Agent and method for inhibiting the growth of Clostridium perfringens

Abstract

Provided is a technology that can effectively inhibit the growth of Clostridium perfringens. According to the present invention, the growth of Clostridium perfringens can be inhibited. Furthermore, according to the present invention, by inhibiting the growth of this bacterium, it is possible to contribute to the prevention and improvement of various diseases and unhealthy conditions in which this bacterium is involved in the onset or exacerbation of the disease. For example, if the number of bacteria of this bacterium in the living body, such as the digestive tract, can be suppressed, it can directly contribute to the prevention and improvement of diseases and unhealthy conditions in which toxins from this bacterium are involved in the intestines (e.g., food poisoning, non-food-toxic diarrhea, necrotizing enteritis, hemorrhagic enteritis, etc.). SOLUTION: A growth inhibitor of Clostridium perfringens containing agarooligosaccharide as an active ingredient.

Description

[Technical Field]

[0001] The present invention relates to an agent and method for inhibiting the growth of Clostridium perfringens. [Background technology]

[0002] Clostridium perfringens (sometimes referred to as "the bacterium" in the present invention) is a Gram-positive, spore-forming, non-motile, obligately anaerobic bacillus, also known as Clostridium perfringens. This bacterium inhabits a variety of environments, including soil in cultivated land, rivers, oceans, sewage, and food, as well as the digestive tracts of humans and animals.

[0003] This bacterium is present in the body regardless of whether it is healthy or unhealthy. It produces as many as 23 different toxins (the combination of toxins produced varies depending on the strain), each of which can cause a specific disease. The toxins produced by this bacterium are shown in Figure 1, excerpted from Sapplementary Table S1 in Non-Patent Document 1. This bacterium is also oxygen-tolerant and can survive in aerobic environments. It produces a toxic gas (hydrogen sulfide), forms spores that can withstand extreme temperatures, and grows rapidly (generation time of 8-12 minutes in optimal medium at 43°C) (Non-Patent Document 1). For these reasons, this bacterium is a pathogenic microorganism that requires significant public health attention.

[0004] For example, diseases in which this bacterium is involved in the onset or exacerbation include clostridial soft tissue infections such as food poisoning (human food and feed) (Non-Patent Document 2) and gas gangrene (humans and animals) (Non-Patent Documents 3 and 4), non-food-induced toxic diarrhea such as antibiotic-associated diarrhea, and systemic and intestinal diseases such as necrotizing enteritis (humans, poultry, birds, pigs, calves, foals, and goats), hemorrhagic enteritis (calves, foals, and sheep), and dysbiosis (sheep, goats, and cattle) (Non-Patent Document 1, Table 1 in Non-Patent Document 5, etc.). [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Raymond Kiu & Lindsay J. Hall, An update on the human and animal enteric pathogen Clostridium perfringens, Emerging Microbes & Infections (2018), 7:141, 1-15, DOI:10.1038 / s41426-018-0144-8 [Non-patent document 2] Tokyo Metropolitan Institute of Public Health, Microbiology Department, Chie Kadouma and Yoshinori Yanagawa, What is Clostridium perfringens infection?, IDWR 2006 No. 33, National Institute of Infectious Diseases, [online][Retrieved November 13, 2024], Internet<URL:https: / / www.niid.go.jp / niid / ja / kansennohanashi / 324-c-perfringens-intro.html> [Non-patent document 3] Merck & Co., Inc., Kenilworth, NJ, USA, MSD Manual Professional Edition / 13. Infectious Diseases / Anaerobic Bacteria / Clostridial Soft Tissue Infections, Authors: Larry M. Bush, Maria T., Review / Revision June 2023, [Retrieved November 13, 2024], Internet <URL: https: / / www.msdmanuals.com / ja-jp / professional / 13-%E6%84%9F%E6%9F%93%E6%80%A7%E7%96%BE%E6%82%A3 / %E5%AB%8C%E6%B0%97%E6%80%A7%E7%B4%B0%E8%8F%8C / %E3%82%AF%E3%83%AD%E3%82%B9%E3%83%88%E3%83%AA%E3%82%B8%E3%82%A6%E3%83%A0%E8%BB%9F%E9%83%A8%E7%B5%84%E7%B9%94%E6%84%9F%E6%9F%93%E7%97%87> [Non-patent document 4] Merck & Co., Inc., Kenilworth, NJ, USA, MSD Manual Home Edition / 16. Infectious Diseases / Bacterial Infections: Anaerobic Bacteria / Gas Gangrene, Author: Larry M. Bush, Review / Revision May 2021, [Retrieved November 13, 2024], Internet <URL: https: / / www.msdmanuals.com / ja-jp / home / 16-%E6%84%9F%E6%9F%93%E7%97%87 / %E7%B4%B0%E8%8F%8C%E6%84%9F%E6%9F%93%E7%97%87%EF%BC%9A%E5%AB%8C%E6%B0%97%E6%80%A7%E7%B4%B0%E8%8F%8C / %E3%82%AC%E3%82%B9%E5%A3%8A%E7%96%BD> [Non-Patent Document 5] Tomasz Grenda et al., Review Clostridium perfringens?Opportunistic Foodborne Pathogen, Its Diversity and Epidemiological Significance, Pathogens 2023, 12, 768. https: / / doi.org / 10.3390 / pathogens12060768, 1-12 Summary of the Invention [Problem to be solved by the invention]

[0006] As described above, this bacterium is a microorganism that is normally present in various environments and living organisms, but is also a pathogenic microorganism that is sometimes involved in the onset or exacerbation of various diseases and unhealthy conditions. Therefore, the present inventors believed that if the growth of this bacterium could be inhibited, it would be possible to contribute to the prevention or improvement of diseases and unhealthy conditions in which this bacterium is involved in the onset or exacerbation.

