Compositions and methods for treating cancer

Abstract

The present invention relates to chimeric binding agents and compositions comprising the same. The present invention further relates to polynucleotides encoding the chimeric binding agents, and vectors and host cells comprising the same. The present invention further relates to methods of mediating antibody-dependent cellular cytotoxicity of epithelial cell cancers and methods of treating epithelial cell cancers using the chimeric binding agents.

Description

[Technical Field]

[0001] [Priority statement] This application claims the benefit of U.S. Provisional Application No. 63 / 014,550, filed April 23, 2020, the entire contents of which are incorporated herein by reference.

[0002] The present invention relates to chimeric binding agents and compositions comprising the same. The present invention further relates to polynucleotides encoding the chimeric binding agents and vectors and host cells comprising the same. The present invention further relates to methods of mediating antibody-dependent cellular cytotoxicity of epithelial cancer cells and methods of treating epithelial cell cancers using the chimeric binding agents. [Background technology]

[0003] Antibodies are proteins that bind to specific antigens. Monoclonal antibodies (mAbs) and mAb-based reagents approved for cancer therapy include those directed against antigens expressed on malignant B cells and plasma cells (CD19, CD20, CD22, CD30, CD38, CD52, CD79B, SLAMF7), epithelial cancer cells (EpCAM, EGFR, HER2, VEGFR2, Nectin-4), acute myeloid leukemia (CD33), cutaneous T-cell lymphoma (CCR4), neuroblastoma (GD2), and sarcoma (PDGFRA), as well as several directed against immune checkpoint targets (PD-1, PD-L1, CTLA-4) (Gasser, 2016; Carter, 2018). A total of 42 antibody-based cancer therapies are currently FDA-approved and on the market. The efficacy of therapeutic antibodies against cancer can be influenced by a combination of mechanisms (Chiavenna, 2017). Antibody binding to antigens selectively expressed on cancer cells can produce antitumor effects by directly blocking the antigen's function in promoting tumor cell growth or survival pathways. Antibodies can also act as a bridge to bring tumor cells together with immune effector cells that can indirectly induce tumor cell destruction.

[0004] The properties of therapeutic antibodies can be modified to enhance or suppress engagement with certain types of immune effector cells using the evolving arsenal of glycoengineering and Fc engineering approaches, or through the creation of bispecific or trispecific antibodies (Saxena, 2016; Rader, 2020). These tools can be utilized for the rational design of "antigen-effector matching" to generate personalized medicine approaches for cancer treatment.

[0005] Antibody engineering strategies focused on improving monocyte or natural killer (NK) cell engagement include a vast collection of glycoengineered and Fc-engineered variants of therapeutic antibodies that promote binding to FcγRIIIA (CD16A), the only Fc receptor expressed on NK cells (Lazar, 2006). Less commonly, several strategies have created antibody variants with enhanced binding to macrophages, such as the G236A Fc mutant, which promotes binding to FcγRIIA (CD32A) (Richards, 2008), or bispecific antibodies that recruit macrophages via FcαRI (CD89) (Li, 2017).

[0006] Selecting antigens for antibody therapy must address cancer phenotypes that evolve over time. Antibody therapeutics have been developed for epithelial cancers that express high levels of markers such as EpCAM, EGFR, HER2, or VEGFR2. While antibodies targeting such antigens can be effective for early-stage tumors, epithelial cancers are known to undergo epithelial-mesenchymal transition (EMT), which involves not only the loss of epithelial markers and the acquisition of mesenchymal markers (Karacosta, 2019), but also changes in the tumor microenvironment and immune cell infiltration (Dongre, 2019). As such, targeting epithelial tumors to convert to a mesenchymal state may require different antigen-effector cell combinations.

[0007] EMT is a dynamic process that reshapes tumor cell phenotypes in crosstalk with tumor stromal components (Dongre, 2019). Cancer-associated fibroblasts, macrophages, and other immune cells engage tumor cells and secrete various cytokines and factors that activate the expression of transcription factors that induce EMT. Mesenchymal-like carcinoma cells also shift the immune components of tumors to an immunodeficient state that excludes antitumor immune cell types and recruits tumor-promoting macrophages.

[0008] As such, targeting mesenchymal tumors, which are often "immune-cold," with antibody therapeutics may require antigen-effector cell combinations different from those developed for epithelial tumors, which are often "immune-hot." Antibodies recognizing epithelial markers such as EpCAM, EGFR, HER2, or VEGFR2 have been developed and optimized to engage receptors on peripheral blood mononuclear cells (PBMCs) or NK cells. For epithelial-like tumors, several approved therapeutic antibodies provide good matches for such antigen-effector combinations. In contrast, antibodies recognizing antigens expressed on the surface of mesenchymal-like tumor cells, which are capable of engaging macrophages as effector cells, are lacking in the field of therapeutic antibody development for solid tumors. Cancers undergoing EMT tend to be more invasive, metastatic, and drug-resistant. Therefore, having drugs that attack tumor cells undergoing EMT is likely to reduce tumor progression and drug resistance.

[0009] Thus, there is a need for new compositions and methods of using such compositions to treat cancer, particularly including late-stage epithelial cancers undergoing EMT. Summary of the Invention

[0010] The present invention is based in part on an understanding of the EMT process, which involves changes in epithelial cancer cells and immune cell populations in the tumor microenvironment. At the core of this transformation process, epithelial tumor cells acquire the expression of αvβ3 integrin on their cell surface, becoming drug-resistant, more stem-like in phenotype, and insensitive to hypoxia or other environmental stresses. The expression of αvβ3 on epithelial cancer cells is triggered by various forms of cellular stress in the microenvironment or by the administration of a wide range of anticancer drugs. Therefore, patients who progress with standard treatment regimens and thereby express αvβ3 are candidates for therapies targeting the αvβ3 antigen. If αvβ3 is necessary and sufficient for drug resistance, it is possible that selective targeting of αvβ3-positive tumor cells may prevent or reverse cancer-acquired drug resistance.

[0011] The present invention provides compositions and methods for engaging appropriate immune effector cells to effectively mediate antibody-dependent cellular cytotoxicity (ADCC) against epithelial cancer cells that have undergone EMT and acquired the cell surface marker αvβ3.

[0012] The present inventors have determined that ADCC, which leads to the death of antibody-targeted cancer cells, is mediated by macrophages but not by NK cells. Furthermore, the cell death does not involve antibody-dependent cellular phagocytosis (ADCP) or direct killing by the antibody alone. Antibody engagement of macrophages as effector cells was previously understood to typically promote ADCP. Surprisingly, the present inventors have determined that the chimeric binding agents of the present invention do not induce ADCP of human cell targets but instead promote exclusively macrophage-dependent ADCC. This unexpected finding advantageously enables the treatment of CD47-positive tumor cells, which are normally resistant to phagocytosis or ADCP, among other benefits. A binding agent that promotes exclusively ADCC will kill any cells it encounters, whereas a binding agent that promotes ADCP will fail to kill CD47-positive cells. Therefore, the chimeric binding agents of the present invention are expected to be more efficient. Without wishing to be bound by theory, it is believed that the advantages of the present invention are based on the structure of the chimeric binding agent (e.g., IgG4 domain) and / or the antigen to be recognized (e.g., integrin αvβ3) that renders cells expressing the antigen particularly susceptible to ADCC rather than ADCP.

[0013] Mesenchymal tumors are identified by the expression of transcription factors (ZEB, SNAIL, SLUG, and TWIST1) that suppress epithelial markers (e.g., E-cadherin, EpCAM, occludin, claudins, and cytokeratins) and promote the expression of mesenchymal markers (e.g., cell adhesion-associated proteins N-cadherin, vimentin, fibronectin, β1 and β3 integrins, and MMPs) (Dongre, 2019). Ideal tumor cell antigens for mesenchymal-like tumors are cell surface markers that are highly expressed on tumor cells but low on all other normal cell types. Because EMT is closely linked to the cancer stem phenotype and drug resistance (Marie-Egyptienne, 2013; Singh, 2010; Ye, 2015), cancer stem cell markers may represent another type of antigen for targeting mesenchymal tumors, even though these often differ between tumor types.

[0014] Among potential cell surface mesenchymal markers, N-cadherin and β1 integrin are expressed on many normal cell types and may therefore contribute to toxicity issues or compete with tumor cells for antibody binding. In contrast, integrin αvβ3 is a more selective candidate as a mesenchymal tumor cell antigen based on its low expression in normal adult tissues and its enrichment on epithelial tumors as they become more aggressive, later stage, and more drug-resistant.

[0015] The present invention is based on the development of agents that can mediate ADCC by engaging bone marrow-derived cells found in mesenchymal tumors and targeting them to antigens expressed on epithelial cancer cells undergoing EMT.

[0016] Accordingly, one aspect of the present invention relates to a chimeric binding agent comprising a first domain that specifically binds to an antigen on epithelial cancer cells that express at least one mesenchymal cell marker and a second domain that mediates ADCC by engaging bone marrow-derived cells that accumulate in mesenchymal tumors, as well as compositions or pharmaceutical compositions comprising said chimeric binding agent.

[0017] Another aspect of the invention relates to polynucleotides encoding the chimeric binding agents of the invention, as well as vectors and host cells containing said polynucleotides.

[0018] An additional aspect of the present invention relates to a method of targeting bone marrow-derived cells that accumulate in mesenchymal tumors to epithelial cancer cells that express at least one mesenchymal cell marker, comprising contacting said cancer cells and said bone marrow-derived cells with an effective amount of a chimeric binding agent of the present invention.

[0019] A further aspect of the present invention relates to a method of treating epithelial cell cancer in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of a chimeric binding agent or pharmaceutical composition of the present invention, thereby treating said epithelial cell cancer. In particular, αβ is expressed in increased amounts in drug-resistant cancers, making it possible to prevent or reverse drug resistance.

[0020] Another aspect of the present invention is a method of treating epithelial cell cancer in a subject in need thereof, comprising: a) selecting a subject having epithelial cancer cells enriched for an antigen specifically bound by a chimeric binding agent of the invention and enriched for bone marrow-derived cells that accumulate in mesenchymal tumors; and b) administering to said subject a therapeutically effective amount of a chimeric binding agent or pharmaceutical composition of the invention, thereby treating said epithelial cell cancer. Cancer patients who become drug resistant have acquired expression of αvβ3, thereby making them candidates for such therapies that target this marker.

[0021] Another aspect of this invention relates to tumor antigen-effector cell matching, where the antigen is specifically present on tumor cells (e.g., tumor cell antigen) and the therapeutic antibody contains an effector cell-binding region that is specific for effector cells found in the tumor (e.g., neutrophils, dendritic cells, NK cells, etc.).

[0022] These and other aspects of the present invention are set forth in greater detail in the description of the invention below. [Brief explanation of the drawings]

[0023] [Figure 1] This figure shows that anti-αvβ3 mouse monoclonal antibody LM609 sensitizes tumor xenografts to erlotinib. LM609 resensitizes tumors resistant to erlotinib. Erlotinib-resistant HCC827-R18 and PC9-R4L tumor cells, generated as reported in Wettersten et al., Cancer Res. 79:5048 (2019), incorporated herein by reference in its entirety, were injected to form subcutaneous flank tumors in nu / nu recipient mice. When tumors reached a volume of 100 mm3, mice were randomized to receive erlotinib alone (6.25 mg / kg) or a combination of erlotinib and LM609 (10 mg / kg). Tumor dimensions were measured biweekly, and volume was calculated as V = 1 / 2 × (length × width 2). Graphs show mean ± SE. *P<0.05 for erlotinib vs. erlotinib / LM609 using ANOVA. [Figure 2] FIG. 1 shows the amino acid sequences for the heavy chain (SEQ ID NO: 11) and light chain (SEQ ID NO: 12) of mAb LM609-mIgG1-kappa. [Figure 3] FIG. 1 shows the amino acid sequences for the heavy chain (SEQ ID NO: 9) and light chain (SEQ ID NO: 10) of hLM609-hIgG1-WT (humanized LM609). [Figure 4] FIG. 1 shows the amino acid sequences for two different forms of shLM609-hIgG1-WT (superhumanized LM609): the Fab domain of the LM609_7 heavy chain (SEQ ID NO: 5) and light chain (SEQ ID NO: 6) and the Fab domain of the JC7U heavy chain (SEQ ID NO: 7) and light chain (SEQ ID NO: 8). [Figure 5]FIG. 1 shows the amino acid sequences for the heavy chain (SEQ ID NO: 1) and light chain (SEQ ID NO: 2) of hLM609-hIgG4-S228P (humanized LM609). [Figure 6] Figure 1 shows the amino acid sequence alignment for the heavy chain of hLM609-hIgG1-WT (SEQ ID NO: 9) versus the heavy chain of hLM609-hIgG4-S228P (SEQ ID NO: 1). Sequence alignment was performed using the Align Sequences Protein BLAST tool from ncbi.nih.gov. The "Query" sequence is hLM609-hIgG1-WT and the "Sbjct" sequence is hLM609-hIgG4-S228P. Sequence differences are shown in bold. [Figure 7] Figure 1 shows that hLM609-IgG4-S228P engages and activates FcγRI in a cell-based ADCC reporter bioassay. Integrin αvβ3-expressing human pancreatic cancer cells were utilized as "target cells" to assess the ability of anti-αvβ3 antibodies to induce effector cell activation using the Promega ADCC reporter bioassay (where "effector cell" activation is assessed using a Raji cell line stably expressing human FcγRI or III and NFAT-inducible luciferase). Six antibody dilutions were tested per antibody, and FcγR activation is presented as the fold change relative to treatment with assay buffer containing no antibody. [Figure 8] Figure 1 shows equivalent blockade of αvβ3-mediated adhesion by hLM609 IgG1 and IgG4-S228P variants. Antibody affinity was assessed using an in vitro cell adhesion assay. 48-well tissue culture plates were coated with fibrinogen, the integrin αvβ3 ligand, or type I collagen, the integrin β1 ligand, and 2,000–10,000 cells were added in duplicate in the presence of each antibody at a series of two-fold dilutions starting at 5 μg / mL. At the endpoint, plates were washed, and cells adhered to the substrate were detected using crystal violet. [Figure 9A]Figure 1 shows in vitro ADCC (NK-ADCC) by NK cells. In vitro NK-ADCC comparing the hIgG4-S228P isotype vs. hIgG1-WT isotype of hLM609. Luminescence-based cell killing assay showing CD16-V176.NK92 cells engaging and killing HCC827+β3 target cells. The graph shows the effect of increasing the effector to target (E:T) ratio. Target cells: HCC827+β3 human lung carcinoma; effector cells: CD16-V176.NK92. [Figure 9B] Figure 1 shows in vitro ADCC (Mac-ADCC) by macrophages. In vitro macrophage-ADCC to compare the hIgG4-S228P isotype versus the hIgG1-WT isotype of hLM609. Primary human macrophages were isolated from the blood of two different healthy donors and used as effector cells in a lethality assay for H1975 target cells with endogenous β3 expression. Target cells: H1975 human lung carcinoma (endogenous β3); effector cells: primary human macrophages isolated from normal donor blood; donor 980-A harbors a CD32 high-affinity variant (H131) and a CD16 low-affinity variant (F158); variant genotype was not determined for donor 980-B. [Figure 9C] Figure 1 shows in vitro ADCC (Mac-ADCC) by macrophages. In vitro macrophage-ADCC induced by hLM609-hIgG4-S228P using macrophages isolated from multiple donors. Primary human macrophages were isolated from the blood of three different healthy donors and used as effector cells in a killing assay for HCC827+β3 target cells. Target cells: HCC827+β3 human lung carcinoma; effector cells: primary human macrophages isolated from normal donor blood. [Figure 10]Figure 1 shows that LM609 and hLM609-hIgG4-S228P induce ADCC mediated by macrophages, but not NK cells, isolated from healthy blood donors. (A) In vitro ADCC with primary human monocyte-derived macrophages as effector cells. (B) In vitro ADCC with human NK cells as effector cells. The graph shows the effect of increasing the effector to target (E:T) ratio on the death of αvβ3-expressing human lung cancer cells. [Figure 11] Figure 1 shows in vitro ADCC by mouse bone marrow-derived macrophages. In vitro ADCC for mouse primary macrophage effector cells. Primary mouse macrophages were isolated from mouse bone marrow and used as effector cells to kill HCC827+β3 target cells. [Figure 12] Figure 1 shows that hLM609-hIgG4-S228P inhibits the growth of αvβ3-expressing tumors in mice over 2 weeks of treatment without weight loss. Human pancreatic cancer cells expressing αvβ3 were injected subcutaneously into the flank region of nu / nu mice. Tumor dimensions were measured twice weekly using calipers. When tumors were palpable (approximately 150 mm3), mice were randomly assigned to groups. Mice were treated with either PBS (vehicle, n=8), LM609 (10 mg / kg, n=8), or hLM609-IgG4-S228P (10 mg / kg, n=9) on days 0, 4, 7, and 11. Body weights were measured on days 0, 7, and 14. Error bars indicate standard error. *P<0.05, **P<0.01 compared to PBS using one-way ANOVA. [Figure 13]Figure 1 shows that the antitumor activity of hLM609-hIgG4-S228P against xenografts in mice is superior to that of hLM609-hIgG1. Human αvβ3+ pancreatic cancer cells were subcutaneously injected into nu / nu mice. Tumor dimensions were measured twice weekly using calipers. When tumors were palpable (approximately 100 mm3), mice were administered PBS (vehicle, n=13), hLM609-hIgG1 (10 mg / kg, n=8), or hLM609-hIgG4-S228P (10 mg / kg, n=9) twice weekly. *P<0.05 compared to PBS using one-way ANOVA. [Figure 14] This figure shows that tumor accumulation of hLM609-hIgG4-S228P is superior to that of hLM609-hIgG1 for xenografts in mice. Nude mice injected with FG-β3 cells (human pancreatic cancer cells expressing αvβ3) were randomly divided into three groups. Mice were treated with PBS at 10 mg / kg, hLM609-hIgG4-S228P (10 mg / kg, intraperitoneally), or hLM609-hIgG1 (10 mg / kg, intraperitoneally) twice a week for 14 days. 30 minutes after the last dose, animals were sacrificed, and tumor tissues were collected and stored at -80°C until further analysis. Tumor tissues were dissolved in RPMI at 6.4 μL / mg. The concentrations of hLM609-hIgG4-S228P and hLM609-hIgG1 in the lysates were measured using a human IgG ELISA kit (Thermo). *P<0.001 compared to PBS using Bonferroni and Tukey's tests. DETAILED DESCRIPTION OF THE INVENTION

[0024] The present invention is described in more detail below. This description is not intended to be a detailed listing of all the different ways in which the invention may be implemented or all the features that may be added to the invention. For example, features illustrated with respect to one embodiment may be incorporated into other embodiments, and features illustrated with respect to a particular embodiment may be omitted from that embodiment. Additionally, numerous variations and additions to the various embodiments suggested herein that do not depart from the invention will be apparent to those skilled in the art in light of this disclosure. Thus, the following specification is intended to illustrate some specific embodiments of the invention, but is not intended to exhaustively specify all permutations, combinations, and variations thereof.

