. DETAILED DESCRIPTION OF THE INVENTION

[0009] Next, the present embodiment will be described in detail with reference to the drawings, but the present embodiment is not limited to these embodiments and includes all embodiments that satisfy the requirements described in the claims of this application.

[0010] In view of the above-described state of the prior art, an object of this embodiment is to provide a highly integrated, automated, and portable nucleic acid detection system that does not require, for example, expensive equipment, specialized workers, or special laboratories, can be stored and transported at room temperature, can ensure sequence specificity of detection results, and does not contaminate the inside or outside.

[0011] This embodiment utilizes the editable sequence specificity and collateral shearing activity of enzymes such as Cas12 / 13 to detect target nucleic acids in a sample. Specific chambers 1 to 4 are sequentially connected to form a continuous liquid flow path. Reagent complexes are rationally arranged on, for example, a paper base material, and nucleic acid detection results are reported on a lateral flow test strip by a color reaction. This integrates multiple steps in nucleic acid detection, such as sampling, nucleic acid extraction, amplification, Cas enzyme reaction, and detection color reaction, thereby realizing "sample in, result out," providing an automated and portable nucleic acid detection system applicable to POCT that can detect target nucleic acids in a sample.

[0012] Furthermore, by simultaneously including multiple fourth chambers in one system, the nucleic acid detection system of this embodiment can achieve simultaneous detection of multiple target nucleic acids, and is also applicable to genotyping, such as HPV genotyping and MTB / RIF, and simultaneous detection of DNA and RNA.

[0013] According to this embodiment, a small-sized nucleic acid detection system with high detection sensitivity can be provided.

[0014] (First embodiment) A first embodiment of this embodiment relates to a nucleic acid detection system for detecting a target nucleic acid in a sample, comprising first to fourth chambers forming a liquid flow path, wherein liquid flows from the first chamber to the fourth chamber, the first chamber comprising a swab inlet for inserting a swab having a sample attached thereto, the second chamber comprising a reagent for thermally inactivating and decomposing the sample, the third chamber comprising a reagent for isothermal amplification of the target nucleic acid, and the fourth chamber comprising a test strip for reacting with the target nucleic acid using a Cas enzyme and for lateral flow detection, a wax valve for separating the chambers between the third and fourth chambers, and a temperature control means for controlling the temperatures of the third chamber and the wax valve.

[0015] 3 is a schematic diagram showing a first embodiment of a nucleic acid detection system according to the present invention. As shown in FIG. 3, the nucleic acid detection system 10 includes a disposable detection unit 100 and a temperature control unit 200. In the disposable detection unit 100, a first chamber 1 to a fourth chamber 4 are connected in order from the top to the bottom of the figure, forming a continuous liquid flow path. If the disposable detection unit is made of, for example, a paper-based material, liquid can flow from the first chamber to the fourth chamber by the siphon effect or capillary action.

[0016] The paper base material is not particularly limited, and various materials commonly used in the field for producing disposable test strips can be used.

[0017] The disposable detection unit 100 may be cylindrical or rectangular, for example, shaped like a ballpoint pen refill, and its length may be, for example, 5 to 15 cm, and its inner diameter may be, for example, 1 to 5 mm.The length and inner diameter may be any numerical value within the above ranges, for example, the length may be 5 cm, 6 cm, 7 cm, 8 cm, 9 cm, 10 cm, 11 cm, 12 cm, 13 cm, 14 cm, 15 cm, etc., and the inner diameter may be 1 mm, 2 mm, 3 mm, 4 mm, 5 mm, etc., and are not particularly limited.

[0018] The temperature control unit 200 may be disposable, or may be integrated with the disposable detection unit 100 for disposable use. However, from a cost perspective, a non-disposable unit is preferable. The temperature control unit 200 may be a nested hollow case or semi-open tank-like structure that fits the disposable detection unit 100, such as a hollow case resembling a ballpoint pen rod. The temperature control unit 200 heats the corresponding chamber and wax valve of the disposable detection unit 100 to a set temperature using a heating block H. During use, a sampled swab is inserted into the disposable detection unit 100, and then the entire or partial disposable detection unit 100 is inserted or embedded in the temperature control unit 200, after which the temperature control unit 200 is activated and the set temperature control program is executed. Note that the temperature control unit is not essential; if the reaction is performed at room temperature, the nucleic acid detection system of this embodiment does not need to include a temperature control unit.