[0007] That is, an object of the present invention is to provide a technique that can effectively inhibit the growth of this bacterium and to provide a technique that can contribute to the prevention and improvement of various diseases and ill health conditions in which this bacterium is involved in the onset or exacerbation of the diseases. [Means for solving the problem]

[0008] As a result of extensive research, the present inventors have found that agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having 3,6-anhydro-L-galactose at the reducing end (hereinafter, these may be collectively referred to as the "active ingredient" or any one or more of these may be referred to as the "active ingredient") can inhibit the growth of this bacterium and reduce its presence in the bacterial flora. Based on this finding, the present inventors have completed the following inventions.

[0009] (1) A first aspect of the growth inhibitor of Clostridium perfringens according to the present invention (sometimes referred to as "the agent") contains agarooligosaccharide as an active ingredient.

[0010] (2) The agent may be used to prevent or ameliorate one or more diseases selected from food poisoning, Clostridial soft tissue infection, non-food-toxic diarrhea, and necrotizing enterocolitis. That is, the present invention also provides an agent for preventing or ameliorating one or more diseases selected from food poisoning, Clostridial soft tissue infection, non-food-toxic diarrhea, and necrotizing enterocolitis, which comprises as an active ingredient one or more selected from agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having agarooligosaccharides at the reducing end.

[0011] (3) In the present invention, the agarooligosaccharide may contain agarobiose.

[0012] (4) A second embodiment of the present agent contains 3,6-anhydro-L-galactose or an oligosaccharide having 3,6-anhydro-L-galactose at the reducing end as an active ingredient.

[0013] (5) A first aspect of the method of the present invention for inhibiting the growth of Clostridium perfringens (sometimes referred to as "the method") is a method for inhibiting the growth of Clostridium perfringens in a living body, which comprises the step of administering to a human or an animal one or more selected from agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having agarooligosaccharides at their reducing ends.

[0014] (6) A second aspect of the present method is a method for inhibiting the growth of Clostridium perfringens in vitro, comprising the step of contacting a substance containing Clostridium perfringens with one or more selected from agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having agarooligosaccharides at their reducing ends.

[0015] (7) The method according to the first aspect may be a method for preventing or ameliorating one or more diseases selected from food poisoning, Clostridial soft tissue infections, non-food-induced diarrhea, and necrotizing enterocolitis by suppressing the growth of Clostridium perfringens in a living body. That is, the present invention also provides a method for preventing or ameliorating one or more diseases selected from food poisoning, Clostridial soft tissue infections, non-food-induced diarrhea, and necrotizing enterocolitis, comprising the step of administering to a human or animal one or more selected from agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having agarooligosaccharides at their reducing ends.

[0016] Furthermore, the method according to the second aspect may be a method for preventing or ameliorating one or more diseases selected from food poisoning, Clostridial soft tissue infections, non-food-induced diarrhea, and necrotizing enterocolitis by suppressing the growth of Clostridium perfringens in vitro. That is, the present invention also provides a method for preventing or ameliorating one or more diseases selected from food poisoning, Clostridial soft tissue infections, non-food-induced diarrhea, and necrotizing enterocolitis, which comprises the step of contacting one or more selected from agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having 3,6-anhydro-L-galactose at their reducing ends with a substance containing Clostridium perfringens.

[0017] The present invention may be practiced outside of medical practice. [Effects of the Invention]

[0018] According to the present invention, the growth of Clostridium perfringens can be inhibited. Furthermore, by inhibiting the growth of this bacterium, the present invention can contribute to the prevention and improvement of various diseases and unhealthy conditions in which this bacterium is involved in the onset or exacerbation of the disease.

[0019] For example, if the number of bacteria of this bacterium in the body, such as in the digestive tract, can be suppressed, it will directly contribute to the prevention and improvement of diseases and unhealthy conditions associated with toxins of this bacterium in the intestines (e.g., food poisoning, non-food-induced diarrhea, necrotizing enteritis, hemorrhagic enteritis, etc.).

[0020] Furthermore, by suppressing the number of bacteria in the body, it is possible to suppress the number of bacteria excreted from the body into the environment, which in turn suppresses the number of bacteria that enter body tissues through wounds or food, and is thought to contribute to the prevention and improvement of diseases and ill health conditions caused by this bacteria (e.g., food poisoning and soft tissue infections).

[0021] Furthermore, if the number of bacteria in vitro can be suppressed in foods or feed, the number of bacteria entering the body through the ingestion of such foods or feed can be suppressed, which is thought to contribute to the prevention and improvement of diseases and ill health conditions caused by this bacteria (e.g., food poisoning and soft tissue infections).

[0022] Furthermore, if the number of bacteria can be suppressed outside the body, for example, on floors, walls, and various facilities in hospitals, elderly care facilities, animal care facilities, etc., the number of bacteria present in the environment can be suppressed. As a result, the number of bacteria that invade and grow in wounds or food, etc., and then invade living tissues through these can be suppressed, which is thought to contribute to the prevention and improvement of diseases and ill health conditions caused by this bacteria (e.g., food poisoning and soft tissue infections).