[0025] Unless the context dictates otherwise, it is specifically intended that the various features of the invention described herein may be used in any combination. Moreover, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein may be eliminated or omitted. By way of example, if the specification states that a composite comprises components A, B, and C, it is specifically contemplated that any of A, B, or C, or combinations thereof, alone or in any combination, may be omitted and discarded.

[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in describing the present invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present invention.

[0027] Unless otherwise indicated, standard methods known to those skilled in the art can be used to produce recombinant and synthetic polypeptides, antibodies or antigen-binding fragments thereof, manipulate nucleic acid sequences, and produce transformed cells. Such techniques are known to those skilled in the art. See, for example, SAMBROOK et al., MOLECULAR CLONING: A LABORATORY MANUAL 4th Ed. (Cold Spring Harbor, NY, 2012), FMAUSUBEL et al. CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York).

[0028] All publications, patent applications, patents, nucleotide sequences, amino acid sequences, and other references mentioned herein are incorporated by reference in their entirety.

[0029] [Definition] As used in the description of this invention and the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly dictates otherwise.

[0030] As used herein, "and / or" refers to and includes any and all possible combinations of one or more of its associated listed items, and in addition, when interpreted in the alternative ("or"), does not include combinations.

[0031] Furthermore, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein may be eliminated or omitted.

[0032] Furthermore, the term "about" as used herein when referring to measurable values ​​such as amounts, doses, times, temperatures, and the like of compounds or agents of this invention is intended to encompass variations of ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of the specified amount.

[0033] Unless otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and the like properties used in the specification and claims are to be understood as being modified in all instances by the term "about." Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the presently disclosed subject matter.

[0034] As used herein, ranges can be expressed as from "about" one particular value and / or to "about" another particular value. It is also understood that there are several values ​​disclosed herein, and that each value is also herein disclosed as "about" that particular value in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed. It is also understood that each unit between two particular units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

[0035] The transitional phrase "consisting essentially of" means that a claim should be construed to include the specified materials or steps recited in the claim and those that do not materially affect the basic and novel characteristics of the claimed invention.

[0036] The term "consisting essentially of" (and grammatical variations) when applied to polynucleotide or polypeptide sequences of the invention means a polynucleotide or polypeptide that consists of both a recited sequence (e.g., SEQ ID NO:) and a total of 10 or fewer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional nucleotides or amino acids at the 5' and / or 3' or N-terminus and / or C-terminus of the recited sequence, or between the two termini (e.g., between domains), such that the function of the polynucleotide or polypeptide is not substantially altered. The total of 10 or fewer additional nucleotides or amino acids includes the total number of additional nucleotides or amino acids added together.

[0037] As used herein, the term "polypeptide" encompasses both peptides and proteins, unless otherwise indicated.

[0038] The term "chimera" refers to a molecule having two or more moieties that are not found together in the same molecule in nature.

[0039] A "nucleic acid" or "nucleotide sequence" is a sequence of nucleotide bases, which may be RNA, DNA, or a DNA-RNA hybrid sequence (containing both naturally occurring and non-naturally occurring nucleotides), but is preferably a DNA sequence, either single-stranded or double-stranded.

[0040] As used herein, the term "isolated" means a molecule, e.g., a protein, polynucleotide, or cell, that is separated from or substantially free of other components of the naturally occurring organism or virus, e.g., components of cellular structure or at least some of other polypeptides or nucleic acids that are typically found associated with the molecule. The term also encompasses molecules that have been synthetically prepared.

[0041] The terms "treat," "treating," or "treatment of" (or grammatical equivalents) mean that the severity of the subject's condition is reduced or at least partially improved or ameliorated, and / or some relief, alleviation, or reduction in at least one clinical symptom is achieved and / or there is a delay in the progression of the condition.

[0042] As used herein, the terms "prevent," "prevents," or "prevention," and "inhibit," "inhibits," or "inhibition" (and grammatical equivalents) are not intended to imply complete elimination of a disease, but rather encompass any type of prophylactic treatment that reduces the incidence of the condition, delays the onset of the condition, and / or reduces the symptoms associated with the condition after onset.

[0043] As used herein, an "effective," "prophylactically effective," or "therapeutically effective" amount is an amount sufficient to provide some improvement or benefit to the subject. In other words, an "effective," "prophylactically effective," or "therapeutically effective" amount is an amount that will provide some delay, relief, alleviation, or reduction of at least one clinical symptom in the subject. Those skilled in the art will recognize that the effect need not be complete or curative, as long as some benefit is provided to the subject.

[0044] As used herein, the terms "bind specifically" or "specifically binds," with respect to a chimeric binding agent of the invention, mean that the agent binds to a target epitope (including one or more epitopes) but does not substantially bind to other unrelated epitopes or molecules. In certain embodiments, the term refers to an agent that exhibits at least about 60% binding, e.g., at least about 70%, 80%, 90%, or 95% binding, to the target epitope compared to binding to other unrelated epitopes or molecules.

[0045] <Chimeric binding substance> A first aspect of the present invention relates to a chimeric binding agent comprising a first domain that specifically binds to an antigen on epithelial cancer cells that express at least one mesenchymal cell marker, and a second domain that mediates antibody-dependent cellular cytotoxicity (ADCC) by engaging bone marrow-derived cells that accumulate in mesenchymal tumors.

[0046] Bone marrow-derived cells that accumulate in mesenchymal tumors are a cell type that is enriched in epithelial cell tumors because they have undergone epithelial-mesenchymal transition. In some embodiments, the level of bone marrow-derived cells in the tumor is increased by 2-fold, 5-fold, 10-fold, or more relative to pre-transition levels. In some embodiments, the bone marrow-derived cells are macrophages, dendritic cells, or granulocytes such as neutrophils, basophils, eosinophils, or mast cells. In some embodiments, the bone marrow-derived cells are macrophages.

[0047] The epithelial cancer may be any known type of carcinoma. Examples of epithelial cancer include, but are not limited to, cancer of the gastrointestinal tract, breast, lung (e.g., non-small cell lung cancer), colon, prostate, or bladder. In some embodiments, the epithelial cancer cells are late-stage epithelial cancer cells. As used herein, late or advanced stage refers to stage III or stage IV cancer based on the TNM staging system. In some embodiments, the epithelial cancer cells have at least partially transformed into mesenchymal cells, e.g., express one or more mesenchymal antigens. In certain embodiments, the epithelial cancer cells are chemoresistant or refractory, which may be due to epithelial-mesenchymal transition.

[0048] The chimeric binding agent can be any structure capable of binding to an antigen on an epithelial cancer cell and engaging bone marrow-derived cells to mediate ADCC. In some embodiments, the chimeric binding agent is an antibody or an antigen-binding fragment thereof. In some embodiments, one or more portions of the chimeric binding agent are composed of an antibody fragment. In some embodiments, one or both domains of the chimeric binding agent are non-immunoglobulin scaffolds, aptamers, small molecules (e.g., receptor ligands), or other binding moieties.

[0049] In certain embodiments, the first domain of the chimeric binding agent is an antibody domain. In certain embodiments, the second domain of the chimeric binding agent is an antibody domain. In some embodiments, both domains are antibody domains. In some embodiments, the first domain is a humanized or human antibody domain. In some embodiments, the second domain is a humanized or human antibody domain. In some embodiments, the first domain and the second domain are humanized or human antibody domains.

[0050] In some embodiments, the first domain specifically binds to an antigen on the surface of epithelial cancer cells. In some embodiments, the antigen is a receptor found on the surface of epithelial-like tumor cells, such as, but not limited to, EGFR, HER2, EpCAM, E-cadherin, ZO-1, or integrin α6β4. In some embodiments, the antigen is a receptor found on the surface of mesenchymal-like tumor cells, such as, but not limited to, integrin αvβ3, integrin β1, integrin αvβ6, N-cadherin, OB-cadherin, or syndecan-1.

[0051] In some embodiments, the antigen can be an antigen that is not present or present at low levels on the surface of normal epithelial cells. In some embodiments, the antigen can be an antigen that is not present or present at low levels on the surface of epithelial cancer cells. In some embodiments, the antigen can be an antigen that is present only or present at increased levels after epithelial cancer cells begin to transform into mesenchymal cells. In some embodiments, the antigen is a mesenchymal cell antigen that is not present or present at low levels on epithelial cancer cells until they begin to transform into mesenchymal cells. In some embodiments, the antigen is a neoantigen not previously recognized by the immune system.

[0052] In certain embodiments, the first domain specifically binds to an integrin, which may be, but is not limited to, integrin αv, integrin β3, or integrin αvβ3.

[0053] In certain embodiments, the first domain comprises, consists essentially of, or consists of an antibody Fab domain. The Fab domain can be derived from any antibody isotype. In some embodiments, the first domain comprises the Fab domain of an IgG antibody, e.g., an IgG1 or IgG4 antibody. In some embodiments, the first domain comprises the amino acid sequence of the light chain of hLM609-hIgG4-S228P (SEQ ID NO: 2) and the Fab portion (also known as the Fd fragment) of the heavy chain of hLM609-hIgG4-S228P (SEQ ID NO: 3), or a sequence at least 90% identical thereto, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical thereto. In some embodiments, the first domain comprises the amino acid sequence of a superhumanized variant of shLM609-hIgG1-WT, e.g., the Fab domain of the LM609_7 heavy chain (SEQ ID NO: 5) and light chain (SEQ ID NO: 6), or the Fab domain of the JC7U heavy chain (SEQ ID NO: 7) and light chain (SEQ ID NO: 8), or a sequence at least 90% identical thereto, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical thereto. In some embodiments, the first domain comprises the amino acid sequence of the light chain of hLM609-hIgG1-WT (SEQ ID NO: 9) and the Fab portion of the heavy chain of hLM609-hIgG1-WT (SEQ ID NO: 10), or a sequence at least 90% identical thereto, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical thereto.

[0054] In certain embodiments, the first domain can specifically bind to a second antigen in addition to an antigen on the surface of an epithelial cancer cell. In some embodiments, the first domain can be a bispecific antibody domain, a trispecific antibody domain, or other structure that specifically binds to more than one antigen. The second antigen can be, for example, a target of an antibody used to treat cancer, such as an immune checkpoint molecule such as PD-1, PD-L1, or CTLA-4. In some embodiments, the second antigen is a cancer stem cell marker (e.g., CD133, CD44, CD90, CD117, CD166, CD105). In some embodiments, the second antigen is an antigen on an effector cell different from the effector cell targeted by the second domain. In some embodiments, the different effector cell is a bone marrow-derived cell, such as a macrophage, dendritic cell, or a granulocyte such as a neutrophil, basophil, eosinophil, or mast cell. In this embodiment, the chimeric binding agent is capable of localizing more than one class of effector cells, for example, macrophages and dendritic cells, or macrophages and neutrophils, to tumor cells.

[0055] The second domain of the chimeric binding agent preferably engages one or more types of bone marrow-derived cells. In some embodiments, the second domain predominantly engages one type of bone marrow-derived cell, e.g., macrophages or dendritic cells, or granulocytes such as neutrophils, basophils, eosinophils, or mast cells. In some embodiments, the second domain predominantly engages macrophages. As used herein, "predominantly engages" refers to engaging at least 80%, e.g., at least 85%, 90%, or 95%, of its target cell type, e.g., macrophages, relative to other cell types.

[0056] In certain embodiments, the second domain does not significantly engage natural killer (NK) cells. In certain embodiments, the second domain does not significantly engage one or more types of lymphocytes, e.g., NK cells, B cells, or T cells. As used herein, "does not significantly engage" refers to less than 30%, e.g., less than 25%, less than 20%, less than 15%, less than 10%, or less than 5% of the total engaged cells being of the indicated cell type.

[0057] In some embodiments, the second domain specifically binds to a protein on the surface of bone marrow-derived cells, which protein, when engaged, is capable of mediating ADCC. In some embodiments, the protein is absent or present at low levels on other cell types, such as natural killer cells. In some embodiments, the second domain specifically binds to an Fc gamma receptor. In some embodiments, the second domain specifically binds to Fc gamma receptor I (FcγRI, CD64).

[0058] In certain embodiments, the second domain comprises, consists essentially of, or consists of an Fc domain of an antibody. The Fc domain can be derived from any antibody isotype. In some embodiments, the second domain comprises the Fc domain of an IgG antibody, e.g., an IgG4 antibody. In some embodiments, the second domain comprises the Fc domain of an IgA or IgE antibody. In certain embodiments, the second domain further comprises an antibody hinge domain. In some embodiments, the second domain comprises the amino acid sequence of the heavy chain Fc domain and hinge domain of hLM609-hIgG4-S228P (SEQ ID NO: 4), or a sequence at least 90% identical thereto, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical thereto. In some embodiments, the second domain comprises the amino acid sequence of the heavy chain Fc domain and hinge domain of hLM609-hIgG1-WT (SEQ ID NO: 9), or a sequence at least 90% identical thereto, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical thereto.

[0059] In certain embodiments, the chimeric binding agent comprises the amino acid sequence of the heavy chain (SEQ ID NO: 1) and light chain (SEQ ID NO: 2) of hLM609-hIgG4-S228P, or sequences at least 90% identical thereto, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical thereto. In certain embodiments, the chimeric binding agent comprises the amino acid sequence of the heavy chain (SEQ ID NO: 9) and light chain (SEQ ID NO: 10) of hLM609-hIgG1-WT, or sequences at least 90% identical thereto, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical thereto.

[0060] Chimeric binding agents may contain sequence modifications known to enhance antibody properties, such as stability, or alter antibody binding to Fc gamma receptors. In some embodiments, the amino acid sequence of the chimeric binding agent contains a S228P (Eu numbering system) mutation in the hinge region. In some embodiments, the amino acid sequence ... a) S239D / A330L / I332E; b) I332E; c) G236A / S239D / I332E; d) G236A; e) N297A / E382V / M428I; f) M252Y / S254T / T256E; g) Q295R / L328W / A330V / P331A / I332Y / E382V / M428I; h) L234A / L235A / P329G; i) M428L / N434S; j) L234A / L235A / P331S; k) L234A / L235A / P329G / M252Y / S254T / T256E; l) S298A / E333A / K334 / A; m) S239D / I332E; n) G236A / S239D / A330L / I332E; o) S239D / I332E / G236A; p) L234Y / G236W / S298A; q) F243L / R292P / Y300L / V305I / P396L; r) K326W / E333S; s) K326A / E333A; t) K326M / E333S; u) C221D / D222C; v) S267E / H268F / S324W; w) H268F / S324W; x) E345R y) R435H; z) N434A; aa)M252Y / S254T / T256E; ab)M428L / N434S; ac)T252L / T / 253S / T254F; ad)E294delta / T307P / N434Y; ae)T256N / A378V / S383N / N434Y; af)E294delta ag)L235E; ah)L234A / L235A; ai)S228P / L235E; aj)P331S / L234E / L225F; ak)D265A; al)G237A; am)E318A; an)E233P; ao)G236R / L328R; ap)H268Q / V309L / A330S / P331S; aq)L234A / L235A / G237A / P238S / H268A / A330S / P331S; ar)A330L; as)D270A; at)K322A; au)P329A; av)P331A; aw V264A; ax)F241A; ay)N297A or G or N az)S228P / F234A / L235A; or ba) any combination of a) to az); (Eu numbering system).