[0019] (First Chamber) Fig. 4 is a schematic diagram showing the specific configuration of each chamber in the disposable detection unit of the nucleic acid detection system shown in Fig. 3. As shown in Fig. 4, the first chamber 1 includes a swab inlet 5 for receiving a swab with a sample attached thereto.

[0020] 5 is a schematic diagram showing the steps of sampling using the nucleic acid detection system of this embodiment. As shown in FIG. 5, after sampling with a swab, insert it into the swab inlet 5 of the nucleic acid detection system, and press the swab against the wall of the system or use the extrusion path 6 to allow the liquid sample containing the target nucleic acid to flow into the liquid flow path. Next, break the swab, and insert and embed the disposable detection unit 100 into the temperature control unit 200. The liquid sample entering the liquid flow path will flow from the first chamber 1 to the fourth chamber 4 by siphon effect or capillary action.

[0021] 6 is a schematic diagram showing the structure of the first chamber in the nucleic acid detection system of this embodiment. The structure of the first chamber is not particularly limited as long as it allows a swab to be inserted, and may be configured, for example, like an extrusion funnel 7, or more specifically, may be a funnel-shaped chamber having a pressing protrusion 8 on the inner wall as shown in FIG. 6. It is preferable to further provide a filter 9 between the first chamber 1 and the second chamber 2 so as to subject the sample to coarse filtration to purify the sample.

[0022] The first chamber does not necessarily have to be provided in the nucleic acid detection system. For example, if the second chamber is provided with a lid having an extrusion funnel 7, the first chamber does not necessarily have to be provided in the nucleic acid detection system. The first chamber is also called a sample chamber.

[0023] (Second Chamber) As shown in Figure 4, the second chamber 2 contains a reagent for thermally inactivating and decomposing the sample, and the liquid sample is hydrated and activated after passing through the filter 9 into the second chamber 2, and is then thermally inactivated and decomposed by the reagent therein. The reagent used for thermal inactivation and decomposition is, for example, a buffer solution containing an enzyme used for inactivation and decomposition.

[0024] Examples of enzymes include protease K, RNaSe nuclease, and / or peptidase. These enzymes can degrade membrane proteins, proteins bound to DNA or RNA, and dissolve virusware, releasing nucleic acids such as DNA and RNA into the sample. The enzymes can react at room temperature, but high-temperature resistant enzymes can also be selected to react at high temperatures. In this case, the target nucleic acid in the sample can be further inactivated by heating the chamber.

[0025] In addition to the enzyme, the buffering agent may contain general components contained in preparing buffer solutions in the art, such as EDTA and Tris-HCl, and is not particularly limited.

[0026] The reagent contained in the second chamber 2 of the nucleic acid detection system of this embodiment is preferably a freeze-dried reagent ball R or a freeze-dried reagent adsorbed to the holder material P (the following reagents are similar).

[0027] FIG. 7 is a schematic diagram showing the structure of a wax valve in the nucleic acid detection system of this embodiment. As shown in FIG. 7, a thermally unstable valve, such as a wax valve W, may be provided between the second chamber 2 and the third chamber 3 to separate the chambers. The wax valve may be composed of a single wax layer or may be adsorbed onto a holder material P. An absorbent material S may be provided around the wax valve W, and the wax valve is absorbed into the absorbent material S after melting. The wax valve W (similar to the wax valve W between the third and fourth chambers described below) opens when heated, allowing the liquid sample to flow from the second chamber to the third chamber.

