Method for producing monodisperse emulsions

The PTE method generates monodisperse emulsions using monodisperse particles to template droplet formation, overcoming the need for microfluidic systems and enabling efficient encapsulation and analysis of target particles like cells and nucleic acids.

JP7819159B2Active Publication Date: 2026-02-24RGT UNIV OF CALIFORNIA
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2023131745
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2017-09-29
Filing Date
2023-08-14
Publication Date
2026-02-24
Estimated Expiration
2038-09-28

AI Technical Summary

Technical Problem

The inability of researchers to readily translate advances in droplet microfluidics to generate monodisperse emulsions hinders the realization of new and useful droplet technologies due to the requirement of advanced microfluidic systems.

Method used

A particle-templated emulsification (PTE) method that uses monodisperse particles to template droplet formation without microfluidic devices, involving the combination of target particles with a first fluid, a second immiscible fluid, and shearing to encapsulate template particles into monodisperse droplets.

Benefits of technology

Enables the generation of monodisperse emulsions for encapsulating target particles like cells, viruses, and nucleic acids, facilitating downstream detection, sorting, and analysis without the need for microfluidic control, and supports applications such as nucleic acid amplification and sequencing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000073_0000
    Figure 00000073_0000
  • Figure 00000074_0000
    Figure 00000074_0000
  • Figure 00000074_0001
    Figure 00000074_0001
Patent Text Reader

Abstract

To provide an improved approach for generating a monodisperse emulsion that encapsulates target particles of interest without requiring the use of a microfluidic device.SOLUTION: A method described herein is referred to as particle-templated emulsification (PTE). Monodisperse droplets may be effectively obtained by using monodisperse particles to template the formation of droplets, without destroying the integrity of the droplets. The droplets can include, e.g., monodisperse single-emulsion droplets, multiple-emulsion droplets, or Giant Unilamellar Vesicles (GUV).SELECTED DRAWING: Figure 3
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] cross reference This application claims the benefit of U.S. Provisional Patent Application No. 62 / 565,976, filed September 29, 2017, which is incorporated herein by reference in its entirety.

[0002] government support This invention was made with government support under Grant Nos. AR068129, R01 EB019453, and R21 HG007233 awarded by the National Institutes of Health; Grant No. HR0011-12-C-0065 awarded by the Defense Advanced Research Projects Agency; and Grant No. DBI1253293 awarded by the National Science Foundation. The government has certain rights in this invention. [Background technology]

[0003] Introduction Droplet microfluidics advances laboratory automation by reducing reaction volumes to picoliters and increasing processing speeds to kilohertz. Microfluidic devices form, process, and sort droplets suspended in a carrier fluid; each droplet provides an isolated "test tube" in which a reaction can occur. The throughput of this approach, combined with very low reagent consumption, offers unprecedented possibilities for a new era of high-throughput science. Furthermore, compartmentalization of monodisperse droplets is a versatile approach for applications across biology. However, the generic requirements of microfluidics for droplet encapsulation present a significant barrier for most researchers, who rarely have access to advanced microfluidic systems. The inability to readily translate advances in droplet microfluidics to researchers hinders the realization of new and useful droplet technologies. The present disclosure addresses the above problems and provides related advantages. Summary of the Invention

[0004] The method described herein, termed particle-templated emulsification (PTE), provides an improved approach for generating monodisperse emulsions that encapsulate target particles of interest without requiring the use of microfluidic devices. This disclosure is based, in part, on the surprising discovery that monodisperse droplets can be effectively obtained without destroying droplet integrity by using monodisperse particles to template droplet formation. The droplets can include, for example, monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, or giant unilamellar vesicles (GUVs) (also referred to herein as liposomes).

[0005] In exemplary embodiments, a disclosed method for generating a monodisperse emulsion includes combining a plurality of monodisperse template particles with a first fluid containing a plurality of target particles to provide a first mixture; combining the first mixture with a second fluid immiscible with the first fluid to provide a second mixture; and shearing the second mixture to encapsulate the plurality of monodisperse template particles into a plurality of monodisperse droplets in the second fluid, thereby providing a plurality of monodisperse droplets containing the first fluid, one of the monodisperse template particles, and one of the plurality of target particles. The generation of monodisperse emulsions described herein can be performed without microfluidic control.

[0006] In some embodiments, target particles may comprise heterogeneous populations of cells, viruses, and / or nucleic acids. In some embodiments, target particles may be diluted prior to encapsulation, e.g., to encapsulate a controlled number of cells, viruses, and / or nucleic acids into monodisperse droplets. Nucleic acid synthesis reagents, e.g., isothermal nucleic acid amplification reagents, non-specific nucleic acid amplification reagents (e.g., MDA reagents), and / or PCR reagents, may be co-encapsulated into monodisperse droplets, e.g., with one or more target particles, or may be added to the monodisperse droplets later using one or more of the methods described herein to facilitate downstream detection, sorting, and / or analysis as described herein.

[0007] The multiphase emulsion droplets described herein can be formed, for example, by combining a first fluid containing a plurality of target particles, e.g., cells, viruses, and / or nucleic acids, with a plurality of monodisperse template particles, along with nucleic acid synthesis reagents, to provide a first mixture; combining the first mixture with a second fluid immiscible with the first fluid to provide a second mixture; shearing the second mixture to encapsulate the plurality of monodisperse template particles into a plurality of monodisperse droplets in the second fluid, thereby providing a plurality of monodisperse droplets containing the first fluid, one of the monodisperse template particles, and one of the plurality of target particles; combining the second mixture with a third fluid immiscible with the second fluid; and shearing the third mixture to encapsulate one or more of the monodisperse droplets, with or without the monodisperse template particles, into one or more droplets in the third fluid to provide one or more two-phase emulsion droplets. In some embodiments, the third fluid is immiscible with the first and second fluids.

[0008] GUVs can be generated from multiple emulsion droplets (e.g., two-phase emulsion droplets) by dewetting the multiple emulsion droplets, where a second fluid is expelled, leaving behind a surfactant film with small droplets of the second fluid attached to the exterior of the surfactant film.

[0009] Monodisperse template particles for use in the methods described herein can be generated, for example, by flowing a first fluid, such as a liquid gel precursor, into a channel of a microfluidic device and contacting the first fluid with a second fluid that is immiscible with the first fluid, for example, using a single-phase emulsion droplet generator. In some embodiments, parallel droplet generation techniques including stage splitting and distribution plates can be used to more rapidly form monodisperse template particles. The monodisperse single-phase emulsion droplets are then solidified by inducing gelation, for example, by polymerizing or crosslinking the gel matrix within the droplets. In some embodiments, surfactants can be used to prevent contacting monodisperse template particles from coalescing with each other. One or more steps of the method for generating monodisperse template particles can be performed under microfluidic control.

[0010] In some embodiments, a sample containing target particles, e.g., cells, is encapsulated in monodisperse single-emulsion droplets prepared as described herein or multiple emulsion droplets or GUVs prepared as described herein and subjected to isothermal nucleic acid amplification conditions and / or nucleic acid amplification conditions described herein. In some embodiments, the encapsulated cells are subjected to one or more cell lysis techniques, such as proteinase K digestion or thermal lysis. An isothermal nucleic acid amplification assay or nucleic acid amplification assay specific for the cells of interest can trigger the monodisperse single-emulsion droplets prepared as described herein or multiple emulsion droplets or GUVs prepared as described herein containing the cells of interest, or nucleic acids derived from the cells of interest, to be detectably labeled, e.g., fluorescently labeled. The monodisperse single-emulsion droplets or multiple emulsion droplets or GUVs can then be sorted and their contents recovered, e.g., via droplet rupture by chemical or electrical means, thereby recovering the cells and / or cellular nucleic acids. The above steps may be followed by one or more sequencing steps, for example one or more next generation sequencing techniques.

[0011] Additional amplification reactions that can be performed with monodisperse single-phase emulsion droplets prepared as described herein or multiple-phase emulsion droplets or GUVs prepared as described herein include, for example, strand displacement amplification (SDA) and rolling circle amplification (RCA).

[0012] In one embodiment, a method of enriching a target nucleic acid sequence is provided, the method comprising: encapsulating a plurality of target particles comprising nucleic acids into a plurality of monodisperse single emulsion droplets prepared as described herein or multiple emulsion droplets or GUVs prepared as described herein; introducing multiple displacement amplification (MDA) reagents, polymerase chain reaction (PCR) reagents, and / or other nucleic acid compounds, e.g., amplification reagents including suitable primers, into the single emulsion droplets or multiple emulsion droplets or GUVs; incubating the monodisperse single emulsion droplets or multiple emulsion droplets or GUVs under conditions sufficient for PCR amplification, or conditions sufficient for MDA amplification followed by PCR amplification, to generate PCR amplification products (wherein the suitable PCR primers may include one or more primers that hybridize to one or more oligonucleotides that incorporate the target nucleic acid sequence, and wherein the PCR amplification products do not include the entire target nucleic acid sequence); introducing a detection component into the monodisperse single emulsion droplets or multiple emulsion droplets or GUVs either before or after incubation; detecting the presence or absence of PCR amplification products by detecting the detection component (wherein detection of the detection component indicates the presence of the PCR amplification products and the target nucleic acid sequences); and sorting the monodisperse single emulsion droplets or multiple emulsion droplets or GUVs based on detection of the detection component (wherein sorting separates monodisperse single emulsion droplets or multiple emulsion droplets or GUVs that contain the PCR amplification products and the target nucleic acid sequences, if present, from monodisperse single emulsion droplets or multiple emulsion droplets or GUVs that do not contain the PCR amplification products and the target nucleic acid sequences, if present); and pooling nucleic acid sequences from the sorted monodisperse single emulsion droplets or multiple emulsion droplets or GUVs, to provide an enriched pool of target nucleic acid sequences, if present.The above steps may be followed by one or more sequencing steps, for example one or more next generation sequencing techniques.

[0013] As used herein, the term "next-generation sequencing" generally refers to an advancement over standard DNA sequencing (e.g., Sanger sequencing). While standard DNA sequencing allows those skilled in the art to determine the exact order of nucleotides in a DNA sequence, next-generation sequencing also provides parallel sequencing, during which millions of base-pair fragments of DNA can be sequenced simultaneously. Standard DNA sequencing generally requires a single-stranded DNA template molecule, DNA primers, and DNA polymerase to amplify the DNA template molecule. Next-generation sequencing facilitates high-throughput sequencing, which makes it possible to sequence an entire genome in a significantly shorter time than standard DNA sequencing. Next-generation sequencing can also facilitate the identification of disease-causing mutations for the diagnosis of pathological conditions. Next-generation sequencing can also provide information about a sample's entire transcriptome in a single analysis, without requiring prior knowledge of the gene sequence.

[0014] Any suitable non-specific nucleic acid amplification method and reagent, such as MDA method and reagent, may be used with the disclosed method, provided that such method and reagent are compatible with any additional, e.g., subsequent, amplification steps and / or reagents of the method, such as PCR amplification steps and reagents. An example of a suitable MDA polymerase that can be used in combination with Taq DNA polymerase is Bst polymerase. Bst polymerase may be advantageous over other MDA polymerases, such as phi29 polymerase, because Bst polymerase is effective over a wider temperature range and is active under similar buffer conditions to Taq DNA polymerase.

[0015] A wide variety of different PCR-based assays, such as quantitative PCR (qPCR) and digital droplet PCR, can be used in practicing the subject methods. The number and nature of primers used in such assays can vary, at least in part, based on the type of assay being performed, the nature of the biological sample, and / or other factors. In certain embodiments, the number of primers that can be added to monodisperse droplets, e.g., monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, or GUVs, can range from 1 to 100 or more and / or can include primers for detecting about 1 to 100 or more different genes (e.g., oncogenes). In addition to or instead of such primers, one or more probes (e.g., TaqMan® probes) can be used in practicing the subject methods.

[0016] As used herein, the terms "drop" and "droplet" are used interchangeably to refer to extremely small, generally spherical microcompartments containing at least a first fluid, e.g., an aqueous phase (e.g., water), bounded by a second fluid (e.g., oil) that is immiscible with the first fluid. In some embodiments, the second fluid will be an immiscible phase carrier fluid. Droplets, including, for example, droplets of single and multiple emulsions, generally range in diameter or largest dimension from about 0.1 to about 1000 μm and can be used to encapsulate cells, DNA, enzymes, and other components. In some embodiments, droplets, e.g., droplets of single emulsions and multiple emulsions, have a diameter or maximum dimension of about 1.0 μm to about 1000 μm, inclusive, such as about 1.0 μm to about 750 μm, about 1.0 μm to about 500 μm, about 1.0 μm to about 250 μm, about 1.0 μm to about 200 μm, about 1.0 μm to about 150 μm, about 1.0 μm to about 100 μm, about 1.0 μm to about 10 μm, or about 1.0 μm to about 5 μm. In some embodiments, droplets, e.g., droplets of single emulsions and multiple emulsions, have a diameter or largest dimension of from about 10 μm to about 200 μm, e.g., from about 10 μm to about 150 μm, from about 10 μm to about 125 μm, or from about 10 μm to about 100 μm.

[0017] GUVs formed from binary emulsion droplets are generally similar in size to the original binary emulsion droplets. Accordingly, the GUVs described herein can range in diameter or largest dimension from about 0.1 to about 1000 μm. In some embodiments, the GUVs described herein have a diameter or largest dimension of about 1.0 μm to about 1000 μm, inclusive, such as about 1.0 μm to about 750 μm, about 1.0 μm to about 500 μm, about 1.0 μm to about 250 μm, about 1.0 μm to about 200 μm, about 1.0 μm to about 150 μm, about 1.0 μm to about 100 μm, about 1.0 μm to about 10 μm, or about 1.0 μm to about 5 μm. In some embodiments, the GUVs described herein have a diameter or largest dimension of about 10 μm to about 200 μm, e.g., about 10 μm to about 150 μm, about 10 μm to about 125 μm, or about 10 μm to about 100 μm.

[0018] The droplets, e.g., monodisperse single-phase emulsion droplets or multiple-phase emulsion droplets or GUVs, may themselves vary, including size, composition, content, etc. Monodisperse single-phase emulsion droplets or multiple-phase emulsion droplets or GUVs may generally have an internal volume of about 0.001 to 1000 picoliters or more, e.g., about 0.001 picoliters to about 0.01 picoliters, about 0.01 picoliters to about 0.1 picoliters, about 0.1 picoliters to about 1 picoliters, about 1 picoliters to about 10 picoliters, about 10 picoliters to about 100 picoliters, or about 100 picoliters to about 1000 picoliters or more. Furthermore, the droplets may or may not be stabilized with surfactants and / or particles.

[0019] The means by which reagents are added to droplets, e.g., monodisperse single emulsion droplets or multiple emulsion droplets or GUVs, can vary widely. Reagents may be added in one step or multiple steps, e.g., two or more steps, four or more steps, or ten or more steps. In certain aspects, reagents may be added to monodisperse single emulsion droplets or multiple emulsion droplets or GUVs via one or more encapsulation and rupture steps. For example, in some embodiments, the disclosed methods may include encapsulating a plurality of target particles, e.g., viruses, cells, or nucleic acids, into a first monodisperse droplet or GUV, encapsulating one or more reagents and the first monodisperse droplet or GUV into a second droplet or GUV, and rupturing the first monodisperse droplet or GUV, thereby contacting the plurality of target particles with one or more reagents.

[0020] In one such embodiment, monodisperse single-phase emulsion droplets prepared as described herein are used with an appropriate lysis buffer to encapsulate cells into two-phase emulsion droplets or GUVs, which are then incubated under conditions sufficient for cell lysis and / or protein digestion and heated to inactivate proteases. The two-phase emulsions or GUVs are then encapsulated in two-phase emulsions or GUVs containing appropriate nucleic acid synthesis reagents and ruptured to release their contents into the encapsulating two-phase emulsions or GUVs, thereby allowing the cell lysate to be mixed with the nucleic acid synthesis reagents. The remaining two-phase emulsions or GUVs may then be incubated under conditions suitable for nucleic acid amplification. Due to their combined hydrophilic and hydrophobic properties, two-phase emulsions or GUVs are widely applicable to drug delivery, including drug encapsulation and delivery; cosmetic applications, including cosmetic encapsulation; and biomedical research, including in vitro compartmentalization and bacterial strain isolation in synthetic biology via FACS-based two-phase emulsion sorting and membrane protein functional studies.

[0021] As a variation of the above method, cells may be encapsulated in a monodisperse single-phase emulsion using an appropriate lysis buffer. Following an optional protease inactivation step, the monodisperse single-phase emulsion may then be merged with a monodisperse single-phase emulsion containing appropriate nucleic acid synthesis reagents via droplet merging. The merged monodisperse single-phase emulsion droplets may then be encapsulated in a two-phase emulsion or GUVs for subsequent nucleic acid amplification. Alternatively, cells may be encapsulated in a single-phase emulsion using an appropriate lysis buffer, and then, following an optional protease inactivation step, encapsulated in a two-phase emulsion or GUVs containing nucleic acid amplification reagents. Note that the single-phase emulsion encapsulation step and the two-phase emulsion encapsulation step may be performed without using a microfluidic device.

[0022] As noted above, when monodisperse single-phase emulsion droplets are utilized as described herein, various techniques applicable to single-phase emulsion droplets can be utilized, including, for example, droplet coalescence, pico-injection, multiple-droplet coalescence, etc., as more fully described herein. In some embodiments, reagents are added by a method in which the injection fluid itself functions as an electrode. The injection fluid may contain one or more types of dissolved electrolytes that allow it to be used by itself. When the injection fluid itself functions as an electrode, it may be unnecessary to provide a metal electrode on the microfluidic chip for the purpose of adding reagents to the droplets. In some embodiments, the injection fluid does not function as an electrode, but one or more liquid electrodes are utilized instead of metal electrodes.

[0023] A variety of techniques can be used to detect the presence or absence of nucleic acid amplification products using a variety of different detection moieties. Detection moieties of interest include, but are not limited to, fluorescein and its derivatives; rhodamine and its derivatives; cyanine and its derivatives; coumarin and its derivatives; cascade blue and its derivatives; lucifer yellow and its derivatives; BODIPY and its derivatives. Exemplary fluorophores include indocarbocyanine (C3), indodicarbocyanine (C5), Cy3, Cy3.5, Cy5, Cy5.5, Cy7, Texas Red, Pacific Blue, Oregon Green 488, Alexa Fluor-355, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor-555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 670, Alexa Fluor 680, Alexa Fluor 690, Alexa Fluor 700, Alexa Fluor 710, Alexa Fluor 720, Alexa Fluor 730, Alexa Fluor 740, Alexa Fluor 750, Alexa Fluor 760, Alexa Fluor 770, Alexa Fluor 780, Alexa Fluor 790, Alexa Fluor 791, Alexa Fluor 792, Alexa Fluor 793, Alexa Fluor 794, Alexa Fluor 795, Alexa Fluor 796, Alexa Fluor 797, Alexa Fluor 798, Alexa Fluor 79 ... Examples of suitable dyes include 680, JOE, Lissamine, rhodamine green, BODIPY, fluorescein isothiocyanate (FITC), carboxyfluorescein (FAM), phycoerythrin, rhodamine, dichlororhodamine (dRhodamine), carboxytetramethylrhodamine (TAMRA), carboxy-X-rhodamine (ROX), LIZ, VIC, NED, PET, SYBR, PicoGreen, RiboGreen, and the like. Detection components may include beads (e.g., magnetic beads or fluorescent beads such as Luminex beads), and the like. In certain embodiments, detection involves holding monodisperse droplets in a fixed position during thermal cycling so that they can be repeatedly imaged. As described more fully herein, such repeated imaging may involve the use of megadroplet arrays. In certain embodiments, detection may involve fixing and / or permeabilizing one or more monodisperse droplets, e.g., monodisperse droplets of one or more multiple emulsions, or one or more cells in a GUV.

[0024] Suitable subjects for the methods disclosed herein include mammals, such as humans. The subject may exhibit a clinical manifestation of disease symptoms or may be a subject diagnosed with a disease. In certain embodiments, the subject may be a subject diagnosed with cancer, exhibiting a clinical manifestation of cancer, or determined to be at risk for developing cancer due to one or more factors, such as family history, environmental exposure, genetic mutation, lifestyle (e.g., diet and / or smoking), the presence of one or more other disease symptoms, etc. In certain embodiments, the subject may be a subject diagnosed with a microbial infection, exhibiting a clinical manifestation of microbial infection, or determined to be at risk for developing a microbial infection due to one or more factors, such as family history, environmental exposure, genetic mutation, lifestyle (e.g., diet and / or transportation), the presence of one or more other disease symptoms, etc. In certain embodiments, the subject may be a subject who has been diagnosed with a viral infection, who exhibits a clinical manifestation of a viral infection, or who is determined to be at risk for developing a viral infection due to one or more factors, such as family history, environmental exposure, genetic mutation, lifestyle (e.g., diet and / or travel), the presence of one or more other disease symptoms, etc.

[0025] Microfluidic devices used to generate monodisperse template particles for use in preparing monodisperse droplets include, but are not limited to, those described in U.S. Patent Application Publication No. 2015 / 0232942, the disclosure of which is incorporated herein by reference. In some embodiments, a microfluidic system including a nucleic acid amplification region and a detection region can be used in conjunction with processing / incubation and analysis of monodisperse droplets prepared as described herein. In some embodiments, the nucleic acid amplification region can include a thermal cycler. In some embodiments, the system includes a detection region that detects the presence or absence of reaction products from the nucleic acid amplification region and can be fluidically connected to the nucleic acid amplification region. In some embodiments, the system includes a means for adding a first reagent to the monodisperse single-phase emulsion droplets and / or a heating element. In some embodiments, the system includes a sorting region or a combination detection / sorting region fluidically connected to the nucleic acid amplification region. In some embodiments, sorting of monodisperse droplets can occur "off-chip" instead of, or in addition to, an "on-chip" sorting region. For example, in the case of a water-in-immiscible-in-aqueous two-phase emulsion, an off-chip flow cytometry device, such as a FACS device or a MACS device, can be utilized for sorting.