[0023] Furthermore, the agarooligosaccharides used as active ingredients in the present invention are oligosaccharides derived from agar, which has been consumed as a food since ancient times, and are extremely safe. Therefore, according to the present invention, the growth of Clostridium perfringens can be inhibited without concerns about safety or side effects. Furthermore, since the existence of strains of this bacterium that are resistant to tetracycline, macrolide, and lincomycin antibiotics has been reported (Non-Patent Document 1), being able to inhibit growth without relying on antibiotics is preferable in terms of preventing the spread of resistant bacteria. [Brief explanation of the drawings]

[0024] [Figure 1] This figure is an excerpt from Sapplementary Table S1 of Non-Patent Document 1, and is a table summarizing the toxins produced by Clostridium perfringens that have been identified to date (2018, the year Non-Patent Document 1 was published), the genes that encode them, and the pathogenic mechanisms of action. [Figure 2] 1 is a bar graph showing the turbidity (OD660) of the culture medium in which Clostridium perfringens was cultured in the presence of sucrose (Suc) or agarooligosaccharides (AOS). In the figure, the plot shows the measured value for each sample. [Figure 3] This table shows the 20 microbial strains that make up the Human Resident Microbial DNA Cocktail (product name "DNA-Mock-003", lot 240101ND, NBRC). This table was taken from the product data sheet (National Institute of Technology and Evaluation, HOME > Biotechnology > Microorganisms and Industrial Use > Microbiome > NBRC Human Resident Microbial Cocktail, [online] [searched July 29, 2024], Internet). <URL: https: / / www.nite.go.jp / nbrc / industry / microbiome / cocktail20220113.html><URL: https: / / www.nite.go.jp / data / 000152907.pdf> ). [Figure 4]1 is a bar graph showing the turbidity (OD660) of the culture medium in which Clostridium perfringens was co-cultured with a human resident bacterial DNA cocktail in the absence (Sample 1) or presence (Sample 2) of agarooligosaccharides. In the figure, the plots show the measured values ​​for each sample. DETAILED DESCRIPTION OF THE INVENTION

[0025] The present invention will be described in detail below.

[0026] Agarooligosaccharides are even-numbered oligosaccharides consisting of repeating units of agarobiose, a disaccharide composed of D-galactose and 3,6-anhydro-L-galactose. Examples of agarooligosaccharides include the smallest unit, the disaccharide agarobiose, the tetrasaccharide agarotetraose, the hexasaccharide agarohexaose, the octasaccharide agarooctaose, and the decasaccharide agarodecaose. In the present invention, agarooligosaccharides contain at least one of these oligosaccharides, and may consist of one type or two or more types. For example, agarooligosaccharides may consist solely of agarobiose, or may contain agarooligosaccharides other than agarobiose. In this case, the content of agarobiose in the agarooligosaccharide may be, for example, 1 to 100% by mass, 10 to 100% by mass, 20 to 100% by mass, 30 to 100% by mass, 40 to 100% by mass, or 50 to 100% by mass.

[0027] Agarooligosaccharides are oligosaccharides having 3,6-anhydro-L-galactose at the reducing end. Therefore, the active ingredient of the present invention may be 3,6-anhydro-L-galactose or an oligosaccharide having 3,6-anhydro-L-galactose at the reducing end. In this case, the number of sugars in the oligosaccharide may be, for example, 2 to 8 sugars, 2 to 10 sugars, or 2 to 12 sugars.

[0028] Agaroligosaccharides can be commercially available agarooligosaccharides (agar oligosaccharides), or can be produced by conventional methods. A typical method for producing agarooligosaccharides is, for example, a method of hydrolyzing agar. Hydrolysis can be performed using either an acid or an enzyme.

[0029] Examples of acid decomposition methods include those using solid acids as described in Japanese Patent No. 4796697, mineral acids such as sulfuric acid and hydrochloric acid, and organic acids such as acetic acid and citric acid, but any method can be used. Acid decomposition can produce an even-numbered sugar having 3,6-anhydro-L-galactopyranose at the reducing end.

[0030] Enzymatic degradation methods include degradation with α-agarase and degradation with β-agarase. As with acid degradation, α-agarase can be used to obtain even-numbered sugars having 3,6-anhydro-L-galactopyranose at the reducing end. Degradation with α-agarase can be carried out, for example, by the method described in Japanese Patent Application Publication No. H2-65789.

[0031] The agar hydrolysate may be used as agarooligosaccharides directly, or may be purified or pH-adjusted before use. Purification methods include filtration using filter paper or activated carbon. The agarooligosaccharide solution obtained by hydrolysis may be used in liquid form, or, if necessary, may be powdered by vacuum freeze-drying or other methods.

[0032] Agar is a dehydrated and dried mucilage extracted from red seaweeds such as Gelidium and Gracilaria, and contains the polysaccharides agarose and agaropectin as its main components. In addition to agar, substances containing agarose and agaropectin can also be used as raw materials for producing agarooligosaccharides. Specific examples of such substances include solutions obtained by hot water extraction of red algae from the Gelidaceae, Gracilaria, and Gracilaria families, which are the raw materials for agar. Examples of red algae from the Gelidaceae family include Acanthus nigricans, Acanthus nigricans, Acanthus nigricans, Acanthus obscurus, and Acanthus japonica. Examples of red algae from the Gracilaria family include Gracilaria gracilaria and Gracilaria sieboldii. Examples of red algae from the Gracilaria family include Acanthus gistus and Acanthus sieboldii. These red algae can be used alone or in combination of two or more.