[0061] The following discussion is presented as a general overview of techniques available for generating antibodies, although one of skill in the art will recognize that many variations on the following methods are known.

[0062] As used herein, the term "antibody" or "antibodies" refers to all types of immunoglobulins, including IgG, IgM, IgA, IgD, and IgE. Antibodies can be monoclonal, oligoclonal, or polyclonal and can be of any species origin, including (for example) mouse, rat, hamster, rabbit, horse, cow, goat, sheep, pig, camel, monkey, or human, or can be chimeric or humanized. See, e.g., Walker et al., Molec. Immunol. 26:403 (1989). Antibodies can be recombinant monoclonal antibodies made according to the methods disclosed in U.S. Pat. No. 4,474,893 or U.S. Pat. No. 4,816,567. Antibodies can also be chemically constructed according to the methods disclosed in U.S. Pat. No. 4,676,980.

[0063] Antibody fragments within the scope of the present invention include, for example, Fab, Fab', F(ab)2, and Fv fragments; domain antibodies, diabodies; vaccibodies, linear antibodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. Such fragments can be produced by known techniques. For example, F(ab')2 fragments can be generated by pepsin digestion of antibody molecules, and Fab fragments can be generated by reducing the disulfide bridges of F(ab')2 fragments. Alternatively, Fab expression libraries can be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (Huse et al., Science 254:1275 (1989)). In some embodiments, the term "antibody fragment" as used herein also includes any protein construct capable of binding to a target antigen.

[0064] Antibodies of the present invention may be altered or mutated for compatibility with species other than those from which they were raised. For example, antibodies may be humanized or camelized. Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (e.g., Fv, Fab, Fab', F(ab')2, or other antigen-binding subsequences of antibodies) that contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies comprise human immunoglobulins (recipient antibodies) in which residues from the recipient's complementarity-determining regions (CDRs) are replaced by residues from the CDRs of a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity. In some cases, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues found neither in the recipient antibody nor in the imported CDR or framework sequences. Generally, a humanized antibody comprises substantially all of at least one, typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the framework (FR) regions (i.e., the sequences between the CDR regions) are those of a human immunoglobulin consensus sequence. A humanized antibody may be a superhumanized antibody in which only two CDRs are non-human (U.S. Patent No. 7,087,409). A humanized antibody also optimally comprises at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin (Jones et al., Nature 321:522 (1986); Riechmann et al., Nature, 332:323 (1988); and Presta, Curr. Op. Struct. Biol. 2:593 (1992)).

[0065] Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a non-human source. These non-human amino acid residues are often referred to as "import" residues, and they are typically removed from an "import" variable domain. Humanization can essentially be performed according to the method of Winter and coworkers (Jones et al., Nature 321:522 (1986); Riechmann et al., Nature 332:323 (1988); Verhoeyen et al., Science 239:1534 (1988)), by substituting rodent CDR sequences for the corresponding sequences of a human antibody. Thus, such "humanized" antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567) in which substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues (e.g., all or part of the CDRs) and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.

[0066] Human antibodies can also be produced using a variety of techniques known in the art, including phage display libraries (Hoogenboom and Winter, J. Mol. Biol. 227:381 (1991); Marks et al., J. Mol. Biol. 222:581 (1991)). The technology of Cole et al. and Boerner et al. can also be used to prepare human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol. 147:86 (1991)). Similarly, human antibodies can be produced by introducing human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon antigen challenge, human antibody production is observed, which resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in scientific publications such as Marks et al., Bio / Technology 10:779 (1992); Lonberg et al., Nature 368:856 (1994); Morrison, Nature 368:812 (1994); Fishwild et al., Nature Biotechnol. 14:845 (1996); Neuberger, Nature Biotechnol. 14:826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13:65 (1995).

[0067] Immunogens (antigens) are used to generate antibodies specifically reactive with target polypeptides. Recombinant or synthetic polypeptides and peptides, e.g., at least 5 (e.g., at least 7 or 10) amino acids in length or longer, are preferred immunogens for generating monoclonal or polyclonal antibodies. In one embodiment, immunogenic polypeptide conjugates are also included as immunogens. Peptides are used in either pure, partially pure, or impure forms. Suitable polypeptides and epitopes for target pathogens and sperm are well known in the art. Polynucleotide and polypeptide sequences are available in public sequence databases such as GENBANK® / GENPEPT®. Numerous antibodies that specifically bind to target cancer cell antigens have been described in the art and can be used as starting materials for preparing the antibodies of the present invention. Alternatively, new antibodies can be generated against target antigens using the techniques described herein and well known in the art.

[0068] Recombinant polypeptides are expressed in eukaryotic or prokaryotic cells and purified using standard techniques. The polypeptide, or a synthetic version thereof, is then injected into an animal capable of producing antibodies. Either monoclonal or polyclonal antibodies can be generated for subsequent use in immunoassays to measure the presence and quantity of the polypeptide.

[0069] Methods for producing polyclonal antibodies are known to those skilled in the art. Briefly, an immunogen, such as a purified or synthetic peptide, a peptide linked to a suitable carrier (e.g., glutathione-S-transferase, keyhole limpet hemocyanin, etc.), or a peptide incorporated into an immunization vector such as a recombinant vaccinia virus, is mixed with an adjuvant, if desired, and an animal is immunized with the mixture. The animal's immune response to the immunogen preparation is monitored by taking test bleeds and determining the titer of reactivity against the peptide of interest. When an appropriately high titer of antibody against the immunogen is obtained, blood is collected from the animal and antisera are prepared. If desired, further fractionation of the antisera to enrich for antibodies reactive against the peptide is performed. Antibodies against a polypeptide, including binding fragments and single-chain recombinant versions thereof, are produced by immunizing animals with an immunogenic conjugate comprising the polypeptide covalently attached (conjugated) to a carrier protein, such as those described above. Typically, the immunogen of interest is a polypeptide of at least about 10 amino acids, in another embodiment the polypeptide is at least about 20 amino acids in length, and in another embodiment the fragment is at least about 30 amino acids in length. Immunogenic conjugates are typically prepared by linking the polypeptide to a carrier protein (e.g., as a fusion protein), or alternatively, they are recombinantly expressed in an immunization vector.

[0070] Monoclonal antibodies are prepared from cells secreting the desired antibody. These antibodies are screened for binding to normal or modified peptides, or for agonist or antagonist activity. Specific monoclonal and polyclonal antibodies usually have a K of at least about 50 mM, e.g., at least about 1 mM, e.g., at least about 0.1 mM or better. DIn some cases, it is desirable to prepare monoclonal antibodies from various mammalian hosts, such as rodents, lagomorphs, primates, and humans. A description of techniques for preparing such monoclonal antibodies can be found in Kohler and Milstein 1975 Nature 256:495-497. Briefly summarized, the method proceeds by injecting an animal with an immunogen, e.g., an immunogenic peptide, either alone or optionally linked to a carrier protein. The animal is then sacrificed, and cells are harvested from its spleen, which are fused with myeloma cells. The result is a hybrid cell, or "hybridoma," capable of reproducing in vitro. The population of hybridomas is then screened to isolate individual clones, each secreting a single antibody species against the immunogen. The resulting individual antibody species are thus the product of immortalized and cloned single B cells from the immunized animal, generated in response to a specific site recognized on the immunogenic substance.

[0071] Alternative methods of immortalization include transformation with Epstein-Barr virus, oncogenes, or retroviruses, or other methods known in the art. Colonies arising from single immortalized cells are screened for production of antibodies of the desired specificity and affinity for the antigen, and the yield of monoclonal antibodies produced by such cells is enhanced by various techniques, including injection into the peritoneal cavity of a vertebrate (preferably mammalian) host. The polypeptides and antibodies of the present invention may be used with or without modification, including chimeric antibodies such as humanized murine antibodies. Other suitable techniques include selection of libraries of recombinant antibodies in phage or similar vectors. See Huse et al. 1989 Science 246:1275-1281; and Ward et al. 1989 Nature 341:544-546.

[0072] Antibodies specific to a target polypeptide can also be obtained by phage display techniques known in the art.

[0073] The present invention further provides polynucleotides encoding the chimeric binding agents of the present invention. In some embodiments, the polynucleotides comprise a nucleotide sequence encoding the heavy chain of SEQ ID NO: 13 and a sequence encoding the light chain of SEQ ID NO: 14, or a sequence at least 90% identical thereto, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical thereto. In some embodiments, the polynucleotides comprise a nucleotide sequence encoding the heavy chain of SEQ ID NO: 15 and a sequence encoding the light chain of SEQ ID NO: 14, or a sequence at least 90% identical thereto, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical thereto.

[0074] Further provided herein is a vector comprising a polynucleotide of the invention, including, but not limited to, a plasmid vector, a phage vector, a viral vector, or a cosmid vector.

[0075] In some embodiments, the present invention provides host cells comprising the polynucleotides and / or vectors of this invention. The host cells may be eukaryotic or prokaryotic and may be used to express the chimeric binding agents or for other purposes.

[0076] A further aspect of the invention relates to a composition comprising a chimeric binding agent of the invention and a carrier. In some embodiments, the composition is a pharmaceutical composition and the carrier is a pharmaceutically acceptable carrier.

[0077] In some embodiments, the pharmaceutical composition may further comprise an additional therapeutic agent, for example, a chemotherapeutic agent. Agents useful for treating cancer include, but are not limited to, 1) vinca alkaloids (e.g., vinblastine, vincristine); 2) epipodophyllotoxins (e.g., etoposide and teniposide); 3) antibiotics (e.g., dactinomycin (actinomycin D), daunorubicin (daunomycin; rubidomycin), doxorubicin, bleomycin, plicamycin (mithramycin), and mitomycin (mitomycin C)); 4) enzymes (e.g., L-asparaginase); 5) biological response modifiers (e.g., interferon alpha); 6) platinum complexes (e.g., cisplatin and carboplatin); 7) anthracenediones (e.g., mitoxantrone); 8) substituted ureas (e.g., hydroxyurea); 9) methylhydrazines. 10) adrenocortical suppressants (e.g., mitotane (o,p'-DDD) and aminoglutethimide); 11) corticosteroids (e.g., prednisone); 12) progestins (e.g., hydroxyprogesterone caproate, medroxyprogesterone acetate, and megestrol acetate); 13) estrogens (e.g., diethylstilbestrol and ethinyl estradiol); 14) antiestrogens (e.g., tamoxifen); 15) androgens (e.g., testosterone propionate and fluoxymesterone); 16) antiandrogens (e.g., flutamide); and 17) gonadotropin-releasing hormone analogs (e.g., leuprolide).In another embodiment, an agent of the invention is administered with an anti-angiogenic agent, such as, for example, antibodies to VEGF (e.g., bevacizumab (AVASTIN), ranibizumab (LUCENTIS)) and other promoters of angiogenesis (e.g., bFGF, angiopoietin-1), antibodies to alpha-v / beta-3 vascular integrin (e.g., VITAXIN), angiostatin, endostatin, dalteparin, ABT-510, CNGRC peptide TNF alpha conjugate, cyclophosphamide, combretastatin A4 phosphate, dimethylxanthenone acetic acid, doxorubicin, cyclosphamide ... In another embodiment, the agent of the present invention is administered in combination with one or more therapeutic antibodies, such as cetaxel, lenalidomide, enzastaurin, paclitaxel, paclitaxel-albumin-stabilized small particle formulation (Abraxane), soy isoflavone (Genistein), tamoxifen citrate, thalidomide, ADH-1 (EXHERIN), AG-013736, AMG-706, AZD2171, sorafenib tosylate, BMS-582664, CHIR-265, pazopanib, PI-88, vatalanib, everolimus, suramin, sunitinib malate, XL184, ZD6474, ATN-161, cilengitide, and celecoxib, or any combination thereof. In other embodiments, the agent of the present invention is administered together with one or more immune checkpoint inhibitors. The immune checkpoint inhibitor can be any molecule that inhibits an immune checkpoint. Immune checkpoints are well known in the art and include, but are not limited to, PD-1, PD-L1, PD-L2, CTLA4, B7-H3, B7-H4, BTLA, IDO, KIR, LAG3, A2AR, TIM-3, and VISTA. In some embodiments, the inhibitor is an antibody against an immune checkpoint protein. In certain embodiments, the immune checkpoint inhibitor is an inhibitor of PD-1 or PD-L1, for example, an antibody that specifically binds to PD-1 or PD-L1.In some embodiments, the immune checkpoint inhibitor is nivolumab, pembrolizumab, ipilimumab, durvalumab, or atezolizumab. In some embodiments, the chimeric binding agent may be linked directly or indirectly to an additional therapeutic agent to form an antibody drug conjugate.

[0078] A further aspect of the present invention relates to kits comprising the chimeric binding agents of the present invention or cells for producing the chimeric binding agents of the present invention. In some embodiments, the kits may include multiple chimeric binding agents and / or compositions containing such agents. In some embodiments, each of the multiple chimeric binding agents provided in such kits can specifically bind to a different antigen and / or engage a different bone marrow-derived cell. In some embodiments, the kits may further include an additional active agent, such as a chemotherapeutic agent, as known to those skilled in the art. In some embodiments, the kits may further include additional reagents, buffers, containers, etc.

[0079] <Method using chimeric binding substances> One aspect of the present invention relates to a method for targeting bone marrow-derived cells (e.g., macrophages) to cancer cells expressing an antigen (e.g., integrin αvβ3) recognized by a chimeric binding agent of the present invention, the method comprising the step of contacting the cancer cells and the bone marrow-derived cells with an effective amount of a chimeric binding agent of the present invention.

[0080] Another aspect of the present invention relates to a method of targeting bone marrow-derived cells that accumulate in mesenchymal tumors to epithelial cancer cells that express at least one mesenchymal cell marker, comprising contacting the cancer cells and the bone marrow-derived cells with an effective amount of a chimeric binding agent of the present invention.

[0081] A further aspect of the present invention relates to a method of treating a cancer that expresses an antigen recognized by a chimeric binding agent of the present invention (e.g., integrin αvβ3) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a chimeric binding agent or pharmaceutical composition of the present invention, thereby treating the cancer.

[0082] An additional aspect of the present invention relates to a method of treating epithelial cell cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a chimeric binding agent or pharmaceutical composition of the present invention, thereby treating the epithelial cell cancer.

[0083] Another aspect of the present invention is a method of treating cancer in a subject in need thereof, comprising: a) selecting a subject having cancer cells enriched for an antigen specifically bound by a chimeric binding agent of the invention (e.g., integrin αβ) and enriched for bone marrow-derived cells; b) administering to said subject a therapeutically effective amount of a chimeric binding agent or pharmaceutical composition of the invention, thereby treating said cancer; The present invention relates to a method, comprising:

[0084] A further aspect of the present invention is a method of treating epithelial cell cancer in a subject in need thereof, comprising: a) selecting a subject having epithelial cancer cells enriched for an antigen specifically bound by a chimeric binding agent of the invention and enriched for bone marrow-derived cells that accumulate in mesenchymal tumors; b) administering to said subject a therapeutically effective amount of a chimeric binding agent or pharmaceutical composition of the invention, thereby treating said cancer; The present invention relates to a method, comprising:

[0085] As used herein, the term "enriched" refers to levels of an antigen on cancer cells or levels of bone marrow-derived cells in a tumor that are higher than levels found in cancer cells or tumors at an earlier time point (e.g., before the onset of EMT) or higher than the average level found in similar cancer cells or tumors at a similar stage in the general population.

[0086] The selection step can be performed by any method known to measure antigens and cells. In some embodiments, step a) includes obtaining a cancer sample from a subject and measuring the levels of antigens and bone marrow-derived cells in the sample. The level of antigens can be measured, for example, by immunoassay, protein analysis, RNA analysis, or immunohistochemistry. The level of bone marrow-derived cells can be measured, for example, by immunoassay, protein analysis, RNA analysis, or flow cytometry.