[0026] The invention can be best understood from the following detailed description when read in conjunction with the accompanying drawings, in which: [Brief explanation of the drawings]

[0027] [Figure 1] 1 shows a schematic of the microfluidic device used to generate particles for PTE. [Figure 2]1 is a schematic diagram illustrating a PTE monodisperse droplet generation workflow according to an embodiment of the present disclosure. Panel A shows combining a plurality of monodisperse template particles with a first fluid containing target particles to provide a first mixture. Panel B shows combining the first mixture with a second fluid immiscible with the first fluid to provide a second mixture. Panel C shows shearing the second mixture to encapsulate the monodisperse template particles into monodisperse droplets in the second fluid, thereby providing monodisperse droplets containing the first fluid, one of the monodisperse template particles, and one of the target particles. [Figure 3] Schematic diagram illustrating an embodiment of the PTE workflow shown in Figure 2. Panel A shows the addition of monodisperse polyacrylamide (PAA) beads to a PCR reaction mix. Panel B shows the capture of PCR reagents in the PAA beads. Panel C shows the removal of excess aqueous solution. Panel D shows the addition of oil containing a stabilizing surfactant, and Panel E shows the creation of an emulsion by vortexing. Panel F shows the amplification of one of multiple nucleic acid target particles within a monodisperse droplet and the detection of a fluorescent signal associated with the amplified product. [Figure 4] Images are provided comparing the monodispersity of droplet sizes generated by PTE compared to those generated using a microfluidic device. Panel A shows images of droplets generated without monodisperse template particles. Emulsions were generated by vortexing (left) or using a microfluidics device (right). Panel B shows monodisperse emulsions generated using PTE with different particle compositions and water-soluble surfactants. Panel C shows droplet size distributions from different emulsification methods. [Figure 5]Figure 1 provides images of droplets prepared under different PTE conditions described in Example 2. Panel A shows droplets prepared by vortexing PAA particles (without aqueous surfactant) for 20 minutes. Panel B shows droplets prepared by vortexing PAA particles with 1% polyethylene glycol (Sigma-Aldrich) for 3 minutes. Panel C shows droplets prepared by vortexing PAA particles with 2% Tween 20 (Sigma-Aldrich) for 3 minutes. Panel D shows droplets prepared by mixing PAA particles with 0.5% Triton, FC-40, and 5% fluorosurfactant and vortexing for 3 minutes. Panel E shows droplets prepared using PAA particles with 0.18% N,N'-bisacryloylcystamine as a crosslinker and vortexing the PAA particles with 0.5% Triton for 30 seconds. [Figure 6] Images and histograms of droplets generated with different vortex times are provided. Panel A shows the image and histogram after a vortex time of 5 seconds. Panel B shows the image and histogram after a vortex time of 15 seconds. Panel C shows the image and histogram after a vortex time of 1 minute. Panel D shows the image and histogram after a vortex time of 2 minutes. [Figure 7] We present the results of a demonstration demonstrating that PTE enables the generation of monodisperse emulsions on the microliter to milliliter scale. Panel A shows images of PTE emulsions with different total volumes. Panel B shows histograms of droplet size distributions for 200 μL and 2 mL emulsions. Panel C provides a table comparing droplet generation times for PTE with those for microfluidics-based methods. [Figure 8]Images of PTE digital droplet PCR (ddPCR) and quantification using monodisperse template particles are shown. Panel A shows fluorescence images of droplets after PCR amplification using TaqMan® probes and primers for yeast genomic DNA templates at various dilution factors (AU = 0, 0.001, 0.01, 0.1, 1.0). The percentage of observed fluorescent-positive droplets corresponds to the template concentration. Panel B shows scatter plots showing the size and fluorescence distributions from samples in the dilution series. The low-fluorescence (<20 AU) and small-diameter (<30 μm) population consists of droplets without hydrogel particles. The expected diameter (30-40 μm) population consists of droplets with a single hydrogel core. This population forms two dense clusters: high fluorescence (PCR positive) and low fluorescence (PCR negative, droplets without template). Panel C shows the average template copy number per droplet estimated by assuming a Poisson distribution scale with controlled template concentrations over the 3-decade range tested (R2 = 0.9994 and error bars indicate standard deviation). [Figure 9] For comparison, a graph showing the results of microfluidic ddPCR is provided. The average template copy number per droplet was estimated by assuming a Poisson distribution scale at controlled template concentrations over the 3-decade range tested (R = 0.9993 and error bars indicate standard deviation). [Figure 10A] We provide schematics, images, and graphs of PTE-based ddPCR and quantification using commercially available particles. Figure 10A shows a schematic illustrating the generation of droplets useful for PTE-based ddPCR using quasi-monodisperse commercially available particles. [Figure 10B]We provide a schematic, images, and graphs of PTE-based ddPCR and its quantification using commercially available particles. Panel A of Figure 10B shows fluorescence images after PCR amplification of yeast genomic DNA at different concentrations (AU = 0, 0.1, 1). Panel B of Figure 10B shows a scatter plot showing the size and fluorescence distribution of samples in a dilution series. Fluorescent positives and negatives are clearly distinguishable from each other and can be quantified by image analysis. Panel C of Figure 10B shows the Poisson estimate obtained using multiple Poisson distributions weighted by droplet volume, which demonstrates a linear correlation with template concentration (R2 = 0.9409 and error bars indicate standard deviation). [Figure 11] Images are provided showing multiplex PTE-based ddPCR using a mixture of lambda virus and yeast DNA. Panel A shows probes targeting lambda virus or yeast fluorescently labeled with Cy5 (red) and carboxyfluorescein (FAM) (green), respectively. Panel B shows yeast cells growing in droplets prepared by PTE. After 10 hours of incubation, colonies grown from single encapsulated cells can be detected by their intrinsic yellow fluorescent protein (YFP) fluorescence. [Figure 12] 1 provides images of monodisperse emulsions prepared in the 96-well plate format discussed in Example 7. [Figure 13] We provide a schematic and associated images of the workflow for generating two-phase emulsions and GUVs (i.e., liposomes) by PTE. Panel A shows an overview of the workflow for our liposome generation method. Panel B shows a single-phase emulsion formed by vortexing with polyacrylamide beads. Panel C shows an image of liposomes formed by adding an outer aqueous solution followed by vortexing. Scale bar = 400 μm. Panel D shows a fluorescent image of liposomes formed with the additional inclusion of fluorescent lipids in the oil phase. [Figure 14A]We provide a schematic diagram of a method for performing high-throughput scRNA-seq using PTE. Figure 14A shows Drop-seq beads encapsulated in a hydrogel. Cells, proteinase K, and hybridization buffer are mixed. [Figure 14B] Figure 14A provides a schematic diagram of a method for performing high-throughput scRNA-seq by PTE. Figure 14B shows vortexing the mixture for emulsification. [Figure 14C] Figure 14C provides a schematic diagram of the method for performing high-throughput scRNA-seq by PTE. Figure 14C shows the recovery of Drop-seq beads and RT sequencing, followed by data analysis. [Figure 15] These images show the results of high-throughput scRNA-seq experiments using PTE, a non-microfluidic scRNA-seq technique. Panel A shows a microscopic image of particles containing Drop-seq beads with a 2000 μm scale bar. Panel B shows a microscopic image of an emulsion containing Drop-seq beads with a 1000 μm scale bar. Panel C shows microscopic images of calcein green-stained cells encapsulated in droplets before and after lysis, with a 400 μm scale bar, and Panel D shows microscopic images of 1000 μm scale bar. Panel E provides a graph showing data from a human and mouse mixed cell experiment. [Figure 16] We provide a schematic of an embodiment of a workflow for fabricating core-shell microgels using the present emulsion technique, which combines affinity-based PTE with target analysis. [Figure 17] Images of polyacrylamide core beads with agarose shells are provided. Panel A shows polyacrylamide core beads surrounded by an agarose shell after droplet breakage. Panel B shows ddPCR of polyacrylamide core beads with agarose shells at two dilution factors. Panel C shows an image of the droplets after FACS. Panel D shows the results of qPCR. DETAILED DESCRIPTION OF THE INVENTION

[0028] The present disclosure provides an improved particle-templated emulsification (PTE) method for generating monodisperse emulsions. The droplets present in such emulsions are referred to interchangeably herein as PTE droplets and PIPs. The disclosed method facilitates the encapsulation and subsequent analysis of target particles of interest without the need for microfluidic devices. The disclosed method involves the use of monodisperse particles to template the formation of monodisperse droplets.

[0029] The disclosed methods facilitate encapsulation of target particles, e.g., nucleic acids, which can then be detected, quantified, and / or sorted based on their sequences, for example, as detected by nucleic acid amplification techniques, e.g., PCR and / or MDA.

[0030] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0031] Where a range of values ​​is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit, between the upper and lower limits of that range, and any other stated value or intervening value within that stated range, is encompassed within the invention unless the context clearly dictates otherwise. The upper and lower limits of these narrower ranges may independently be included in the narrower ranges and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. When the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, some potential exemplary methods and materials are described here. All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publication is cited. It is understood that the present disclosure supersedes any disclosure of the incorporated publication to the extent of any conflict.

[0033] It should be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, a reference to a "droplet" includes a plurality of such droplets, a reference to a "nucleic acid" includes a reference to one or more nucleic acids and equivalents thereof known to those skilled in the art, and so forth.

[0034] It is further noted that the claims may be drafted to exclude any element that may be optional. Accordingly, this statement is intended to serve as a predicate for using exclusive terminology, such as "solely," "only," or the like, or for using a "negative" limitation in connection with the recitation of claim elements.

[0035] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Further, the publication dates provided may be different from the actual publication dates, which may need to be independently confirmed.

[0036] As will be apparent to those skilled in the art upon reading this disclosure, each of the individual embodiments described and exemplified herein has distinct components and features that can be readily separated from or combined with the features of any of the other embodiments without departing from the scope or spirit of the present invention. Any recited method may be performed in the order of events recited or in any other order that is logically possible. For example, described herein are various additional methods and applications that can be performed in conjunction with the methods described herein for producing monodisperse emulsions or that can utilize monodisperse droplets prepared according to the methods described herein for producing monodisperse emulsions. In this regard, it is contemplated that any of the non-limiting aspects of the disclosure numbered 1-62 herein can be appropriately modified in one or more steps of such methods and applications and / or that such methods and applications can utilize monodisperse droplets prepared according to one or more of the non-limiting aspects of the disclosure numbered 1-62 herein.Such methods and uses include, but are not limited to, those described in the sections herein under the following titles: Methods; Monodisperse Template Particles and Their Generation; Monodisperse Droplets, Including Single Emulsion Droplets and Multiple Emulsion Droplets, and Their Generation; Giant Unilamellar Vesicles (GUVs); Fluids Involved in the Generation of Monodisperse Emulsions; Surfactants; Shear; Addition of Reagents to Single Emulsion Droplets, Multiple Emulsion Droplets, and / or GUVs; Tethering Moieties; Reactions in Single Emulsion Droplets, Multiple Emulsion Droplets, and / or GUVs; Detection of PCR Products; Detection of Cells (e.g., Tumor Cells) in Single Emulsion Droplets, Multiple Emulsion Droplets, and / or GUVs; Single Emulsion Droplets, Multiple Emulsion Droplets Nucleic acid detection in droplets and / or GUVs; multiple displacement amplification; PCR; double PCR; digital PCR; RNA sequencing (RNAseq); measurement of nucleic acid length; microfluidic enrichment for sequence analysis (MESA) in single-phase emulsion droplets, multiple-phase emulsion droplets and / or GUVs; PCR-activated cell sorting (PACS) in single-phase emulsion droplets, multiple-phase emulsion droplets and / or GUVs; live cell PCR-activated cell sorting (PACS); mass spectrometry-activated cell sorting (MS-ACS); colony growth and lysis; multiplexing; digital enzyme-linked immunosorbent assay (ELISA); digital oligo-linked immunosorbent assay (dOLISA); sorting; appropriate subjects and / or samples; detection of protein or DNA using enzyme-linked probes; and cancer detection.

[0037] method As summarized above, the present disclosure provides improved PTE methods for generating monodisperse emulsions. The disclosed methods facilitate encapsulation of target particles of interest and, optionally, subsequent analysis, without requiring the use of microfluidic devices. In particular, the disclosed methods involve the generation of monodisperse, target-particle-containing droplets without the need for sophisticated microfluidic systems. While a microfluidic system may be utilized with monodisperse droplets prepared as described herein, for example, for adding reagents to the droplets or sorting the droplets, such a system is not required for the generation of the monodisperse droplets themselves. The disclosed methods involve the use of monodisperse particles to template the formation of monodisperse droplets through the application of shear forces, which may be applied, for example, using a homogenizer (e.g., a vortex mixer), forcing a suitable mixture through a pipette tip, shaking a suitable mixture using a bead beater, or any other suitable method.

[0038] As used herein, the term "biological sample" encompasses various sample types obtained from a variety of sources, including biological materials. For example, the term includes biological samples obtained from mammalian subjects, e.g., human subjects, as well as biological samples obtained from food, water, or other environmental sources. This definition encompasses blood and other liquid samples of biological origin, as well as solid tissue samples, e.g., biopsy specimens or tissue cultures, or cells derived therefrom and their progeny. This definition also includes samples that have been manipulated in any way after procurement, such as by treatment with reagents, solubilization, or enrichment for specific components, such as polynucleotides. The term "biological sample" encompasses clinical samples, including cells in culture, cell supernatants, cell lysates, cells, serum, plasma, biological fluids, and tissue samples. "Biological samples" include cells, e.g., bacterial cells or eukaryotic cells, obtained from an individual; biological fluids, e.g., blood, cerebrospinal fluid, semen, saliva, etc.; bile; bone marrow; skin (e.g., skin biopsy); and antibodies.

[0039] As described more fully herein, in various embodiments, the subject methods can be used to detect a variety of components from such biological samples, including, but not necessarily limited to, cells (e.g., circulating cells and / or circulating tumor cells), viruses, polynucleotides (e.g., DNA and / or RNA), polypeptides (e.g., peptides and / or proteins), and many other components that may be present in a biological sample.

[0040] As used herein, the terms "polynucleotide" and "oligonucleotide" refer to a linear polymer of nucleotide monomers and may be used interchangeably. Polynucleotides and oligonucleotides can have any of a variety of structural forms, such as single-stranded, double-stranded, or a combination of both, as well as higher-order intramolecular or intermolecular secondary / tertiary structures, such as hairpins, loops, and triple-stranded regions. Polynucleotides typically range in size from a small number of monomer units, e.g., 5-40, as commonly referred to as "oligonucleotides," to several thousand monomer units. Whenever a polynucleotide or oligonucleotide is represented by a string of characters (upper or lower case), such as "ATGCCTG," it will be understood that the nucleotides are in 5'->3' order from left to right, with "A" representing deoxyadenosine, "C" representing deoxycytidine, "G" representing deoxyguanosine, "T" representing thymidine, "I" representing deoxyinosine, and "U" representing uridine, unless otherwise indicated or apparent from the context. Unless otherwise stated, terminology and atomic numbering conventions will follow those disclosed in Strachan and Read, Human Molecular Genetics 2 (Wiley-Liss, New York, 1999).

[0041] The terms "polypeptide," "peptide," and "protein," used interchangeably herein, refer to polymeric forms of amino acids of any length. NH2 refers to the free amino group present at the amino terminus of a polypeptide. COOH refers to the free carboxyl group present at the carboxyl terminus of a polypeptide. Standard polypeptide nomenclature, J. Biol. Chem., 243 (1969), 3552-3559, is used.

[0042] In one embodiment, methods are provided for enumerating and / or genotyping cells, including normal cells or tumor cells such as CTCs. A feature of such methods is the use of microfluidics.

[0043] The methods described herein generally involve generating a plurality of monodisperse droplets, including monodisperse single-phase emulsion droplets or multiphase emulsion droplets and / or GUVs, which may be followed, for example, by one or more nucleic acid synthesis steps and / or one or more detection and / or sorting steps. Figure 2 presents a schematic diagram illustrating a PTE workflow according to an embodiment of the present disclosure. Panel A illustrates a first step of combining a plurality of monodisperse template particles with a first fluid containing target particles to provide a first mixture. Panel B illustrates a second step of combining the first mixture with a second fluid immiscible with the first fluid to provide a second mixture. Panel C illustrates a step of shearing the second mixture to encapsulate the monodisperse template particles into monodisperse droplets in the second fluid. As a result of these steps, a monodisperse droplet is provided that includes the first fluid, one of the monodisperse template particles, and one of the target particles.

[0044] Following generation of monodisperse droplets, such droplets can be subjected to any of a variety of suitable workflows, techniques, and / or reactions described herein or otherwise known in the art for droplet-based analysis of target particles, e.g., cells, viruses, and their components, such as nucleic acids, e.g., DNA and RNA. Additional droplet-based analysis methods that can be used with monodisperse droplets prepared according to the methods described herein can be found, for example, in the following publications: U.S. Patent Application Publication Nos. 2015 / 0232942, 2017 / 0121756, 2017 / 0022538, and 2017 / 0009274, which are incorporated herein by reference.

[0045] FIG. 3 presents a schematic diagram illustrating a more detailed embodiment of the PTE workflow shown in FIG. 2. Panel A illustrates adding monodisperse polyacrylamide (PAA) beads to a PCR reaction mix to provide a first mixture. The reaction mix may include, for example, template nucleic acid, primers, probes, dNTPs, and an appropriate enzyme (e.g., Taq polymerase). Panel B illustrates capturing PCR reagents in PAA beads by immersing the PAA beads in the PCR reaction mix. Panel C illustrates removing excess aqueous solution from the first mixture after immersing the PAA beads in the PCR reaction mix. Panel D illustrates adding oil containing a stabilizing surfactant (a second fluid immiscible with the PCR reaction mix) to provide a second mixture. Panel E illustrates generating a monodisperse emulsion by vortexing the second mixture. Panel F illustrates amplifying one of multiple nucleic acid target particles within the monodisperse droplet and detecting a fluorescent signal associated with the amplified product.

[0046] A feature of certain methods described herein is the use of polymerase chain reaction (PCR)-based assays to detect the presence of specific oligonucleotides and / or genes, such as oncogenes, present in cells. Examples of PCR-based assays of interest include, but are not limited to, quantitative PCR (qPCR), quantitative fluorescent PCR (QF-PCR), multiplex fluorescent PCR (MF-PCR), digital droplet PCR (ddPCR), single-cell PCR, PCR-RFLP / real-time PCR-RFLP, hot-start PCR, nested PCR, in situ polony PCR, in situ rolling circle amplification (RCA), bridge PCR, picotiter PCR, emulsion PCR, and reverse transcriptase PCR (RT-PCR). Other suitable amplification methods include ligase chain reaction (LCR), transcription amplification, self-sustained sequence replication, selective amplification of target polynucleotide sequences, consensus sequence primed polymerase chain reaction (CP-PCR), arbitrarily primed polymerase chain reaction (AP-PCR), degenerate oligonucleotide primed PCR (DOP-PCR), and nucleic acid-based sequence amplification (NABSA).

[0047] PCR-based assays can be used to detect the presence of specific genes, such as specific oncogenes. In such assays, one or more primers specific to each gene of interest are reacted with the genome of each cell. These primers have sequences specific to the particular gene and will hybridize and initiate PCR only if they are complementary to the cell's genome. If the gene of interest is present and the primers match, many copies of the gene are made. To determine whether a particular gene is present, PCR products can be detected through assays that probe a liquid of monodisperse droplets, for example, by staining the solution with an intercalating dye such as Sybr Green or ethidium bromide, by hybridizing PCR products to a solid substrate such as beads (e.g., magnetic beads or fluorescent beads such as Luminex beads), or by detecting them through an intermolecular reaction such as FRET. These dyes, beads, etc. are each examples of "detection components," a term used broadly and generally herein to refer to any component used to detect the presence or absence of a nucleic acid amplification product, e.g., a PCR product.

[0048] Some variations on these basic approaches are now outlined in more detail below.

[0049] Monodisperse template particles and their generation As used herein, the term "monodisperse" as applied to template particles refers to the variation in diameter or maximum dimension of the template particles such that the diameter or maximum dimension of at least 50% or more, e.g., 60% or more, or 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more of the template particles varies by less than 10-fold, e.g., less than 5-fold, less than 4-fold, less than 3-fold, less than 2-fold, less than 1.5-fold, less than 1.4-fold, less than 1.3-fold, less than 1.2-fold, less than 1.1-fold, less than 1.05-fold, or less than 1.01-fold.

[0050] As used herein, the terms "multiple template particles" and "template particle" are used interchangeably to refer to extremely small, generally spherical particles. The template particle may be porous or non-porous. In any suitable embodiment herein, the template particle may include microcompartments that may contain additional components and / or reagents, such as those that may be releasable into the monodisperse droplets described herein. In any suitable embodiment herein, the template particle may include a polymer, such as a hydrogel. In some embodiments, such as those described herein where the first fluid is an aqueous fluid, the polymer is a hydrophilic polymer. In some embodiments, such as those described herein where the first fluid is a non-aqueous fluid, such as an oil, the polymer is a lipophilic polymer. The template particle generally ranges in diameter or largest dimension from about 0.1 to about 1000 μm. In some embodiments, the template particle has a diameter or maximum dimension of about 1.0 μm to about 1000 μm, inclusive, such as about 1.0 μm to about 750 μm, about 1.0 μm to about 500 μm, about 1.0 μm to about 250 μm, about 1.0 μm to about 200 μm, about 1.0 μm to about 150 μm, about 1.0 μm to about 100 μm, about 1.0 μm to about 10 μm, or about 1.0 μm to about 5 μm. In some embodiments, the template particle has a diameter or maximum dimension of about 10 μm to about 200 μm, e.g., about 10 μm to about 150 μm, about 10 μm to about 125 μm, or about 10 μm to about 100 μm.

[0051] In practicing the methods described herein, the composition and properties of the monodisperse template particles may vary. For example, in some aspects, the monodisperse template particles may be microgel particles, which are micron-scale spheres of a gel matrix. In some embodiments, the microgel is composed of a hydrophilic polymer that dissolves in water, including alginate or agarose. In other embodiments, the microgel is composed of a lipophilic microgel.

[0052] In another aspect, the monodisperse template particles can be a hydrogel. In some embodiments, the hydrogel is selected from naturally occurring materials, synthetically occurring materials, and combinations thereof. Examples of hydrogels include, but are not limited to, collagen, hyaluronic acid, chitosan, fibrin, gelatin, alginate, agarose, chondroitin sulfate, polyacrylamide, polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyacrylamide / poly(acrylic acid) (PAA), hydroxyethyl methacrylate (HEMA), poly(N-isopropylacrylamide) (NIPAM), and polyanhydride, poly(propylene fumarate) (PPF).

[0053] In some embodiments, the monodisperse template particles have an average volume, and the methods described herein include shrinking the monodisperse template particles to reduce the average volume. Shrinkage can occur upon application of an external stimulus, such as heat. By way of example, the monodisperse template particles can be encapsulated in a fluid by shearing followed by application of heat, causing the size of the monodisperse template particles to shrink. Because the volume of the droplet is constant and determined by the original size of the monodisperse template particles, monodisperse single-phase emulsion droplets or two-phase emulsion droplets or GUVs will not shrink, but the monodisperse template particles within the droplet will shrink from the surface of the droplet.

[0054] In any suitable embodiment herein, the monodisperse template particles may comprise at least one of cells, genes, drug molecules, therapeutic agents, particles, bioactive agents, osteogenic agents, osteoconductive agents, osteoinductive agents, anti-inflammatory agents, growth factors, fibroin-derived polypeptide particles, nucleic acid synthesis reagents, nucleic acid detection reagents, target particles, DNA molecules, RNA molecules, genomic DNA molecules, and combinations thereof. In embodiments involving a combination of multiple reagents in monodisperse single-phase emulsion droplets or two-phase emulsion droplets or GUVs, the monodisperse template particles may comprise multiple compartments. The monodisperse template particles may be used to encapsulate a reagent that can be triggered to release a desired compound, such as a substrate for an enzymatic reaction. For example, a two-phase emulsion droplet may be encapsulated in a monodisperse template particle that can be triggered to rupture upon application of a stimulus, such as heat. After the monodisperse template particles are encapsulated in an immiscible carrier phase fluid, the stimulus initiates a reaction.