[0033] The sugar composition of agarooligosaccharides can be confirmed by liquid chromatography, including high performance liquid chromatography, as shown in the Examples below. This allows agarooligosaccharides with a desired number of sugars, such as agarobiose only, agarotetraose only, or agarohexaose only, to be fractionated and used after adjusting the sugar composition of the agarooligosaccharides.

[0034] 3,6-Anhydro-L-galactose can be prepared using commercially available reagents or by standard methods. Examples of such methods include the method described in Japanese Patent No. 4007760. Specifically, 50 μL of 10x phosphate-buffered saline and 50 μL of 10 units / μL β-galactosidase phosphate-buffered saline solution were added to 450 μL of a 100 mM aqueous solution of agarobiose, mixed, and allowed to react at 37°C for 1 hour. 5 mL of a 1:1 mixture of 1-butanol and ethanol was added to the reaction mixture, and the mixture was centrifuged to precipitate insoluble matter. The resulting supernatant was subjected to column chromatography using a silica gel column, and the mixture was compressed at 0.3 kg / cm using a compressor with a 5:5:1 mixture of 1-butanol, ethanol, and water as the eluent. 2The mixture is pressurized to 100°C and separated. By separating the fractions so that each fraction is 7 mL, a liquid containing highly purified 3,6-anhydro-L-galactose can be obtained, for example, in fractions 14 to 17. These fractions can be collected and evaporated to dryness under reduced pressure to obtain 3,6-anhydro-L-galactose.

[0035] "Suppressing the growth" of Clostridium perfringens includes not only reducing the number of bacteria of this bacterium (reducing the proportion of bacteria in the bacterial flora), but also maintaining the number of bacteria at a similar level or increasing the number of bacteria but to a smaller extent than when the active ingredient of the present invention is not used. Furthermore, suppressing growth and suppressing the number of bacteria are synonymous.

[0036] Whether or not the growth of the present bacterium can be inhibited can be confirmed by a conventional method. For example, if the present bacterium is in an isolated state, the active ingredient can be added to the medium, and the number of bacteria can be confirmed by a turbidity method or the like, in comparison with the case where the active ingredient is not added.

[0037] Furthermore, when the bacterium is not isolated (e.g., feces, saliva, vaginal secretions, nasal secretions, soil, river water, seawater, food, feed, a cocktail of bacterial solutions containing multiple bacterial species, or a human intestinal model), a method can be used to amplify bacterial 16S rDNA by polymerase chain reaction (PCR) using the total genomic DNA of the bacterium extracted from the sample as a template, and then the amplified product can be decoded by next-generation sequencing (NGS). The bacterial species and abundance can be identified based on a 16S database, and the abundance ratio of the bacterium can be determined and compared between samples administered with and without the active ingredient of the present invention. Alternatively, quantitative PCR can be performed on the total genomic DNA of the bacterium using primers specific to the bacterium. When determining the number of bacteria by PCR, because the amount of genes purified from the sample (purification efficiency) is not constant, it is preferable to calculate the proportion of the bacterium (abundance ratio, occupancy) in the total number of bacteria or the amount of template DNA and use this proportion to make a judgment.

[0038] When quantifying this bacterium by PCR, specific primers can be designed based on a partial sequence of genomic DNA (a conserved region of this bacterium) that is conserved in this bacterium but not in closely related species, identified based on published sequence information. For example, the genome of Clostridium perfringens JCM 1290, the type strain of this bacterium, is published under GenBank accession number CP000246, and the DNA sequence of the plc gene (the gene encoding alpha-toxin (phospholipase C)) (SEQ ID NO: 1) has also been identified. In this way, this bacterium can also be quantified using primers specific to the sequence of the gene encoding this bacterium's toxin.

[0039] [SEQ ID NO: 1] plc gene (length 1197 bases) derived from Clostridium perfringens JCM 1290 (Clostridium perfringens ATCC 13124), accession number: GenBank: CP000246 (genome): 48363-49559 (plc gene corresponding portion) atgaaaagaa agatttgtaa ggcgcttatt tgtgccgcgc tagcaactag cctatgggct ggggcatcaa ctaaagtcta cgcttgggat ggaaagattg atggaacagg aactcatgct atgattgtaa ctcaaggggt ttcaatctta gaaaatgatc tgtccaaaaa tgaaccagaa agtgtaagaa aaaacttaga gattttaaa gagaacatgc atgagcttca attaggttct acttatccag attatgataa gaatgcatat gatctatatc aagatcattt ctgggatcct gatacagata ataatttctc aaaggataat agttggtatt tagcttattc tatacctgac acagggggaat cacaataaag aaaattttca gcattagcta gatatgaatg gcaaagagga aactataaac aagctacatt ctatcttgga gaggctatgc actattttgg agatatagat actccatatc atcctgctaa tgtgcc gttgatagcg caggacatgt taagtttgag acttttgcag aggaaagaaa agaacagtat aaaaataaca cagcaggttg caaaactaat gaggctttt atactgatat cttaaaaaac aaagatttta atgcatggtc aaaagaatat gcaagaggtt ttgctaaaac aggaaaatca atatactata gtcatgctag catgagtcat agttgggatg attgggatta tgcagcaaag gtaactttag ctaactctca aaaaggaaca gcgggatata tttatagagatt cttacacgat gtatcagagg gtaatgatcc atcagttgga aagaatgtaa aagaactagt agcttacata tcaactagtg gtgagaaaga tgctggaaca gatgactacatgtattttgg aatcaaaaca aaggatggaa aaactcaaga atgggaaatg gacaacccag gaaatgattt tatgactgga agtaaagaca cttatacttt caaattaaaa gatgaaaatc taaaaattga tgatatacaa aatatgtgga ttagaaaaag aaaatataca gcattctcag atgcttataa gccagaaaac ataaagataa tagcaaatgg aaaagttgta gtggacaaag atataaacga gtggatttca ggaaattcaa cttataatat aaaataa