[0028] In this embodiment, a case where a wax valve is used has been described, but the present invention is not limited to this, and any known valve can be used. Examples of known valves that can be used include valves that open by melting with an electrical stimulus and electrically operated valves. The second chamber is also called a thermal deactivation chamber.

[0029] (3rd Chamber) As shown in FIG. 4, the third chamber 3 contains reagents for amplifying the target nucleic acid, and the liquid sample is amplified in the chamber, for example, isothermal amplification. The isothermal amplification may be any type selected from nucleic acid sequence-based amplification, recombinant enzyme polymerase amplification, loop-mediated isothermal amplification, strand displacement amplification, ribonuclease-dependent amplification, and slit enzyme amplification. To facilitate amplification, a temperature control unit 200 may be used to control the temperature of the third chamber 3 and / or further heat the wax valve W. This allows the flow of the liquid sample between each chamber to be controlled.

[0030] The reagents and methods used for amplification may be determined by referring to the descriptions in the prior art, and are not particularly limited to those described in, for example, Non-Patent Document 2 or Patent Document 2. The third chamber is also called an amplification chamber.

[0031] (4th Chamber) When the wax valve W between the third chamber 3 and the fourth chamber 4 is heated and melted to open, the liquid sample flows into the fourth chamber 4 .

[0032] As shown in FIG. 4, the fourth chamber 4 contains a test strip for performing a Cas enzyme reaction with the target nucleic acid in the sample and lateral flow detection.

[0033] The reagent for carrying out the Cas enzyme reaction includes a Cas enzyme complex. Specifically, the Cas enzyme complex may include a Cas enzyme, a guide nucleic acid, and a probe. The guide nucleic acid includes a guide sequence capable of binding to a target nucleic acid in a sample and forming a complex with the Cas enzyme. The probe may be a DNA- or RNA-based molecule containing a non-target nucleic acid sequence, which, when sheared by the Cas enzyme, can generate molecules necessary for the subsequent reaction.

[0034] The Cas enzyme may be, for example, Cas12, Cas13, or Cas14. These may have shearing activity against a target nucleic acid, such as at least one selected from Cas12a, Cas13a, Cas13b, Cas14a, Cas14b, and Cas14c. They may also have shearing activity against a target nucleic acid, such as at least one selected from dCas12a, dCas13a, dCas13b, dCas14a, dCas14b, and dCas14c. For example, the nucleic acid detection system of this embodiment does not require the Cas enzyme to be active simply to detect the presence or absence of a target nucleic acid. However, it may be active. The fourth chamber is also referred to as a detection chamber.

[0035] FIG. 8 is a schematic diagram showing a specific configuration of the fourth chamber in the nucleic acid detection system of this embodiment.

[0036] From left to right, there are a sample pad 11, a Cas enzyme reaction region 12 (Cas enzyme complex), a Cas enzyme reaction termination region 13 (Cas enzyme antibody or inhibitor), a gold-labeled anti-FAM antibody region 14, a streptavidin region 15 (control band 1), an antibody capture region 16 (test band), an anhydrous copper sulfate band 17 (control band 2), and an absorption pad 18.

[0037] FIG. 9 is a schematic diagram showing the reactions that take place in the above-mentioned regions when a positive sample and a negative sample pass through the nucleic acid detection system of this embodiment.

[0038] Next, with reference to FIGS. 8 and 9, the detection and color development in the fourth chamber 4 for positive and negative samples will be described in the following steps S11 to S16.

[0039] Step S11: After a liquid sample (hereinafter simply referred to as "liquid") is placed in the sample pad 11, it first passes through the Cas enzyme reaction area, where a positive sample activates the Cas enzyme complex, cleaving the probe (reporting sequence) and producing separated FAM and biotin, whereas a negative sample does not cleave the probe.

[0040] Step S12: After the Cas enzyme reaction product passes through the Cas enzyme reaction termination zone, the Cas enzyme reaction is terminated, the Cas enzyme is captured, and the forward flow is stopped, thereby ensuring the reaction efficiency and time for detection.