[0055] Monodisperse template particles can be generated under microfluidic control, for example, using the method described in U.S. Patent Application Publication No. 2015 / 0232942, the disclosure of which is incorporated herein by reference. Microfluidic devices can form emulsions consisting of droplets with highly uniform sizes. The process of generating monodisperse template particles can be achieved by pumping two immiscible fluids, such as oil and water, through a junction. The junction geometry, fluid properties (e.g., viscosity, interfacial tension), and flow rate affect the properties of the generated monodisperse template particles. However, over a relatively wide range of properties, methods such as T-junctions and flow focusing can be used to generate monodisperse template particles of controlled, uniform size. To vary the monodisperse template particle size, the flow rate of the immiscible liquid can be varied. This is because, with T-junctions and flow focusing methodologies, over a specific range of properties, the monodisperse template particle size depends on the ratio between the total flow rate and the two fluid flow rates. To generate monodisperse template particles in microfluidic methods, two fluids are typically loaded into two inlet reservoirs (e.g., syringes, pressure tubing) and then pressurized as needed (e.g., using a syringe pump, pressure regulator, gravity, etc.) to generate the desired flow rate, which pumps the fluids through the device at the desired flow rate and, in doing so, generates droplets of the desired size and velocity.

[0056] In some embodiments, monodisperse template particles can be generated using parallel droplet generation techniques, including but not limited to, step-splitting and distribution plates. Further parallel droplet generation techniques of interest include those described in Abate and Weitz, Lab Chip 2011, Jun 7;11(11):1911-5; and Huang et al., RSC Advances 2017,7,14932-14938, the disclosures of each of which are incorporated herein by reference.

[0057] In some embodiments, the monodisperse template particles can be solidified by inducing a gelation mechanism, including, but not limited to, polymerization or crosslinking of the gel matrix. For example, polyacrylamide gels are formed by copolymerization of acrylamide and bisacrylamide. The reaction is a vinyl addition polymerization initiated by a free radical generating system. In some aspects, agarose hydrogels are gelled by cooling the hydrogel below its gelation temperature.

[0058] In some embodiments, the monodisperse template particles can be removed from the fluid, dried, and stored in a stable form for a period of time. Examples of drying approaches include, but are not limited to, heating, vacuum drying, freeze-drying, and supercritical drying. In some embodiments, the dried monodisperse template particles can be combined with a fluid but retain their shape and structure as independent, often spherical, gel particles. In some embodiments, the dried monodisperse template particles can be combined with an appropriate fluid, causing a portion of the fluid to be absorbed by the monodisperse template particles. In some embodiments, the porosity of the monodisperse template particles can be altered to allow at least one of the multiple target particles to be absorbed by the monodisperse template particles when combined with an appropriate fluid. Any convenient fluid can be used that allows the desired absorption to occur in the monodisperse template particles.

[0059] As used herein, the terms "imbibition," "swelling," and "expansion" as applied to monodisperse template particles may be used interchangeably to refer to the process by which a fluid penetrates a substance or a substance incorporates a fluid. In some embodiments, an absorbed substance may retain at least a portion of its shape and structure. In some embodiments, an absorbed substance may become incorporated into a fluid to form a solution.

[0060] In some embodiments, a surfactant can be used to stabilize the monodisperse template particles. Thus, the monodisperse template particles can comprise a surfactant-stabilized emulsion, such as a surfactant-stabilized single-phase emulsion or a surfactant-stabilized two-phase emulsion. Any convenient surfactant can be used that allows the desired reaction to occur within the monodisperse template particles. In other embodiments, the monodisperse template particles are not surfactant- or particle-stabilized.

[0061] Monodisperse droplets, including single-phase emulsion droplets and multiple-phase emulsion droplets, and their generation As used herein, the term "monodisperse," as applied to droplets, e.g., monodisperse single-phase emulsion droplets, refers to a variation in diameter or maximum dimension of droplets generated by shearing in the presence of monodisperse template particles that is less than that which occurs when droplets are generated by shearing under the same conditions in the absence of monodisperse template particles. Generally, monodisperse single-phase emulsion droplets or multiple emulsion droplets may exhibit a greater variation in diameter or maximum dimension while functioning in the various methods described herein compared to the monodisperse template particles from which they are generated. Monodisperse droplets generally range in diameter or maximum dimension from about 0.1 to about 1000 μm and may vary in diameter or maximum dimension by less than 10-fold, e.g., less than 5-fold, less than 4-fold, less than 3-fold, less than 2-fold, less than 1.5-fold, less than 1.4-fold, less than 1.3-fold, less than 1.2-fold, less than 1.1-fold, less than 1.05-fold, or less than 1.01-fold. In some embodiments, the monodisperse droplets have a variation in diameter or maximum dimension such that the diameter or maximum dimension of at least 50% or more, e.g., 60% or more, or 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more of the monodisperse droplets varies by less than 10-fold, e.g., less than 5-fold, less than 4-fold, less than 3-fold, less than 2-fold, less than 1.5-fold, less than 1.4-fold, less than 1.3-fold, less than 1.2-fold, less than 1.1-fold, less than 1.05-fold, or less than 1.01-fold. In some embodiments, monodisperse droplets have a diameter of about 1.0 μm to about 1000 μm, inclusive, such as about 1.0 μm to about 750 μm, about 1.0 μm to about 500 μm, about 1.0 μm to about 250 μm, about 1.0 μm to about 200 μm, about 1.0 μm to about 150 μm, about 1.0 μm to about 100 μm, about 1.0 μm to about 10 μm, or about 1.0 μm to about 5 μm. In some embodiments, the internal volume of monodisperse droplets can be about 0.01 pL or less, about 0.1 pL or less, 1 pL or less, about 5 pL or less, 10 pL or less, 100 pL or less, or 1000 pL or less. In some embodiments, the internal volume of monodisperse droplets can be about 1 fL or less, about 10 fL or less, or 100 fL or less.In some embodiments, the internal volume of the monodisperse droplets can encompass liquid volumes ranging between picoliters and femoliters (e.g., about 0.001 pL to about 1000 pL). In some embodiments, the internal volume of the monodisperse droplets reaches strictly below the nanoliter level (e.g., strictly picoliters, strictly femtoliters, or a combination thereof).

[0062] In carrying out the methods described herein, the composition and properties of the monodisperse droplets, e.g., single-emulsion droplets and multiple-emulsion droplets, may vary. For example, in some embodiments, surfactants may be used to stabilize the droplets. Thus, the droplets may comprise surfactant-stabilized emulsions, e.g., surfactant-stabilized single-emulsions or surfactant-stabilized two-emulsions. Any convenient surfactant that allows the desired reaction to occur in the droplets may be used. In other embodiments, the monodisperse droplets are not stabilized with surfactants.

[0063] The droplets described herein may be prepared as emulsions, e.g., an aqueous phase fluid dispersed in an immiscible phase carrier fluid (e.g., a fluorocarbon oil or a hydrocarbon oil), or vice versa. In particular, the multiple emulsion droplets described herein may be provided as two-phase emulsions, e.g., an aqueous phase fluid in an immiscible phase fluid dispersed in an aqueous phase carrier fluid; or as four-phase emulsions, e.g., an aqueous phase fluid in an immiscible phase fluid dispersed in an aqueous phase carrier fluid, an aqueous phase fluid, an aqueous phase fluid in an immiscible phase fluid, etc. Generating the monodisperse single-phase emulsion droplets or multiple emulsion droplets described herein can be performed without microfluidic control. In alternative embodiments, monodisperse single-phase emulsions can be prepared without the use of a microfluidic device, in which case a microfluidic device is used to provide a multiple emulsion, e.g., a two-phase emulsion.

[0064] The methods described herein can be used to generate monodisperse single-phase emulsions without the use of microfluidic devices. Generating monodisperse emulsions using monodisperse template particles can provide emulsions containing droplets with very uniform sizes. The droplet generation process can be accomplished by combining a plurality of monodisperse template particles with a first fluid containing a plurality of target particles to form a first mixture; combining the first mixture with a second fluid immiscible with the first fluid to form a second mixture; and shearing the second mixture to encapsulate the plurality of monodisperse template particles into a plurality of monodisperse droplets in the second fluid, thereby providing a plurality of monodisperse droplets containing the first fluid, one of the monodisperse template particles, and one of the plurality of target particles. The shear rate and monodisperse template particle size can be varied to vary droplet size. In the case of agarose gels, the monodisperse template particles can be liquefied using an external stimulus (e.g., heat) to generate a liquid monodisperse emulsion.

[0065] The percentage of monodisperse droplets, e.g., monodisperse single-phase emulsion droplets or multiphase emulsion droplets, containing no more than one monodisperse template particle can be about 70% or more; about 75% or more; about 80% or more; about 85% or more; about 90% or more; or about 95% or more. For example, the percentage of monodisperse droplets containing no more than one monodisperse template particle can be about 70% to about 100%, e.g., about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, or about 95% to about 100%. As a further example, the percentage of monodisperse droplets containing no more than one monodisperse template particle can be about 70% to about 95%, e.g., about 75% to about 90%, or about 80% to about 85%. The percentage of monodisperse template particles encapsulated in monodisperse droplets in the second fluid can be about 70% or more; about 75% or more; about 80% or more; about 85% or more; or about 90% or more. For example, the percentage of monodisperse template particles encapsulated in monodisperse droplets in the second fluid can be about 70% to about 100%, e.g., about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, or about 95% to about 100%. As a further example, the percentage of monodisperse template particles encapsulated in monodisperse droplets in the second fluid can be about 70% to about 95%, e.g., about 75% to about 90%, or about 80% to about 85%.

[0066] The methods described herein can also be used to generate two-phase emulsions without the use of microfluidic devices. Two-phase emulsions include droplets contained within droplets, such as an aqueous phase fluid surrounded by an immiscible phase shell in an aqueous phase carrier fluid (e.g., water-in-oil-in-water), or an immiscible phase fluid surrounded by an aqueous phase shell in an immiscible phase carrier fluid (e.g., oil-in-water-in-oil). The second mixture described herein contains monodisperse single-phase emulsion droplets in a second fluid and is combined with a third fluid that is immiscible with at least the second fluid to generate a third mixture. The third mixture is then sheared to encapsulate monodisperse template particles into two-phase emulsion droplets in the third fluid. The third fluid can be immiscible with both the first and second fluids. A particularly useful type of two-phase emulsion contains water droplets encapsulated in slightly larger oil droplets, which are themselves dispersed in a carrier aqueous phase. Two-phase emulsions are valuable. This is because the internal "core" of the structure can be used to provide active compounds, such as solutes or biomaterials, which are protected from the external environment by the surrounding oil shell. The advantages of using monodisperse template particles to generate two-phase emulsions are the same as those for generating single-phase emulsions, in that the dimensions of the two-phase emulsion (inner and outer droplet sizes) can be controlled over a wide range and the droplets can be formed with a high degree of uniformity. As discussed herein, in appropriate embodiments, monodisperse template particles can be dissolved and / or fused within the monodisperse droplets. Thus, in some embodiments, multiple emulsions, e.g., two-phase emulsions, can be prepared from monodisperse droplets that no longer contain intact template particles but retain their original size. In this way, such monodisperse droplets can serve as templates for the preparation of multiple emulsions, e.g., two-phase emulsions.

[0067] Encapsulation of sample materials and / or reagents, such as nucleic acids and / or nucleic acid synthesis reagents (e.g., isothermal nucleic acid amplification reagents and / or nucleic acid amplification reagents), into droplets can be achieved through several methods, including microfluidic and non-microfluidic approaches. Within microfluidic approaches, several applicable techniques exist, including glass microcapillary two-phase emulsification or two-phase emulsification using continuous droplet generation in wettability-patterned devices. Microcapillary techniques form droplets by generating coaxial jets of immiscible phases that are induced to break into droplets via coaxial flow focusing through a nozzle. However, a potential drawback of this approach is that devices are typically assembled from aligned and glued microcapillary tubes. Because drop-forming nozzles are on the scale of tens of microns, even small errors in capillary placement can lead to device failure. In contrast, continuous droplet formation at spatially patterned drop-generation junctions can be achieved in lithographically assembled devices, making them easier to construct and mass-produce while maintaining overall dimensional uniformity. However, in some cases, the planar nature of these devices may not be ideal for generating two-phase emulsions. This is because the separating phases all enter the device in contact with the channel walls, requiring careful patterning of wettability to capture the appropriate phases in the appropriate locations. This can make device assembly more challenging and, in some cases, may prevent emulsification of liquids whose wetting properties are not optimized for the device. Thus, in some aspects, the present disclosure provides methods for generating monodisperse emulsions encapsulating sample materials and / or reagents, such as nucleic acids and / or nucleic acid synthesis reagents (e.g., isothermal nucleic acid amplification reagents and / or nucleic acid amplification reagents), without the use of microfluidic devices.

[0068] For example, the methods described herein may include combining a plurality of monodisperse template particles with a first fluid containing a plurality of target particles, such as nucleic acids, to provide a first mixture. In some embodiments, combining a plurality of monodisperse template particles with the first fluid to provide a first mixture includes absorbing a portion of the first fluid, and the target particles and / or reagents contained therein, onto the monodisperse template particles. In some embodiments, combining a plurality of monodisperse template particles with the first fluid to provide a first mixture includes flowing a portion of the first fluid onto the monodisperse template particles. In some embodiments, combining a plurality of monodisperse template particles with the first fluid to provide a first mixture includes diffusing a portion of the first fluid onto the monodisperse template particles. In some embodiments, combining a plurality of monodisperse template particles with the first fluid to provide a first mixture includes swelling the monodisperse template particles with a portion of the first fluid.

[0069] In some embodiments, excess first fluid is removed from the first mixture after allowing a portion of the first fluid to be absorbed by the monodisperse template particles. The amount of excess first fluid removed can vary. For example, by removing most of the excess fluid, target particles that cannot flow into the monodisperse template particles can be encapsulated by physically bringing the target particle, e.g., a cell, into close proximity with at least one of the monodisperse template particles. Combining this mixture with a second fluid that is immiscible with the first fluid provides a second mixture. Shearing this second mixture can cause the monodisperse template particles to encapsulate monodisperse droplets in the second fluid, thereby providing monodisperse droplets containing the first fluid, one of the monodisperse template particles, and one of the target particles that cannot flow into the monodisperse template particles.

[0070] In some embodiments, the target molecules are cells. In such embodiments, the monodisperse droplets may contain one or more cells per droplet. Alternatively, the monodisperse droplets may not contain more than one cell per droplet. In some embodiments, after shearing, some droplets in the emulsion do not contain any of the multiple target particles.

[0071] In some embodiments, the methods disclosed herein include combining a first mixture containing a plurality of monodisperse template particles and a first fluid containing a plurality of target particles with a second fluid immiscible with the first fluid to provide a second mixture; and shearing the second mixture to encapsulate the plurality of monodisperse template particles into a plurality of monodisperse droplets in the second fluid, thereby providing a plurality of monodisperse droplets containing the first fluid, one of the monodisperse template particles, and one of the plurality of target particles. In some embodiments, after shearing, the second fluid contains a plurality of droplets that do not contain one of the monodisperse template particles. Droplets that do not contain one of the monodisperse template particles can be removed from the monodisperse emulsion by a suitable separation technique, such as filtration or centrifugation. The droplets that do not contain one of the monodisperse template particles can have a smaller diameter than the droplets that contain one of the monodisperse template particles. The monodisperse droplets that contain the monodisperse template particles can also be concentrated relative to droplets that do not contain one of the monodisperse template particles.

[0072] As used herein, the terms "enriched" and "enrichment" may be used interchangeably to refer to a process of increasing the ratio of target entities (e.g., monodisperse droplets that include monodisperse template particles) to non-target entities (e.g., monodisperse droplets that do not include monodisperse template particles) in a monodisperse emulsion compared to the ratio in the original monodisperse emulsion. Using the methods disclosed herein, monodisperse droplets that include monodisperse template particles may be enriched, for example, by at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 100-fold, or more, compared to droplets that do not include one of the monodisperse template particles.

[0073] In some embodiments, excess second fluid is removed from the second mixture, which after shearing comprises a plurality of monodisperse template particles encapsulated in a plurality of monodisperse droplets. The excess second fluid can be removed using any suitable method, such as, for example, centrifugation and removal of the supernatant.

[0074] Multiple emulsions, e.g., two-phase emulsions, produced as described herein may be further manipulated to adjust their properties. For example, in many two-phase emulsion formulations, the shell of the two-phase emulsion is permeable to certain molecules, allowing these molecules to passively diffuse into or out of the two-phase emulsion. This can be used, for example, to adjust the environment of the two-phase emulsion. Similarly, the internal droplets of a two-phase emulsion can be shrunk or grown, for example, by diffusing solvent into or out of them. For example, by dispersing the two-phase emulsion in a buffer containing a high salt concentration, aqueous phase fluid can be induced to diffuse out of the two-phase emulsion until the osmotic pressures of the internal droplets and the external carrier phase match, at which point the droplet size remains constant. This can be used to change the size of the internal droplets or to concentrate or dilute reagents contained within the two-phase emulsion by adding or removing excess solvent.

[0075] The shell of a binary emulsion can also be adjusted using techniques such as solvent extraction to remove excess hydrophobic phase from the shell, for example, in the case of a water-in-oil-in-water binary emulsion. This can induce other changes in the binary emulsion, such as its transition to lipid vesicles, polymersomes, or colloidosomes, for example, via dewetting or other phenomena. Air bubbles may be introduced into the binary emulsion, for example, in the internal droplets or in the intermediate encapsulation phase. The ability to expand and compress air can also be utilized, for example, in some embodiments, to increase or decrease the size of the binary emulsion or the thickness of the binary emulsion shell, as needed. Air bubbles in the intermediate phase can expand, for example, by reducing the system pressure, which will exert a force on the internal droplets that can be used to induce transition to another structure, such as a polymersome or vesicle. A gelling agent can also be added to solidify the outer layer of the droplets. Examples of gelling agents include, but are not limited to, gelatin, agar, xanthan gum, gellan gum, carrageenan, isagol, and guar gum.

[0076] Giant unilamellar vesicles (GUVs) Two-phase emulsions generally refer to emulsions within emulsions, i.e., droplets contained within droplets of a second, immiscible phase. They may be stabilized with surfactants, but importantly, the intermediate phase "shell" contains a liquid phase in addition to any surfactant. As the shell volume decreases, the two-phase emulsion becomes less like a droplet-within-a-droplet structure than a vesicle-like structure, with the core fluid encapsulated in a thin film of surfactant molecules. Formation of such "vesicles" using two-phase emulsions can be achieved by subjecting the "vesicle" to a dewetting transition (in which the intermediate liquid phase fluid is removed from the shell but the surfactant layer is maintained) to produce a vesicle containing an aqueous core surrounded by a thin layer of surfactant molecules and a small oil droplet that was originally attached to the shell. Such vesicles are also referred to herein as liposomes.

[0077] The tendency of two-phase emulsions to dewet depends on the properties of the different solutions and surfactants, particularly the interfacial tension of the different phases relative to one another. Aqueous formulations containing fluorinated oils, PEG-Krytox® surfactants, Jeffamine® (polyetheramine)-Krytox® surfactants, and Pluronic®, when added to a carrier phase, can form both two-phase emulsions and vesicles that are thermally stable at temperatures above 95°C. Krytox® fluids are fluorinated synthetic oils based on hexafluoropropylene oxide combined with functional end groups. Other surfactants, such as Tween® 20 (Polysorbate 20) and Span® 80 (sorbitan monooleate), with or without thickeners such as PEG, alginate, and glycerol, can be used to induce GUV formation from two-phase emulsions.

[0078] Fluids involved in the formation of monodisperse emulsions As discussed herein, the disclosed methods generally include combining a plurality of monodisperse template particles with a first fluid containing a plurality of target particles to provide a first mixture; combining the first mixture with a second fluid immiscible with the first fluid to provide a second mixture; and shearing the second mixture to encapsulate the plurality of monodisperse template particles into a plurality of monodisperse droplets in the second fluid, thereby providing a plurality of monodisperse droplets containing the first fluid, one of the monodisperse template particles, and one of the plurality of target particles. In some embodiments, the method further includes, following shearing of the second mixture, combining a third fluid immiscible with the second fluid with the second mixture to produce a third mixture.

[0079] The first fluid is generally selected to be immiscible with the second fluid and share common hydrophilicity / hydrophobicity with the material comprising the monodisperse template particles. The third fluid is generally selected to be immiscible with the second fluid and may or may not be miscible with the first fluid. Thus, in some embodiments, the first fluid is an aqueous phase fluid, and the second fluid is a fluid immiscible with the first fluid, e.g., a non-aqueous phase, such as a fluorocarbon oil, a hydrocarbon oil, or a combination thereof. The third fluid is an aqueous phase fluid. Alternatively, in some embodiments, the first fluid is a non-aqueous phase, such as a fluorocarbon oil, a hydrocarbon oil, or a combination thereof, the second fluid is a fluid immiscible with the first fluid, e.g., an aqueous phase fluid, and the third fluid is a fluorocarbon oil, a hydrocarbon oil, or a combination thereof.

[0080] The non-aqueous phase can serve as a carrier fluid that forms a continuous phase that is immiscible with water, or the non-aqueous phase can be a dispersed phase. The non-aqueous phase can be called an oil phase, containing at least one oil, but can also include any liquid (or liquefiable) compound or mixture of liquid compounds that is immiscible with water. The oil can be synthetic or natural. The oil can contain or not contain carbon and / or silicon, and can contain or not contain hydrogen and / or fluorine. The oil can be lipophilic or lipophobic. In other words, the oil can generally be miscible with organic solvents or not. Exemplary oils can include, among others, at least one silicone oil, mineral oil, fluorocarbon oil, vegetable oil, or a combination thereof.

[0081] In an exemplary embodiment, the oil is a fluorinated oil, such as a fluorocarbon oil, which may be a perfluorinated organic solvent. Examples of suitable fluorocarbon oils include C9H5OF 15 (HFE-7500), C 21 F 48 N2 (FC-40), and perfluoromethyldecalin (PFMD).

[0082] As discussed herein, in some embodiments, the first fluid comprises a plurality of target particles (e.g., DNA molecules, e.g., genomic DNA molecules, RNA molecules, nucleic acid amplification reagents, e.g., nucleic acid synthesis reagents including PCR and / or isothermal amplification reagents).

[0083] In some embodiments, a gelling agent can be added to solidify the outer layer of the droplet.

[0084] surfactants In some embodiments, a surfactant may be included in the first fluid, the second fluid, and / or the third fluid. Thus, the droplets may comprise surfactant-stabilized emulsions, such as surfactant-stabilized single-phase emulsions or surfactant-stabilized two-phase emulsions, when the surfactant is dissolved in the first fluid, the second fluid, and / or the third fluid. Any convenient surfactant that allows the desired reaction to occur in the droplets may be used, including octylphenol ethoxylate (Triton X-100), polyethylene glycol (PEG), C 26 H 50 O 10 (Tween 20) and / or octylphenoxypolyethoxyethanol (IGEPAL). In other embodiments, the droplets are not stabilized with a surfactant.

[0085] The surfactant used will depend on several factors, such as the oil and water phases (or other suitable immiscible phases, e.g., any suitable hydrophobic and hydrophilic phases) used in the emulsion. For example, if water droplets are used in a fluorocarbon oil, the surfactant may have a hydrophilic block (PEG-PPO) and a hydrophobic fluorinated block (Krytox® FSH). However, if the oil is switched to a hydrocarbon oil, for example, the surfactant may instead be selected so that it has a hydrophobic hydrocarbon block, such as the surfactant ABIL EM90.