[0087] Another aspect of this invention relates to tumor antigen-effector cell matching, where the antigen is specifically present on tumor cells (e.g., tumor cell antigen) and the therapeutic antibody contains an effector cell-binding region that is specific for effector cells found in the tumor (e.g., neutrophils, dendritic cells, NK cells, etc.).

[0088] In one embodiment of the method of the present invention, the inventors have determined that αvβ3 integrin appears on the surface of cancer cells that have acquired drug resistance. This helps identify patients who are most likely to be effectively treated with therapeutic monoclonal antibody approaches directed against αvβ3 integrin. This provides a precision medicine approach to the correct patient population, allowing for the inclusion of other therapeutic monoclonal antibodies that target αvβ3 integrin. Cancer patients whose tumors have become resistant to standard treatment therapies have acquired αvβ3 expression, making them candidates for treatment with αvβ3-targeting antibodies that can promote immune cell-mediated ADCC of αvβ3-expressing tumor cells.

[0089] In the methods of the invention, the bone marrow-derived cells are macrophages, dendritic cells, or granulocytes such as neutrophils, basophils, eosinophils, or mast cells. In some embodiments, the bone marrow-derived cells are macrophages.

[0090] The epithelial cancer can be any known type of carcinoma. Examples of epithelial cancer include, but are not limited to, cancer of the gastrointestinal tract, breast, lung (e.g., non-small cell lung cancer), colon, prostate, or bladder. In some embodiments, the epithelial cancer cells are late-stage epithelial cancer cells. In some embodiments, the epithelial cancer cells have at least partially transformed into mesenchymal cells, e.g., express one or more mesenchymal antigens. In certain embodiments, the epithelial cancer cells are chemoresistant or refractory, which may be due to epithelial-mesenchymal transition.

[0091] In some embodiments, the method may further include isolating bone marrow-derived cells from the subject, contacting the bone marrow-derived cells with the chimeric binding agent or pharmaceutical composition, and administering the contacted bone marrow-derived cells to the subject.

[0092] In some embodiments, more than one chimeric binding agent can be delivered to a subject. For example, if a cancer sample indicates that more than one targetable antigen or more than one type of bone marrow-derived cell is enriched in the cancer, an agent targeting each of the antigens and / or bone marrow-derived cells can be administered. In some embodiments, the chimeric binding agent can be multispecific (e.g., bispecific or trispecific) to engage multiple targetable antigens and / or more than one type of bone marrow-derived cell.

[0093] The methods of the present invention may further comprise administering to the subject an additional cancer therapeutic agent or treatment (e.g., surgery, radiation). Cancer therapeutic agents include, but are not limited to, 1) vinca alkaloids (e.g., vinblastine, vincristine); 2) epipodophyllotoxins (e.g., etoposide and teniposide); 3) antibiotics (e.g., dactinomycin (actinomycin D), daunorubicin (daunomycin; rubidomycin), doxorubicin, bleomycin, plicamycin (mithramycin), and mitomycin (mitomycin C)); 4) enzymes (e.g., L-asparaginase); 5) biological response modifiers (e.g., interferon alpha); 6) platinum complexes (e.g., cisplatin and carboplatin); 7) anthracenediones (e.g., mitoxantrone); 8) substituted ureas (e.g., hydroxyurea); 9) methylhydrazine derivatives (e.g., methylhydrazine derivatives). For example, procarbazine (N-methylhydrazine; MIH); 10) adrenocortical suppressants (e.g., mitotane (o,p'-DDD) and aminoglutethimide); 11) corticosteroids (e.g., prednisone); 12) progestins (e.g., hydroxyprogesterone caproate, medroxyprogesterone acetate, and megestrol acetate); 13) estrogens (e.g., diethylstilbestrol and ethinyl estradiol); 14) antiestrogens (e.g., tamoxifen); 15) androgens (e.g., testosterone propionate and fluoxymesterone); 16) antiandrogens (e.g., flutamide); and 17) gonadotropin-releasing hormone analogs (e.g., leuprolide).Other cancer therapeutic agents include, but are not limited to, anti-angiogenic agents, such as antibodies against VEGF (e.g., bevacizumab (AVASTIN), ranibizumab (LUCENTIS)) and antibodies against other promoters of angiogenesis (e.g., bFGF, angiopoietin-1), angiostatin, endostatin, dalteparin, ABT-510, CNGRC peptide TNF alpha conjugate, cyclophosphamide, combretastatin A4 phosphate, dimethylxanthenone acetic acid, docetaxel, lenalidomide, enzastaurin, and paku. These include rituximab, paclitaxel albumin-stabilized small particle formulation (Abraxane), soy isoflavone (Genistein), tamoxifen citrate, thalidomide, ADH-1 (EXHERIN), AG-013736, AMG-706, AZD2171, sorafenib tosylate, BMS-582664, CHIR-265, pazopanib, PI-88, vatalanib, everolimus, suramin, sunitinib malate, XL184, ZD6474, ATN-161, cilengitide, and celecoxib.

[0094] In some embodiments, the method further comprises administering a CD47 blocking agent to enhance phagocytosis of cancer cells. Such agents include CD47-blocking monoclonal antibodies (Hu5F9-G4, CC-90002, Ti-061, or SRF231) or SIRPα-Fc fusion proteins (TTI-621, TTI-622, ALX148). However, one advantage of the present invention is that the method is effective against cancers regardless of whether the cancer cells express CD47. Thus, in some embodiments, the method of the present invention is used to treat cancers that express CD47. In some embodiments, the method of the present invention is used to treat cancers that express CD47. In some embodiments, the method of the present invention does not comprise administering a CD47 blocking agent to a subject.

[0095] In some embodiments, the method further comprises administering an immune checkpoint inhibitor to the subject. Immune checkpoints are well known in the art and include, but are not limited to, PD-1, PD-L1, PD-L2, CTLA4, B7-H3, B7-H4, BTLA, IDO, KIR, LAG3, A2AR, TIM-3, and VISTA. In some embodiments, the inhibitor is an antibody against an immune checkpoint protein. In certain embodiments, the immune checkpoint inhibitor is an inhibitor of PD-1, PD-L1, or CTLA-4, which are enriched in mesenchymal tumors, e.g., an antibody that specifically binds to PD-1, PD-L1, or CTLA-4. In some embodiments, the immune checkpoint inhibitor is nivolumab, pembrolizumab, ipilimumab, durvalumab, or atezolizumab.

[0096] In some embodiments, the method further comprises administering to the subject an EGFR inhibitor, including tyrosine kinase inhibitors (e.g., erlotinib, gefitinib, lapatinib, osimertinib, neratinib) and monoclonal antibodies (e.g., cetuximab, necitumumab, panitumumab).

[0097] In certain embodiments, the chimeric binding agents used in the methods of the present invention are administered directly to a subject. In some embodiments, the chimeric binding agents are suspended in a pharmaceutically acceptable carrier (e.g., saline) and administered orally or intravenously, or subcutaneously, intramuscularly, intrathecally, intraperitoneally, rectally, intravaginally, intranasally, intragastrically, intratracheally, or intrapulmonary. In another embodiment, intratracheal or intrapulmonary delivery can be achieved using a standard nebulizer, jet nebulizer, wire mesh nebulizer, dry powder inhaler, or metered-dose inhaler. The agents can be delivered directly to the site of disease or disorder, such as the lung, kidney, or intestine, for example, by injection into or near a tumor in situ. The dosage required depends on the choice of route of administration; the nature of the formulation; the nature of the patient's illness; the subject's size, weight, surface area, age, and sex; other medications being administered; and the judgment of the attending physician. An appropriate dosage for each agent is in the range of 0.01 to 100 μg / kg. Considering the variety of available active substances and the different efficiencies of various administration routes, it is natural that the required dosage will vary widely.For example, oral administration is expected to require a higher dosage than administration by intravenous injection.These dosage level variations can be adjusted using standard empirical routines for optimization, as is well known in the art.Administration can be single or multiple (e.g., 2, 3, 4, 6, 8, 10; 20, 50, 100, 150 or more).Encapsulating the compound into a suitable delivery vehicle (e.g., polymer microparticles or nanoparticles, or implantable device) can increase the efficiency of delivery, especially for oral delivery.

[0098] "Pharmaceutically acceptable" means a material that is not biologically or otherwise harmful, i.e., that the material can be administered to a subject without causing any adverse biological effects, such as toxicity.

[0099] The formulations of the present invention may include medicinal agents, pharmaceutical agents, carriers, adjuvants, dispersants, diluents, and the like, as appropriate.

[0100] The chimeric binding agents of the present invention can be formulated for administration in a pharmaceutical carrier according to known techniques. See, for example, Remington, The Science and Practice of Pharmacy (21 st Ed. 2006). In preparing pharmaceutical formulations according to the present invention, the active agent is typically mixed with, inter alia, an acceptable carrier. The carrier may be solid or liquid, or both, and may be formulated with the active agent as a unit-dose formulation, e.g., a capsule or vial, which may contain from 0.01% or 0.5% to 95% or 99% by weight of the active agent. One or more active agents may be incorporated into the formulations of the present invention, which may be prepared by any of the well-known techniques of pharmacy.

[0101] Formulations of the present invention include those suitable for oral, rectal, topical, buccal (e.g., sublingual), vaginal, parenteral (e.g., subcutaneous, intramuscular, including skeletal muscle, cardiac muscle, diaphragm muscle, and smooth muscle, intradermal, intravenous, intraperitoneal), local (i.e., both skin and mucosal surfaces, including respiratory tract surfaces), intranasal, transdermal, intraarticular, intrathecal, and inhalation administration, administration to the liver via intraportal delivery, as well as direct organ injection (e.g., into the liver, into the brain for delivery to the central nervous system, or into the pancreas) or injection into a body cavity. The most appropriate route in any given case will depend on the nature and severity of the condition to be treated and the nature of the particular agent to be used.

[0102] For injection, the carrier is typically a liquid such as sterile pyrogen-free water, pyrogen-free phosphate-buffered saline, bacteriostatic water, or Cremophor EL® (BASF, Parsippany, NJ). For other methods of administration, the carrier can be solid or liquid.

[0103] For oral administration, the active ingredient can be administered in solid dosage forms such as capsules, tablets, and powders, or in liquid dosage forms such as elixirs, syrups, and suspensions. The active ingredient can be encapsulated in a gelatin capsule along with inactive ingredients and powdered carriers, such as glucose, lactose, sucrose, mannitol, starch, cellulose or cellulose derivatives, magnesium stearate, stearic acid, sodium saccharin, talcum, magnesium carbonate, and the like. Examples of additional inactive ingredients that can be added to provide desired color, taste, stability, buffering capacity, dispersion, or other known desirable characteristics include red iron oxide, silica gel, sodium lauryl sulfate, titanium dioxide, edible white ink, and the like. Similar diluents can be used to prepare compressed tablets. Both tablets and capsules can be manufactured as sustained-release formulations to provide sustained release of the drug over several hours. Compressed tablets can be sugar-coated or film-coated to mask any unpleasant taste and protect the tablet from the atmosphere, or enteric-coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration can contain coloring and flavoring to increase patient acceptance.

[0104] Formulations suitable for buccal (sublingual) administration include lozenges which contain the agent in a flavored base, usually sucrose and acacia or tragacanth; and pastilles which contain the agent in an inert base such as gelatin and glycerin or sucrose and acacia.

[0105] Formulations of the present invention suitable for parenteral administration include sterile aqueous and non-aqueous injection solutions of the agent, which preparations are preferably isotonic with the blood of the intended recipient. These preparations may contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient. Aqueous and non-aqueous sterile suspensions may contain suspending agents and thickening agents. The formulations may be provided in unit / dose or multi-dose containers, such as sealed ampoules and vials, and can be stored in a freeze-dried (lyophilized) state, requiring only the addition of a sterile liquid carrier, such as saline or water for injection, immediately prior to use.

[0106] Ready-to-use injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the type described above. For example, in one embodiment of the present invention, an injectable, stable, sterile composition containing the agent of the present invention is provided in a sealed container as a unit dosage form. The agent is provided in the form of a lyophilizate that can be reconstituted with a suitable pharmaceutically acceptable carrier to form a liquid composition suitable for injection into a subject. A unit dosage form typically contains from about 1 mg to about 10 grams of the agent. When the agent is substantially water-insoluble, a sufficient amount of a pharmaceutically acceptable emulsifier can be used in an amount sufficient to emulsify the agent in an aqueous carrier. One such useful emulsifier is phosphatidylcholine.

[0107] Formulations suitable for rectal administration are preferably provided as unit-dose suppositories, which may be prepared by admixing the agent with one or more conventional solid carriers, for example, cocoa butter, and then shaping the resulting mixture.

[0108] Formulations suitable for topical application to the skin preferably take the form of an ointment, cream, lotion, paste, gel, spray, aerosol, or oil. Carriers that can be used include petrolatum, lanolin, polyethylene glycols, alcohols, transdermal enhancers, and combinations of two or more thereof.

[0109] Formulations suitable for transdermal administration can be provided as individual patches adapted to remain in intimate contact with the recipient's epidermis for an extended period of time. Formulations suitable for transdermal administration can also be delivered by iontophoresis (see, for example, Tyle, Pharm. Res. 3:318 (1986)), and typically take the form of an appropriately buffered aqueous solution of the compound. Suitable formulations include citrate buffer or Bis / Tris buffer (pH 6) or ethanol / water, containing 0.1M to 0.2M of the compound.

[0110] Alternatively, the agent can be formulated for administration to the subject's lungs by any suitable means, such as nasal or otherwise, for administration by an aerosol suspension of respirable particles comprising the agent, which the subject inhales. Respirable particles can be liquid or solid. The term "aerosol" includes any gaseous suspension that can be inhaled into the bronchial or nasal passages. Specifically, aerosols include gaseous suspensions of droplets, such as those generated in metered-dose inhalers or nebulizers, or in mist sprayers. Aerosols also include dry powder compositions suspended in air or other carrier gas, which can be delivered, for example, by insufflation from an inhaler device. See Ganderton & Jones, Drug Delivery to the Respiratory Tract, Ellis Horwood (1987); Gonda (1990) Critical Reviews in Therapeutic Drug Carrier Systems 6:273-313; and Raeburn et al., J. Pharmacol. Toxicol. Meth. 27:143 (1992). Aerosols of liquid particles containing the agent can be generated by any suitable means, as known to those skilled in the art, for example, using a pressure-driven aerosol nebulizer or an ultrasonic nebulizer. See, e.g., U.S. Patent No. 4,501,729. Aerosols of solid particles containing the agent can similarly be generated using any solid particulate drug generator, according to techniques known in the pharmaceutical arts.

[0111] Alternatively, the compounds can be administered in a local rather than systemic manner, such as in a depot or sustained release formulation.

[0112] The present invention further provides liposomal formulations of the active substances and their salts disclosed herein. Technology for forming liposomal suspensions is well known in the art. If the compound or its salt is a water-soluble salt, it can be incorporated into lipid vesicles using conventional liposome technology. In such cases, the water solubility of the active substance allows the active substance to be substantially entrapped within the hydrophilic center or core of the liposome. The lipid layer used may have any conventional composition and may contain cholesterol or may be cholesterol-free. If the compound or salt of interest is water-insoluble, again, conventional liposome formation technology can be used to substantially entrap the salt within the hydrophobic lipid bilayer that forms the liposome structure. In either case, the resulting liposomes can be reduced in size, such as through the use of standard sonication and homogenization techniques.

[0113] The liposomal formulation containing the active agent can be lyophilized to produce a lyophilizate, which can be reconstituted with a pharmaceutically acceptable carrier, such as water, to regenerate the liposomal suspension.

[0114] For water-insoluble active substances, pharmaceutical compositions containing water-insoluble active substances can be prepared, for example, in aqueous base emulsion.In such cases, the composition contains a sufficient amount of pharmaceutically acceptable emulsifier to emulsify the desired amount of the active substance.Particularly useful emulsifiers include phosphatidylcholine and lecithin.

[0115] In certain embodiments, the compound is administered to a subject in a therapeutically effective amount, the term therapeutically effective amount being as defined above. The dosage of a pharmaceutically active substance can be determined by methods known in the art, see, for example, Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, Pa.). The therapeutically effective amount of any particular agent will vary somewhat between agents and between patients, depending on the patient's condition and the route of delivery. As a general suggestion, a dosage of about 0.1 mg / kg to about 50 mg / kg will produce a therapeutic effect, with all weights calculated based on the weight of the agent. Due to toxicity concerns at higher levels, intravenous dosages may be limited to lower levels, such as up to about 10 mg / kg, with all weights calculated based on the weight of the agent. Dosages of about 10 mg / kg to about 50 mg / kg can be used for oral administration. Typically, dosages of about 0.5 mg / kg to 5 mg / kg can be used for intramuscular injection. Particular dosages are from about 1 μmol / kg to 50 μmol / kg, more particularly up to about 22 μmol / kg and up to 33 μmol / kg of the agent for intravenous or oral administration, respectively.