[0040] As mentioned above, Clostridium perfringens has been reported to be a food poisoning pathogen. Food poisoning caused by this bacterium is an infectious food poisoning caused by the ingestion of foods containing large amounts of this bacterium. The bacteria multiply in the intestinal tract and form spores, producing and releasing a toxin (enterotoxin, CPE). The main symptoms are abdominal pain and diarrhea. The main causative foods include curry, soup, meatballs, roasted pork, and stewed vegetables. These foods are often cooked in large quantities and then left at room temperature for several hours or overnight. While most coexisting bacteria are killed in cooked foods, the heat-resistant spores of this bacterium survive. Reheating promotes spore germination and simultaneously expels oxygen from the food, creating favorable conditions for bacterial growth. Furthermore, the optimum growth temperature of this bacterium is 43-47°C, which is higher than that of other bacteria, and its proliferation rate is also fast, so it is thought that it will rapidly proliferate as cooked food is gradually cooled (Non-Patent Document 2), exceeding the threshold for onset. Food poisoning caused by this bacterium has been reported to be caused by type A (producing alpha-toxin) and type F (producing alpha-toxin and CPE) (Non-Patent Documents 1 and 5).

[0041] Therefore, if the growth of this bacterium can be inhibited in vivo, the amount of toxins released in the intestine, such as alpha-toxin and CPE, can be reduced. Furthermore, if the growth of this bacterium can be inhibited in vivo, the number of bacteria excreted from the organism into the environment can be reduced, thereby suppressing the number of bacteria invading food or feed. Furthermore, if the growth of this bacterium can be inhibited in food or feed by adding an active ingredient to the food or feed, the number of bacteria invading the organism can be reduced by ingesting the food or feed. Based on these findings, it is believed that inhibiting the growth of this bacterium in vivo or in vitro can contribute to the prevention or amelioration of food poisoning. In other words, the active ingredient of the present invention can be used to prevent or ameliorate food poisoning.

[0042] As mentioned above, this bacterium has also been reported to be a pathogen of clostridial soft tissue infections. Clostridial soft tissue infections are diseases in which the genus Clostridium infects skin or muscle tissue, causing tissue damage. Examples of such diseases include clostridial cellulitis, clostridial myositis, and clostridial myonecrosis, and they vary in severity. Clostridium perfringens is the most common bacterial species involved in this disease. While this infection can occur naturally, it usually occurs after trauma such as surgery or injury. This is because damaged soft tissues and deep wounds have poor blood flow and reduced oxygen levels, creating an environment suitable for the growth of anaerobic bacteria (Non-Patent Documents 3 and 4).

[0043] Clostridial cellulitis is a localized infection occurring in superficial wounds; the infection spreads widely along fascial planes, often accompanied by obvious crepitus and copious gas production, but the toxicity is less severe than that of widespread myonecrosis, and pain is minimal (Non-Patent Documents 3 and 4).

[0044] Clostridial myositis is a non-necrotic suppurative infection of the muscles, causing edema, pain, and often emphysema within the tissues. It is frequently seen in injection drug users. Although no systemic symptoms are observed, the infection can spread rapidly and progress to myonecrosis (Non-Patent Documents 3 and 4).

[0045] Clostridial myonecrosis (gas gangrene) is an infectious disease that rapidly spreads to muscles, causing symptoms such as discoloration of the affected area, severe pain, blisters, tension edema, tenderness, foul-smelling wounds and pus discharge, crepitus, fever, sweating, tachycardia, pallor, decreased blood pressure, toxic shock, acute renal failure, and sepsis. It is a severe disease with a mortality rate of 100% if untreated and approximately 25% even with treatment (Non-Patent Documents 3 and 4). Alpha-toxin and perfringulinicin O (PFO) have been reported to be involved in myonecrosis (Non-Patent Documents 1 and 5).

[0046] Therefore, if the growth of this bacterium can be inhibited in vivo, the amount of toxins such as alpha-toxin and PFO released at the affected area can be reduced. Furthermore, if the growth of this bacterium can be inhibited in vivo or ex vivo, the number of bacteria excreted from the living body into the environment or present in the environment can be suppressed, thereby suppressing the number of bacteria invading the wound site. From these findings, it is believed that if the growth of this bacterium can be inhibited in vivo or ex vivo, it can contribute to the prevention or amelioration of Clostridium soft tissue infections. In other words, the active ingredient of the present invention can be used to prevent or ameliorate Clostridium soft tissue infections.