[0086] Other surfactants, including ionic surfactants, are also contemplated. Other additives may be included in the oil to stabilize the droplets, including polymers that improve droplet stability at temperatures above 35°C.

[0087] While not intending to be bound by any particular theory, it has been proposed that the preparation of thermostable emulsions relies on the use of surfactants that can form membranes or two-phase emulsion interfaces that can withstand high temperatures, such as those associated with standard PCR reactions. One way to achieve this may be to use surfactants with relatively high molecular weights, such that when assembled at the droplet interface or in a membrane configuration, the energy required to remove the surfactant from the interface (or disrupt the membrane) is higher than the energy that can be provided at kT.

[0088] Exemplary surfactants that can be utilized to provide heat-stable emulsions are "biocompatible" surfactants, including PEG-PFPE (polyethylene glycol-perfluoropolyether) block copolymers, such as PEG-Krytox® (see, e.g., Holtze et al., "Biocompatible surfactants for water-in-fluorocarbon emulsions," Lab Chip, 2008, 8, 1632-1639, the disclosure of which is incorporated herein by reference), and surfactants that include ionic Krytox® in the oil phase and Jeffamine® (a polyetheramine) in the water phase (see, e.g., DeJournette et al., "Creating Biocompatible Oil-Water Interfaces without Synthesis: Direct Interactions between Primary Amines and Carboxylated Perfluorocarbon Surfactants," Anal. Chem. 2013, 85(21):10556-10564, the disclosure of which is incorporated herein by reference). Additional and / or alternative surfactants may be used, provided they form a stable interface. Thus, many suitable surfactants will be block copolymer surfactants with high molecular weights (such as PEG-Krytox®). Examples of these include fluorinated molecules and solvents, although non-fluorinated molecules may be used as well.

[0089] Thus, in some embodiments, the present disclosure provides thermostable emulsions that are suitable for use in conducting biological reactions such as PCR, RT-PCR, protein-protein interaction studies, and the like.

[0090] A key consideration in forming emulsions, particularly two-phase emulsions, is stabilizing them so that they remain together and do not burst or coalesce. This is often achieved using stabilizers such as surfactants. However, in some cases, it may be advantageous to create highly stable two-phase emulsions. In the methods described herein, this can be achieved by using a crosslinkable intermediate phase (envelope phase), such as a polymer gel phase like polydimethylsiloxane. Alternatively, the surfactants themselves may be crosslinked to each other, for example, by creating crosslinking groups. These groups may be present in the hydrophobic tails or hydrophilic heads of the surfactants. These groups may crosslink surfactants to each other, or crosslinking may be induced by the addition of a reagent from the aqueous phase, for example, a molecule that induces polymerization, covalent crosslinking, or the like. Biomolecules such as antibodies or biotin-streptavidin may also be used to create surfactant-surfactant crosslinks.

[0091] Cross-linking the interface is another way to make the two-phase emulsion shell thermostable. For example, such cross-linking can be achieved by cross-linking the oil phase or by cross-linking the membrane vesicles. As discussed above, one method for cross-linking the interface uses a biomolecule such as streptavidin. For example, the head group of a Krytox® polymer can be biotinylated with multiple biotins. Streptavidin is then added to the aqueous phase, which cross-links different Krytox® polymers together, creating a cross-linked shell at the water / oil interface. These shells can then be dispersed directly in water or, if desired, encapsulated as a two-phase emulsion.

[0092] shear To produce a monodisperse emulsion, the disclosed method includes shearing a second mixture obtained by combining a first mixture with a second fluid that is immiscible with the first fluid. Any suitable method or technique can be used to apply sufficient shear force to the second mixture. For example, the second mixture can be sheared by passing the second mixture through a pipette tip. Other methods include, but are not limited to, shaking the second mixture with a homogenizer (e.g., a vortexer) or a bead beater. Upon application of sufficient shear force, the second mixture breaks down into monodisperse droplets that encapsulate one of the plurality of monodisperse template particles. Some droplets may also be present that do not contain one of the plurality of monodisperse template particles.

[0093] Generally, if shear is increased, the average droplet size produced will be smaller than that of the monodisperse template particles. However, because the monodisperse template particles are in solid form, the size of the droplets containing them will not further decrease, thereby producing a monodisperse emulsion. If the shear rate is substantially higher than the elastic modulus of the monodisperse template particles, the shear can squeeze out liquid from the monodisperse template particles. While not intending to be bound by any particular theory, it is proposed that an appropriate shear rate is one that appropriately matches the elastic modulus of the monodisperse template particles. For example, it may be desirable to select a shear rate / force that is higher than the Laplace pressure of droplets of the desired size, but lower than the elastic modulus of the template particles.

[0094] By way of example and not limitation, when monodisperse PAA, PEG, or agarose template particles are used with Triton or IGEPAL in the aqueous phase and HFE-7500 fluorinated oil is used as the non-aqueous phase, vortexing for 30 seconds generates sufficient shear to generate monodisperse droplets.

[0095] Addition of reagents to single emulsion droplets, multiple emulsion droplets, and / or GUVs In carrying out the subject methods, it may be necessary to add some reagents to the droplets in one or more steps (e.g., about two, about three, about four, or about five or more steps). The means of adding reagents to the droplets may vary in some ways depending, for example, on the emulsification stage of the droplets; for example, different approaches may be applicable to adding reagents to monodisperse single-emulsion droplets versus multiple emulsion droplets, such as two-emulsion droplets. Approaches of interest include, but are not limited to, those described in Ahn et al., Appl. Phys. Lett. 88, 264105 (2006); Priest et al., Appl. Phys. Lett. 89, 134101 (2006); Abate et al., PNAS, November 9, 2010 vol. 107 no. 45 19163-19166; and Song et al., Anal. Chem., 2006, 78(14), pp. 4839-4849, the disclosures of which are incorporated herein by reference. In some embodiments, reagents may be added to droplets during the emulsification process described herein, e.g., as a component of the first fluid, without the use of a microfluidic device or system. In other embodiments, microfluidic techniques, devices, and / or systems may be utilized to add reagents and / or condition monodisperse droplets once prepared as otherwise described herein.

[0096] For example, a reagent may be added to a monodisperse single-phase emulsion droplet described herein by a method that includes merging the droplet with a second droplet containing the reagent. The reagent contained in the second droplet may be added by any convenient means, including those specifically described herein. This droplet may be merged with a first droplet to create a droplet containing the contents of both the first and second droplets. In some embodiments, the first droplets are substantially larger than the second droplets and more numerous than the second droplets.

[0097] One or more reagents may also, or instead, be added to the monodisperse single-phase emulsion droplets described herein using techniques such as droplet coalescence and / or pico-injection. In droplet coalescence, a target droplet may be flowed with a droplet containing a reagent to be added to the target droplet. The two droplets may flow so that they contact each other but not the other droplet. These droplets may then be passed through an electrode or other means of applying an electric field, where the electric field may destabilize the droplets so that they merge with each other.

[0098] In picoinjection, target droplets may flow through a channel containing the reagent to be added, and the reagent is under high pressure. However, due to the presence of surfactants, in the absence of an electric field, the droplets will flow through without being injected because the surfactant coating the droplets may prevent fluid entry. However, if an electric field is applied to the droplets as they pass through the injector, the fluid containing the reagent will be injected into the droplets. The amount of reagent added to the droplets can be controlled by several different parameters, such as adjusting the injection pressure and the velocity of the flowing droplets, or by switching the electric field on and off.

[0099] In other embodiments, one or more reagents may also or instead be added to the monodisperse single-phase emulsion droplets described herein by methods that do not rely on merging two droplets together or injecting a liquid into a droplet. Rather, one or more reagents may be added to a droplet by a method that includes emulsifying the reagent into a stream of very small drops and merging these small drops with a target droplet. Such methods are referred to herein as "reagent addition by multiple drop coalescence." These methods take advantage of the fact that the small size of the added drops compared to the size of the target droplets causes the small drops to flow faster than the target droplets and accumulate behind them. The aggregates may then be merged, for example, by applying an electric field. This approach may also or instead be used to add multiple reagents to a droplet by using several parallel streams of small drops of different fluids. To effectively merge tiny droplets with target droplets, it is important that the tiny droplets be smaller than the channel containing the target droplets and that the distance between the electrode applying the electric field and the channel into which the target droplets are injected be long enough to allow the tiny droplets time to "catch up" with the target droplets. If this channel is too short, not all tiny droplets will merge with the target droplets, and less reagent than desired may be added. This can be compensated for to some extent by increasing the magnitude of the electric field, which will facilitate merging of droplets further apart. In addition to, or instead of, generating tiny droplets in the same microfluidic device, they may also, or instead, be injected into the device containing the target droplets using a separate microfluidic drop generator or offline via homogenization.

[0100] Thus, in certain embodiments, a reagent is added to droplets prepared as described herein by a method comprising emulsifying the reagent into a stream of droplets, wherein the droplets are smaller than the size of the target droplets (e.g., monodisperse single-emulsion droplets or multi-emulsion droplets or GUVs); flowing the droplets together with the target droplets; and merging the droplets with the target droplets. The diameter of the droplets in the droplet stream can vary within a range of about 75% or less of the diameter of the target droplets, e.g., the diameter of the flowing droplets is about 75% or less of the diameter of the target droplets, about 50% or less of the diameter of the target droplets, about 25% or less of the diameter of the target droplets, about 15% or less of the diameter of the target droplets, about 10% or less of the diameter of the target droplets, about 5% or less of the diameter of the target droplets, or about 2% or less of the diameter of the target droplets. In some embodiments, multiple flowing droplets, such as two or more droplets, three or more, four or more, or five or more droplets, may be merged with a target droplet. Such merging may be achieved by any convenient means, including, but not limited to, applying an electric field, where the electric field is effective to merge the flowing droplets with the target droplet.

[0101] As a variation of the above method, the fluid may be jetted. That is, rather than emulsifying the fluid added to the flowing droplets, a long jet of this fluid may be formed and flow together with the target droplets. The two fluids may then be merged, for example, by applying an electric field. This results in a bulging jet where the droplets are located, which may spontaneously break down into droplets of approximately the same size as the target droplets before merging due to Rayleigh plateau instability. Several variations are possible. For example, one or more agents, such as a gelling agent and / or a surfactant, may be added to the jetting fluid to make jetting easier. Furthermore, the viscosity of the continuous fluid can be adjusted to enable jetting, for example, as described in Utada, et al., Phys. Rev. Lett. 99, 094502 (2007), the disclosure of which is incorporated herein by reference.

[0102] In other embodiments, one or more reagents may be added using a method that uses the infusion fluid itself as an electrode by utilizing electrolytes dissolved in the solution.

[0103] In another aspect, a reagent is added to an earlier-formed droplet by encasing the droplet to which the reagent is to be added (i.e., the "target" droplet) within the drop containing the reagent to be added (the "target" reagent). In certain embodiments, such a method is performed by first encapsulating the target droplet in a shell of a suitable hydrophobic phase, such as an oil, to form a two-phase emulsion. The two-phase emulsion is then encapsulated by the droplet containing the target reagent to form a three-phase emulsion. To combine the target droplet with the drop containing the target reagent, the two-phase emulsion is then cleaved using any suitable method, including, but not limited to, application of an electric field, addition of a chemical that destabilizes the droplet interface, flowing the three-phase emulsion through constrictions and other microfluidic features, application of shear or ultrasound, increasing or decreasing temperature, or by encapsulating magnetic particles in the droplet that can rupture the two-phase emulsion interface when attracted by a magnetic field.

[0104] Aspects of the above method of adding reagents to droplets are described in more detail in U.S. Patent Application Publication No. 2015 / 0232942, the disclosure of which is incorporated herein by reference in its entirety and for all purposes.

[0105] While the above-described methods of adding reagents to droplets may be suitable for adding reagents to monodisperse single-emulsion droplets, one or more of the above-described methods may not be suitable for directly adding reagents to multiple emulsion droplets, such as two-phase emulsion droplets, and / or GUVs. This may be the case, for example, if such a method disrupts the structure of the multiple emulsion droplets and / or GUVs. However, the above-described methods may be used to add reagents to monodisperse single-emulsion droplets that are subsequently encapsulated to form multiple emulsion droplets and / or GUVs. Accordingly, additional methods of adding reagents to multiple emulsion droplets and / or GUVs are described below. For example, in some embodiments, a reagent, such as a detectable label designed to detectably label a nucleic acid amplification product and / or a nucleic acid synthesis reagent designed to generate a nucleic acid synthesis product, may be added to a multiple emulsion droplet and / or GUV by adding the reagent to a miscible phase carrier fluid, where the reagent diffuses from the miscible phase carrier fluid, through the immiscible shell of the multiple emulsion droplet and / or GUV, and into the first miscible phase fluid of the multiple emulsion droplet and / or GUV.

[0106] In some embodiments, the multiple emulsion droplets and / or GUVs are second multiple emulsion droplets and / or GUVs, and the method of adding nucleic acid synthesis reagents to the second multiple emulsion droplets and / or GUVs includes encapsulating nucleic acids, e.g., target nucleic acids, in first multiple emulsion droplets and / or GUVs, encapsulating the synthesis reagents and the first multiple emulsion droplets in the second multiple emulsion droplets and / or GUVs, and rupturing the first multiple emulsion droplets and / or GUVs, thereby contacting the nucleic acids with the synthesis reagents.

[0107] In some embodiments, the multiple emulsion droplets and / or GUVs are second multiple emulsion droplets and / or GUVs, and the method of adding nucleic acid synthesis reagents to the second multiple emulsion droplets and / or GUVs includes encapsulating the nucleic acid synthesis reagents in the first multiple emulsion droplets and / or GUVs, encapsulating the nucleic acid, e.g., the target nucleic acid, and the first multiple emulsion droplets and / or GUVs in the second multiple emulsion droplets and / or GUVs, and rupturing the first multiple emulsion droplets and / or GUVs, thereby contacting the nucleic acid with the synthesis reagents.

[0108] In some embodiments, the multiple emulsion droplets and / or GUVs are first multiple emulsion droplets and / or GUVs, and a suitable method comprises adding a reagent to the first multiple emulsion droplets and / or GUVs by encapsulating the first multiple emulsion droplets and / or GUVs in a second multiple emulsion droplet and / or GUV that contains the reagent, and rupturing the first multiple emulsion droplets and / or GUVs within the second multiple emulsion droplets and / or GUVs to contact the reagent with the contents of the first multiple emulsion droplets and / or GUVs.

[0109] In some embodiments, the multiple emulsion droplets and / or GUVs are second multiple emulsion droplets and / or GUVs, and a suitable method comprises adding the reagent to the second multiple emulsion droplets and / or GUVs by encapsulating first multiple emulsion droplets and / or GUVs containing the reagent within the second multiple emulsion droplets and / or GUVs, and rupturing the first multiple emulsion droplets and / or GUVs within the second multiple emulsion droplets and / or GUVs to contact the reagent with the contents of the second multiple emulsion droplets and / or GUVs.

[0110] Mooring section In some embodiments, target particles, such as nucleic acid target molecules; nucleic acid synthesis reagents; and / or nucleic acid detection reagents, are attached to monodisperse template particles via one or more tethering moieties disposed on or within the monodisperse template particles. The tethering moieties can interact with the tethered target particles. For example, the tethering moieties can be oligonucleotides with specific sequences attached to the monodisperse template particles. The specific oligonucleotides can hybridize to the target particles in the fluid, for example, through base pairing and cross-linking.

[0111] In some embodiments, certain target particles may be too large to travel through monodisperse template particles containing functional groups for capturing the target particles. In such cases, the tethering moieties may be functionalized beads encapsulated in the monodisperse template particles. For example, as the target particles diffuse through the monodisperse template particles, they will come into contact with the functionalized beads, providing an opportunity for capture. Even if the monodisperse template particles are absorbed into a miscible carrier fluid, the target particles will remain tethered because they are tethered to beads captured in or on the monodisperse template particles.

[0112] Reactions in single emulsion droplets, multiple emulsion droplets, and / or GUVs The methods disclosed herein generally facilitate the implementation of multiple compartmentalized reactions and the subsequent reading and sorting of these reactions using a variety of detection methods, including spectroscopy, chemical techniques, biological techniques, and sequencing. Reactions can include organic or inorganic reactions performed without biomolecules, or reactions involving biomolecules and / or cells, such as enzymatic reactions, e.g., PCR. Reactions can also include cellular material or cell-based extracts, including transcription and translation extracts that can express DNA, RNA, and proteins without the use of living cells. This can be used, for example, in synthetic biology applications, including screening pathways for activity.

[0113] For example, a pathway incorporating one or more proteins can be encoded by nucleic acids encapsulated in monodisperse single- or multiple-emulsion droplets, e.g., two-phase emulsions and / or GUVs, using a cell-free extract capable of expressing one or more pathway proteins. Assay components can also be included to allow testing of the pathway. Based on pathway activity and assay measurements, the reactors can be sorted to recover monodisperse single-emulsion droplets, multiple-emulsion droplets, and / or GUVs that happen to encapsulate a particularly desirable pathway. After sorting, they can be analyzed, amplified, etc., to continue the process, screen, or perform directed evolution to generate enriched pathway sequences.

[0114] Reactions in monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs can also be used for applications such as nucleic acid manipulation, including generating low-bias sequencing libraries or combining molecules with specific functions. For example, cells expressing specific gene sequences or nucleic acid synthesis and / or amplification products can be encapsulated in monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs and then subjected to the methods described herein to isolate, amplify, and link the sequences to generate a single molecule that can be analyzed or used in further applications. For example, if the cells include human antibody-producing cells, the genes corresponding to the heavy and light chains of the cells can be linked together to generate a single molecule that can be analyzed to detect heavy and light chain pairs or to generate antibodies such as molecules such as scFvs or Fabs.

[0115] Detection of PCR products When carrying out the subject methods, methods for detecting nucleic acid synthesis and / or amplification products, such as isothermal nucleic acid amplification products or PCR products, may vary. For example, if the goal is to enumerate specific cell types, such as tumor cells, present in a population, this may be accomplished using a simple binary assay in which SybrGreen, or any other dye and / or intercalating dye, is added to each monodisperse single-emulsion droplet, multiple-emulsion droplet, and / or GUV, so that if a characterizing gene, such as an oncogene, is present and a PCR product is generated, the monodisperse single-emulsion droplet, multiple-emulsion droplet, and / or GUV will become fluorescent. The change in fluorescence may be due to fluorescence polarization. The detection component may include the use of an intercalating dye (e.g., SybrGreen).

[0116] A variety of different detection components can be used in practicing the subject methods, including the use of fluorescent dyes known in the art. Fluorescent dyes can typically be divided into categories such as fluorescein and its derivatives; rhodamine and its derivatives; cyanine and its derivatives; coumarin and its derivatives; cascade blue and its derivatives; lucifer yellow and its derivatives; BODIPY and its derivatives; and the like. Exemplary fluorophores include indocarbocyanine (C3), indodicarbocyanine (C5), Cy3, Cy3.5, Cy5, Cy5.5, Cy7, Texas Red, Pacific Blue, Oregon Green 488, Alexa Fluor-355, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor-555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 670, Alexa Fluor 680, Alexa Fluor 690, Alexa Fluor 700, Alexa Fluor 710, Alexa Fluor 720, Alexa Fluor 730, Alexa Fluor 740, Alexa Fluor 750, Alexa Fluor 760, Alexa Fluor 770, Alexa Fluor 780, Alexa Fluor 790, Alexa Fluor 791, Alexa Fluor 792, Alexa Fluor 793, Alexa Fluor 794, Alexa Fluor 795, Alexa Fluor 796, Alexa Fluor 797, Alexa Fluor 798, Alexa Fluor 79 ... 680, JOE, Lissamine, rhodamine green, BODIPY, fluorescein isothiocyanate (FITC), carboxyfluorescein (FAM), phycoerythrin, rhodamine, dichlororhodamine (dRhodamine), carboxytetramethylrhodamine (TAMRA), carboxy-X-rhodamine (ROX), LIZ, VIC, NED, PET, SYBR, PicoGreen, RiboGreen, etc.Descriptions of fluorophores and their uses can be found, inter alia, in R. Haugland, Handbook of Fluorescent Probes and Research Products, 9th ed. (2002), Molecular Probes, Eugene, Oreg.; M. Schena, Microarray Analysis (2003), John Wiley & Sons, Hoboken, NJ; Synthetic Medicinal Chemistry 2003 / 2004 Catalog, Berry and Associates, Ann Arbor, Mich.; G. Hermanson, Bioconjugate Techniques, Academic Press (1996); and Glen Research 2002 Catalog, Sterling, VA.

[0117] In other embodiments, further testing may be required, particularly if the goal is to further characterize the nucleic acid, e.g., oncogene, present. For example, in the case of a multiplexed assay, this can be achieved by associating light output with any of the genes amplified in the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs. An alternative approach would be to determine whether any of the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs contain any oncogenes, e.g., using a binary output from an intercalated dye. These can then be sorted, and the droplets and / or GUVs can be recovered so they can be analyzed in more detail to determine which oncogenes they contain. Microfluidic or non-microfluidic techniques can be used to determine the oncogenes present in such droplets and / or GUVs. Using non-microfluidic techniques, droplets and / or GUVs identified as containing an oncogene can be placed into wells on a well plate, where they are diluted into a larger volume to release all of the PCR product generated during the multiplexed PCR reaction. The sample from this well can then be transferred to other wells, into each of which primers for one oncogene are added, and the wells are then temperature cycled to initiate PCR, at which point an intercalating dye is added, causing wells with matching oncogenes and primers to light up.

[0118] Thus, when performing the subject method, components can be detected based on, for example, a change in fluorescence. In some embodiments, the change in fluorescence is due to fluorescence resonance energy transfer (FRET). This approach uses a special primer set in which the 5' primer has a quencher dye and the 3' primer has a fluorescent dye. These dyes can be located anywhere on the primers, either at the ends or in the middle. Because the primers are complementary, they exist as double strands in solution. Therefore, because they are close to each other, the emission of the fluorescent dye is quenched by the quencher dye, causing the solution to appear dark. After PCR, these primers will become incorporated into long PCR products and move farther apart. This will cause the fluorescent dye to emit light, making the solution fluorescent. Therefore, to detect the presence of a specific oncogene, the intensity of the droplets and / or GUVs can be measured at the wavelength of the fluorescent dye. To detect the presence of different oncogenes, this can be done with differently colored dyes for the different primers. This causes the droplets and / or GUVs to fluoresce at all wavelengths corresponding to the primers for the oncogenes present in the cell.

[0119] Detection of cells (e.g., tumor cells) in single emulsion droplets, multiple emulsion droplets, and / or GUVs Embodiments of the subject methods include detecting the presence of one or more cells or cell subsets (e.g., tumor cells) in a biological sample. Such methods can include, for example, the steps of encapsulating cells in monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs; subjecting the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs to conditions sufficient to result in lysis of the cells in the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs; subjecting the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs to one or more emulsions that have an inhibitory effect on nucleic acid amplification. introducing nucleic acid synthesis reagents, e.g., nucleic acid amplification reagents, into the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs; if present, subjecting the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs to nucleic acid synthesis conditions, e.g., nucleic acid amplification conditions, sufficient to result in synthesis, e.g., amplification, of the target nucleic acid; if present, detecting amplification products or synthesis products resulting from synthesis, e.g., amplification, of the target nucleic acid.