[0116] In certain embodiments of the invention, more than one administration (e.g., two, three, four, or more administrations) may be used over various time intervals (e.g., hourly, daily, weekly, monthly, etc.) to achieve a therapeutic effect.

[0117] The present invention is used for veterinary and medical applications. Suitable subjects include both birds and mammals, with mammals being preferred. As used herein, the term "mammal" includes, but is not limited to, humans, primates, cattle, sheep, goats, horses, cats, dogs, rabbits, and the like. Human subjects include neonates, infants, juveniles, and adults. The subject may be one in need of the method of the present invention, for example, a subject having or suspected of having cancer. The subject may be an experimental animal, for example, an animal model of a disease.

[0118] Non-limiting embodiments of the present invention include the following.

[0119] Embodiment 1. A chimeric binding agent comprising a first domain that specifically binds to an antigen on epithelial cancer cells that express at least one mesenchymal cell marker, and a second domain that mediates antibody-dependent cellular cytotoxicity (ADCC) by engaging bone marrow-derived cells that accumulate in mesenchymal tumors.

[0120] Embodiment 2. The chimeric binding agent of embodiment 1, wherein the bone marrow-derived cell is a macrophage, a dendritic cell, or a granulocyte such as a neutrophil, a basophil, an eosinophil, or a mast cell.

[0121] Embodiment 3. The chimeric binding agent of embodiment 1 or 2, wherein the epithelial cancer cells are late stage epithelial cancer cells.

[0122] Embodiment 4. The chimeric binding agent of embodiment 3, wherein the epithelial cancer cells have at least partially transformed into mesenchymal cells.

[0123] Embodiment 5. The chimeric binding agent of any one of embodiments 1-4, wherein the epithelial cancer cells are chemotherapy-resistant or refractory.

[0124] Embodiment 6. The chimeric binding agent of any one of embodiments 1 to 5, wherein the first domain is an antibody domain.

[0125] Embodiment 7. The chimeric binding agent of any one of embodiments 1 to 6, wherein the second domain is an antibody domain.

[0126] Embodiment 8. The chimeric binding agent of any one of embodiments 1-7, wherein the first domain is a humanized or human antibody domain.

[0127] Embodiment 9. The chimeric binding agent of any one of embodiments 1-8, wherein the second domain is a humanized or human antibody domain.

[0128] Embodiment 10. The chimeric binding agent of any one of Embodiments 1 to 9, which is a chimeric antibody or antigen-binding fragment thereof.

[0129] Embodiment 11. The chimeric binding agent of any one of embodiments 1 to 10, wherein the first domain specifically binds to an integrin.

[0130] Embodiment 12 The chimeric binding agent of embodiment 11, wherein the integrin is integrin αv.

[0131] Embodiment 13 The chimeric binding agent of embodiment 11, wherein the integrin is integrin β3.

[0132] Embodiment 14 The chimeric binding agent of embodiment 11, wherein the integrin is integrin αvβ3.

[0133] Embodiment 15. The chimeric binding agent of any one of embodiments 1 to 14, wherein the first domain specifically binds to an antigen on the surface of a cancer cell, including a receptor on the surface of an epithelial-like tumor cell (e.g., EGFR, HER2, EpCAM, E-cadherin, ZO-1, integrin α6β4) or a mesenchymal-like tumor cell (e.g., integrin αvβ3, integrin β1, integrin αvβ6, N-cadherin, OB-cadherin, syndecan-1).

[0134] Embodiment 16. The chimeric binding agent of any one of embodiments 1-14, wherein the first domain specifically binds to a neo-antigen not previously recognized by the immune system.

[0135] Embodiment 17. The chimeric binding agent of any one of embodiments 1-16, wherein the first domain comprises an Fab domain of an antibody.

[0136] Embodiment 18 The chimeric binding agent of embodiment 17, wherein the first domain comprises an Fab domain of an IgG antibody.

[0137] Embodiment 19. The chimeric binding agent of embodiment 18, wherein the first domain comprises an Fab domain of an IgG4 antibody.

[0138] Embodiment 20. The chimeric binding agent of embodiment 19, wherein the first domain comprises the amino acid sequence of the light chain of hLM609-hIgG4-S228P (SEQ ID NO: 2), or a sequence at least 90% identical thereto, and the amino acid sequence of the Fab portion of the heavy chain of hLM609-hIgG4-S228P (SEQ ID NO: 3), or a sequence at least 90% identical thereto.

[0139] Embodiment 21. The chimeric binding agent of embodiment 19, wherein the first domain comprises the amino acid sequence of the Fab portion of the heavy chain of LM609_7 (SEQ ID NO: 5), or a sequence at least 90% identical thereto, and the amino acid sequence of the light chain of LM609_7 (SEQ ID NO: 6), or a sequence at least 90% identical thereto, the amino acid sequence of the Fab portion of the heavy chain of JC7U (SEQ ID NO: 7), or a sequence at least 90% identical thereto, and the amino acid sequence of the light chain of JC7U (SEQ ID NO: 8), or a sequence at least 90% identical thereto.

[0140] Embodiment 22. The chimeric binding agent of any one of Embodiments 1 to 19, wherein the first domain further specifically binds to a second antigen.

[0141] Embodiment 23 The chimeric binding agent of embodiment 22, wherein the first domain is a bispecific antibody domain.

[0142] Embodiment 24 The chimeric binding agent of embodiment 22 or 23, wherein the second antigen is an immune checkpoint molecule such as PD-1, PD-L1, or CTLA-4.

[0143] Embodiment 25 The chimeric binding agent of embodiment 22 or 23, wherein the second antigen is a cancer stem cell marker, such as CD133, CD44, CD90, CD117, CD166, or CD105, or an effector cell antigen.

[0144] Embodiment 26 The chimeric binding agent of embodiment 22 or 23, wherein the second antigen is an effector cell antigen.

[0145] Embodiment 27. The chimeric binding agent of any one of embodiments 1-26, wherein the second domain engages a macrophage.

[0146] Embodiment 28. The chimeric binding agent of any one of Embodiments 1-27, wherein the second domain does not significantly engage natural killer cells.

[0147] Embodiment 29. The chimeric binding agent of any one of embodiments 1-28, wherein the second domain does not significantly engage lymphocytes.

[0148] Embodiment 30. The chimeric binding agent of any one of Embodiments 1-29, wherein the second domain specifically binds to a protein on the surface of a bone marrow-derived cell.

[0149] Embodiment 31 The chimeric binding agent of embodiment 30, wherein the second domain specifically binds to an Fc gamma receptor.

[0150] Embodiment 32 The chimeric binding agent of embodiment 30, wherein the second domain specifically binds to Fc gamma receptor I (FcγRI, CD64).

[0151] Embodiment 33. The chimeric binding agent of any one of Embodiments 1 to 32, wherein the second domain comprises an Fc domain of an antibody.

[0152] Embodiment 34 The chimeric binding agent of embodiment 33, wherein the second domain comprises an Fc domain of an IgG antibody.

[0153] Embodiment 35 The chimeric binding agent of embodiment 34, wherein the second domain comprises an Fc domain of an IgG4 antibody.

[0154] Embodiment 36 The chimeric binding agent of embodiment 33, wherein the second domain comprises an Fc domain of an IgA or IgE antibody.

[0155] Embodiment 37. The chimeric binding agent of any one of embodiments 33 to 36, wherein the second domain further comprises an antibody hinge domain.

[0156] Embodiment 38. The chimeric binding agent of embodiment 37, wherein the second domain comprises the amino acid sequence of the heavy chain Fc domain and hinge domain of hLM609-hIgG4-S228P (SEQ ID NO: 4), or a sequence at least 90% identical thereto.

[0157] Embodiment 39. The chimeric binding agent of any one of embodiments 1 to 38, wherein the amino acid sequence comprises a S228P mutation (Eu numbering system) in the hinge region.

[0158] Embodiment 40. The chimeric binding agent of embodiment 39, comprising the amino acid sequences of the heavy chain (SEQ ID NO: 1) and light chain (SEQ ID NO: 2) of hLM609-hIgG4-S228P, or sequences at least 90% identical thereto.

[0159] Embodiment 41. The amino acid sequence a) S239D / A330L / I332E; b) I332E; c) G236A / S239D / I332E; d) G236A; e) N297A / E382V / M428I; f) M252Y / S254T / T256E; g) Q295R / L328W / A330V / P331A / I332Y / E382V / M428I; h) L234A / L235A / P329G; i) M428L / N434S; j) L234A / L235A / P331S; k) L234A / L235A / P329G / M252Y / S254T / T256E; l) S298A / E333A / K334 / A; m) S239D / I332E; n) G236A / S239D / A330L / I332E; o) S239D / I332E / G236A; p) L234Y / G236W / S298A; q) F243L / R292P / Y300L / V305I / P396L; r) K326W / E333S; s) K326A / E333A; t) K326M / E333S; u) C221D / D222C; v) S267E / H268F / S324W; w) H268F / S324W; x) E345R y) R435H; z) N434A; aa)M252Y / S254T / T256E; ab)M428L / N434S; ac)T252L / T / 253S / T254F; ad)E294delta / T307P / N434Y; ae)T256N / A378V / S383N / N434Y; af)E294delta ag)L235E; ah)L234A / L235A; ai)S228P / L235E; aj)P331S / L234E / L225F; ak)D265A; al)G237A; am)E318A; an)E233P; ao)G236R / L328R; ap)H268Q / V309L / A330S / P331S; aq)L234A / L235A / G237A / P238S / H268A / A330S / P331S; ar)A330L; as)D270A; at)K322A; au)P329A; av)P331A; aw V264A; ax)F241A; ay)N297A or G or N az)S228P / F234A / L235A; or ba) Any combination of a) to az) 41. The chimeric binding agent of embodiment 39 or 40, comprising a mutation selected from:

[0160] Embodiment 42. A polynucleotide encoding the chimeric binding agent of any one of embodiments 1 to 40.

[0161] Embodiment 43. A vector comprising the polynucleotide of embodiment 42.

[0162] Embodiment 44. A host cell comprising the polynucleotide of embodiment 42 or the vector of embodiment 43.

[0163] Embodiment 45. A composition comprising the chimeric binding agent of any one of Embodiments 1 to 41 and a carrier.

[0164] Embodiment 46. A pharmaceutical composition comprising the chimeric binding agent of any one of Embodiments 1 to 41 and a pharmaceutically acceptable carrier.

[0165] Embodiment 47 The pharmaceutical composition of embodiment 46, further comprising an additional therapeutic agent.

[0166] Embodiment 48 The pharmaceutical composition of embodiment 47, wherein the additional therapeutic agent is a chemotherapeutic agent.

[0167] Embodiment 49. A kit comprising the chimeric binding agent of any one of Embodiments 1 to 41.

[0168] Embodiment 50. A method of targeting bone marrow-derived cells that accumulate in a tumor to cancer cells that express at least one cell marker, comprising contacting the cancer cells and the bone marrow-derived cells with an effective amount of a chimeric binding agent of any one of embodiments 1 to 41.

[0169] Embodiment 51 The method of embodiment 50, wherein the cancer cells express at least one cell marker due to cellular stress.

[0170] Embodiment 52 The method of embodiment 50, wherein the cancer cells express at least one cell marker by undergoing epithelial-mesenchymal transition.

[0171] Embodiment 53. A method of targeting bone marrow-derived cells that accumulate in mesenchymal tumors to epithelial cancer cells that express at least one mesenchymal cell marker, comprising contacting the cancer cells and the bone marrow-derived cells with an effective amount of the chimeric binding agent of any one of embodiments 1 to 41.

[0172] Embodiment 54 The method of embodiment 53, wherein the bone marrow-derived cells are macrophages, dendritic cells, or granulocytes such as neutrophils, basophils, eosinophils, or mast cells.

[0173] Embodiment 55. A method of treating a cancer expressing at least one cell marker in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a chimeric binding agent of any one of embodiments 1-41 or a pharmaceutical composition of any one of embodiments 46-48, thereby treating the cancer.

[0174] Embodiment 56. A method of treating epithelial cell cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a chimeric binding agent of any one of embodiments 1-41 or a pharmaceutical composition of any one of embodiments 46-48, thereby treating the cancer.

[0175] Embodiment 57. A method of treating cancer in a subject in need thereof, comprising: a) selecting a subject having cancer cells enriched for an antigen specifically bound by the chimeric binding agent of any one of embodiments 1 to 41 and enriched for bone marrow-derived cells that accumulate in mesenchymal tumors; and b) administering to the subject a therapeutically effective amount of a chimeric binding agent according to any one of embodiments 1 to 41 or a pharmaceutical composition according to any one of embodiments 46 to 48, thereby treating the cancer. A method comprising:

[0176] Embodiment 58. A method of treating epithelial cell cancer in a subject in need thereof, comprising: a) selecting a subject having epithelial cancer cells enriched for an antigen specifically bound by the chimeric binding agent of any one of embodiments 1 to 41 and enriched for bone marrow-derived cells that accumulate in mesenchymal tumors; and b) administering to the subject a therapeutically effective amount of a chimeric binding agent according to any one of embodiments 1 to 41 or a pharmaceutical composition according to any one of embodiments 46 to 48, thereby treating the cancer. A method comprising:

[0177] Embodiment 59. The method of embodiment 58, wherein step a) comprises obtaining a cancer sample from the subject and measuring the levels of antigens and bone marrow-derived cells in said sample.

[0178] Embodiment 60. The method of any one of embodiments 55-59, wherein the bone marrow-derived cells are macrophages, dendritic cells, or granulocytes such as neutrophils, basophils, eosinophils, or mast cells.

[0179] Embodiment 61. The method of embodiment 60, wherein the epithelial cell cancer is a late stage epithelial cell cancer.

[0180] Embodiment 62 The method of embodiment 61, wherein one or more of the epithelial cells in the cancer have at least partially transformed into mesenchymal cells.

[0181] Embodiment 63 The method of any one of embodiments 58-62, wherein the epithelial cell cancer is or is becoming chemotherapy-resistant or refractory.

[0182] Embodiment 64 The method of any one of embodiments 55-63, wherein the cancer is a carcinoma such as cancer of the gastrointestinal tract, breast, lung (e.g., non-small cell lung cancer), colon, prostate, or bladder.

[0183] Embodiment 65 The method of any one of embodiments 55 to 64, further comprising administering to the subject a CD47 blocking agent and / or an immune checkpoint inhibitor and / or an EGFR inhibitor.

[0184] Embodiment 66 The method of any one of embodiments 55-64, which does not include administering a CD47 blocking agent to the subject.

[0185] Embodiment 67. The method of any one of embodiments 58-66, wherein the epithelial cell cancer expresses CD47.

[0186] Embodiment 68 The method of any one of embodiments 58-66, wherein the epithelial cell cancer does not express CD47.

[0187] Embodiment 69 The method of any one of embodiments 55-68, further comprising administering to the subject an additional cancer therapeutic agent or treatment.

[0188] Embodiment 70. The method of any one of embodiments 55-69, wherein the chimeric binding agent or pharmaceutical composition is administered intravenously, subcutaneously, or intramuscularly to the subject, or injected into or near the cancer in situ.

[0189] Embodiment 71. The method of any one of embodiments 55-70, further comprising isolating bone marrow-derived cells from the subject, contacting the bone marrow-derived cells with a chimeric binding agent or pharmaceutical composition, and administering the contacted bone marrow-derived cells to the subject.

[0190] Embodiment 72. The method of any one of embodiments 55 to 71, wherein the subject is a human.

[0191] The present invention is more particularly described in the following examples, which are intended as illustrations only, since numerous modifications and variations therein will be apparent to those skilled in the art. [Example]

[0192] Example 1: Integrin β3 expression positively correlates with macrophage markers across multiple cancers. During cancer progression, the tumor microenvironment changes dramatically with the emergence of various stromal and immune cells that influence tumor malignant behavior (Coussens, 2002; Ruffell, 2015). Therefore, when targeting tumors with therapeutic antibodies, it is important to consider the availability of immune cells. Although enrichment of integrin αvβ3 on tumor cells is a driver of aggressive and drug-resistant tumor phenotypes (Desgrosellier, 2009; Seguin, 2014a), the impact of αvβ3-positive tumor cells on the tumor immune microenvironment is poorly defined. As reported in Figure 1A of Wettersten et al., Cancer Res. 79:5048 (2019), we queried multiple TCGA datasets to identify whether β3-expressing tumors could be enriched for certain immune effector cell types that may contribute to antibody-mediated lethality. This analysis revealed that ITGB3 mRNA expression positively correlated with marker sets for macrophages (MΦ), dendritic cells (DC), and neutrophils (NΦ) (rho ≥ 0.3) but not with NK cells (NK) in certain types of solid tumors. For example, ITGB3 mRNA expression positively correlated with macrophage markers in kidney, breast, GBM, lung, stomach, prostate, pancreas, esophageal, and colorectal cancers, but no correlation was observed in renal papillary, sarcoma, thyroid, melanoma, and ovarian cancers. ITGB3 also positively correlated with other immune cell types, such as mast cells, T cells, and B cells, but this relationship was observed in a limited number of tumor types. Interestingly, no correlation between ITGB3 and immune cell markers was observed in thyroid, melanoma, renal papillary, and sarcoma, even though these cancers have the highest median ITGB3 expression in the TCGA pan-cancer dataset.