[0047] As mentioned above, this bacterium has also been reported to be a pathogen of non-food-induced diarrhea. Non-food-induced diarrhea is a disease distinct from food poisoning, characterized primarily by severe symptoms and prolonged duration. Examples include antibiotic-associated diarrhea (AAD) and sporadic diarrhea (SD). Clinical symptoms include abdominal pain, prolonged diarrhea (3 days to several weeks), and bloody stools. AAD occurs in 5–25% of patients receiving broad-spectrum antibiotics. While Clostridium difficile and S. aureus have also been implicated in AAD, Clostridium perfringens type F (producing alpha toxin and CPE) is estimated to be the causative agent in 15% of cases. CPE, a toxin commonly present in diarrheal patients but absent in healthy individuals, has been reported to be the causative agent of non-food-induced diarrhea caused by this bacterium. Type F of this bacterium has also been reported to be involved in SD. It has been reported that the AAD-associated strain of this bacterium adheres more readily to Caco-2 intestinal cells than other food poisoning strains, which is thought to be due to the production of a sialidase (NanI).The spore-forming ability of this bacterium may also contribute to the persistence and recurrence of this disease (Non-Patent Document 1).

[0048] Therefore, if the growth of this bacterium can be inhibited in vivo, the amount of toxins released in the intestine, such as CPE, can be reduced. Furthermore, if the growth of this bacterium can be inhibited in vivo or ex vivo, the number of bacteria excreted from the organism into the environment or present in the environment can be suppressed, thereby suppressing the number of bacteria entering the organism via various routes, such as drinking water, food, and feed. Based on these findings, it is believed that inhibiting the growth of this bacterium in vivo or ex vivo can contribute to the prevention or amelioration of non-food-induced diarrhea. In other words, the active ingredient of the present invention can be used to prevent or ameliorate non-food-induced diarrhea.

[0049] As mentioned above, this bacterium has been reported to be the pathogen of necrotic enteritis (NECO), a disease characterized by partial necrosis of the intestine. Necrotic enteritis caused by Clostridium perfringens was observed in adult humans in postwar environments with poor sanitary conditions and malnutrition, but is now primarily seen in premature infants (premature babies). It has also been reported in animals such as poultry, horses, and pigs. The toxins believed to be the etiological agents of enteritis in each subject vary. For example, NetB and TpeL are responsible for necrotic enteritis in poultry; CPE, β2 toxin, NetE, NetF, and NetG are responsible for necrotic enteritis in horses; and β toxin is responsible for hemorrhagic enteritis in pigs. β toxin and CPE have been reported to be involved in postwar human necrotizing enteritis, and β2 toxin has been suggested to be involved in necrotizing enteritis in premature infants (Non-Patent Document 1).

[0050] Therefore, if the growth of this bacterium can be inhibited in vivo, the amount of toxins released in the intestine, such as NetB, TpeL, CPE, β2 toxin, NetE, NetF, NetG, and β toxin, can be reduced. Furthermore, if the growth of this bacterium can be inhibited in vivo or ex vivo, the number of bacteria excreted from the organism into the environment or present in the environment can be suppressed, thereby suppressing the number of bacteria entering the organism via various routes, such as drinking water, food, and feed. Based on these findings, it is believed that inhibiting the growth of this bacterium in vivo or ex vivo can contribute to the prevention or amelioration of necrotizing enterocolitis. In other words, the active ingredient of the present invention can be used to prevent or ameliorate necrotizing enterocolitis.

[0051] The active ingredient of the present invention can be used, for example, in a form to be administered to humans or animals. More specific modes of use can be appropriately determined depending on the recipient, application site, purpose of use, etc. For example, the administration method and route may be any as long as the active ingredient reaches the site where Clostridium perfringens inhabits. Specific examples include oral ingestion, nasal drip, placement under the tongue (sublingual) or between the gums and cheek, and insertion into the rectum (transrectal) or vagina (transvaginal).

[0052] The dosage of the active ingredient can also be appropriately determined depending on the recipient and site of administration, the form of the product, the intended use, etc. Specific examples of dosages include, for example, 0.01 mg / kg body weight or more, 0.1 mg / kg body weight or more, 1 mg / kg body weight or more, 5 mg / kg body weight or more, 10 mg / kg body weight or more, 1000 mg / kg body weight or less, 800 mg / kg body weight or less, 600 mg / kg body weight or less, 400 mg / kg body weight or less, 200 mg / kg body weight or less, 100 mg / kg body weight or less, and 10 mg / kg body weight or less per day for an adult.

[0053] The active ingredient may be used as it is in the form of food and drink, supplements, pharmaceuticals, quasi-drugs, feed, etc., or may be used by blending it with other ingredients as an ingredient in food and drink, supplements, pharmaceuticals, quasi-drugs, feed, etc. These products can be produced by methods known to those skilled in the art using the active ingredient as a raw material.

[0054] The active ingredient of the present invention can also be used in a form that allows it to come into contact with a substance containing the bacterium. More specific modes of use can be appropriately determined depending on the object to be contacted (application location) and the purpose of use. For example, the object (application location) can be food or feed, where the bacterium may live and grow in an anaerobic environment. Other examples include floors, walls, equipment, and fixtures of facilities used by people at high risk of the above-mentioned diseases, livestock, and poultry. Any method of contact can be used as long as it allows the active ingredient to reach the area where the bacterium lives. Specific examples of the contact method include adding a solid or liquid active ingredient to food or drink, spraying a liquid containing the active ingredient or applying an impregnated sheet to facility equipment.