[0120] A biological sample (e.g., whole blood) may be collected from a subject using any convenient means. The biological sample may be processed to remove non-cellular components, for example, using processing steps such as centrifugation, filtration, etc. If desired, cells may be stained with one or more antibodies and / or probes before being encapsulated in monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs.

[0121] One or more lysing agents may also be added to the cell-containing monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs under conditions that can cause the cells to rupture, thereby releasing the cell's genome. The lysing agent may be added after the cells are encapsulated in the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs. Any suitable lysing agent may be used, for example, any suitable protease and / or proteinase (e.g., a protease and / or proteinase with broad substrate specificity, e.g., a nonspecific serine protease, e.g., proteinase K, a protease derived from Bacillus licheniformis (e.g., CAS No. 9014-01-1)), OB protease (available from Omega Bio-Tek), or a cytotoxin. In certain embodiments, cells may be co-encapsulated in monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs with a lysis buffer containing a detergent such as Triton X-100 and / or proteinase K. The specific conditions that may cause cell rupture will vary depending on the particular lysis agent used. For example, if proteinase K is incorporated as the lysis agent, the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs may be heated to about 37-60°C for about 15-20 minutes to lyse the cells and allow the proteinase K to digest cellular proteins, and then they may be heated to about 95°C for about 5-10 minutes to inactivate the proteinase K.

[0122] In some embodiments, a lysis agent may be added to cells prior to or simultaneously with encapsulation of the cells into the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs described herein. Any convenient lysis agent may be used, for example, any suitable protease and / or proteinase (e.g., a protease and / or proteinase with broad substrate specificity, e.g., a nonspecific serine protease, e.g., proteinase K, a protease derived from Bacillus licheniformis (e.g., CAS No. 9014-01-1)), OB protease (available from Omega Bio-Tek), or a cytotoxin. In some embodiments, detergents are not specifically utilized, as they may result in premature cell lysis prior to encapsulation. In such embodiments, the protease and / or proteinase, e.g., proteinase K, may be added to the cells prior to or simultaneously with encapsulation of the cells in monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs, e.g., in the absence of surfactant. The protease and / or proteinase, e.g., proteinase K, may be added at a temperature low enough to ensure that the protease and / or proteinase is not in an active state prior to or during encapsulation of the cells, e.g., from about 0°C to about 25°C, including from about 1°C to about 5°C, from about 1°C to about 10°C, from about 1°C to about 15°C, or from about 1°C to about 20°C. In some embodiments, the protease and / or proteinase may be added at about 4°C. Subsequently, the temperature of the monodisperse single emulsion droplets, multiple emulsion droplets and / or GUVs can be increased to a temperature sufficient to ensure protease and / or proteinase activation, e.g., 37-80°C, e.g., 30-50°C, 37-55, 40-60°C, 50-60°C, 60-70°C, or 70-80°C, to promote protease and / or proteinase activation and lysed cells.The protease and / or proteinase incubation may be for a time sufficient to result in cell lysis, e.g., 15 to 60 minutes (or longer if necessary), e.g., 15 to 20 minutes. The emulsion may then be broken, and the protease and / or proteinase may be washed away if necessary. Such methods are used, for example, in the single-cell RNA sequencing (scRNAseq) methods described herein.

[0123] In certain embodiments, cell lysis may also, or instead, rely on techniques that do not involve the addition of lysing agents. For example, lysis may be achieved by mechanical techniques that may use various geometric features to puncture, shear, abrade, etc. the cells. Other types of mechanical disruption, such as acoustic techniques, may also be used. Additionally, thermal energy may be used to lyse cells. Any convenient means of performing cell lysis may be used in the methods described herein.

[0124] Primers can be introduced into monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs for each gene and / or genetic marker, e.g., oncogene, to be detected. Thus, in some embodiments, primers for various genes and / or genetic markers, e.g., all oncogenes, are simultaneously present in monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs, thereby enabling multiplexed assays. The droplets and / or GUVs may be temperature cycled so that droplets and / or GUVs containing target cells, e.g., cancer cells, undergo PCR. Alternatively, or in addition, MDA or other isothermal nucleic acid amplification methods, such as loop-mediated isothermal nucleic acid amplification (LAMP), strand displacement amplification (SDA), helicase-dependent amplification (HDA), and nicking enzyme amplification reaction (NEAR), can be utilized. Only primers corresponding to oncogenes and / or genetic markers present in the genome will induce amplification, resulting in the generation of many copies of these oncogenes and / or genetic markers in the droplets and / or GUVs. Detection of the presence of these amplification products can be achieved in a variety of ways, such as by FRET, staining with an intercalating dye, or attachment to beads. The droplets and / or GUVs can be optically probed to detect the amplification products. In some embodiments, optically probing the droplets and / or GUVs can include enumerating the tumor cells present in the initial population and / or allowing identification of the oncogene present in each tumor cell.

[0125] The subject methods can be used to determine whether a biological sample contains particular cells of interest, e.g., tumor cells. In certain embodiments, the subject methods can include quantifying the number of cells of interest, e.g., tumor cells, present in the biological sample. Quantifying the number of cells of interest, e.g., tumor cells, present in the biological sample can be based, at least in part, on the number of droplets and / or GUVs in which amplification products are detected. For example, droplets and / or GUVs can be generated under conditions in which the majority of droplets are expected to contain zero or one cell. Using techniques described more fully herein, droplets and / or GUVs that do not contain any cells can be removed. After performing the PCR steps outlined above, the total number of droplets and / or GUVs detected to contain amplification products can be counted to quantify the number of cells of interest, e.g., tumor cells, in the biological sample. In certain embodiments, the methods can also include counting the total number of droplets and / or GUVs to determine the proportion or percentage of cells from the biological sample that are cells of interest, e.g., tumor cells.

[0126] In some embodiments, introducing a synthesis reagent into multiple emulsion droplets and / or GUVs prepared from monodisperse droplets described herein comprises introducing the synthesis reagent into a third fluid, wherein the synthesis reagent diffuses from the third fluid through the immiscible shell into the first fluid of the multiple emulsion droplets and / or GUVs.

[0127] The cells and / or cellular material of interest may be recovered by sorting the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs and recovering the contents via droplet rupture, e.g., by chemical, electrical, or mechanical means as described in more detail herein. A variety of suitable sorting techniques and associated devices may be utilized to sort and separate monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs containing amplification and / or synthesis products, including those described herein.

[0128] Nucleic acid detection in single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs As discussed herein, the disclosed methods find use in detecting nucleic acids of interest, such as DNA or RNA, from various biological samples. Such methods may include, for example, encapsulating nucleic acids and synthesis reagents in monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs; subjecting the monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs to amplification conditions sufficient to result in amplification of the nucleic acid; and detecting the amplification products resulting from the amplification of the nucleic acid. The amplification conditions may be MDA conditions and / or PCR conditions, such as RT-PCR conditions, and / or additional isothermal nucleic acid amplification conditions, such as loop-mediated isothermal nucleic acid amplification (LAMP), strand displacement amplification (SDA), helicase-dependent amplification (HDA), and nicking enzyme amplification reaction (NEAR).

[0129] Nucleic acids of interest can be recovered by sorting the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs and recovering the contents via droplet rupture, e.g., by chemical, electrical, or mechanical means as described in more detail herein. A variety of suitable sorting techniques and associated devices can be utilized to sort and separate monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs containing amplification products, including those described herein.In one aspect, a method of enriching a target nucleic acid sequence is provided, the method including the steps of: encapsulating a sample comprising nucleic acids into a plurality of monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs; introducing MDA reagents and polymerase chain reaction (PCR) reagents and a plurality of suitable primers into the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs; incubating the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs under conditions sufficient for MDA amplification and conditions sufficient for PCR amplification to generate MDA amplification products and PCR amplification products, respectively (wherein the suitable PCR primers may comprise one or more primers that hybridize to one or more oligonucleotides that incorporate the target nucleic acid sequence, and wherein the PCR amplification products do not comprise the entire target nucleic acid sequence); either before or after incubation, encapsulating the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs in a suitable manner. detecting the presence or absence of PCR amplification products by detecting the detection component (wherein detection of the detection component indicates the presence of the PCR amplification products and the target nucleic acid sequences); and sorting the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs based on detection of the detection component (wherein sorting separates monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs containing the PCR amplification products and the target nucleic acid sequences, if present, from monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs that do not contain the PCR amplification products and the target nucleic acid sequences, if present); and pooling nucleic acid sequences from the sorted monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs, if present, to provide an enriched pool of target nucleic acid sequences. One or more of these steps may be performed under microfluidic control.

[0130] The above method allows for the enrichment of DNA molecules from a heterogeneous system based on the presence of subsequences detectable by, for example, PCR. The DNA molecules can be short (e.g., hundreds of bases) or long (e.g., megabases or longer). The sample can be encapsulated in droplets such that target molecules are digitally detected within the monodisperse droplets (i.e., each droplet contains 0 or 1 target molecules). The monodisperse droplets can then be sorted, for example, based on fluorescence, to recover the target molecules. This method can be used to enrich large genomic regions, e.g., on the order of megabases in length, in a heterogeneous sample of DNA fragments.

[0131] The above method allows for the recovery of sufficient amounts of DNA for sequencing without the need for PCR to amplify the DNA for sequencing. For example, amplification-free DNA sample preparation is useful when PCR does not preserve the sequence or epigenetic factors of interest or cannot recover sequences of the required length (e.g., the practical limit of long-range PCR is greater than about 10 kb).

[0132] Another application of the above method is to enrich DNA for epigenetic sequencing. Because epigenetic marks on DNA are not preserved by PCR, sequencing requires unamplified DNA derived from the host nucleic acid. This method allows for the generation of sufficient DNA for sequencing without the need for PCR, thereby preserving epigenetic marks.

[0133] The above methods are particularly useful when the length of the target nucleic acid exceeds the practical limit of long-range PCR, for example, when the nucleic acid is larger than about 10 kb, and / or when it is desired to preserve epigenetic marks on the DNA. In some embodiments, the target nucleic acid to be enriched is larger than about 100 kb in length, for example, larger than about 1 megabase in length. In some embodiments, the target nucleic acid to be enriched is about 10 kb to about 100 kb, about 100 kb to about 500 kb, or about 500 kb to about 1 megabase in length.

[0134] After amplification and / or purification, emulsions may be broken using both chemical and osmotic means for further analysis. For example, an equal volume of 1H,1H,2H,2H-perfluoro-1-octanol may be added to the purified sample and mixed by pipetting or vortexing. The resulting mixture may then be equilibrated, and the aqueous layer may be eluted for further analysis. Similarly, a large excess of purified water may be added to the sorted sample, mixed, and allowed to incubate at room temperature for several hours. The resulting mixture may then be directly analyzed for the purified sample of interest.

[0135] Multiple displacement amplification As summarized above, in practicing the methods of the present invention, MDA can be used to amplify nucleic acids, e.g., genomic DNA, in a generally unbiased, non-specific manner for downstream analysis, e.g., via next-generation sequencing.

[0136] Exemplary embodiments of the methods described herein include encapsulating nucleic acid template molecules obtained from a biological sample into monodisperse droplets (e.g., monodisperse single-emulsion droplets or monodisperse multiple-emulsion droplets), introducing an MDA reagent and a plurality of MDA primers into the monodisperse droplets, and incubating the monodisperse droplets under conditions effective to generate MDA amplification products, wherein the incubation is effective to generate MDA amplification products from the nucleic acid template molecules. In some embodiments, the encapsulating and introducing steps are performed as a single step, e.g., in which the nucleic acid template molecules are mixed with the MDA reagent and a plurality of MDA primers and emulsified using, e.g., a flow-focusing element of a microfluidic device.

[0137] The conditions for the MDA-based assays described herein may be varied in one or more ways. For example, the number of MDA primers that can be added (or encapsulated) to monodisperse droplets can be varied. The term "primer" refers to one or more primers, whether naturally occurring as found in a purified restriction digest or synthetically produced, and refers to an oligonucleotide that, when placed under conditions that catalyze the synthesis of a primer extension product complementary to a nucleic acid strand, can serve as a synthesis initiation point along a complementary strand. Such conditions include the presence of four different deoxyribonucleoside triphosphates and a polymerization inducer, such as a suitable DNA polymerase (e.g., Φ29 DNA polymerase or Bst DNA polymerase), in an appropriate buffer (a "buffer" containing cofactors or substituents that affect pH, ionic strength, etc.) and at a suitable temperature. Primers are preferably single-stranded for maximum efficiency in amplification. In MDA, random hexamer primers are routinely utilized.

[0138] As used herein, the complement of a nucleic acid sequence refers to the oligonucleotide that is in " antiparallel association " when aligned with a nucleic acid sequence so that the 5' end of one sequence pairs with the 3' end of the other.Complementarity does not need to be perfect; a stable duplex may contain mismatched base pairs or unmatched bases.Those skilled in the art of nucleic acid technology can empirically determine duplex stability, taking into account several variables, including, for example, the length of the oligonucleotide, the percentage concentration of cytosine and guanine bases in the oligonucleotide, ionic strength, and the occurrence rate of mismatched base pairs.

[0139] The number of MDA primers that can be added (or encapsulated) to monodisperse droplets can range from about 1 to about 500 or more primers, for example, about 2 to 100 primers, about 2 to 10 primers, about 10 to 20 primers, about 20 to 30 primers, about 30 to 40 primers, about 40 to 50 primers, about 50 to 60 primers, about 60 to 70 primers, about 70 to 80 primers, about 80 to 90 primers, about 90 to 100 primers, about 100 to 150 primers, about 150 to 200 primers, about 200 to 250 primers, about 250 to 300 primers, about 300 to 350 primers, about 350 to 400 primers, about 400 to 450 primers, about 450 to 500 primers, or about 500 primers or more.

[0140] Such primers and / or reagents may be added to the monodisperse droplets in one step or in more than one step. For example, primers may be added in two or more steps, three or more steps, four or more steps, or five or more steps. When a lysis agent is used, regardless of whether the primers are added in one step or more than one step, the primers may be added after, before, or simultaneously with the addition of the lysis agent. If added before or after the addition of the lysis agent, the MDA primers may be added in a step separate from the addition of the lysis agent.

[0141] Once the primers have been added to the monodisperse droplets, the monodisperse droplets may be incubated under conditions sufficient for MDA. The monodisperse droplets may be incubated in the same microfluidic device used to add the primers, or in a separate device. In some embodiments, incubation of the monodisperse droplets under conditions sufficient for MDA amplification occurs in the same microfluidic device used for cell lysis. Incubation of the monodisperse droplets may take a variety of forms; for example, the monodisperse droplets may be incubated at a constant temperature, e.g., 30°C, for, e.g., about 8 to about 16 hours. Alternatively, a cycle of 5 minutes at 25°C followed by 25 minutes at 42°C may be utilized.

[0142] Although the methods for generating MDA amplification products described herein do not require the use of specific probes, the methods of the present invention may also include introducing one or more probes into monodisperse droplets. When used herein with respect to nucleic acids, the term "probe" generally refers to a labeled oligonucleotide that forms a double-stranded structure with a sequence of a target nucleic acid due to the complementarity of at least one sequence in the probe with a sequence in the target region. The probe preferably does not contain a sequence complementary to the sequence used to initiate the MDA reaction. The number of probes added can be about 1 to 500, e.g., about 1 to 10 probes, about 10 to 20 probes, about 20 to 30 probes, about 30 to 40 probes, about 40 to 50 probes, about 50 to 60 probes, about 60 to 70 probes, about 70 to 80 probes, about 80 to 90 probes, about 90 to 100 probes, about 100 to 150 probes, about 150 to 200 probes, about 200 to 250 probes, about 250 to 300 probes, about 300 to 350 probes, about 350 to 400 probes, about 400 to 450 probes, about 450 to 500 probes, or more than about 500 probes. Probes can be introduced into the monodisperse droplets before, subsequent to, or after the addition of one or more primers.

[0143] In some embodiments, MDA-based assays can be used to detect the presence of specific RNA transcripts present in cells or to sequence the genomes of one or more RNA viruses. In such embodiments, MDA reagents can be added to monodisperse droplets using any of the methods described herein. Before or after addition of the MDA reagent (or encapsulation), the monodisperse droplets can be incubated under conditions that allow reverse transcription followed by MDA-enabling conditions as described herein. The monodisperse droplets can be incubated on the same microfluidic device used to add the MDA reagent, or on a separate device. In some embodiments, incubation of the monodisperse droplets under conditions that allow MDA is performed on the same microfluidic device used to encapsulate and / or lyse one or more cells.

[0144] In some embodiments, the reagents added to the monodisperse droplets for MDA further include a fluorescent DNA probe capable of detecting MDA amplification products. Any suitable fluorescent DNA probe may be used, including, but not limited to, SYBR Green, TaqMan®, Molecular Beacons, and Scorpion probes. In some embodiments, the reagents added to the monodisperse droplets include more than one DNA probe, for example, two, three, or four fluorescent DNA probes. The use of multiple fluorescent DNA probes allows for simultaneous measurement of MDA amplification products in a single reaction.

[0145] PCR As summarized above, in practicing the methods of the present invention, PCR-based assays can be used to detect the presence of specific nucleic acids of interest, such as genes and / or genetic markers of interest, e.g., oncogenes, present in cells or heterogeneous samples of nucleic acids. Such PCR-based assays can be performed in the same monodisperse droplets as a preceding or subsequent MDA amplification step, e.g., monodisperse single-phase emulsion droplets or monodisperse multiple-phase emulsion droplets. In other embodiments, PCR reactions can be performed independently in monodisperse droplets. The conditions for such PCR-based assays can be varied in one or more ways.

[0146] For example, the number of PCR primers that may be added to monodisperse single-phase emulsion droplets or multiple-phase emulsion droplets and / or GUVs can vary. The term "primer" refers to one or more primers, whether naturally occurring as found in a purified restriction digest or synthetically produced, and refers to an oligonucleotide that can serve as a synthesis initiation point along a complementary strand when placed under conditions that catalyze the synthesis of a primer extension product complementary to the nucleic acid strand. Such conditions include the presence of four different deoxyribonucleoside triphosphates and a polymerization inducer, such as a DNA polymerase or reverse transcriptase, in an appropriate buffer (a "buffer" containing cofactors or substituents that affect pH, ionic strength, etc.) and at a suitable temperature. Primers are preferably single-stranded for maximum efficiency in amplification.

[0147] As used herein, the complement of a nucleic acid sequence refers to the oligonucleotide that is in " antiparallel association " when aligned with a nucleic acid sequence so that the 5' end of one sequence pairs with the 3' end of the other.Complementarity does not need to be perfect; a stable duplex may contain mismatched base pairs or unmatched bases.Those skilled in the art of nucleic acid technology can empirically determine duplex stability, taking into account several variables, including, for example, the length of the oligonucleotide, the percentage concentration of cytosine and guanine bases in the oligonucleotide, ionic strength, and the occurrence rate of mismatched base pairs.

[0148] The number of PCR primers that can be added to (or encapsulated in) monodisperse single-phase emulsion droplets or multiple-phase emulsion droplets and / or GUVs can range from about 1 to about 500 or more primers, for example, about 2-100 primers, about 2-10 primers, about 10-20 primers, about 20-30 primers, about 30-40 primers, about 40-50 primers, about 50-60 primers, about 60-70 primers, about 70-80 primers, about 80-90 primers, about 90-100 primers, about 100-150 primers, about 150-200 primers, about 200-250 primers, about 250-300 primers, about 300-350 primers, about 350-400 primers, about 400-450 primers, about 450-500 primers, or about 500 primers or more.

[0149] These primers may contain primers for one or more genes of interest, such as oncogenes. The number of primers for genes of interest added can range from about 1 to about 500 or more primers, for example, about 1 to 10 primers, about 10 to 20 primers, about 20 to 30 primers, about 30 to 40 primers, about 40 to 50 primers, about 50 to 60 primers, about 60 to 70 primers, about 70 to 80 primers, about 80 to 90 primers, about 90 to 100 primers, about 100 to 150 primers, about 150 to 200 primers, about 200 to 250 primers, about 250 to 300 primers, about 300 to 350 primers, about 350 to 400 primers, about 400 to 450 primers, about 450 to 500 primers, or about 500 primers or more. Genes and oncogenes of interest include, but are not limited to, BAX, BCL2L1, CASP8, CDK4, ELK1, ETS1, HGF, JAK2, JUNB, JUND, KIT, KITLG, MCL1, MET, MOS, MYB, NFKBIA, EGFR, Myc, EpCAM, NRAS, PIK3CA, PML, PRKCA, RAF1, RARA, REL, ROS1, RUNX1, SRC, STAT3, CD45, cytokeratin, CEA, CD133, HER2, CD44, CD49f, CD146, MUC1 / 2, and ZHX2.

[0150] Such primers and / or reagents may be added to the monodisperse single- or multiple-emulsion droplets and / or GUVs in one step or in more than one step. For example, primers may be added in two or more steps, three or more steps, four or more steps, or five or more steps. When a lysis agent is used, regardless of whether the primers are added in one step or more than one step, the primers may be added after, before, or simultaneously with the addition of the lysis agent. If added before or after the addition of the lysis agent, PCR primers may be added in a separate step from the addition of the lysis agent.

[0151] Once the primers have been added to the monodisperse single emulsion droplets or multiple emulsion droplets and / or GUVs, the monodisperse single emulsion droplets or multiple emulsion droplets and / or GUVs can be incubated under conditions that allow PCR. The monodisperse single emulsion droplets or multiple emulsion droplets and / or GUVs can be incubated in the same microfluidic device used to add the primers, or in a separate device. In some embodiments, incubation of the monodisperse single emulsion droplets or multiple emulsion droplets and / or GUVs under conditions that allow PCR amplification is performed in the same microfluidic device used to encapsulate and lyse the cells. Incubation of the monodisperse single emulsion droplets or multiple emulsion droplets and / or GUVs can take a variety of forms. In certain embodiments, monodisperse single-phase emulsion droplets or multiple-phase emulsion droplets and / or GUVs containing a PCR mix may be flowed through a channel that incubates the monodisperse droplets under conditions effective for PCR. In some embodiments, the PCR reaction is performed without the use of a microfluidic device and / or system. Flowing the monodisperse single-phase emulsion droplets or multiple-phase emulsion droplets and / or GUVs through the channel may involve a channel that meanders through various temperature zones maintained at temperatures effective for PCR. Such a channel may, for example, cycle through two or more temperature zones, where at least one zone is maintained at about 65°C and at least one zone is maintained at about 95°C. Alternatively, zones at 86°C, 60°C, and 20°C may be utilized. As the monodisperse single-phase emulsion droplets or multiple emulsions and / or GUVs pass through such zones, the temperatures required for PCR are cycled. The exact number of zones and the respective temperatures of each zone can be readily determined by one of skill in the art to achieve the desired PCR amplification.