[0041] Step S13: The liquid continues to flow forward, and the cleaved and uncleaved reporting sequences bind to the anti-FITC, FAM antibody in the gold-labeled anti-FAM antibody region.

[0042] Step S14: As the liquid continues to reach the streptavidin region, biotin is captured, and the gold-labeled particles aggregate and develop color (control band 1). This region develops color regardless of whether the reporting sequence is cleaved or not.

[0043] Step S15: As the liquid continues to reach the antibody capture area, the FAM end of the cleaved reporting sequence + FITC, FAM antibody + gold-labeled particles bind to the antibody capture area, and the gold-labeled particles aggregate and develop color (i.e., two lines of color). If the sample is negative, the reporting sequence is not cleaved, and all of the reporting sequence is bound to the streptavidin region, so the antibody capture area does not develop color.

[0044] Step S16: The liquid continues to pass through the anhydrous copper sulfate band and reaches the absorbent pad. Regardless of whether the target sequence is present in the sample, when the aqueous solution flows through the anhydrous copper sulfate band, it turns blue. This indicates that the amount of liquid is sufficient and has completely flowed through the test strip. In contrast, if the anhydrous copper sulfate band (control zone 2) does not turn color, it is determined that the detection is invalid. This allows for quality control of the detection effectiveness of the entire test strip.

[0045] As is clear from the above, the detection result can be determined to be valid only when control band 1 and control band 2 simultaneously develop color. By providing an anhydrous copper sulfate band (control band 2) in addition to control band 1, as in this embodiment, it is possible to solve the problem of false negatives (invalid detection) due to insufficient sample volume when the control band is designed in front and the test band is designed behind the test strip in the prior art. This demonstrates that this embodiment also improves the accuracy of nucleic acid detection.

[0046] 10A and 10B are schematic diagrams showing the color development of the test strip according to this embodiment, where Fig. 10A is a schematic diagram showing the color development determined to be valid when a positive sample and a negative sample pass through the nucleic acid detection system according to this embodiment, and Fig. 10B is a schematic diagram showing the color development determined to be invalid.

[0047] As described above, the nucleic acid detection system according to the first embodiment is a nucleic acid detection system for detecting a target nucleic acid in a sample, and includes a thermal inactivation chamber, an amplification chamber, and a detection chamber, which form a liquid flow path. Liquid flows sequentially through the thermal inactivation chamber, the amplification chamber, and the detection chamber. The thermal inactivation chamber contains a reagent for thermally inactivating and decomposing the sample. The amplification chamber contains a reagent for amplifying the target nucleic acid. The detection chamber contains a test strip for performing a Cas enzyme reaction with the target nucleic acid and lateral flow detection. This allows the nucleic acid detection system according to the first embodiment to detect nucleic acids with high sensitivity.

[0048] Preferably, the nucleic acid detection system further comprises a sample chamber including a swab inlet into which a swab having a sample attached thereto is inserted, located upstream of the heat inactivation chamber.

[0049] (Second embodiment) A second embodiment of this embodiment relates to a nucleic acid detection system for simultaneously detecting multiple target nucleic acids in a sample, which includes the nucleic acid detection system described in the first embodiment, and wherein the fourth chamber includes two or more test strips.

[0050] Similar to the principles and operation of the nucleic acid detection system of the first embodiment, liquid flows from the first chamber 1 to the fourth chamber 4. However, in this embodiment, the fourth chamber branches into multiple channels to detect multiple target nucleic acids in parallel. The editable Cas complexes in each channel may be different to detect different target nucleic acids.

[0051] 11 is a schematic diagram showing a second embodiment of the nucleic acid detection system of the present embodiment. This nucleic acid detection system has two fourth chambers (lateral flow test strips), which allows simultaneous detection of two target nucleic acids.

[0052] The nucleic acid detection system according to the second embodiment of this invention can be used for genotyping, such as HPV genotyping and MTB / RIF, and can be applied to simultaneous detection of DNA and RNA. For example, when two or more test strips each contain a Cas complex designed for a different target sequence, the genotype of the target nucleic acid in the sample can be determined.