[0193] As reported in Figure 1B in Wettersten et al., Cancer Res. 79:5048 (2019), a positive correlation between integrin β3 and immune cell type markers was confirmed for 10 independent tumor samples from frozen lung adenocarcinoma biopsies analyzed using the NanoString nCounter platform. Even with this modest sample size, tumors with ITGB3 expression above the median were enriched for markers characterizing macrophages, dendritic cells, and neutrophils (but not NK cells) compared with tumors with ITGB3 expression below the median. Consistent with analysis of the TCGA dataset, there is a strong positive correlation between ITGB3 and these marker sets. Taken together, these data suggest that β3-positive epithelial cancers may be enriched for multiple cell types that can serve as effector cells for antibody-mediated therapy.

[0194] To further confirm the positive correlation of macrophage enrichment with β3 expression on tumor cells at the protein level for a variety of genetically and histologically distinct solid tumor types, as reported in Figure 1C of Wettersten et al., Cancer Res. 79:5048 (2019), we performed immunohistochemical staining on a series of commercially available tumor microarray slides. This analysis revealed that integrin β3 protein expression on tumor cells positively correlated with the presence of macrophage markers CD68 and CD163 for lung, prostate, colorectal, kidney, and glioblastoma tumors. High-magnification images confirmed that individual areas with integrin β3 staining on tumor cells were enriched for cells that stained positive for macrophage markers. Notably, the percentage of tumors with positive tumor cell expression of β3 ranged from 29 to 54% among the array slides examined, indicating a significant proportion of β3+ tumors across a diverse population of tumor types, grades, and stages. Taken together, these findings indicate that tumors with high tumor cell expression of integrin β3 are particularly enriched for TAMs, a component of the tumor microenvironment that contributes to tumor progression (Pathria, 2019), and that these cells may prove important when targeting tumors with certain therapeutic antibodies.

[0195] Example 2: Tumor cell expression of integrin β3 is enriched after tumors acquire resistance to the EGFR inhibitor erlotinib in vivo. TAM enrichment has been observed after cancer treatments, including the EGFR inhibitor erlotinib (Chung, 2012), and we previously reported that integrin αvβ3 is upregulated during erlotinib resistance in lung cancer in mice and in the BATTLE trial in humans (Seguin, 2014b). Accordingly, in Figure 2B of Wettersten et al., Cancer Res. 79:5048 (2019), we showed that αvβ3-negative HCC827 human EGFR mutant lung tumors that acquired resistance to erlotinib in vivo not only acquired αvβ3 as they became drug resistant, but also became enriched for TAMs.

[0196] Example 3: Anti-αvβ3 monoclonal antibodies induce macrophage-mediated tumor cell killing. Given the simultaneous enrichment of TAMs and integrin αvβ3-expressing tumor cells, we reasoned that this relationship provides the basis for therapeutic strategies to treat αvβ3+ cancers. We further reasoned that therapeutically targeting integrin αvβ3 may offer new opportunities to treat tumors that acquire αvβ3 expression as a means to evade the effects of the EGFR inhibitor erlotinib. To test this hypothesis, we used our previously developed function-blocking monoclonal antibody LM609 (Cheresh, 1987), which recognizes integrin αvβ3 on human cells but not on mouse cells, as the parent antibody for the fully humanized version, Vitaxin / etaracizumab (Delbaldo, 2008; Gutheil, 2000).

[0197] LM609 was tested for its ability to block the growth of tumors that acquire erlotinib resistance due to increased expression of integrin αvβ3. First, the ability of LM609 to delay the onset of erlotinib resistance was tested. Briefly, HCC827 (5×10 in 100 μl PBS) were cultured in 100 μl of LM609. 6αvβ3-negative human EGFR mutant lung cancer cells were injected subcutaneously into the right flank of female nu / nu mice (Charles River, 088, 8-10 weeks old). Tumors were measured twice weekly with a vernier caliper. The tumor diameter was 250-700 mm. 3 Animals with tumor volumes of 0.001 mg / kg were randomly assigned to treatment groups receiving a combination of Captisol (oral, 6 times / week), PBS (ip, 2 times / week), LM609 (ip, 10 mg / kg, 2 times / week), or erlotinib (oral, 6.25 mg / kg, 6 times / week). Vehicle-treated mice were sacrificed on day 15 due to large tumor size, and erlotinib-treated mice were sacrificed on day 50. Tumors were placed in liquid nitrogen, OCT compound, or 10% formalin. As reported in Figure 2C of Wettersten et al., Cancer Res. 79:5048 (2019), LM609 alone does not affect the growth of HCC827 xenograft tumors prior to the development of drug resistance due to the lack of the αvβ3 antigen. Mice treated with erlotinib alone showed an initial reduction in tumor size, but this was followed by eventual tumor regrowth and acquisition of αvβ3 expression. In contrast, the combination of erlotinib plus LM609 prolonged drug sensitivity and prevented the appearance of integrin β3 on tumor cells.

[0198] LM609 was then tested for its ability to resensitize resistant tumors to the effects of erlotinib. To generate erlotinib-resistant tumors in vitro, HCC827 or PC9 human lung cancer cells (5 x 10 in 100 μl PBS) were cultured in vitro. 6 100-200 mm (100-200 mm tumor cells) were injected subcutaneously into the right flank of female nu / nu mice (Charles River, 088, 8-10 weeks old), and tumors were measured twice weekly with a vernier caliper. 3Animals with tumor volumes of 0.01 mg / kg were randomly assigned to treatment with a combination of Captisol (oral, 6 times per week) or erlotinib (oral, 6.25 mg / kg, 6 times per week). Vehicle-treated erlotinib-sensitive (HCC827-P and PC9-P) and erlotinib-resistant (HCC827-R18 and PC9-R4L) cells were isolated from each individual tumor shown in Figure S3 of Wettersten et al., Cancer Res. 79:5048 (2019). Acquisition of αvβ3 expression on the cell surface of erlotinib-resistant tumor cells was confirmed by flow cytometry. When HCC827-R18 and PC9-R4L erlotinib-resistant cell lines were injected subcutaneously into recipient mice, systemic treatment with LM609 (ip, 10 mg / kg, twice weekly) was able to resensitize the resistant tumors to the growth inhibitory effects of erlotinib (Fig. 1 ).

[0199] Finally, we investigated whether the antitumor activity of LM609 might be related to the simultaneous enrichment of tumor adenocarcinoma (TAM) and integrin αvβ3-expressing tumor cells. As reported in Figure 2A of Wettersten et al., Cancer Res. 79:5048 (2019), we found that αvβ3-expressing human lung and pancreatic xenograft tumors growing in nude mice were highly sensitive to LM609, and that this effect could be completely blocked by macrophage depletion using clodronate liposomes, demonstrating that TAMs play an important role in the antitumor efficacy of this tumor-targeting antibody. Successful macrophage depletion by clodronate treatment was confirmed by staining tumor sections for the mouse macrophage marker F4 / 80. Thus, macrophages are required for the antitumor activity of LM609.

[0200] Example 4: LM609 induces macrophage-mediated antibody-dependent cellular cytotoxicity (ADCC). To confirm that the mechanism of action for LM609 is macrophage-dependent, we asked whether LM609 could kill tumor cells in vitro using macrophages isolated from mouse tumors or bone marrow or human blood.

[0201] TAMs were isolated from tumor tissue as previously described (Kaneda, 2016). Tumors were dissociated in HBSS containing collagenase IV (Sigma, C5138), hyaluronidase (Sigma, H2654), dispase II (Roche, 04942078001), and DNase IV (Millipore, D5025) at 37°C for 15 minutes. The cell suspension was filtered through a 70 μm cell strainer and washed with PBS. Single cell suspensions (10 in 5% BSA in PBS) were prepared. 6 Cells (100 μL) were incubated with Mouse BD Fc Block™ (BD Biosciences, 553142, 1:50) for 10 minutes at 4°C and with fluorescently labeled antibodies, CD11b (eBioscience, 17-0112-81, 1:100) and Ly-6G (eBioscience, 25-5931-81, 1:100) for 1 hour at 4°C. TAMs (CD11b positive, Ly-6G negative) were sorted.

[0202] Murine bone marrow-derived macrophages (BMDMs) were collected aseptically from euthanized female C57BL / 6 mice (8-10 weeks old) by flushing the hindlimb bones with RPMI, filtering them through a 70 μm cell strainer, and incubating them in red blood cell lysis buffer Hybri-Max™ (Sigma, R7757). The cells were incubated with murine M-CSF (Peprotech, 315-02) for 7 days prior to the ADCC assay.

[0203] Human peripheral blood mononuclear cells (PBMCs) and macrophages were isolated using a leukocyte reduction system chamber (LRSC) purchased from the San Diego Blood Bank. PBMCs were isolated from LRSCs using Histopaque-1083 (Sigma, 10831) according to the manufacturer's protocol. To obtain macrophages, PBMCs were incubated in tissue culture plates containing human M-CSF (Peprotech, 300-25) for 5 days.

[0204] We used isolated macrophages as effector cells in antibody-dependent cellular cytotoxicity (ADCC) assays. Briefly, target cells (i.e., tumor cells) stained with the CFSE Cell Division Tracker Kit (BioLegend, 423801) were cocultured with effector cells (i.e., TAMs) with or without isotype IgG or LM609 for 5–16 h at 37°C, stained with PI, and flow cytometry was performed on a BD LSRFortessa™. The ratio of dead target cells (PI positive) to the total target cell population (CFSE positive) was calculated as described (Bracher, 2007).

[0205] As reported in Figures 3A-3B of Wettersten et al., Cancer Res. 79:5048 (2019), LM609 demonstrated robust ADCC activity using tumor amniotic membrane proteins (TAMs) isolated from murine Lewis lung carcinoma (LLC) tumors grown in immunocompetent C57BL6 mice or immunodeficient athymic nude mice. The antibody was also able to kill tumor cells using bone marrow-derived macrophages (BMDMs) isolated from healthy mice and human monocyte-derived macrophages isolated from healthy donor blood.

[0206] Surprisingly, LM609-mediated ADCC was not achieved with either mouse NK cells or peripheral blood mononuclear cells (PBMCs) isolated from human blood, immune effector cell types commonly engineered for optimal antibody binding (Listinsky, 2013; Yu, 2017). Indeed, NK cell expression did not correlate with tumor β3 expression. These findings were reported in Figure 3E of Wettersten et al., Cancer Res. 79:5048 (2019).

[0207] Binding of antibodies to Fc receptors on macrophages is crucial for their killing ability, because macrophage-mediated killing was absent in the presence of antibody blockade of Fc receptors CD16, CD32, and CD64, and a form of LM609 lacking the Fc portion (Fab LM609) was unable to cause macrophage-mediated killing. These findings were reported in Figures 3C-3D of Wettersten et al., Cancer Res. 79:5048 (2019).

[0208] Monoclonal antibodies can direct macrophages to induce tumor cell killing through two major mechanisms: processes known as antibody-dependent cellular phagocytosis (ADCP) and antibody-dependent cellular cytotoxicity (ADCC). In Figure 3F of Wettersten et al., Cancer Res. 79:5048 (2019), we show that LM609 induced macrophage ADCC but not ADCP or direct killing, which required integrin β3 expression. The lack of an ADCP response is consistent with high tumor cell expression of CD47, a "don't eat me" signal that tumor cells often use to evade phagocytosis (Chao, 2012). Furthermore, macrophage-mediated ADCC, rather than ADCP or direct lethality, was observed in additional αvβ3-expressing tumor cell lines representing tumor types whose ITGB3 expression is associated with macrophage enrichment, including lung, pancreatic, brain, and kidney cancers, as reported in Figure 3G of Wettersten et al., Cancer Res. 79:5048 (2019).

[0209] Taken together, these findings suggest that the antitumor activity of LM609 involves opsonization of αvβ3-expressing tumor cells with its monoclonal antibody, followed by engagement with macrophage Fc receptors to induce killing.

[0210] Example 5: A new humanized version of LM609 designed for preferential engagement of macrophages. In vitro ADCC assays have shown that the murine monoclonal antibody LM609 can selectively engage and mediate ADCC with macrophages, but not with NK cells, and we reasoned that a humanized version of LM609 could be generated that retained this functional difference.

[0211] Antibody Fc engineering and glycoengineering strategies to enhance binding to NK cells for the purpose of triggering ADCC include alterations to promote Fc binding only to CD16 (FcγRIII), an Fc receptor expressed on NK cells. However, our findings suggest that mesenchymal, stem-like, and drug-resistant αvβ3-expressing tumors contain high levels of macrophages, dendritic cells, and neutrophils (but not NK cells), as reported by Wettersten et al., Cancer Res. 79:5048 (2019). Therefore, designing an anti-αvβ3 antibody to induce ADCC requiring NK cell engagement represents a mismatch between the antigen (αvβ3) and the type of effector cells present in αvβ3-expressing tumors. Therefore, we reasoned that if anti-αvβ3 could be engineered to recruit macrophages, this new antibody might demonstrate improved antitumor efficacy by more robustly triggering ADCC.

[0212] Our design goal was to create a new humanized version of LM609 that preferentially engages macrophages over other immune effector cell types. LM609 is a murine monoclonal IgG1κ antibody that recognizes the human integrin αvβ3 (Figure 2). Several humanized versions of LM609 have previously been generated as the hIgG1 isotype (Figures 3 and 4). Because hIgG4 binds only to FcγRI / CD64 and not to other Fc receptors, we generated a new humanized version of LM609 by switching the isotype of etaracizumab / Vitaxin from the hIgG1 isotype (Figure 3) to the hIgG4-S228P isotype (Figure 5). The S228P (Eu numbering system) mutation in the antibody hinge region was included to prevent Fab arm exchange, as previously reported (Reddy, 2000). FIG. 6 shows an amino acid sequence alignment comparing humanized LM609 hIgG1 versus hIgG4-S228P.

[0213] Although isotype switching to hIgG4 has previously been utilized to generate cancer therapeutics, the rationale for this change was to generate antibodies that were deficient in engaging ADCC effector cells, most notably NK cells and monocytes. In contrast, macrophages are not widely recognized as mediators of ADCC. Given that the murine monoclonal antibody LM609 can recruit macrophages to induce ADCC but not phagocytosis, our use of isotype switching to hIgG4 represents an unconventional and unexpected strategy to engage macrophages for ADCC.

[0214] NK cells utilize only FcγRIII / CD16 to engage antibody Fc regions, whereas macrophages can utilize FcγRI / CD64. Using a cell-based ADCC reporter bioassay, we show that hLM609-hIgG4-S228P can strongly activate FcγRI on effector cells, whereas hIgG1 and hIgG1-I332E isotypes exhibit lower levels of engagement (Figure 7). In contrast, the hIgG1 isotype can strongly activate FcγRIII, and the hIgG1-I332E mutation enhances this, as expected (Figure 7). Notably, hLM609-hIgG4 does not activate FcγRIII on effector cells, confirming that the hIgG4 isotype primarily interacts with FcγRI. Conventional thinking might suggest that isotype switching to hIgG4-S228P would eliminate all effector cell engagement, but we show here that hLM609-hIgG4-S228P can selectively engage and activate the Fc receptor FcγRI / CD64 expressed on macrophages.

[0215] Next, we confirmed that isotype switching to hIgG4 did not alter the ability of humanized LM609 to block integrin αvβ3-mediated cell adhesion. Each antibody was tested for its ability to block αvβ3-mediated adhesion of integrin αvβ3-expressing tumor cells to fibrinogen, as well as β1 integrin-mediated adhesion to type I collagen. Figure 8 shows that both IgG1 and IgG4 forms of humanized LM609 blocked adhesion to fibrinogen without disrupting β1-mediated adhesion to collagen.