[0152] In other embodiments, incubation of monodisperse single or multiple emulsion droplets and / or GUVs may involve the use of megadroplet arrays. In such devices, an array of hundreds, thousands, or even millions of traps indented into a channel (e.g., a PDMS channel) is placed on a thermal system. The channel is pressurized, thereby preventing gas from escaping. The height of the microfluidic channel is smaller than the diameter of the monodisperse single or multiple emulsion droplets and / or GUVs, causing them to adopt a flat, pancake-like shape. When monodisperse single or multiple emulsion droplets and / or GUVs flow over an unoccupied indentation, a force is generated that draws the monodisperse single or multiple emulsion droplets and / or GUVs completely into the trap, adopting a lower, more energetically favorable radius of curvature. Close-packed flow of monodisperse single or multiple emulsion droplets and / or GUVs ensures that all traps on the array are occupied, and the entire device can be thermally cycled using a heater.

[0153] In one embodiment, the heater comprises a Peltier plate, a heat sink, and a control computer. The Peltier plate allows for heating or cooling of the chip above or below room temperature by controlling the applied current. To ensure controlled and reproducible temperatures, the computer can monitor the temperature of the array using an integrated temperature probe and adjust the applied current to heat and cool as needed. The metal (e.g., copper) plate allows for uniform heating and dissipation of residual heat during cooling cycles, allowing for cooling from about 95°C to about 60°C in less than about one minute.

[0154] The method of the present invention can also include introducing one or more probes into the monodisperse single-phase emulsion droplets or multiple-phase emulsion droplets and / or GUVs. As used herein with respect to nucleic acids, the term "probe" refers to a labeled oligonucleotide that forms a double-stranded structure with a sequence of a target nucleic acid due to the complementarity of at least one sequence in the probe with a sequence in the target region. In some embodiments, the probe does not contain a sequence complementary to a sequence used to initiate a polymerase chain reaction. The number of probes added can be about 1 to 500, e.g., about 1 to 10 probes, about 10 to 20 probes, about 20 to 30 probes, about 30 to 40 probes, about 40 to 50 probes, about 50 to 60 probes, about 60 to 70 probes, about 70 to 80 probes, about 80 to 90 probes, about 90 to 100 probes, about 100 to 150 probes, about 150 to 200 probes, about 200 to 250 probes, about 250 to 300 probes, about 300 to 350 probes, about 350 to 400 probes, about 400 to 450 probes, about 450 to 500 probes, or more than about 500 probes. The probes can be introduced into the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs prior to, subsequent to, or after the addition of one or more primers. Suitable probes include, but are not limited to, TaqMan® probes (e.g., as described in Holland, PM; Abramson, RD; Watson, R.; Gelfand, DH (1991), "Detection of specific polymerase chain reaction product by utilizing the 5'-3' exonuclease activity of Thermus aquaticus DNA polymerase," PNAS, 88(16):7276-7280).

[0155] In certain embodiments, RT-PCR-based assays can be used to detect the presence of a specific transcript of interest, e.g., an oncogene, present in a cell. In such embodiments, in addition to the reagents used to perform PCR as described herein, reverse transcriptase and any other reagents necessary for cDNA synthesis (collectively referred to as "RT-PCR reagents") are added to the monodisperse single or multiple emulsion droplets and / or GUVs. The RT-PCR reagents are added to the monodisperse single or multiple emulsion droplets and / or GUVs using any suitable method described herein. The monodisperse single or multiple emulsion droplets and / or GUVs to which the reagents for RT-PCR have been added may be incubated under conditions that allow reverse transcription, as described herein, followed by PCR. The monodisperse single or multiple emulsion droplets and / or GUVs may be incubated in the same microfluidic device used to add RT-PCR reagents, or may be incubated in a separate device. In one embodiment, incubation of the monodisperse single or multiple emulsion droplets and / or GUVs under conditions that allow RT-PCR is performed in the same microfluidic device used to encapsulate and lyse the cells.

[0156] In some embodiments, the reagents added to the monodisperse single- or multiple-emulsion droplets and / or GUVs for RT-PCR or PCR further include a fluorescent DNA probe capable of detecting RT-PCR or PCR products. Any suitable fluorescent DNA probe may be used, including, but not limited to, SYBR Green, TaqMan®, Molecular Beacons, and Scorpion probes. In some embodiments, the reagents added to the monodisperse single- or multiple-emulsion droplets and / or GUVs include more than one DNA probe, for example, two, three, or four fluorescent DNA probes. The use of multiple fluorescent DNA probes allows for simultaneous measurement of RT-PCR or PCR products in a single reaction.

[0157] Double PCR To amplify rare transcripts, the monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs subjected to the first-step RT-PCR or PCR reaction described herein may be further subjected to a second-step PCR reaction. In some embodiments, the first monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs subjected to the first-step RT-PCR or PCR reaction are encapsulated in second single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs containing additional PCR reagents, including, but not limited to, enzymes (e.g., DNA polymerases), DNA probes (e.g., fluorescent DNA probes), and primers, followed by rupturing the first monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs. In certain embodiments, the second single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs containing additional PCR reagents are larger than the monodisperse droplets subjected to the first-step RT-PCR or PCR reaction. This can be beneficial because, for example, it allows for dilution of cellular components that may be inhibitory to the second-step PCR. The second-step PCR reaction may be performed in the same microfluidic device used to perform the first-step reaction, in a different microfluidic device, or without the use of a microfluidic device.

[0158] In some embodiments, the primers used in the second step PCR reaction are the same primers used in the first step RT-PCR or PCR reaction, while in other embodiments, the primers used in the second step PCR reaction are different from the primers used in the first step reaction.

[0159] Digital PCR The methods described herein can be used to quantify nucleic acids, for example, using digital PCR. In digital PCR, when the sample is isolated in compartments, target nucleic acids from a solution are diluted so that most compartments contain zero or one target molecule. However, higher loading rates can often be used, provided that they can be modeled. Reagents sufficient for amplifying the target nucleic acid are also contained within the compartments, and the compartments are subjected to conditions suitable for amplification. The compartments can have a variety of structures, including microwells or single-phase emulsion droplets fabricated within a substrate. They can also be formed, for example, as monodisperse single-phase emulsion droplets, monodisperse droplets of multiple emulsions, such as two-phase emulsions and / or GUVs, as described herein. In some embodiments, a sample is compartmentalized into monodisperse single-phase emulsion droplets, monodisperse droplets of a multiple-phase emulsion, e.g., a two-phase emulsion and / or GUVs, and the monodisperse single-phase emulsion droplets, monodisperse droplets of a multiple-phase emulsion, e.g., a two-phase emulsion and / or GUVs, are subjected to amplification conditions. Target-containing droplets undergo amplification, while non-target-containing droplets do not, resulting in no nucleic acid amplification product. If a detection component is included, target-containing single-phase or multiple-phase emulsions are filled with a detectable signal and can be identified, for example, by imaging or flow dropometry. A powerful advantage of using two-phase emulsions to perform such digital PCR is that two-phase emulsions can be suspended in an aqueous carrier phase that is miscible with the partitioned sample, making them easily detectable and / or sortable using commercially available flow cytometers and fluorescence-activated cell sorters (FACS). This allows for enrichment of target entities from samples that would not be possible with other methods where sorting is not easily achieved.

[0160] In some embodiments, the disclosed methods can be used to quantify nucleic acids in solution by counting the fraction of single- or multiple-phase emulsions that are fluorescent and undergo amplification, containing at least a single target nucleic acid; spurious amplification can occur for stochastic reasons or due to, for example, the inclusion of dust or other contaminants that interfere with the specificity of the amplification reaction. TaqMan probes, molecular beacons, SYBR, and other types of detection components can also be included, which allows the use of multiple optical spectra to simultaneously detect the amplification of different nucleic acid sequences within a target, or can be advantageous in some cases because multiple targets are encapsulated in the same monodisperse single-emulsion droplet, monodisperse droplet of a multiple-emulsion, such as a two-emulsion droplet, and / or GUV.

[0161] Like other PCR analysis methods, dPCR can be multiplexed using probes labeled with different fluorescent dyes. Because dPCR operates on molecules in droplets, it offers unique measurement opportunities not possible with conventional methods, such as the physical association of distinct sequences. This is valuable for a variety of important applications in genome biology, including characterization of viral diversity, phasing of microbial genomes, haplotyping of cancer genomes, measurement of mRNA splice forms, and characterization of the length distribution of target molecules in solution.

[0162] RNA sequencing (RNAseq) The methods disclosed herein can be used for single-cell encapsulation and RNA sequencing. RNA sequencing utilizes massively parallel sequencing enabled by next-generation sequencing (NGS) technology, which is another approach to analyzing RNA transcripts within tissue samples. Specifically, RNA sequencing can be used to study changes in gene expression, alternative splicing events, allele-specific gene expression, and phenomena such as gene fusion events, novel transcripts, and chimeric transcripts, including RNA editing. Complementary DNA (cDNA) can be recovered from the monodisperse emulsion, and standard in vitro transcription and library preparation for NGS are performed to collect data for single-cell gene expression profile analysis.

[0163]

[0006] Provided herein are methods for single-cell RNA sequencing, the methods comprising: combining a plurality of monodisperse template particles with a first fluid comprising a plurality of cells to form a first mixture; combining the first mixture with a second fluid immiscible with the first fluid to form a second mixture; and shearing the second mixture to encapsulate the plurality of monodisperse template particles into a plurality of monodisperse droplets in the second fluid, thereby providing a plurality of monodisperse droplets comprising the first fluid, one of the monodisperse template particles, and one of the plurality of cells. Such methods may include a cell lysis step described herein, e.g., a protease and / or proteinase lysis step described herein, e.g., a proteinase K lysis step described herein. For example, a protease and / or proteinase, e.g., a protease and / or proteinase with broad substrate specificity, e.g., a non-specific serine protease, e.g., proteinase K, a protease from Bacillus licheniformis (e.g., CAS No. 9014-01-1), or OB protease (available from Omega Bio-Tek), may be added to cells, e.g., in the absence of surfactant, before or simultaneously with encapsulation of the cells into monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs. The protease and / or proteinase may be added at a temperature low enough to ensure that the protease and / or proteinase is not in an active state prior to or during encapsulation of the cells, for example, at a temperature of about 0° C. to about 25° C., including about 1° C. to about 5° C., about 1° C. to about 10° C., about 1° C. to about 15° C., about 1° C. to about 20° C., or about 1° C. to about 25° C. In some embodiments, the protease and / or proteinase may be added at about 4° C.Subsequently, the temperature of the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs can be increased to a temperature sufficient to ensure protease and / or proteinase activation, e.g., 37-80°C, e.g., 30-50°C, 37-55°C, 40-60°C, 50-60°C, 60-70°C, or 70-80°C, to promote proteinase K activation and lysed cells. The proteinase K incubation can be for a time sufficient to result in cell lysis, e.g., 15-60 minutes (or longer as needed), e.g., 15-20 minutes. The emulsion can then be broken, and the protease and / or proteinase, e.g., proteinase K, can be washed away as needed. RNA from the lysed cells can be captured for subsequent sequencing using any appropriate method and reagents in the monodisperse droplets, e.g., before breaking the emulsion. For example, functionalized RNA capture beads, such as Drop-seq beads available from ChemGenes Corporation, can be encapsulated with cells in monodisperse droplets. In some embodiments, such functionalized RNA capture beads can be directly incorporated into template particles. For example, functionalized RNA capture beads can be encapsulated in a suitable polymer (such as a hydrogel) material, such as BAC polyacrylamide hydrogel, using bis(acryloyl)cystamine as a crosslinker for polyacrylamide bead synthesis.

[0164] Nucleic acid length measurement The methods described herein can be used to measure the length distribution of nucleic acids in solution. This can be achieved by designing probe sequences that anneal to target nucleic acids at different regions at known distances along their length. The probes can then be mixed with the target nucleic acids and compartmentalized into monodisperse single-emulsion droplets, multiple-emulsion droplets, and / or GUVs. Each monodisperse single-emulsion droplet, multiple-emulsion droplet, and / or GUV can contain, for example, two primer-probe sets that signal the presence of two different regions on the target separated by a known distance. This can be repeated for different combinations of probes, with different pairs probing different distances and different regions of the target. The sample can then be subjected to amplification, analysis, and sorting as needed. In the analysis, one skilled in the art will find that some monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs undergo amplification with only one of the probes, while others undergo amplification with, for example, only the other probe. This suggests that among these single emulsion droplets, multiple emulsion droplets, and / or GUVs, one type contains exactly one region of the probe, while the other type contains the region of the other probe. In this population, single emulsion droplets, multiple emulsion droplets, and / or GUVs may also undergo amplification with both probes, indicating that the target nucleic acid therein contains both regions. Of course, there will be many single emulsion droplets, multiple emulsion droplets, and / or GUVs in the same suspension, each containing a measurable fraction of droplets of the three types, in addition to those that do not undergo amplification and therefore likely do not contain the target region. This data can be used to infer the length of the nucleic acid in solution.

[0165] For example, if the nucleic acid in solution is largely intact as a whole molecule, the majority of droplets undergoing amplification will show a mixed signal, since both sets of probes and primers will show amplification. In contrast, if the nucleic acid target is highly fragmented, most detection events will be due to one or the other probe, with only rare instances due to both probes. Because the distance between the probes may be known, one skilled in the art can estimate the length and fragmentation of the molecule in solution. This process can be repeated with various probe sets targeting different regions and / or with different distances between them to more fully characterize the fragmentation of the target nucleic acid.

[0166] Microfluidic Enrichment for Sequence Analysis (MESA) in Single Emulsion Droplets, Multiple Emulsion Droplets, and / or GUVs The methods described herein can be used to perform microfluidic enrichment (MESA) for sequence analysis of target nucleic acids. This is achieved by encapsulating target nucleic acids in monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs, and performing amplification in the droplets to emit a fluorescent signal if the droplet contains the target sequence. These droplets can then be sorted to enrich the nucleic acid in the sorted pool. Reactions can also be multiplexed, if desired, to distinguish between molecules containing multiple different subsequences. Amplification can also be used to amplify the nucleic acids being sorted before, simultaneously with, or after sorting to enable sequencing.

[0167] A key advantage of this approach is that the region amplified in the droplet can simply be used as the "detection region"; the amplicon need not contain the molecule to be sequenced. Instead, if the target molecule is present in the droplet, those regions will emit a signal, allowing the entire molecule to be recovered for downstream analysis. This is powerful because large nucleic acids can be recovered for downstream analysis, even if they are too large to be efficiently amplified. For example, suppose there is a gene in a previously undiscovered microorganism that is thought to be part of an important biological pathway, such as a signaling cascade. The goal is to recover genes encoding proteins involved in this pathway so that they can be sequenced and studied. This cannot be easily achieved using existing enrichment methods because unknown microorganisms cannot be specifically cultured, and pathways with largely unknown sequences cannot be purified using hybridization probes because the sequences to which the probes hybridize are unknown, ignoring individual genes that may be too small to extract the entire pathway. However, this can be achieved using the MESA method described herein.

[0168] In some embodiments, target-derived nucleic acids may be fragmented into fragments large enough to encapsulate entire pathways, e.g., tens or hundreds of kilobases, or even megabases in length or longer. If a pathway is present within the fragments, they may contain known genes. Fragmented nucleic acids, most of which do not contain the target, are subjected to the techniques described herein to generate monodisperse single-phase emulsion droplets that do not contain the pathway and therefore show no amplification, while rare droplets that contain the pathway undergo amplification. Positive droplets can then be recovered, for example, by FACS sorting the fluorescently bright two-phase emulsion. These can then be subjected to further manipulations, such as specific and non-specific amplification, quantification by digital PCR or quantitative PCR, and DNA sequencing, as needed. A powerful advantage of MESA over other enrichment strategies is that very large nucleic acids, even up to the size of an entire genome, can be detected and recovered based on known sequences as short as just a few tens of base pairs out of hundreds of base pairs. Few other enrichment methodologies have the ability to enrich such large nucleic acid sequences from heterogeneous pools with such limited sequence information.

[0169] This method can also be used to identify the DNA sequence of an individual genome. In this embodiment, nucleic acids from the target may be fragmented and encapsulated into monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs together with PCR reagents and primers specific to the DNA sequence of interest. After amplification, positive monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs may be sorted into individual compartments, such as well plate arrays, using FACS or MACS. The individual compartments may then be subjected to further manipulations, such as specific amplification or non-specific amplification. The resulting amplicons may then be used to create libraries for next-generation sequencing techniques or as material directly used in Sanger sequencing. This technology is useful, for example, in methods designed to identify genetic differences in retroviral populations, such as HIV, found in individual patients.

[0170] As discussed above, the methods described herein can be used for microfluidic enrichment (MESA) for digital PCR and related sequencing analysis. In some embodiments, samples containing nucleic acids, viruses, cells, particles, etc. are distributed into the single-phase or multiple-phase emulsions described herein. Droplets are collected in reservoirs, e.g., PCR tubes, and incubated under conditions suitable for amplification, such as thermal cycling. Isothermal methods, e.g., MDA, MALBAC, LAMP, etc., can also be used. Fluorescent reporters can be included in the droplets or added to the carrier phase to induce fluorescence differences between droplets containing target nucleic acids and those not containing target nucleic acids.

[0171] For example, Sybr green can be added to the carrier phase so that it distributes into a single or multiple emulsion. Because Sybr fluoresces significantly in the presence of double-stranded DNA, droplets that undergo amplification will be brighter in fluorescence than droplets that do not undergo amplification. To quantify the number of target molecules in a sample, the droplets can be subjected to flow cytometry analysis or even fluorescence-activated cell sorting (FACS).

[0172] As droplets flow through a flow cytometer, information about their size and fluorescence can be recorded. In examples where target molecules are loaded at limiting dilution, some droplets will contain the target molecule and be detected as fluorescent, while others will lack the target molecule and be detected as dim. The fraction of bright to dim droplets can be used to estimate the starting concentration of the target molecule in the original sample, according to a Poisson distribution. Using FACS to sort droplets based on fluorescence allows the recovery of a two-phase emulsion containing the target molecule, and breaking the two-phase emulsion allows the recovery of the target molecule. This can be used to screen large heterogeneous populations of nucleic acids to selectively recover target sequences. The above method can also be performed using GUVs, where appropriate, instead of multiple emulsion droplets.

[0173] PCR-activated cell sorting (PACS) in single emulsion droplets, multiple emulsion droplets, and / or GUVs While the MESA technique allows for the concentration of naked nucleic acids from solution, a similar approach may be applied to nucleic acids contained within entities, such as cells, viruses, spores, particles, etc., where the process is largely the same. For example, entities containing target nucleic acids may be encapsulated in the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs described above and subjected to conditions sufficient to amplify the target nucleic acids. The monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs may then be sorted based on amplification to recover target-bearing entities.

[0174] An important consideration when applying this technique to entities, particularly biological entities with membranes or protective shells, such as cells, is that the nucleic acids must be accessible to amplification reagents for specific detection to occur, which may require specialized procedures. For example, entities may be encapsulated in monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs along with a nucleic acid-releasing agent, such as a protease, lysozyme, detergent, or strong base. Entities may also be encapsulated in monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs and then immersed in a solution containing a lysis agent, which may partition the shell through the monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs and induce lysis. Entities may also be encapsulated in gel particles, for example, which may be immersed in a lysis agent. These gel particles, which may contain the nucleic acids of interest, may then be encapsulated in monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs for detection via an amplification procedure. The gel may be selected so as not to inhibit the lysis or amplification reaction, for example, by ensuring that the pore size is large enough to trap the nucleic acid while allowing reagents to diffuse through the gel, or by allowing the monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs to melt immediately upon heating, as is the case with agarose. The gel may also be functionalized, if desired, to attach desired cellular compounds, such as RNA molecules, that would otherwise leak out of the gel and become undetectable. Yet another procedure that can be performed to allow synthetic reagents access to the target nucleic acid is to use an electric current to lyse cells, viruses, particles, etc., because they are encapsulated in the monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs. This can be achieved, for example, by passing the cells through a channel through which an electric current flows, which can create pores in the cell membrane, for example, facilitating cell lysis.

[0175] Live cell PCR-activated cell sorting (PACS) The application of emulsion PCR and sorting to cells described herein has involved lysis and, in most cases, the death of the organism. However, by modifying the approach and using the methods described herein, it is also possible to recover live, intact cells. This can be achieved, for example, by encapsulating live cells in monodisperse single-emulsion droplets, monodisperse multiple-emulsion droplets, and / or GUVs while maintaining cell viability under conditions that cause leakage of cellular contents into the encapsulating monodisperse single-emulsion droplets, multiphase emulsion droplets, and / or GUVs. This can be achieved, for example, by passing cells through a channel that also carries an electric current, which can induce pore formation in the cell membrane and allow leakage of cell lysate. As the cells exit the channel, their membranes can seal against the underside, while the leaked lysate still surrounds the cells. For laminar flow conditions, this can be done so that the lysate surrounding the cells flows with the cells and is encapsulated in the same compartment, e.g., monodisperse single-emulsion droplets, multiple-emulsion droplets, and / or GUVs. Reagents suitable for amplifying cellular nucleic acids or detecting other cellular components can also be included so that the lysate surrounding the cells can interact with the reagents when in the droplet. The reaction can be designed to emit a fluorescent signal, allowing droplets containing target cells to be recovered via sorting, enabling live cell recovery. This is a powerful use of the technology because it provides the benefits of PACS (the ability to differentiate cells based on sequence biomarkers, e.g., molecules and RNA) while preserving cell lifespan for other reactions and analyses.

[0176] Mass spectrometry activated cell sorting (MS-ACS) In some embodiments, the methods described herein rely on the ability to compartmentalize reactions within monodisperse single-emulsion droplets, multiple-emulsion droplets, e.g., two-phase emulsion droplets and / or GUVs, detect reaction products within the monodisperse single-emulsion droplets, multiple-emulsion droplets and / or GUVs, and sort the droplets and / or GUVs to recover specific entities based on their products and perform appropriate analyses. Many assay types, such as enzymatic assays, e.g., PCR, can be performed to distinguish between different entities, e.g., cells and viruses. However, in some cases, enzymatic techniques may not be able to detect the analyte of interest. In this case, other methods, such as spectroscopy, can be implemented. Mass spectrometry is a very powerful detection method because it is highly sensitive and common. However, a limitation of mass spectrometry is that it is a destructive technique that destroys the sample being analyzed. While this may be acceptable if the goal is simply to recover information, in some cases it is desirable to recover additional material from a system that would normally be destroyed by a mass spectrometer.

[0177] Using the methods described herein, mass spectrometry can be used to analyze samples while still allowing for sample recovery. For example, assume the goal is to identify cells expressing proteins involved in a pathway. Cells can be loaded and cultured into monodisperse single emulsion droplets, multiple emulsion droplets, e.g., binary emulsions, and / or GUVs, so that they are abundant in each monodisperse single emulsion droplet, multiple emulsion droplet, and / or GUV, and / or can produce pathway products, e.g., molecules, compounds, etc., that will fill the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs. The monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs can then be flowed through a device that will split a portion of the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs, capturing a portion of the material from the cells or cell secretions, which can then be subjected to destructive mass spectrometry. The other portion can then be sorted. A mass spectrometer can be used to analyze the compounds in the sampled portion, and this information can be used to determine how to sort the sister portions of the droplet. Using this method, it is possible to collect whole cells or whole cell lysates while specifically sorting cells using highly sensitive and general mass spectrometry methods.