[0053] Thus, this embodiment is a method for determining the genotype of a target nucleic acid in a sample, which uses the nucleic acid detection system described in Embodiment 2. In this embodiment, the Cas complexes contained in the two or more test strips are each designed for a different target sequence.

[0054] This embodiment also relates to a method for detecting a target nucleic acid in a sample, the method comprising the steps of: using the nucleic acid detection system described in the first or second embodiment to sample, inserting the swab into the swab inlet of the detection system, turning on the temperature control means, and observing a color change of the test strip in the fourth chamber. The sample may be urine, blood, serum, cerebrospinal fluid, saliva, or the like.

[0055] (Example) Hereinafter, the nucleic acid detection system and nucleic acid detection method of this embodiment will be specifically illustrated using the novel coronavirus (hereinafter also referred to as "Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)") as an example, but this embodiment is not limited to these examples. The novel coronavirus infection is also referred to as "COVID-19."

[0056] (Example 1: Preparation of nucleic acid detection system) Based on the novel coronavirus genome sequence, we designed LAMP primers for isothermal LAMP amplification and crRNA sequences for detection using the Cas12 enzyme for the N gene.

[0057] The template was a plasmid containing a fragment of the N gene of SARS-CoV-2, where the N gene is as follows (SEQ ID NO: 1):

[0058]

[0059] Table 1 below shows the LAMP primer sequences used in this example.

[0060] [Table 1]

[0061] The designed crRNA sequence (SEQ ID NO: 8) is as follows:

[0062] SEQ ID NO: 8: UAAUUUCUACUAAGUGUAGAUUUGAACUGUUGCGACUACGU

[0063] Probe sequence: FITC-T12-Biotin

[0064] All of the above materials are synthesized and purchased from Nanjing Jinsirui Company.

[0065] The LAMP amplification method may be carried out by referring to the specifications of the WarmStart (registered trademark) LAMP kit.

[0066] The SARS-CoV-2 detection test paper was prepared as follows: steps S21 to S29.

[0067] Step S21: Glass fiber filter paper (Whatman, 1827-021) was cut to the desired size.

[0068] Step S22: High-pressure sterilization is performed for 90 minutes (high-pressure sterilizer, MKII).

[0069] Step S23: Block in 5% nuclease-free BSA (EM Millipore, 126609-10GM) for 12 hours.

[0070] Step S24: Wash three times with nuclease-free water (Life Technologies, AM9932).

[0071] Step S25: Add 4% RNASecure (Life Technologies, AM7006) and leave at 60°C for 20 minutes, then wash three times with nuclease-free water.

[0072] Step S26: The treated paper is dried in an oven (DHG-9140A, Shanghai Yiheng) at 80°C for 15 minutes.

[0073] Step S27: The components of each chamber are arranged on the test paper processed as described above, as designed. Specifically, the following (a) to (d) are arranged.

[0074] a) Second Chamber [Table 2]

[0075] b) Third Chamber: Amplification mixture as shown in Table 3. [Table 3]

[0076] c) Here, carnauba wax is used for the wax valve (C804522, MACKLIN).

[0077] d) Fourth chamber: Reagents and other components contained in the Cas enzyme reaction area are shown in Tables 4 and 5, respectively. [Table 4] [Table 5]

[0078] Step S28: Rapidly cool with liquid nitrogen and freeze-dry overnight.

[0079] Step S29: The test paper prepared in a dry environment is assembled into a sleeve material.