[0216] Next, we confirmed that the hIgG4 form of humanized LM609 was unable to engage NK cells, as expected due to the inability of IgG4 to bind to FcγRIIIA / CD16, the only Fc receptor expressed by NK cells. In an in vitro ADCC assay using CD16-expressing human NK cells, we confirmed that the hIgG4-S228P form of humanized LM609 was unable to engage NK cells and mediate ADCC (Figure 9A). In contrast, the hIgG4-S228P form of humanized LM609 engaged primary human macrophages and induced ADCC against H1975 human lung cancer cells, which have endogenous expression of β3 (but the hIgG1-WT form did not) (Figure 9B). The macrophage-mediated killing activity of the hIgG4-S228P form of humanized LM609 was further confirmed using macrophages isolated from three individual healthy blood donors with polymorphic variants in CD16 / CD32 as indicated (Figure 9C). Furthermore, both LM609 and hLM609-IgG4-S228P can induce ADCC using human macrophages as effector cells (Figure 10A). Unlike hLM609-hIgG1, the hLM609-IgG4-S228P isotype cannot utilize NK cells for tumor cell killing (Figure 10B). This difference may result in a therapeutic advantage by achieving a match between the antigen (integrin αvβ3) and a type of effector cell that is particularly enriched in αvβ3-expressing cells, such as macrophages.

[0217] As observed with LM609, the hIgG4-S228P form of humanized LM609 was able to engage mouse bone marrow-derived macrophages in vitro and induce ADCC (Figure 11). Having established that the murine monoclonal antibody LM609 kills αvβ3-expressing tumor cells by recruiting macrophages for ADCC, we next compared the antitumor activity of LM609 and hLM609-IgG4-S228P in mice. Indeed, both antibodies produced equivalent antitumor activity (Figure 12), suggesting that the humanized form and the isotype switch that enables macrophage engagement were sufficient to mimic the activity of the murine monoclonal antibody. Next, we compared the antitumor activity of hLM609-hIgG1 (an isotype that engages NK cells) with that of hLM609-hIgG4-S228P (an isotype that engages macrophages). Importantly, the antibody affinities for these isotype variants are equivalent, as demonstrated by their ability to block αvβ3-dependent cell adhesion (Figure 8). For rapidly growing human tumor xenografts in mice, the antitumor activity for hLM609-hIgG4-S228P was superior to that of hLM609-hIgG1 (Figure 13), suggesting that its ability to selectively engage macrophages provides a therapeutic advantage for αvβ3-expressing tumors with abundant macrophages, but not NK cells.

[0218] Next, we compared the tumor accumulation of hLM609-hIgG1 with hLM609-hIgG4-S228P. hLM609-hIgG4-S228P was able to localize to tumors to a greater extent than hLM609-hIgG1 (Figure 14). Without wishing to be bound by theory, it is believed that hLM609-hIgG4-S228P may be better able to localize to tumors, where macrophages are primarily localized, because they engage fewer effector cells overall. In contrast, hLM609-hIgG1, which engages a wider variety of immune cells, may engage effector cells in the blood, lymph nodes, spleen, etc., and therefore may not be as readily available for localization to tumors.

[0219] Taken together, these findings demonstrate that the hIgG4-S228P form of humanized LM609 mimics the functional activity of murine monoclonal LM609. Specifically, these antibodies can preferentially engage macrophages and induce killing of integrin αvβ3-expressing tumor cells. This antibody design strategy reflects the goal of matching tumor cell antigens (αvβ3) with appropriate ADCC-inducing effector cells (macrophages). By preventing the antibody from broadly engaging immune effector cell types not enriched in the tumor microenvironment, we propose that it can better accumulate in tumors by binding to αvβ3 on tumor cells and / or CD64 / FcγRI on macrophages.

[0220] Some therapeutic antibodies induce tumor cell killing through ADCC. This occurs when the antibody Fc region engages with Fc receptors on immune effector cells, triggering the release of cytotoxic granules that induce tumor cell killing. Because this scenario typically involves antibody binding to CD16 on NK cells, many antibody glycoengineering and Fc engineering strategies are designed to facilitate this interaction. Because IgG4 has high affinity for CD64 but weak affinity for all other receptors, IgG4 is generally considered a weak inducer of Fc-mediated effector function. Therefore, isotype switching to IgG4 is an unexpected approach to enhance effector cell-mediated killing of tumor cells.

[0221] For example, the FDA has approved three hIgG4 tumor therapeutic antibodies, pembrolizumab (KEYTRUDA), nivolumab (OPDIVO), and cemiplimab (LIBTAYO), all of which target the immune checkpoint molecule PD-1, which is primarily expressed on activated T cells and NK cells. These antibodies work by neutralizing T cell inhibition, i.e., preventing the immunosuppressive results that occur when PD-1 (on T cells and NK cells) binds to PD-L1 (on tumor cells). The IgG4 subclass allows the antibodies to block PD-1 function without engaging additional immune effector cells. As is common for hIgG4 antibodies, all three anti-PD-1 antibodies contain the S228P mutation in the hinge region to stabilize the hIgG4 antibody structure. Based on knowledge in the art, IgG4-S228P antibodies are expected to block the function of target antigens without engaging any effector cells.

[0222] In Wettersten et al., Cancer Res. 79:5048 (2019), we reported that macrophage engagement is required for the antitumor activity of LM609, a murine monoclonal antibody that recognizes integrin αvβ3. Mechanistically, we determined that blocking all Fc receptors (CD16, CD32, and CD64) in vitro prevented LM609's ability to induce ADCC. However, because LM609 (and murine IgG1 antibodies) cannot bind CD64, LM609-induced macrophage ADCC is CD64-independent. While LM609 selectively engaged macrophages to induce potent antitumor activity, its inability to bind CD64 suggested that CD64 engagement was not critical.

[0223] Macrophages, which are phagocytes, are widely known to induce ADCC, which is generally understood to involve CD16 and CD32 engagement. As such, ADCC could be enhanced by isotype switching to IgG2, which has high affinity for CD32, which is primarily expressed in macrophages. However, the efficacy of such antibodies is limited by the expression of CD47 on tumor cells, a "don't eat me" signal. It has been less frequently reported that macrophages can also induce ADCC, and this activity has been linked to CD16. Therefore, it was unexpected that macrophage ADCC would be triggered by IgG4-CD64 interaction.

[0224] Antibodies for cancer therapy include several that recognize epithelial tumor cell antigens EGFR, Her2, and EpCAM. Engineering such antibodies can enhance ADCC by promoting NK cell engagement via antibody Fc binding to CD16. However, cancer treatment and progression can ultimately induce EMT, or enrichment of cancer stem cells, which involves not only the loss of epithelial markers but also the elimination or inactivation of NK cells and CD8+ T cells. Thus, late-stage, mesenchymal-like, stem-like tumors become refractory to epithelial-targeting monoclonal antibodies that utilize NK cells for tumor killing.

[0225] One hallmark of EMT in cancer is a switch in tumor immune content from immunologically hot to immunologically cold. While it is unclear whether they are the cause or effect of EMT, tumor-associated macrophages are highly immunosuppressive and act to eliminate T cells and NK cells, creating an immunologically cold tumor microenvironment. The advantages of the present invention are 1) the ability to recognize stem / mesenchymal markers (integrin αvβ3) on the tumor cell surface and 2) the ability to achieve "antigen-effector cell matching" to induce tumor cell death by engaging tumor-associated macrophages and inducing ADCC.

[0226] The foregoing is illustrative of the invention and is not to be construed as limiting thereof. The invention is defined by the following claims, along with equivalents of such claims which may be included. [References] Bracher, M., HJ Gould, BJ Sutton, D. Dombrowicz, and SN Karagiannis, Three-colour flow cytometric method to measure antibody-dependent tumor cell killing by cytotoxicity and phagocytosis. J Immunol Methods, 323(2): p. 160-71, 2007. Carter, P.J. and G.A. Lazar, Next generation antibody drugs: pursuit of the 'high-hanging fruit'. Nat Rev Drug Discov, 17(3): p. 197-223, 2018. Chao, M.P., I.L. Weissman, and R. Majeti, The CD47-SIRPalpha pathway in cancer immune evasion and potential therapeutic implications. Curr Opin Immunol, 24(2): p. 225-32, PMC3319521, 2012. Cheresh, D.A., Human endothelial cells synthesize and express an Arg-Gly-Asp-directed adhesion receptor involved in attachment to fibrinogen and von Willebrand factor. PNAS, 84(18): p. 6471-5, PMC299099, 1987. Chiavenna, S.M., J.P. Jaworski, and A. Vendrell, State of the art in anti-cancer mAbs. Journal of biomedical science, 24(1): p. 15-15, 2017. Chung, F.T., K.Y. Lee, C.W. Wang, C.C. Heh, Y.F. Chan, H.W. Chen, C.H. Kuo, P.H. Feng, T.Y. Lin, C.H. Wang, C.L. Chou, H.C. Chen, S.M. Lin, and H.P. Kuo, Tumor-associated macrophages correlate with response to epidermal growth factor receptor-tyrosine kinase inhibitors in advanced non-small cell lung cancer. Int J Cancer, 131(3): p. E227-35, 2012. Coussens, L.M. and Z. Werb, Inflammation and cancer. Nature, 420(6917): p. 860-7, 2002. Delbaldo, C., E. Raymond, K. Vera, L. Hammershaimb, K. Kaucic, S. Lozahic, M. Marty, and S. Faivre, Phase I and pharmacokinetic study of etaracizumab (Abegrin), a humanized monoclonal antibody against alphavbeta3 integrin receptor, in patients with advanced solid tumors. Invest New Drugs, 26(1): p. 35-43, 2008. Desgrosellier, J.S., L.A. Barnes, D.J. Shields, M. Huang, S.K. Lau, N. Prevost, D. Tarin, S.J. Shattil, and D.A. Cheresh, An integrin alpha(v)beta(3)-c-Src oncogenic unit promotes anchorage-independence and tumor progression. Nat Med, 15(10): p. 1163-9, PMC2759406, 2009. Dongre, A. and R.A. Weinberg, New insights into the mechanisms of epithelial-mesenchymal transition and implications for cancer. Nature Reviews Molecular Cell Biology, 20(2): p. 69-84, 2019. Gasser, M. and A.M. Waaga-Gasser, Therapeutic Antibodies in Cancer Therapy. Adv Exp Med Biol, 917: p. 95-120, 2016. Gutheil, J.C., T.N. Campbell, P.R. Pierce, J.D. Watkins, W.D. Huse, D.J. Bodkin, and D.A. Cheresh, Targeted antiangiogenic therapy for cancer using Vitaxin: a humanized monoclonal antibody to the integrin alphavbeta3. Clin Cancer Res, 6(8): p. 3056-61, 2000. Kaneda, MM, KS Messer, N Ralainirina, H Li, Leem CJ, Gorjestani S, Woo G, Nguyen AV, Figueiredo CC, Foubert P, Schmid MC, Pink M, Winkler DG, Rausch M, Palombella VJ, Kutok J, McGovern K, Frazer KA, Wu X, Karin M, View Article PubMed Google Scholar Sasik, R. Sasik, EE Cohen, and JA Varner, PI3Kgamma: A molecular switch that controls immune suppression. Nature, 539(7629): p. 437–442 , PMC5479689 , 2016 . Karacosta, LG, B. Anchang, N. Ignatiadis, SC Kimmey, JA Benson, JB Shrager, R Tibshirani, SC Bendall, and SK Plevritis, Mapping lung cancer epithelial-mesenchymal transition states and trajectories with single-cell resolution. Common Nat, 10(1): p. 5587 , PMC6898514 , Lazar, G.A., W. Dang, S. Karki, O. Vafa, J.S. Peng, L. Hyun, C. Chan, H.S. Chung, A. Eivazi, S.C. Yoder, J. Vielmetter, D.F. Carmichael, R.J. Hayes, and B.I. Dahiyat, Engineered antibody Fc variants with enhanced effector function. Proceedings of the National Academy of Sciences of the United States of America, 103(11): p. 4005-4010, 2006. Li, B., L. Xu, C. Pi, Y. Yin, K. Xie, F. Tao, R. Li, H. Gu, and J. Fang, CD89-mediated recruitment of macrophages via a bispecific antibody enhances anti-tumor efficacy. Oncoimmunology, 7(1): p. e1380142-e1380142, 2017. Listinsky, J.J., G.P. Siegal, and C.M. Listinsky, Glycoengineering in cancer therapeutics: a review with fucose-depleted trastuzumab as the model. Anticancer Drugs, 24(3): p. 219-27, 2013. Marie-Egyptienne, D.T., I. Lohse, and R.P. Hill, Cancer stem cells, the epithelial to mesenchymal transition (EMT) and radioresistance: Potential role of hypoxia. Cancer Letters, 341(1): p. 63-72, 2013. Pathria, P., T.L. Louis, and J.A. Varner, Targeting Tumor-Associated Macrophages in Cancer. Trends Immunol, 40(4): p. 310-327, 2019. Rader, C., Bispecific antibodies in cancer immunotherapy. Curr Opin Biotechnol, 65: p. 9-16, 2020. Reddy, M.P., C.A. Kinney, M.A. Chaikin, A. Payne, J. Fishman-Lobell, P. Tsui, P.R. Dal Monte, M.L. Doyle, M.R. Brigham-Burke, D. Anderson, M. Reff, R. Newman, N. Hanna, R.W. Sweet, and A. Truneh, Elimination of Fc receptor-dependent effector functions of a modified IgG4 monoclonal antibody to human CD4. J Immunol, 164(4): p. 1925-33, 2000. Richards, J.O., S. Karki, G.A. Lazar, H. Chen, W. Dang, and J.R. Desjarlais, Optimization of antibody binding to FcgammaRIIa enhances macrophage phagocytosis of tumor cells. Mol Cancer Ther, 7(8): p. 2517-27, 2008. Ruffell, B. and L.M. Coussens, Macrophages and therapeutic resistance in cancer. Cancer Cell, 27(4): p. 462-72, PMC4400235, 2015. Saxena, A. and D. Wu, Advances in Therapeutic Fc Engineering - Modulation of IgG-Associated Effector Functions and Serum Half-life. Frontiers in immunology, 7: p. 580-580, 2016. Seguin, L., S. Kato, A. Franovic, M.F. Camargo, J. Lesperance, K.C. Elliott, M. Yebra, A. Mielgo, A.M. Lowy, H. Husain, T. Cascone, L. Diao, J. Wang, Wistuba, II, J.V. Heymach, S.M. Lippman, J.S. Desgrosellier, S. Anand, S.M. Weis, and D.A. Cheresh, An integrin beta(3)-KRAS-RalB complex drives tumour stemness and resistance to EGFR inhibition. Nat Cell Biol, 16(5): p. 457-68, PMC4105198, 2014a. Seguin, L., S. Kato, A. Franovic, M.F. Camargo, J. Lesperance, K.C. Elliott, M. Yebra, A. Mielgo, A.M. Lowy, H. Husain, T. Cascone, L. Diao, J. Wang, I.I. Wistuba, J.V. Heymach, S.M. Lippman, J.S. Desgrosellier, S. Anand, S.M. Weis, and D.A. Cheresh, An integrin beta(3)-KRAS-RalB complex drives tumour stemness and resistance to EGFR inhibition. Nat Cell Biol, 16(5): p. 457-68, PMC4105198, 2014b. Singh, A. and J. Settleman, EMT, cancer stem cells and drug resistance: an emerging axis of evil in the war on cancer. Oncogene, 29(34): p. 4741-4751, 2010. Ye, X., W.L. Tam, T. Shibue, Y. Kaygusuz, F. Reinhardt, E. Ng Eaton, and R.A. Weinberg, Distinct EMT programs control normal mammary stem cells and tumour-initiating cells. Nature, advance online publication, 2015. Yu, X., M.J.E. Marshall, M.S. Cragg, and M. Crispin, Improving Antibody-Based Cancer Therapeutics Through Glycan Engineering. BioDrugs, 31(3): p. 151-166, 2017.