[0178] Colony growth and lysis The ability to encapsulate cells in monodisperse single emulsion droplets, multiple emulsion droplets, e.g., two-phase emulsions, and / or GUVs is useful for culturing living organisms, such as cells and viruses. For example, if cells are grown in a single, shared volume, competition between cells can result in certain cells taking over the population, comprising the majority of cells after some culture time. By compartmentalizing cells in monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs and culturing them, competition can be controlled and / or mitigated. Furthermore, the permeability of monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs can be set to allow certain molecules to pass through while others cannot. This allows, for example, signaling molecules or other molecules important for proliferation to freely pass through the shell of the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs, allowing for better control of culture conditions.

[0179] multiplexing In certain embodiments of the subject methods, multiple biomarkers can be detected and analyzed for a particular cell. The detected biomarkers can include, but are not limited to, one or more proteins, transcripts, and / or genetic signatures in the cell's genome, or a combination thereof. With standard fluorescence-based detection, the number of biomarkers that can be simultaneously interrogated can be limited to the number of fluorescent dyes that can be independently visualized within each monodisperse single emulsion droplet, multiple emulsion droplet, and / or GUV. In certain embodiments, the number of biomarkers that can be individually detected within a particular monodisperse single emulsion droplet, multiple emulsion droplet, and / or GUV can be increased. For example, this can be achieved by separating dyes into different portions of the monodisperse single emulsion droplet, multiple emulsion droplet, and / or GUV. In certain embodiments, beads (e.g., LUMINEX® beads) conjugated with dyes and probes (e.g., nucleic acid or antibody probes) can be encapsulated in monodisperse single-emulsion droplets, multiple-emulsion droplets, and / or GUVs to increase the number of biomarkers analyzed. In another embodiment, fluorescence polarization can be used to achieve more detectable signals for different biomarkers for single cells. For example, fluorescent dyes can be attached to various probes, and monodisperse single-emulsion droplets, multiple-emulsion droplets, and / or GUVs can be visualized under different polarization conditions. In this way, the same colored dye can be utilized to provide signals for different probe targets for single cells. The use of fixed and / or permeabilized cells (discussed in more detail below) also allows for increased levels of multiplexing. For example, labeled antibodies can be used to target protein targets localized to cellular components, while labeled PCR and / or RT-PCR products are free within monodisperse single-emulsion droplets, multiple-emulsion droplets, and / or GUVs. This allows the same color dye to be used for the antibody and for the amplicon generated by RT-PCR.

[0180] Digital enzyme-linked immunosorbent assay (ELISA) In some embodiments, the disclosed methods and devices can be used to quantify epitopes in a sample using a digital ELISA procedure. In some embodiments, for example, an epitope bound to a solid substrate, such as a flat substrate surface or the surface of a bead, can additionally bind with an affinity reagent labeled with an enzyme catalyst. The sample can be washed to remove unbound affinity reagent and enzyme. The labeled epitope, or a portion thereof, can then be released into solution in various ways. For simplicity, the enzyme catalyst can be bound to the affinity reagent chemically or via a bond that can be degraded, for example, by applying heat or light. Alternatively, the interaction between the affinity reagent and the epitope, or the interaction between the epitope and the substrate, can be disrupted. If the binding occurs on beads, the beads can be suspended in solution after a washing step, thereby suspending the enzyme catalyst. The suspended enzyme catalyst can then be encapsulated in monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, such as a two-phase emulsion and / or GUVs, along with sufficient reagents to detect the enzyme catalyst, such as a substrate that the enzyme catalyst can convert to a fluorescent product. The monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs can then be incubated under conditions suitable for catalytic reaction to produce monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs containing a large amount of reaction product in the presence of a catalyst, and monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs containing a small amount of reaction product in the absence of a catalyst. The number of fluorescent monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs can then be quantified relative to the dim monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs to provide a measure of the number of catalyst molecules present in the sample. This information can then be used to infer the concentration of the epitope in the original sample.

[0181] This can also be achieved using the multiplexing methods described herein, without the need to wash the sample after binding. For example, two antibodies detecting the same target can be introduced to a sample, each labeled with a different catalyst. The sample can then be encapsulated in monodisperse single-emulsion droplets, multiple-emulsion droplets, e.g., two-phase emulsions and / or GUVs. If the target is present, it will often be bound by both antibodies, as occurs in a typical "sandwich" ELISA, except in this case the molecule freely diffuses in solution rather than being bound to a substrate. This results in monodisperse single-emulsion droplets, multiple-emulsion droplets, and / or GUVs that sometimes contain only one of the antibodies or both antibodies, which can be detected by monitoring the presence of a catalytic reaction in the droplets. If the dilution is properly controlled so that most droplets are empty, the presence of both catalytic products can be attributed to the target present in the droplet, while the presence of only one of the catalytic products can likely be attributed to unbound antibody. By quantifying the fraction of double-positive droplets, it is possible to estimate the fraction of target in solution without the need to perform a washing procedure.

[0182] Digital Oligo-Linked Immunosorbent Assay (dOLISA) The methods described herein can be used for the highly sensitive detection and absolute quantification of RNA molecules. Assay approaches of interest include, but are not limited to, those described in Chang, et al., J. Immuno. Methods. 378 (1-2), 102-15 (2012), the disclosures of which are incorporated herein by reference. This application applies to very low concentrations of analyte, and the binding characteristics may deviate from typical immunoassay or ELISA platforms. Theoretical analysis reveals performance metrics (e.g., detection sensitivity, assay speed) that can be expected from a set of experimental parameters.

[0183] This method involves the binding of target protein molecules to antibodies bound to the surface of beads. The amount of bound protein at equilibrium (capture efficiency) is determined by the dissociation constant K D The binding reaction has on and off rates (k on and k off ), and the time-dependent evolution of the system can be simulated by numerically solving the differential equations that describe the reaction rates. Without intending to be bound by any theory, it is believed that the binding reaction rate is primarily governed by k on While it depends on the value of K D The value of the antibody concentration has little effect on it. If a higher concentration of antibody can be provided for binding, the slow reaction rate can be rescued.

[0184] In some embodiments, k on The rate determines the incubation period required to achieve the desired detection efficiency. In dOLISA, a secondary antibody is conjugated to a DNA oligo. The ternary complex (Ab-Ligand-oligoAb) is encapsulated into 10-10 million droplets, e.g., monodisperse single-phase emulsion droplets (each 5-50 pL in volume), so that a single DNA template molecule is present per droplet. Droplet PCR amplification is then performed in the presence of a fluorogenic reagent, and the fluorescent droplets are counted.

[0185] Formation of core-shell microgels by PTE Provided herein are methods for fabricating core-shell microgels using PTEs. Such methods generally include combining a plurality of monodisperse template particles with a first fluid containing a plurality of target particles and a polymer component to form a first mixture; combining the first mixture with a second fluid immiscible with the first fluid and the polymer component to form a second mixture; and shearing the second mixture to encapsulate the plurality of monodisperse template particles into a plurality of monodisperse droplets in the second fluid, thereby providing a plurality of monodisperse droplets containing the first fluid, one of the monodisperse template particles surrounded by a shell of the polymer component, and a plurality of target particles.

[0186] The newly formed outer shell can be used to retain biomaterials and reagents, broadening the range of applications of this emulsion technology. In some embodiments, the shell may be formed after shearing. In some embodiments, the shell of the polymeric component may be solidified by incubation at a suitable temperature, for example, from about 0°C to about 25°C, including from about 1°C to about 5°C, from about 1°C to about 10°C, from about 1°C to about 15°C, or from about 1°C to about 20°C. In some embodiments, an incubation temperature of 4°C is used.

[0187] Such methods can be combined with affinity-based particle-templated emulsification target analysis as described herein. For example, in some embodiments, monodisperse template particles are functionalized with capture agents, e.g., antibodies or nucleic acid capture reagents, e.g., oligos.

[0188] sorting One or more sorting steps may be used in carrying out the methods of the present disclosure. Sorting approaches of interest include, but are not necessarily limited to, membrane valves, branching channels, surface acoustic waves, selective coalescence, dielectrophoretic deflection, flow control, and / or other stimuli used to selectively deflect monodisperse droplets. Further sorting approaches of interest include those described in Agresti, et al., PNAS vol. 107, no. 9, pp. 4004-4009, the disclosure of which is incorporated herein by reference. Enrichment of a population by sorting can be achieved by removing members that do not possess a desired property, thereby producing an enriched population with the desired property.

[0189] Sorting can be applied before or after any of the steps described herein. Additionally, two or more sorting steps can be applied to droplets, e.g., monodisperse droplets and / or GUVs, such as about two or more, about three or more, about four or more, or about five or more sorting steps. When multiple sorting steps are applied, the steps can be substantially identical or different in one or more ways (e.g., sorting based on different properties, sorting using different techniques, etc.).

[0190] Droplets, including monodisperse droplets prepared as described herein, can be sorted based on one or more properties. Properties of interest include, but are not limited to, size, viscosity, mass, buoyancy, surface tension, conductivity, charge, magnetism, fluorescence, and / or the presence or absence of one or more components. In some embodiments, sorting can be based at least in part on the presence or absence of cells in the monodisperse droplets. In some embodiments, sorting can be based at least in part on the detection of the presence or absence of nucleic acid amplification products, such as amplification or synthesis products, as indicated, for example, by the detection of fluorescent amplification products or by the detection of surface antigens on the amplification products.

[0191] Monodisperse droplet sorting can be used, for example, to remove monodisperse droplets that are free of cells. Encapsulation can result in one or more monodisperse droplets, including a majority of monodisperse droplets free of cells. If such empty monodisperse droplets remain in the system, they will be processed like any other monodisperse droplet, wasting reagents and time. To achieve maximum speed and efficiency, these empty monodisperse droplets can be removed by monodisperse droplet sorting. For example, a drop generator can operate to approach a dripping-to-jetting transition, such that 8 μm drops are formed in the absence of cells; in contrast, if cells are present, disturbances in the flow induce the breakup of the jet, forming drops with a diameter of 25 μm. Thus, the device can generate a bidisperse population of empty 8 μm droplets and 25 μm drops containing single cells, which can then be sorted by size, for example, using a fluidic sorter, to recover only the larger, single-cell-containing drops.

[0192] Passive sorters of interest include fluidic sorters, which sort droplets into different channels according to size based on the different migration patterns of small and large monodisperse droplets in microfluidic channels. Bulk sorters are also of interest, a simple example of which is a tube containing monodisperse droplets of different masses in a gravitational field. By centrifuging, stirring, and / or shaking the tube, the more buoyant, lighter monodisperse droplets will naturally migrate toward the top of the container. Monodisperse droplets with magnetic properties can be sorted in a similar process, except that a magnetic field is applied to the container, causing the monodisperse droplets with magnetic properties to naturally migrate according to the magnitude of their properties. Passive sorters used in the subject methods may also involve relatively large channels, which will simultaneously sort a large number of monodisperse droplets based on their flow characteristics.

[0193] Pico-injection can also be used to change the electrical properties of monodisperse droplets. This can be used, for example, to change the conductivity of monodisperse droplets by adding ions, which can then be used to sort the droplets using, for example, dielectrophoresis. Alternatively, pico-injection can also be used to charge monodisperse droplets. This can be achieved by injecting a fluid into charged monodisperse droplets, which then become charged after injection. This will produce a collection of monodisperse droplets, some charged and some uncharged, which can then be extracted by flowing through a region of an electric field that deflects them based on their charge. By injecting different volumes of liquid, tuning the pico-injection, or adjusting the voltage to inject different charges for a fixed injection volume, the final charge on the monodisperse droplets can be adjusted to produce monodisperse droplets of different charges. These are then deflected by different amounts in the field, allowing them to be sorted into different containers.

[0194] Flow cytometry (FC) may be used as an alternative to on-chip monodisperse droplet sorting in any of the methods described herein. Such methods, along with devices that can be used to perform the methods, are described in Lim and Abate, Lab Chip, 2013, 13, 4563-4572; the disclosure of which is incorporated herein by reference in its entirety for all purposes. Briefly, monodisperse droplets can be formed and manipulated to produce single-phase emulsions, for example, using techniques such as fragmentation and pico-injection described herein. These single-phase emulsions can then be double-emulsified, for example, using one or more devices described herein or in Lim and Abate, Lab Chip, 2013, 13, 4563-4572, to provide, for example, the multiple emulsion droplets and / or GUVs described herein. The double-phase emulsions can then be analyzed via FC, e.g., FACS.

[0195] Droplets generated using the methods and devices described herein, such as monodisperse single- or two-phase emulsion droplets and / or GUVs, can be used to perform a variety of encapsulated chemical and biological reactions, including, for example, reactions involving enzymes, such as PCR. Often, the result of a reaction can be a product that can be of interest for detection. Furthermore, it can be of interest to recover monodisperse single-emulsion droplets, multiple emulsion droplets, and / or GUVs with different levels of product or a combination of multiple products. This can be achieved in a variety of ways using the present invention. For example, reactants can be distributed within monodisperse single-emulsion droplets, multiple emulsion droplets, and / or GUV reactors such that different monodisperse single-emulsion droplets, multiple emulsion droplets, and / or GUVs can react to different levels and have different final product concentrations. The monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs can then be examined using, for example, spectroscopic techniques, such as optical or fluorescence imaging, flow cytometry, Raman spectroscopy, mass spectrometry, etc. These methods, or combinations thereof, can be used to determine the concentrations of various compounds in the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs. These methods can be combined with mechanisms to sort the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs, for example, using microfluidic-based sorting or flow cytometry in the case of two-phase emulsions. The contents of positively and negatively sorted monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs can be analyzed to identify distinct properties of these sorted pools.

[0196] Furthermore, in some cases, it may be desirable to load individual positively sorted droplets into isolated wells for further study, for example, to allow for more detailed individual analysis of each positively sorted droplet. As a non-limiting example, the methods and devices described herein can be used to investigate viruses containing specific nucleic acid sequences. Viruses from a heterogeneous population can be loaded, for example, into monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, e.g., two-phase emulsions and / or GUVs, along with reagents sufficient for lysis and amplification of the target nucleic acid. The monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs can then be analyzed and sorted, for example, by flow cytometry for two-phase emulsions, to detect and recover all droplets that have undergone amplification of the target nucleic acid. These droplets can be sorted, for example, into a single positive pool or individually into wells on a well plate array. They can be loaded into specific groups as needed, with each well on the array containing a desired combination of positive events, which may all represent the same or different amplification targets. The sorted droplets can then be subjected to further analysis, such as mass spectrometry or next-generation sequencing.

[0197] In the case of pooled analysis, the nucleic acids from all cells loaded into the positive container are mixed together and analyzed as a whole. However, by loading a single droplet into each well, the contents of each well can be analyzed individually, for example, by barcoding the nucleic acid in each well before pooling or sequencing. This allows, for example, dissolving a single viral genome of a target species to not only detect the target species but also recover individual genomes, allowing comparisons between different members of the same species. Such analysis is useful for various applications, such as metagenomics, or for studying viral diversity.

[0198] In some embodiments of the present invention, in addition to the amplification used for detection, it is desirable to amplify the target molecules, for example, to enable further analysis of the sorted target nucleic acids. For example, in some applications, the target may contain nucleic acids desired for sequencing, but the amount of nucleic acid provided by the target may be too small to allow sequencing. In this case, amplification procedures such as specific PCR and / or non-specific multiple displacement amplification may be applied before or after sorting of the monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs. For example, in the case of viruses with relatively small linear genomes, such as polio or HIV, PCR may be performed before or after sorting to provide sufficient copies of each genome after sorting to enable sequencing analysis. For example, individual genomes may be encapsulated in droplets and subjected to amplification of the entire genome or a portion of the genome. Concurrently with or subsequent to this reaction, further amplification can be performed to identify genomes in the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs, and based on this information, the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs can be sorted. These sorted single or multiple emulsions, now containing multiple copies of the target nucleic acid, can then be more easily subjected to subsequent analysis.

[0199] Alternatively, for example, individual genomes can be encapsulated and subjected to detection amplification so that each positive monodisperse single-emulsion droplet, monodisperse multiple-emulsion droplet, and / or GUV contains only one copy of the full-length target nucleic acid and multiple small detection region amplicons. Based on these amplicons, the monodisperse single-emulsion droplets, multiple-emulsion droplets, and / or GUVs can be collected as a pool, providing one full-length copy of the target genome for each positive sorting event. These positive genomes can then be amplified using PCR with primers specific to and flanking the desired region, or nonspecific methods that amplify the entire genome, such as multiple displacement amplification (MDA) or multiple annealing and loop-based amplification cycles (MALBAC), to prepare a sequencing library. Furthermore, if the positive monodisperse single emulsion droplets, multiple emulsion droplets and / or GUVs are not pooled, for example, if the positive monodisperse single emulsion droplets, multiple emulsion droplets and / or GUVs are sorted into a well plate array and then subjected to amplification using PCR with primers that are specific and flank the desired region, the resulting individual amplicons can be used directly as material for Sanger sequencing.

[0200] A powerful advantage of the disclosed methods and devices is the ability to perform multiple independent, isolated reactions and then apply various spectroscopic techniques to detect the reaction products and sort to recover the specific reactor that underwent the desired reaction. A potential challenge with the performance of the disclosed methods is that, in some cases, positive events desired for further analysis may be very rare. For example, if the disclosed methods are used to detect a specific virus in a large, diverse pool of viruses where the desired virus is present at very low levels, many individual viruses may need to be analyzed to recover the specific virus. And, if it is desired to recover multiple instances of a species, an even larger number of total viruses may need to be analyzed. Because the number of reactions that can be performed and sorted with the disclosed methods is finite, there may be instances where the target is too rare to reliably detect.

[0201] In some examples, the methods described herein can be used in a hierarchical sorting process to recover extremely rare events, with each sorting round providing an enrichment factor. By repeatedly sorting a sample, the sample can be enriched for the target, resulting in a total enrichment that is the multiplicative product of all the individual enrichments. For example, assume that the system described herein can generate, analyze, and sort at most 1 million monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs. Under ideal conditions, this means that an event that occurs at, for example, 1 in 1 billion is unlikely to be detected by simply using the system. However, by performing hierarchical sorting and enriching the target in each sorting round, such rare events can be recovered.

[0202] For example, in a first round, 10 billion test entities can be isolated into 1 million monodisperse single-emulsion droplets, multiple-emulsion droplets, and / or GUVs, such that each droplet and / or GUV contains approximately 10,000 entities. If the target entity is present at 1 in 1 billion, then at most 10 monodisperse single-emulsion droplets, multiple-emulsion droplets, and / or GUVs in such a sample will be positive for containing the target. These will then be sorted, each providing 10,000 entities, to obtain a total of 100,000 entities, with the desired 10 being mixed. While this enrichment may be sufficient in some cases, further enrichment to even 100% purity may be desired. In this case, a hierarchical sorting approach can be used, e.g., 100,000 entities are loaded into 1 million droplets such that 1 in 10 droplets contains one entity, with the loading following a Poisson distribution. In this example, most droplets that test positive for a target will contain only that target entity, but due to the random nature of Poisson loading, some will contain negative off-target entities that happen to be co-encapsulated with the positive ones.

[0203] If 1 million droplets are analyzed and sorted, 10 will again be determined to contain the target entity and will be recovered by sorting, providing a highly enriched population that is almost completely pure for the target. Further rounds of sorting can be performed to further enrich. The scaling factor for hierarchical sorting is that in this case, the final enrichment is the multiplicative product of the individual enrichments. For example, the method can be used to enrich up to 10 in one round. 3 If enrichment is possible, sorting the same sample twice will result in a final enrichment of 10 3 x10 3 =10 6 and another round will produce, say, 10 9Furthermore, the enrichment may be similar or different in each round, depending on the user's desire. For example, the first round, where there are a small number of relations, may be, for example, 10 3 More intensive rounds can be used to achieve enrichment of 10 6 It can be used to concentrate 9 These values ​​can be adjusted to optimize for a particular application, if necessary, but tiered sorting methods generally offer the very powerful advantage of being able to enrich extremely rare events from a large population, even at a finite enrichment factor.

[0204] When using the disclosed PCR-activated sorting enrichment methods, special consideration may be required to ensure that each enrichment is successful and increases the concentration of the target in solution. For example, if the goal is to detect a very rare virus in a large population, the first round may generate amplification primers for a specific sequence in the viral genome. These will generate many copies of the region that will be collected in the sorted chamber. If this same region is used in additional sorting rounds, product amplicons from earlier rounds will be detected and sorted, and the large number of positive events will diminish the method's ability to achieve significant enrichment. In this example, primers in later rounds may be modified so as not to detect amplification products from earlier rounds. This can be achieved in several ways, including using a nested PCR approach in which primers in later rounds amplify beyond the region used in the earlier rounds, preventing products from earlier rounds from being amplified in later rounds. Alternatively, entirely different regions, such as different portions of the same gene or entire different genes, may be targeted in later rounds. A combination of these methods may also be used to achieve highly enriched samples.

[0205] Suitable subjects and / or samples The subject methods can be applied to biological samples obtained from a variety of different subjects. In many embodiments, the subject is a "mammal" or "mammalia," which terms are used broadly to describe organisms belonging to the class Mammalia, including Carnivora (e.g., dogs and cats), Rodents (e.g., mice, guinea pigs, and rats), and Primates (e.g., humans, chimpanzees, and monkeys). In many embodiments, the subject is a human. The subject methods can be applied to human subjects of both genders and at any stage of development (i.e., newborn, infant, juvenile, adolescent, adult); in some embodiments, the human subject is a juvenile, adolescent, or adult. While the present invention can be applied to human subjects, it should be understood that the subject methods can also be performed on other animal subjects (i.e., "non-human subjects"), including, but not limited to, birds, mice, rats, dogs, cats, livestock, and horses. Thus, it should be understood that any subject requiring the evaluation described herein is suitable.

[0206] Furthermore, suitable subjects include those who have been diagnosed with a condition, such as cancer, and those who have not been so diagnosed. Suitable subjects include those who exhibit one or more clinical manifestations of cancer and those who do not. In some embodiments, the subject may be a subject who may be at risk for developing cancer due to one or more factors, such as family history, chemical and / or environmental exposure, genetic mutations (e.g., BRCA1 and / or BRCA2 mutations), hormones, infectious agents, radiation exposure, lifestyle (e.g., diet and / or smoking), the presence of one or more other disease symptoms, etc.

[0207] As described more fully above, a variety of different types of biological samples can be obtained from such subjects. In certain embodiments, whole blood is extracted from the subject. If desired, the whole blood may be processed, for example, by centrifugation, fractionation, purification, etc., before performing the subject method. The volume of the whole blood sample extracted from the subject may be 100 mL or less, e.g., about 100 mL or less, about 50 mL or less, about 30 mL or less, about 15 mL or less, about 10 mL or less, about 5 mL or less, or about 1 mL or less.