[0080] (Example 2: Detection of SARS-CoV-2 using the nucleic acid detection system of Example 1) The SARS-CoV-2 detection test strip from Example 1 was combined with a temperature control unit, and 50 μL of a positive plasmid solution (positive sample) and a solution not containing SARS-CoV-2 (negative sample) were dropped into the first chamber. The temperature control unit operated according to a preset program, and the sample flowed directly from the first chamber to the second chamber. In this example, a mock sample was used, and since thermal inactivation and decomposition in the second chamber were not required, the sample flowed directly into the third chamber. The temperature of the third chamber was controlled at 65°C, and LAMP amplification was performed in the chamber. After 10 minutes, the wax valve opened, allowing the sample to flow into the fourth chamber. The temperature of the fourth chamber was controlled at 37°C. In this chamber, liquid first entered the Cas enzyme reaction area, where the lyophilized reagent in that area hydrated. The pre-designed Cas enzyme recognized the target nucleic acid and sheared the probe. The reaction time was 5 minutes. The sheared probe continued to move toward the absorbent pad of the test strip, and according to the designed principle, control band 1 first turned red, then the test band turned red, and finally the anhydrous copper sulfate band (control band 2) turned blue. In a positive sample, all three bands above turned colored, while in a negative sample, the test band did not turn colored. A photograph of the test strip (fourth chamber) showing the above detection results is shown in Figure 12.

[0081] As can be seen from the above, this embodiment provides a highly integrated, automated, and portable nucleic acid detection system that does not require expensive equipment, specialized operators, or a special laboratory, can be stored and transported at room temperature, ensures sequence specificity of detection results, does not contaminate the inside or outside, achieves "sample in, result out," and is applicable to POCT. Furthermore, the nucleic acid detection system of this embodiment includes multiple fourth chambers, which enables simultaneous detection of multiple target nucleic acids, making it applicable to, for example, genotyping and simultaneous detection of DNA and RNA.

[0082] According to at least one of the embodiments described above, nucleic acids can be detected with high sensitivity.

[0083] Although several embodiments have been described, these embodiments are presented as examples and are not intended to limit the scope of the invention. These embodiments can be implemented in various other forms, and various omissions, substitutions, modifications, and combinations of embodiments can be made without departing from the spirit of the invention. These embodiments and their modifications are included within the scope and spirit of the invention, as well as within the scope of the invention and its equivalents as defined in the claims. [Explanation of symbols]

[0084] 10 Nucleic Acid Detection System 100 Disposable detector 200 Temperature Control Unit 1. First Chamber 2. Second Chamber 3. Third Chamber 4. Fourth Chamber 5 Swab inlet 6 Extrusion Passage 7 Extrusion funnel 8 Pressing protrusion 9 Filters W wax valve R Freeze-dried Reagent Ball P holder material S absorbent material H Heating Block 11 Sample pad 12 Cas enzyme reaction domain 13 Cas enzyme reaction termination region 14 Gold-labeled anti-FAM antibody region 15 Streptavidin domain 16 Antibody capture region 17 Anhydrous copper sulfate band 18 Absorbent Pads

Claims

1. A nucleic acid detection system for detecting a target nucleic acid in a sample, comprising: forming a liquid flow path and including a sample chamber, a thermal deactivation chamber, an amplification chamber, and a detection chamber arranged in a line; liquid flows sequentially through the sample chamber, the thermal deactivation chamber, the amplification chamber, and the detection chamber by siphoning or capillary action; the sample chamber includes a swab inlet into which a swab having a sample attached thereto is inserted; the thermal inactivation chamber contains a reagent for thermally inactivating and decomposing membrane proteins and proteins bound to nucleic acids of viruses contained in the sample; the amplification chamber contains reagents for amplifying the target nucleic acid; the detection chamber includes a test strip for performing a Cas enzyme reaction with the target nucleic acid and lateral flow detection; the heat deactivation chamber, the amplification chamber, and the detection chamber are constructed from a continuous paper-based material; Nucleic acid detection system.

2. a filter between the sample chamber and the thermal deactivation chamber for purifying the sample; The nucleic acid detection system according to claim 1 .

3. the sample chamber further includes an extrusion passage; The nucleic acid detection system according to claim 1 or 2.

4. a valve for separating the chambers between the thermal deactivation chamber and the amplification chamber; The nucleic acid detection system according to any one of claims 1 to 3.

5. a valve for separating the amplification chamber from the detection chamber; The nucleic acid detection system according to any one of claims 1 to 4.