[0055] The content of the active ingredient in various products and aqueous solutions can also be appropriately set depending on the form and use of the product. Specific examples of the content include 0.0001% by mass or more, 0.001% by mass or more, 0.01% by mass or more, 0.1% by mass or more, 100% by mass or less, 90% by mass or less, 80% by mass or less, 70% by mass or less, 60% by mass or less, 50% by mass or less, 40% by mass or less, 35% by mass or less, 30% by mass or less, 10% by mass or less, and 5% by mass or less.

[0056] The present invention will be described below based on examples, but the technical scope of the present invention is not limited to the features shown in these examples. [Example]

[0057] Example 1: Preparation of agarooligosaccharides 50 g of agar ("Ultra Agar AX-30" manufactured by Ina Food Industry Co., Ltd.) was added to 1000 g of purified water and heated to dissolve. 2 g of concentrated sulfuric acid was then added and stirred at 90°C for 3 hours. The pH was adjusted to 3.5 with sodium hydroxide, and the mixture was treated with activated carbon. The filtrate was then filtered through a filter paper and collected. This was then further filtered through a 0.1 μm pore filter, and the collected filtrate was then powdered by vacuum freeze-drying to obtain agarooligosaccharide powder.

[0058] The composition of the prepared agarooligosaccharides was measured using high-performance liquid chromatography (Prominence® HPLC system (Shimadzu Corporation)). Measurement conditions were as follows: two columns (TSKgel® α-2500, Tosoh Corporation) connected in series, elution with HO as solvent, a flow rate of 0.3 mL / min, and a temperature of 60°C, and detection was by RI (differential refractive index). The results were as follows. In this example, a composition containing the following disaccharides to decasaccharides is referred to as "agarooligosaccharides (AOS)." Disaccharide (agarobiose): 31.5% by mass Tetrasaccharide (agarotetraose): 30.1% by mass Hexasaccharide (agarohexaose): 21.2% by mass Octasaccharide (agarooctaose): 11.6% by mass Decasaccharide (agarodecaose): 5.6% by mass

[0059] Example 2: Growth inhibitory effect on Clostridium perfringens: Evaluation by turbidity (1)Culture conditions etc. The culture medium used was RF medium*, a modified version of Brain-Heart Infusion medium (Thermo Scientific). Anaerobic culture was performed using the Anaeropack anaerobic culture kit (Mitsubishi Gas Chemical) by static culture at 37°C. *Composition of RF medium: 1L Brain-Heart Infusion medium, 5g yeast extract, 5g K2HPO4, 8g glucose, 0.5g L-cysteine ​​hydrochloride, 1g Tween 80, 0.005g hemin, 0.002g vitamin K1, 0.001g resazurin sodium, 0.025g acetate, 0.01g MgSO2·7H2O, pH 6.8.

[0060] (2) Cultivation in the presence of agarooligosaccharides Clostridium perfringens JCM 1290 (a strain producing phospholipase C (α-toxin), type strain, Microbial Materials Development Laboratory, RIKEN BioResource Research Center) (sometimes referred to as the "CP strain") was anaerobically cultured in RF medium for 23.5 hours, and this was used as the seed broth. Two types of medium were prepared as main culture media: RF medium supplemented with glucose to a final concentration of 1.0% by mass (Sample 1), and RF medium supplemented with glucose and agarooligosaccharides to final concentrations of 0.5% and 1.0% by mass (Sample 2). Each main culture medium was dispensed into deep well plates (AxyGen Scientific, CA, USA) at 0.3 mL per well, and 20 μL of a 50-fold diluted seed broth was inoculated into each well and cultured anaerobically for 23 hours (main culture). Hereinafter, the culture solutions obtained by main culture using Sample 1 or Sample 2 are referred to as Sample 1 and Sample 2, respectively.

[0061] (3) Measurement of bacterial count by turbidity method After the main culture, 20 μL of the culture medium was sampled and diluted 10-fold by adding 180 μL of water. The light transmittance of the diluted culture medium at a wavelength of 660 nm was measured using a microplate reader (Wako SUNRISE Rainbow) to calculate the turbidity (OD660) (primary measurement value). The RF medium was also diluted 10-fold and measured in the same way to calculate the turbidity (diluted medium turbidity). The diluted medium turbidity was subtracted from the primary measurement value, and the result was multiplied by 10 to obtain the turbidity of the culture medium. The turbidity was calculated as the average value of eight samples for each sample. Statistical analysis between groups was performed using the Mann-Whitney test using medical statistical analysis software GraphPad Prism (GraphPad Software), with a P value of <0.05 indicating a significant difference. The results are shown in Figure 2.

[0062] As shown in Figure 2, the turbidity (OD660) of the culture medium was 1.77 for Sample 1 (main culture in AOS-free medium), while it was 0.07 for Sample 2 (main culture in 1.0% AOS-containing medium), which was significantly lower than Sample 1 (P = 0.0022). In other words, the turbidity of the Clostridium perfringens culture medium decreased in the presence of agarooligosaccharides. These results demonstrated that agarooligosaccharides can inhibit the growth of Clostridium perfringens.