[0227] [Array] hLM609-hIgG4-S228P (humanized LM609) Heavy chain (SEQ ID NO: 1) QVQLVESGGG VVQPGRSLRL SCAASGFTFS SYDMSWVRQA PGKGLEWVAK VSSGGGSTYY 60 LDTVQGRFTI SRDNSKNTLY LQMNSLRAED TAVYYCARHL HGSFASWGQG TTVTVSSAST 120 KGPSVFPLAP CSRSTSESTA ALGCLVKDYF PEPVTVSWNS GALTSGVHTF PAVLQSSGLY 180 SLSSVVTVPS SSLGTKTYTC NVDHKPSNTK VDKRVESKYG PPCPPCPAPE FLGGPSVFLF 240 PPKPKDTLMI SRTPEVTCVV VDVSQEDPEV QFNWYVDGVE VHNAKTKPRE EQFNSTYRVV 300 SVLTVLHQDW LNGKEYKCKV SNKGLPSSIE KTISKAKGQP REPQVYTLPP SQEEMTKNQV 360 SLTCLVKGFY PSDIAVEWES NGQPENNYKT TPPVLDSDGS FFLYSRLTVD KSRWQEGNVF 420 SCSVMHEALH NHYTQKSLSL SLGK 444 Light chain (SEQ ID NO: 2) EIVLTQSPAT LSLSPGERAT LSCQASQSIS NFLHWYQQRP GQAPRLLIRY RSQSISGIPA 60 RFSGSGSGTD FTLTISSLEP EDFAVYYCQQ SGSWPLTFGG GTKVEIKRTV AAPSVFIFPP 120 SDEQLKSGTA SVVCLLNNFY PREAKVQWKV DNALQSGNSQ ESVTEQDSKD STYSLSSTLT 180 LSKADYEKHK VYACEVTHQG LSSPVTKSFN RGEC 214 Fab domain of the heavy chain (SEQ ID NO: 3) QVQLVESGGG VVQPGRSLRL SCAASGFTFS SYDMSWVRQA PGKGLEWVAK VSSGGGSTYY 60 LDTVQGRFTI SRDNSKNTLY LQMNSLRAED TAVYYCARHL HGSFASWGQG TTVTVSSAST 120 KGPSVFPLAP CSRSTSESTA ALGCLVKDYF PEPVTVSWNS GALTSGVHTF PAVLQSSGLY 180 SLSSVVTVPS SSLGTKTYTC NVDHKPSNTK VDKRV 215 Fc and hinge domain of the heavy chain (SEQ ID NO: 4) ESKYGPPCPP CPAPEFLGGP SVFLFPPKPK DTLMISRTPE VTCVVVDVSQ EDPEVQFNWY 60 VDGVEVHNAK TKPREEQFNS TYRVVSVLTV LHQDWLNGKE YKCKVSNKGL PSSIEKTISK 120 AKGQPREPQV YTLPSQEEM TKNQVSLTCL VKGFYPSDIA VEWESNGQPE NNYKTTPPVL 180 DSDGSFFLYS RLTVDKSRWQ EGNVFSCSVM HEALHNHYTQ KSLSLSLGK 229 shLM609-hIgG1-WT (Super humanized LM609_7) Fab domain of the heavy chain (SEQ ID NO: 5) QVQLQESGPG LVKPSQTLSL TCTVSGASIS RGGYYWSWIR QYPGKGLEWI GYIHSHSGST 60 YYNPSLKSRV TIAIDTSKNQ LSLRLTSVTA ADTAVYYCAR HNYGSFAYWG QGTLVTVSSA 120 STKGPSVFPL APSSKSTSGG TAALGCLVKD YFPEPVTVSW NSGALTSGVH TFPAVLQSSG 180 LYSLSSVVTV PSSSLGTQTY ICNVNHKPSN TKVDKKV 217 Light chain (SEQ ID NO: 6) ELVMTQSPEF QSVTPKETVT ITCRASQDIG NSLHWYQQKP GQSPKLLIKY ASQPVFGVPS 60 RFRGSGSGTD FTLTISRLEP EDFAVYYCQQ SNSWPHTFGQ GTKLEIKRTV AAPSVFIFPP 120 SDEQLKSGTA SVVCLLNNFY PREAKVQWKV DNALQSGNSQ ESVTEQDSKD STYSLSSTLT 180 LSKADYEKHK VYACEVTHQG LSSPVTKSFN RGEC 214 shLM609-hIgG1-WT (super humanized JC7U) Fab domain of the heavy chain (SEQ ID NO: 7) QVQLQESGPG LVKPSQTLSL TCTVSGASIS RGGYRWSWIR QYPGKGLEWI GYIHSHSGST 60 YYNPSLKSRV TIAIDTSKNQ LSLRLTSVTA ADTAVYYCAR QNLGSFAYWG QGTLVTVSSA 120 STKGPSVFPL APSSKSTSGG TAALGCLVKD YFPEPVTVSW NSGALTSGVH TFPAVLQSSG 180 LYSLSSVVTV PSSSLGTQTY ICNVNHKPSN TKVDKKV 217 Light chain (SEQ ID NO: 8) ELVMTQSPEF QSVTPKETVT ITCRASQDIG NSLHWYQQKP GQSPKLLIKY ASQPVFGVPS 60 RFRGSGSGTD FTLTISRLEP EDFAVYYCQQ SQFWPHTFGQ GTKLEIKRTV AAPSVFIFPP 120 SDEQLKSGTA SVVCLLNNFY PREAKVQWKV DNALQSGNSQ ESVTEQDSKD STYSLSSTLT 180 LSKADYEKHK VYACEVTHQG LSSPVTKSFN RGEC 214 hLM609-hIgG1-WT (humanized LM609) Heavy chain (SEQ ID NO: 9) QVQLVESGGG VVQPGRSLRL SCAASGFTFS SYDMSWVRQA PGKGLEWVAKVSSGGGSTYY 60 LDTVQGRFTI SRDNSKNTLY LQMNSLRAED TAVYYCARHL HGSFASWGQG TTVTVSSAST 120 KGPSVFPLAP SSKSTSGGTA ALGCLVKDYF PEPVTVSWNS GALTSGVHTF PAVLQSSGLY 180 SLSSVVTVPS SSLGTQTYIC NVNHKPSNTK VDKRVEPKSC DKTHTCPPCP APELLGGPSV 240 FLFPPKPKDT LMISRTPEVT CVVVDVSHED PEVKFNWYVD GVEVHNAKTK PREEQYNSTY 300 RVVSVLTVLH QDWLNGKEYK CKVSNKALPA PIEKTISKAK GQPREPQVYT LPPSREEMTK 360 NQVSLTCLVK GFYPSDIAVE WESNGQPENN YKTTPPVLDS DGSFFLYSKL TVDKSRWQQG 420 NVFSCSVMHE ALHNHYTQKS LSLSPGK 447 Light chain (SEQ ID NO: 10) EIVLTQSPAT LSLSPGERAT LSCQASQSIS NFLHWYQQRP GQAPRLLIRY RSQSISGIPA 60 RFSGSGSGTD FTLTISSLEP EDFAVYYCQQ SGSWPLTFGG GTKVEIKRTV AAPSVFIFPP 120 SDEQLKSGTA SVVCLLNNFY PREAKVQWKV DNALQSGNSQ ESVTEQDSKD STYSLSSTLT 180 LSKADYEKHK VYACEVTHQG LSSPVTKSFN RGEC 214 mAb LM609-mIgG1-kappa Heavy chain (SEQ ID NO: 11) MNFGLRLIFL VLTLKGVKCE VQLVESGGGL VKPGGSLKLS CAASGFAFSS YDMSWVRQIP 60 EKRLEWVAKV SSGGGSTYYL DTVQGRFTIS RDNAKNTLYL QMSSLNSEDT AMYYCARHNY 120 GSFAYWGQGT LVTVSAAKTT PPSVYPLAPG SAAQTNSMVT LGCLVKGYFP EPVTVTWNSG 180 SLSSGVHTFP AVLQSDLYTL SSSVTVPSST WPSETVTCNV AHPASSTKVD KKIVPRDCGC ​​240 KPCICTVPEV SSVFIFPPKP KDVLTITLTP KVTCVVVDIS KDDPEVQFSW FVDDVEVHTA 300 QTQPREEQFN STFRSVSELP IMHQDWLNGK EFKCRVNSAA FPAPIEKTIS KTKGRPKAPQ 360 VYTIPPPKEQ MAKDKVSLTC MITDFFPEDI TVEWQWNGQP AENYKNTQPI MDTDGSYFVY 420 SKLNVQKSNW EAGNTFTCSV LHEGLHNHHT EKSLSHSPGK 460 Light chain (SEQ ID NO: 12) MVFTPQILGL MLFWISASRG DIVLTQSPAT LSVTPGDSVS LSCRASQSIS NHLHWYQQKS 60 HESPRLLIKY ASQSISGIPS RFSGSGSGTD FTLSINSVET EDFGMYFCQQ SNSWPHTFGG 120 GTKLEIKRAD AAPTVSIFPP SSEQLTSGGA SVVCFLNNFY PKDINVKWKI DGSERQNGVL 180 NSWTDQDSKD STYSMSSTLT LTKDEYERHN SYTCEATHKT STSPIVKSFN RNEC 234 hLM609-hIgG4-S228P (humanized LM609) Heavy chain coding sequence (SEQ ID NO: 13) Light chain coding sequence (SEQ ID NO: 14) gcggccgccatgaattttggactgaggctgattttcctggtgctgaccctgaaaggcgtccagtgtgagatcgtcctcacccaatcgccggcgacgctgagcctctctcccggagagcgggcgaccttgagctgccaagcgagccaatcaatctccaatttcttgcactggtatcaacaa aggccgggacaagcaccgaggctgctgataagatataggagccaatcgatctccgggatacccgcacgatttagcggaagcggatcgggcaccgattttacgctaacgatttcgagcctggagccggaggactttgcggtctattactgccaacaatcgggaagctggccgctgacatttg gaggaggtaccaaggtcgagatcaagcgtacggtcgcggcgccttctgtgttcattttccccccatctgatgaacagctgaaatctggcactgcttctgtggtctgtctgctgaacaacttctaccctagagaggccaaagtccagtggaaagtggacaatgctctgcagagtgggaattc ccaggaatctgtcactgagcaggactctaaggatagcacatactccctgtcctctactctgacactgagcaaggctgattacgagaaacacaaagtgtacgcctgtgaagtcacacatcaggggctgtctagtcctgtgaccaaatccttcaataggggagagtgctgatagtaaaagctt hLM609-hIgG1-WT (humanized LM609) Heavy chain coding sequence (SEQ ID NO: 15)

Claims

1. 1. A chimeric binding agent comprising a first domain that specifically binds to integrin αvβ3 on epithelial cancer cells that express at least one mesenchymal cell marker, and a second domain that mediates antibody-dependent cellular cytotoxicity (ADCC) by engaging macrophages that accumulate in mesenchymal tumors, The first domain comprises the amino acid sequence of the light chain of hLM609-hIgG4-S228P (SEQ ID NO: 2) and the amino acid sequence of the Fab portion of the heavy chain of hLM609-hIgG4-S228P (SEQ ID NO: 3); and the second domain comprises the amino acid sequence of the heavy chain Fc domain and hinge domain of hLM609-hIgG4-S228P (SEQ ID NO: 4) or a sequence at least 90% identical thereto, and comprises a S228P mutation (Eu numbering system) in the hinge domain; Chimeric binding agents.

2. The chimeric binding agent of claim 1 , wherein the first domain further specifically binds to a second antigen.

3. The chimeric binding agent of claim 2 , wherein the first domain is a bispecific antibody domain.

4. The chimeric binding agent of claim 2 or 3, wherein the second antigen is an immune checkpoint molecule.

5. The chimeric binding substance described in claim 4, wherein the immune checkpoint molecule is PD-1, PD-L1 or CTLA-4.

6. The chimeric binding agent of claim 2 or 3, wherein the second antigen is a cancer stem cell marker or an effector cell antigen.

7. The chimeric binding substance described in claim 6, wherein the cancer stem cell marker is CD133, CD44, CD90, CD117, CD166 or CD105.

8. The chimeric binding agent of claim 2 or 3, wherein the second antigen is an effector cell antigen.

9. The chimeric binding agent of any one of claims 1 to 8, wherein the second domain does not significantly engage natural killer cells.

10. The chimeric binding agent of any one of claims 1 to 9, wherein the second domain does not significantly engage lymphocytes.

11. The chimeric binding agent of any one of claims 1 to 10, wherein the second domain specifically binds to a protein on the surface of a bone marrow-derived cell.

12. The chimeric binding agent of claim 11 , wherein the second domain specifically binds to an Fc gamma receptor.

13. The chimeric binding agent of claim 12 , wherein the second domain specifically binds to Fc gamma receptor I (FcγRI, CD64).

14. The amino acid sequence a) S239D / A330L / I332E; b) I332E; c) G236A / S239D / I332E; d) G236A; e) N297A / E382V / M428I; f) M252Y / S254T / T256E; g) Q295R / L328W / A330V / P331A / I332Y / E382V / M428I; h) L234A / L235A / P329G; i) M428L / N434S; j) L234A / L235A / P331S; k) L234A / L235A / P329G / M252Y / S254T / T256E; l) S298A / E333A / K334 / A; m) S239D / I332E; n) G236A / S239D / A330L / I332E; o) S239D / I332E / G236A; p) L234Y / G236W / S298A; q) F243L / R292P / Y300L / V305I / P396L; r) K326W / E333S; s) K326A / E333A; t) K326M / E333S; u) C221D / D222C; v) S267E / H268F / S324W; w) H268F / S324W; x) E345R y) R435H; z) N434A; aa) M252Y / S254T / T256E; ab) M428L / N434S; ac) T252L / T / 253S / T254F; ad) E294delta / T307P / N434Y; ae) T256N / A378V / S383N / N434Y; af) E294delta ag) L235E; ah) L234A / L235A; ai) S228P / L235E; aj) P331S / L234E / L225F; ak) D265A; al) G237A; am) E318A; an) E233P; ao) G236R / L328R; ap) H268Q / V309L / A330S / P331S; aq) L234A / L235A / G237A / P238S / H268A / A330S / P331S; ar) A330L; as) D270A; at) K322A; au) P329A; av) P331A; aw) V264A; ax) F241A; ay) N297A or G or N az) S228P / F234A / L235A; or ba) any combination of a) to az) 14. The chimeric binding agent of any one of claims 1 to 13, comprising a mutation selected from (according to the Eu numbering system):

15. A polynucleotide encoding the chimeric binding agent of any one of claims 1 to 14.

16. A vector comprising the polynucleotide of claim 15.

17. A host cell comprising the polynucleotide of claim 15 or the vector of claim 16.

18. A pharmaceutical composition comprising the chimeric binding agent of any one of claims 1 to 14 and a pharmaceutically acceptable carrier.

19. 20. The pharmaceutical composition of claim 18, further comprising an additional therapeutic agent.

20. 20. The pharmaceutical composition of claim 19, wherein the additional therapeutic agent is a chemotherapeutic agent.

21. The pharmaceutical composition of any one of claims 18 to 20 for treating a cancer that expresses integrin αvβ3 in a subject in need thereof.

22. The pharmaceutical composition of any one of claims 18 to 20 for treating epithelial cell cancer in a subject in need thereof.

23. 21. The pharmaceutical composition of any one of claims 18 to 20 for treating cancer in a subject in need thereof, wherein the pharmaceutical composition is administered to a subject having cancer cells that are enriched for integrin αvβ3 and enriched for macrophages.

24. 21. The pharmaceutical composition of any one of claims 18 to 20 for treating epithelial cell cancer in a subject in need thereof, wherein the pharmaceutical composition is administered to a subject having epithelial cancer cells that are enriched for integrin αvβ3 and for macrophages that accumulate in mesenchymal tumors.

25. 25. The pharmaceutical composition of claim 24, wherein the epithelial cell cancer is a late stage epithelial cell cancer.

26. 25. The pharmaceutical composition of claim 24, wherein one or more of the epithelial cells in the cancer have at least partially transformed into mesenchymal cells.

27. The pharmaceutical composition of any one of claims 24 to 26, wherein the epithelial cell cancer is or is becoming chemotherapy-resistant or refractory.

28. The pharmaceutical composition of any one of claims 21 to 27, wherein the cancer is carcinoma.

29. The pharmaceutical composition of claim 28, wherein the cancer is cancer of the gastrointestinal tract, breast, lung, colon, prostate or bladder.

30. The pharmaceutical composition described in claim 29, wherein the lung cancer is non-small cell lung cancer.

31. The pharmaceutical composition of any one of claims 21 to 30, wherein the subject is further administered a CD47 blocking agent and / or an immune checkpoint inhibitor and / or an EGFR inhibitor.

32. The pharmaceutical composition of any one of claims 21 to 30, wherein the subject has not been administered a CD47 blocking agent.

33. The pharmaceutical composition of any one of claims 22 or 24 to 27, wherein the epithelial cell cancer expresses CD47.

34. The pharmaceutical composition of any one of claims 22 or 24 to 27, wherein the epithelial cell cancer does not express CD47.

35. The pharmaceutical composition of any one of claims 21 to 34, wherein the subject is further administered or is undergoing an additional cancer therapeutic agent or treatment.

36. 36. The pharmaceutical composition of any one of claims 21 to 35, wherein the pharmaceutical composition is administered to the subject intravenously, subcutaneously, or intramuscularly, or injected into or near a cancer in situ.

37. 37. The pharmaceutical composition of any one of claims 21 to 36, further comprising the steps of isolating macrophages from the subject, contacting them with the pharmaceutical composition, and administering the contacted macrophages to the subject.

38. The pharmaceutical composition of any one of claims 21 to 37, wherein the subject is a human.

39. An antibody-drug conjugate comprising a chimeric binding substance according to any one of claims 1 to 14.

40. A kit comprising a chimeric binding substance according to any one of claims 1 to 14.

Images