6. The valve is a wax valve. The nucleic acid detection system according to claim 4 or 5.

7. The wax valve is composed of a single wax layer or is attached to a holder material. The nucleic acid detection system according to claim 6 .

8. a temperature control means for controlling the temperature of the amplification chamber; The nucleic acid detection system according to any one of claims 1 to 7.

9. The wax valve is opened by heating with a temperature control means. The nucleic acid detection system according to claim 6 .

10. the reagents in the heat inactivation chamber and the amplification chamber are lyophilized agents; The nucleic acid detection system according to any one of claims 1 to 9.

11. The freeze-dried agent is adsorbed onto a freeze-dried reagent ball or holder material. The nucleic acid detection system according to claim 10.

12. The reagent used in the Cas enzyme reaction includes a Cas enzyme complex, The Cas enzyme complex comprises a Cas enzyme, a guide nucleic acid, and a probe; the guide nucleic acid comprises a guide sequence capable of binding to the target nucleic acid and forming a complex with the Cas enzyme; The probe is a DNA or RNA-based molecule that contains a non-target nucleic acid sequence, and when sheared by the Cas enzyme, generates a molecule required for the subsequent reaction. The nucleic acid detection system according to any one of claims 1 to 11.

13. The reagent for performing the Cas enzyme reaction is a freeze-dried agent, The nucleic acid detection system according to any one of claims 1 to 12.

14. The freeze-dried agent is a freeze-dried reagent ball or is adsorbed on a holder material; The nucleic acid detection system according to claim 13 .

15. The amplification is selected from nucleic acid sequence-based amplification, recombinant enzyme polymerase amplification, loop-mediated isothermal amplification, strand displacement amplification, ribonuclease-dependent amplification, or slit enzyme amplification; The nucleic acid detection system according to any one of claims 1 to 14.

16. The detection chamber includes, in order along a liquid flow path, a sample pad, a Cas enzyme reaction area, a gold-labeled anti-FAM antibody area, a streptavidin area, and an antibody capture area. The nucleic acid detection system according to any one of claims 1 to 15.

17. The detection chamber further comprises a Cas enzyme reaction termination region containing a Cas enzyme antibody or inhibitor after the Cas enzyme reaction region and before the gold-labeled anti-FAM antibody region; The nucleic acid detection system according to claim 16.

18. the detection chamber further comprises an anhydrous copper sulfate band after the antibody capture region; The nucleic acid detection system according to claim 16 or 17.

19. The detection chamber comprises: two or more test strips; using the two or more test strips to simultaneously detect multiple target nucleic acids in a sample; The nucleic acid detection system according to any one of claims 1 to 18.

20. A nucleic acid detection method for detecting a target nucleic acid in a sample, comprising: forming a liquid flow path and including a sample chamber, a thermal deactivation chamber, an amplification chamber, and a detection chamber arranged in a line; a liquid flows sequentially through the sample chamber, the thermal deactivation chamber, the amplification chamber, and the detection chamber by siphoning or capillary action; a nucleic acid detection system in which the heat inactivation chamber, the amplification chamber, and the detection chamber are made of a continuous paper-based material; In the sample chamber, a swab having a sample attached thereto is inserted into a swab inlet; In the thermal inactivation chamber, the membrane proteins and proteins bound to nucleic acids of the viruses contained in the sample are thermally inactivated and decomposed; amplifying the target nucleic acid in the amplification chamber; In the detection chamber, a Cas enzyme reaction with the target nucleic acid and lateral flow detection are performed. A nucleic acid detection method comprising:

21. observing a color change in the test strip in the detection chamber; The nucleic acid detection method according to claim 20.

22. The sample is urine, blood, serum, cerebrospinal fluid, or saliva. The nucleic acid detection method according to claim 20 or 21.

23. the detection chamber contains two or more test strips; Each Cas complex contained in the two or more test strips is designed for a different target sequence; using the two or more test strips to simultaneously detect multiple target nucleic acids in the sample; The nucleic acid detection method according to any one of claims 20 to 22.

Images