[0063] Example 3: Growth inhibitory effect on Clostridium perfringens: Evaluation based on abundance ratio (1) Cultivation in the presence of agarooligosaccharides Culture conditions were as described in Example 2(1). The CP strain was anaerobically cultured in RF medium for 23.5 hours, and this was used as the CP seed mother liquor. A human commensal bacterial DNA cocktail (product name "DNA-Mock-003", lot 240101ND, National Biotechnology Center (NBRC), National Institute of Technology and Evaluation) (sometimes referred to as the "cocktail strain") was anaerobically cultured in RF medium for 23.5 hours, and this was used as the cocktail seed mother liquor. The cocktail strains were a mixture of 20 strains, shown in Figure 3, from the microbial strains held by the NBRC, with equal copies of each genomic DNA. The 20 strains are species known to inhabit the human intestine, oral cavity, skin, etc. Shotgun sequencing of the cocktail strains confirmed that each strain was detected at a detection rate of approximately 5% (Tourlousse, DM, Narita, K., Miura, T. et al. Characterization and demonstration of mock communities as control reagents for accurate human microbiome community measurements. Microbiology Spectrum, 10(2): e01915-21.).

[0064] The CP seed mother liquor was diluted 25-fold, and the cocktail seed mother liquor was diluted 10-fold, and then equal volumes were mixed to prepare a mixed seed mother liquor. Two types of medium were prepared as main culture media: RF medium (Sample 1) and RF medium supplemented with agarooligosaccharides to a final concentration of 0.5% by mass (Sample 2). Each main culture medium was dispensed into deep well plates (AxyGen Scientific, CA, USA) at 0.4 mL per well, and 20 μL of the mixed seed mother liquor was inoculated into each well and cultured anaerobically for 23.5 hours (main culture). Hereinafter, the culture solutions obtained by main culture using Sample 1 and Sample 2 are referred to as Sample 1 and Sample 2, respectively.

[0065] (2) Measurement of bacterial count by turbidity method The turbidity (OD660) of the culture solution after the main culture was measured by the method described in Example 2(3). The average turbidity was calculated by averaging four specimens for each sample. The results are shown in Figure 4. As shown in Figure 4, the turbidity (OD660) of the culture solution was 3.33 for Sample 1 (main culture in RF medium) and 1.90 for Sample 2 (main culture in medium containing 0.5% AOS), and there was no significant difference between the two (p = 0.1339). In other words, there was no significant difference in the total number of bacteria in the presence of agarooligosaccharides compared to their absence.

[0066] (3) Comprehensive analysis of bacterial flora After the main culture, the culture medium was diluted 10-fold, and a 0.5 mL aliquot was incubated at 70°C for 10 minutes. The samples were then disrupted using zirconia beads at 4,300 rpm for 2 minutes in a FastPrep FP100A device (MP Biomedicals). The mixture was centrifuged at 15,000 rpm for 1 minute, and the supernatant was collected and used as total bacterial DNA. Using total bacterial DNA as a template, PCR was performed using the universal primers SEQ ID NOs: 2 and 3 below to amplify the V3-V4 region of bacterial 16S rDNA (Takahashi S, et al., (2014) Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing. PLoS ONE 9(8): e105592. Published: August 21, 2014). Forward primer (Pro341F): 5'-CCTACGGGNBGCASCAG-3' (SEQ ID NO: 2) Reverse primer (Pro805R): 5'-GACTACNVGGGTATCTAATCC-3' (SEQ ID NO: 3)

[0067] The PCR-amplified products were then sequenced by next-generation sequencing (NGS). NGS was performed using the Illumina MiSeq platform (Illumina) and MiSeq Reagent Kit ver. 3 (Illumina) using a paired-end method (2 × 300 bp). The sequences were analyzed using the EzBioCloud 16S database and the 16S Microbiome Pipeline (EzBioCloud 16S-based MTP app, https: / / www.EZbiocloud.net) to identify species and determine their abundance (occupancy). The abundance was calculated as the percentage of the number of reads for each bacterial species relative to the total number of reads. This NGS analysis was performed by Seibu Giken Co., Ltd.

[0068] As a result, the abundance ratio of Clostridium perfringens was 70.60% in Sample 1 (main culture in RF medium), while it was 0.00% in Sample 2 (main culture in medium containing 0.5% AOS). In other words, in the presence of agarooligosaccharides, the abundance ratio of Clostridium perfringens decreased to almost 0. These results demonstrated that agarooligosaccharides can suppress the growth of Clostridium perfringens even in a bacterial flora environment where a considerable amount of multiple other bacterial species are present.

Claims

1. A growth inhibitor of Clostridium perfringens, containing agarooligosaccharide as the active ingredient.

2. 2. The agent according to claim 1, which is used to prevent or ameliorate one or more diseases selected from food poisoning, clostridial soft tissue infection, non-food toxic diarrhea, and necrotizing enterocolitis.

3. 3. The agent according to claim 1, wherein the agarooligosaccharide is an agarooligosaccharide containing agarobiose.

4. A growth inhibitor of Clostridium perfringens, which comprises as an active ingredient 3,6-anhydro-L-galactose or an oligosaccharide having 3,6-anhydro-L-galactose at the reducing end.

5. A method for inhibiting the growth of Clostridium perfringens in a living body (excluding medical procedures), comprising the step of having a human or animal ingest one or more selected from agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having 3,6-anhydro-L-galactose at the reducing end.

6. A method for inhibiting the growth of Clostridium perfringens in vitro (excluding medical procedures), comprising the step of contacting one or more selected from agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having 3,6-anhydro-L-galactose at the reducing end with a substance containing Clostridium perfringens.

7. The method according to claim 5 or 6 (excluding medical procedures), which is a method for preventing or ameliorating one or more diseases selected from food poisoning, clostridial soft tissue infection, non-food toxic diarrhea, and necrotizing enterocolitis.

Images