[0208] The subject methods and devices described herein are compatible with both fixed and live cells. In certain embodiments, the subject methods and devices are performed on live cells. In other embodiments, the subject methods and devices are performed on fixed cells. Fixing a cell sample allows the sample to be washed to extract small molecules and lipids that may interfere with downstream analysis. Furthermore, fixation and permeabilization of cells allows the cells to be stained with antibodies for surface and intracellular proteins. In combination with the nuclear amplification methods described herein, such staining can be used to achieve high levels of multiplexing. This is because the antibodies are localized in the cell sample, while the nuclear amplification products are released within monodisperse single-phase emulsion droplets, monodisperse droplets of multiple emulsions, and / or GUVs. With such a configuration, dyes of the same color can be used for the antibodies and for the amplicons generated by nucleic acid amplification. Any suitable method can be used to fix cells, including, but not limited to, fixation using formaldehyde, methanol, and / or acetone.

[0209] Protein or DNA detection using enzyme-linked probes The methods and devices described herein can be used in a variety of ways to detect and sort entities in heterogeneous solutions. Some of the embodiments described thus far achieve this using nucleic acid amplification performed in monodisperse single-phase emulsion droplets or multiple-phase emulsion droplets, such as two-phase emulsions and / or GUVs, although other methods are enabled as described herein. For example, when the disclosed methods and devices are used to detect nucleic acids, this can be achieved, for example, by encapsulating individual nucleic acid entities in monodisperse single-phase emulsion droplets, multiple-phase emulsion droplets, and / or GUVs, subjecting them to amplification with primers specific to the target nucleic acid, detecting the target amplicons, and then sorting based on amplification. However, other detectable signals can be generated using other means, such as by binding affinity reagents to the target. For example, if the target is a nucleic acid, probes specific to the target and capable of hybridizing to the target, if present, can be synthesized; these probes can be labeled with dyes or, in some cases, with catalysts, such as enzyme-based or non-enzyme-based catalysts. The targets now bound by those probes can be subjected to purification to remove unbound probes, and the remaining material can be encapsulated into multiple emulsion droplets and / or GUVs using the methods described herein.

[0210] In the case of catalyst-bound probes, the substrate for the catalyst may also be contained within the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs. In this example, the monodisperse single emulsion or multiple emulsion containing the target will bind to the probe and thus contain the catalyst, resulting in the catalytic reaction of the substrate and the generation of a product, which may be, for example, fluorescent. This will cause the monodisperse single emulsion droplets or multiple emulsion droplets and / or GUVs to fill with fluorescent product over time. In contrast, monodisperse single emulsion droplets or multiple emulsion droplets and / or GUVs that are empty or contain off-target molecules will not contain the catalyst, will not generate a product, and will therefore not emit a detectable signal. The result of such an approach is a large collection of monodisperse single or multiple emulsion droplets and / or GUVs, some of which are fluorescent and others are dim, allowing for target recovery by sorting the fluorescing and encapsulating monodisperse single or multiple emulsion droplets and / or GUVs. This procedure can also be applied to other types of targets, such as biomolecules, viruses, cells, etc., that can be bound by affinity reagents, e.g., antibodies. In this case, the affinity reagents would be conjugated, e.g., with a catalyst, to perform the procedure described above for nucleic acid targets bound by nucleic acid probes.

[0211] In both of these examples, washing can be performed to remove unbound catalysts, which would otherwise be encapsulated in monodisperse single- or multiple-emulsion droplets and / or GUVs, resulting in false positives. However, if washing to remove unbound catalysts is undesirable or not possible, alternative approaches include multiplexed assays, in which the localization of two signals is used to identify positive events. For example, if the goal is to detect a nucleic acid target in solution, probes for two different sequences on the target can be synthesized, each with a different catalyst attached, which then performs a reaction that results in, for example, a fluorescent product. In one embodiment, the fluorescent products for the different catalysts can be different colors, e.g., one producing a green fluorescent product and the other a red fluorescent product. The probes can bind to the target as usual. In this case, many unbound probes will be present in the solution, but in most cases, a probe corresponding to a first type of catalyst will not physically bind to a second probe with a different catalyst unless both are bound to the same target nucleic acid.

[0212] The solution can also be diluted, if necessary, to perform hybridization at a higher concentration. The concentration can then be reduced so that an equal volume of solution for any given droplet contains only one probe or both probes bound to the target. This solution can then be encapsulated with a substrate for the catalyst, incubated, detected, and sorted. In this embodiment, many monodisperse single-phase emulsion droplets or multiple-phase emulsion droplets and / or GUVs will contain only the red catalyst or only the green catalyst, while others will contain both the red and green (bound to the target). This would allow droplets containing target nucleic acid to be distinguished from those containing only the catalyst by detecting fluorescent droplets at both wavelengths without the need for washing.

[0213] Again, false positives can occur if unbound probes of both catalysts happen to be co-encapsulated in the same droplet, but this can be mitigated by diluting the solution sufficiently to ensure that this event is substantially rarer than the presence of the target, so that identified double-positive monodisperse single- or multiphase emulsion droplets and / or GUVs will almost always be accompanied by the presence of the target. Similar techniques using different types of affinity reagents, e.g., binding molecules such as antibodies, can be applied to other types of targets, such as cells or proteins, and the reagents can again bind to catalysts with different reactivities, etc.

[0214] Cancer detection The methods described herein also relate to methods for detecting cancer, which may include encapsulating oligonucleotides obtained from a subject-derived biological sample into monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs, wherein at least one oligonucleotide is present in the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs; introducing polymerase chain reaction (PCR) reagents, a detection component, and a plurality of PCR primers into the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs, and incubating the monodisperse single emulsion droplets, multiple emulsion droplets, and / or GUVs under conditions in which PCR amplification can produce PCR amplification products, wherein the plurality of PCR primers include one or more primers that each hybridize to one or more oncogenes; and detecting the presence or absence of the PCR amplification products by detecting the detection component, wherein detection of the detection component indicates the presence of the PCR amplification products.

[0215] Detection of one or more PCR amplification products corresponding to one or more oncogenes can indicate that the subject has cancer. The particular oncogenes added to the droplets can vary. In some embodiments, the oncogenes can be specific to a particular type of cancer, such as breast cancer, colon cancer, etc.

[0216] Furthermore, when performing the subject methods, the biological sample from which components are to be detected may vary and may be based, at least in part, on the particular type of cancer being sought to be detected. For example, if it is desired to determine whether a subject has breast cancer, in one example, breast tissue may be used as the biological sample. When performing methods for detecting cancer, certain variations to the general steps described herein may be made, such as the number of primers that may be added, the manner in which reagents are added, appropriate targets, etc. The above methods may also be performed using single-phase emulsion droplets instead of multiple-phase emulsion droplets.

[0217] Exemplary Non-Limiting Aspects of the Disclosure Aspects, including embodiments, of the present subject matter described above may be beneficial alone or in combination with one or more other aspects or embodiments. Without limiting the foregoing, certain non-limiting aspects of the present disclosure, numbered 1 through 73, are provided below. As will be apparent to those skilled in the art upon reading this disclosure, each individually numbered aspect may be used or combined with any of the preceding or following individually numbered aspects. This is intended to support all such combinations of aspects, and is not limited to the combinations of aspects explicitly listed below: 1. A method for producing a monodisperse emulsion, said method comprising: combining a plurality of monodisperse template particles with a first fluid comprising a plurality of target particles to provide a first mixture; combining the first mixture with a second fluid immiscible with the first fluid to provide a second mixture; and shearing the second mixture to encapsulate the plurality of monodisperse template particles into a plurality of monodisperse droplets in the second fluid, thereby providing a plurality of monodisperse droplets comprising the first fluid, one of the monodisperse template particles, and one of the plurality of target particles. A method comprising: 2. The method of claim 1, wherein combining the plurality of monodisperse template particles with the first fluid to provide the first mixture comprises absorbing a portion of the first fluid into the monodisperse template particles. 3. The method of 1, further comprising removing excess first fluid from the first mixture after allowing a portion of the first fluid to be absorbed into the monodisperse template particles. 4. The method of 1, wherein combining the plurality of monodisperse template particles with the first fluid to provide the first mixture comprises flowing a portion of the first fluid through the monodisperse template particles. 5. The method of any one of 1 to 4, wherein the monodisperse template particles comprise a hydrogel. 6. The method of 5, wherein the hydrogel is selected from agarose, alginate, polyethylene glycol (PEG), polyacrylamide (PAA), and combinations thereof. 7. The method of any one of 1 to 6, wherein the first fluid comprises an aqueous phase fluid. 8. The method of any one of 1 to 7, wherein the second fluid comprises an oil. 9. The method of claim 8, wherein the oil comprises a fluorocarbon oil, a hydrocarbon oil, or a combination thereof. 10. The method of any one of 1 to 9, wherein the second fluid comprises a surfactant that dissolves in the second fluid. 11. The method of any one of 1 to 10, wherein the first fluid comprises a surfactant that dissolves in the first fluid. 12. The method of claim 11, wherein the surfactant dissolved in the first fluid comprises octylphenol ethoxylate and / or octylphenoxypolyethoxyethanol. 13. The method of any one of 1 to 12, wherein said method does not utilize microfluidics. 14. The method of any one of 1 to 13, wherein after shearing, the second fluid comprises a plurality of droplets that do not comprise one of the monodisperse template particles. 15. The method of claim 14, comprising enriching monodisperse droplets that include monodisperse template particles relative to droplets that do not include one of said monodisperse template particles. 16. The method of claim 15, wherein one or more droplets that do not contain one of the monodisperse template particles are removed from the monodisperse emulsion by filtration or centrifugation. 17. The method of any one of 14 to 16, wherein the monodisperse droplets have an average diameter, and the plurality of droplets that do not include one of the monodisperse template particles have an average diameter that is smaller than the average diameter of the monodisperse template particles. 18. The above shear is allowing the second mixture to flow into a pipette tip; agitating the second mixture with a homogenizer; or shaking the second mixture with a bead beater 18. The method according to any one of 1 to 17, comprising: 19. The method of any one of 1 to 18, comprising the step of swelling said monodisperse template particles encapsulated in said monodisperse droplets. 20. A method according to any one of 1 to 19, wherein the target particle is a DNA molecule. 21. The method of claim 20, wherein the DNA molecule is a genomic DNA molecule. 22. A method according to any one of 1 to 19, wherein the target particle is an RNA molecule. 23. The method of any one of 1 to 22, wherein the target particle is a cell. 24. The method of claim 23, wherein the monodisperse droplets contain one or more cells per droplet. 25. The method of claim 23, wherein the monodisperse droplets do not contain more than one cell per droplet. 26. The method of any one of 1 to 25, further comprising incorporating the cell lysis reagent into the monodisperse droplets. 27. The method of claim 26, wherein the cell lysis reagent is present in the first mixture prior to encapsulating the plurality of monodisperse template particles into the plurality of monodisperse droplets. 28. The method according to 26 or 27, wherein the cell lysis reagent does not contain a detergent. 29. The method of any one of 26 to 28, wherein the cell lysis reagent comprises proteinase K. 30. The method of any one of 1 to 29, further comprising the step of sorting the monodisperse droplets. 31. The method of claim 30, wherein the sorting is performed by dielectrophoretic deflection, selective coalescence, fluorescence-activated cell sorting (FACS), electrophoresis, acoustic separation, magnetically activated cell sorting (MACS), flow control, or other stimuli used to selectively deflect monodisperse droplets. 32. A method according to any one of 1 to 31, wherein the target particles are nucleic acids, and the first fluid containing the plurality of target particles further contains a nucleic acid synthesis reagent, and the nucleic acid synthesis reagent is encapsulated in the monodisperse droplets. 33. The method of 32, comprising subjecting one or more of the monodisperse droplets comprising the first fluid and one or more of the plurality of target particles to nucleic acid synthesis conditions. 34. The method of claim 32, wherein the nucleic acid synthesis reagent comprises a nucleic acid amplification reagent. 35. A method according to any one of 1 to 34, comprising subjecting one or more of the monodisperse droplets comprising the first fluid and one or more of the plurality of target particles to nucleic acid amplification conditions. 36. The method of any one of 1 to 34, comprising isolating nucleic acids from one or more of the plurality of monodisperse droplets. 37. The method of claim 36, comprising isolating nucleic acid synthesis and / or amplification products from one or more of the plurality of monodisperse droplets. 38. A method according to any one of 1 to 37, comprising sequencing nucleic acids and / or nucleic acid compounds and / or amplification products isolated from one or more of said plurality of monodisperse droplets. 39. The method of 34, wherein the nucleic acid amplification reagents comprise polymerase chain reaction (PCR) reagents or multiple displacement amplification (MDA) reagents, and the nucleic acid amplification conditions comprise PCR conditions or MDA conditions, respectively. 40. The method of claim 34, wherein the nucleic acid amplification reagent comprises an isothermal nucleic acid amplification reagent, and the nucleic acid amplification conditions comprise isothermal nucleic acid amplification conditions. 41. The method of any one of 1 to 40, wherein the first fluid containing the plurality of target particles comprises a nucleic acid detection reagent encapsulated in the monodisperse droplets. 42. The method of claim 41, comprising detecting one or more of said target particles, portions thereof, nucleic acid synthesis products thereof, and / or nucleic acid amplification products thereof by detecting one or more of said detection reagents. 43. A method according to any one of 1 to 42, comprising attaching one or more of the target particles, the nucleic acid synthesis reagent, and the nucleic acid detection reagent to one or more of the monodisperse template particles. 44. The method of claim 43, wherein one or more of the target particles, the nucleic acid synthesis reagent, and the nucleic acid detection reagent are attached to the monodisperse template particles via one or more tethering moieties disposed on or in the monodisperse template particles. 45. The method of 44, wherein one or more tethering moieties are oligonucleotides attached to or in the monodisperse template particles. 46. ​​The method of 44, wherein the one or more tethering moieties are functionalized beads encapsulated in the monodisperse template particle. 47. The method of any one of 1 to 46, wherein each of the monodisperse droplets comprises a separate compartment containing a reagent. 48. The method of claim 47, including the step of releasing said reagent from said separate compartment. 49. The method of any one of 1 to 48, wherein the monodisperse template particles have an average volume, and the method comprises shrinking the monodisperse template particles to reduce the average volume. 50. A method according to any one of 1 to 49, wherein the monodisperse template particles are particles of a first type, and the method comprises encapsulating one or more particles of a second type in droplets having one or more of the particles of the first type. 51. The method of any one of 1 to 50, comprising the step of removing excess second fluid from said second mixture following said shearing of said second mixture. 52. The method of claim 51, wherein removing excess second fluid from the second mixture comprises centrifuging the mixture and removing the supernatant. 53. The method of any one of 1 to 52, comprising, following said shearing of said second mixture, combining a third fluid with said second mixture to form a third mixture, wherein said third fluid is immiscible with said second fluid. 54. The method of any one of 1 to 52, comprising, following said shearing of said second mixture, combining said third fluid with said second mixture to form a third mixture, wherein said third fluid is immiscible with said first and second fluids. 55. The method of claim 53, wherein the third fluid comprises an aqueous phase fluid. 56. The method of claim 49 or 54, wherein the third fluid comprises oil. 57. The method of any one of 53 to 56, wherein the third fluid comprises a surfactant that dissolves in the third fluid. 58. The method of any one of 53 to 57, comprising shearing the third mixture to encapsulate the monodisperse template particles into two-phase emulsion droplets in the third fluid. 59. The method of any one of 53 to 53, comprising shearing the third mixture to encapsulate one or more of the monodisperse droplets, with or without the monodisperse template particles, into one or more droplets in the third fluid to provide one or more two-phase emulsion droplets. 60. The method of any one of 53 to 59, wherein the third fluid comprises a gelling agent. 61. The method of any one of 1 to 60, wherein 75% or more of said monodisperse droplets contain not more than one monodisperse template particle. 62. The method of any one of 1 to 60, wherein 85% or more of said monodisperse droplets contain not more than one monodisperse template particle. 63. The method of any one of 1 to 60, wherein 95% or more of said monodisperse droplets contain not more than one monodisperse template particle. 64. The method of any one of 1 to 62, wherein 75% or more of the monodisperse template particles are encapsulated in monodisperse droplets in the second fluid. 65. The method of any one of 1 to 62, wherein 90% or more of the monodisperse template particles are encapsulated in monodisperse droplets in the second fluid. 66. The method of any one of 1 to 65, wherein the monodisperse template particles comprise a lipophilic polymer. 67. Combining a plurality of monodisperse template particles with a first fluid comprising a plurality of cells and a cell lysis reagent to provide a first mixture; combining the first mixture with a second fluid that is immiscible with the first fluid to provide the second mixture; shearing the second mixture to encapsulate the plurality of monodisperse template particles into a plurality of monodisperse droplets in the second fluid, thereby providing a plurality of monodisperse droplets comprising the first fluid, one of the monodisperse template particles, the cell lysis reagent, and one of the plurality of cells; maintaining the lysis reagent at a temperature sufficient to prevent activation of the lysis reagent until the plurality of monodisperse droplets is provided; and Following providing the plurality of monodisperse droplets, incubating the plurality of monodisperse droplets at a temperature sufficient to activate the cell lysis reagent and lyse one of the plurality of cells. A method comprising: 68. The method according to 67, wherein the cell lysis reagent comprises proteinase K. 69. The method according to 67 or 68, wherein the cell lysis reagent does not contain a detergent. 70. The method of any one of 67 to 69, comprising the step of bursting the plurality of monodisperse droplets. 71. The method of any one of 67 to 70, wherein the first fluid comprises a plurality of RNA capture beads. 72. The method of any one of 67 to 70, wherein the monodisperse template particles comprise one or more RNA capture beads incorporated therein. 73. The method described in 71 or 72, comprising a step of sequencing the RNA molecules captured by the RNA capture beads. [Example]

[0218] The following examples are presented to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent that the following experiments are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should be accounted for. Unless otherwise specified, parts and parts by weight, molecular weights are weight average molecular weights, temperatures are in degrees Celsius, and pressures are approximately atmospheres. Standard abbreviations may be used, such as bp, base pairs; kb, kilobase; pl, picoliter; s or sec, seconds; min, minutes; h or hr, hours; aa, amino acid; nt, nucleotide; im, intramuscular; ip, intraperitoneal; sc, subcutaneous, etc.

[0219] material and method The following materials and methods generally apply to the results presented in the examples described herein, except where noted.

[0220] Preparation of monodisperse hydrogel particles Monodisperse polyacrylamide (PAA) particles were prepared using 6.2% acrylamide (Sigma-Aldrich), 0.18% N,N'-methylenebisacrylamide (Sigma-Aldrich), and 0.3% ammonium persulfate (Sigma-Aldrich). Polyethylene glycol (PEG) particles were prepared using 14% (w / v) 8-arm PEGSH (Creative PEGworks) in 100 mM NaHCO3 and PEGDA (6 kDA) (Creative PEGworks) in 100 mM NaHCO3. Agarose particles were prepared using 1% low-melting-point agarose (Sigma-Aldrich). The agarose suspension was heated with a space heater during emulsification to prevent solidification. The agarose and PEG solution was injected into the droplet generator device (Figure 1) along with oil (HFE-7500 fluorinated oil supplemented with 5% (w / w) deprotonated Krytox 157 FSH) using a syringe pump (New Era, NE-501). The PAA solution was injected into the droplet generator device along with fluorinated oil supplemented with 1% tetramethylethylenediamine (TEMED). The hydrogel solution and oil were loaded into separate 1 mL syringes (BD) and injected into the droplet generator at 300 and 500 μL, respectively, using a syringe pump controlled by a Python script (see the example website, "github.com / AbateLab / Pump-Control-Program," preceded by "https: / / "). The PAA and PEG droplets were collected and incubated at room temperature for 1 h for gelation. The agarose droplets were incubated on ice for gelation. After gelation, the gelled droplets were transferred to an aqueous carrier by adding an equal volume of 20% (v / v) perfluoro-1-octanol to the HFE-7500 to destabilize the oil. To remove residual oil, the particles were washed twice with hexane containing 2% Span-80 (Sigma-Aldrich). After the hexane wash, the particles were washed with sterile water until the oil was removed. The droplets were imaged using an EVOS Cell Imaging System (Thermo Fisher).Images were taken under 4x and 10x objectives using an EVOS FITC LED light source.

[0221] Device fabrication Polydimethylsiloxane (PDMS) devices used to generate monodisperse hydrogel particles were fabricated by pouring uncured PDMS (10:1 polymer to crosslinker ratio) over a photolithographically patterned photoresist layer (SU-8 3025, MicroChem) on a silicon wafer. The devices were cured in an oven at 80 °C for 1 h, excised with a scalpel, and injection holes were punched using a 0.75 mm biopsy puncher (World Precision Instruments, #504529). The devices were bonded to glass slides using oxygen plasma, and the inner surfaces of the channels were made hydrophobic by treating them with Aquapel (PPG Industries). The sealed devices were baked at 80 °C for 10 min.

[0222] dPCR Monodisperse PAA particles or commercially available PAA particles (Bio-Rad) were washed with 0.5% Triton-X100 (Sigma-Aldrich) in sterile water. 33 μL of washed PAA particles were mixed with 17 μL of PCR reagents to a total reaction volume of 50 μL. The 50 μL mixture contained 1x LongAmp Taq reaction buffer (NEB), 2 units of LongAmp Taq DNA polymerase (NEB), 0.6 μM forward and reverse primers (IDT), 0.6 μM TaqMan® probe (IDT), 300 μM dNTPs (Fisher Scientific), and varying amounts of Saccharomyces cerevisiae genomic DNA (Millipore). For multiplexed ddPCR, an additional 0.6 μM forward and reverse primers and a TaqMan® probe for lambda virus DNA were included. The primer and probe sequences used were: yeast FWD: 5'-GCAGACCAGACCAGAACAAA-3' (SEQ ID NO: 1), yeast REV: 5'-ACACGTATGTATCTAGCCGAATAAC-3' (SEQ ID NO: 2), yeast probe: 5'- / 56-FAM / ATATGTTGT / ZEN / TCACTCGCGCCTGGG / 3IABkFQ / -3' (SEQ ID NO: 3), lambda FWD: 5'-GTGGCATTGCAGCAGATTAAG-3' (SEQ ID NO: 4), lambda REV: 5'-GGCAGTGAAGCCCAGATATT-3' (SEQ ID NO: 5), lambda probe: 5'- / Cy5 / TATCCGTCAGGCAATCGACCGTTG / 3IAbRQSp / -3' (SEQ ID NO: 6). The mixture was incubated for 15 minutes to allow the PCR reagents to diffuse into the particles, and then centrifuged at 6,000 x g for 1 minute. Excess aqueous phase was removed using a micropipette. 20 μL of particles and 25 μL of HFE-7500 oil supplemented with 2% (w / w) PEG-PFPE amphiphilic block copolymer surfactant (008-Fluorosurfactant, Ran Technologies) were mixed thoroughly in a 1.7 mL Eppendorf tube by tapping, and the mixture was stirred at 2,300 rpm for 30 s using a vortexer (VWR).After transferring the emulsion to a PCR tube, the oil beneath the floating droplets was removed with a pipette and replaced with FC-40 oil (Sigma-Aldrich) containing 5% (w / w) PEG-PFPE amphiphilic block copolymer surfactant. This oil / surfactant combination provided better thermal stability during PCR. The emulsion was transferred to a T100 thermocycler (Bio-Rad) and subjected to the following program: 94°C for 30 seconds, followed by 45 cycles of 94°C for 30 seconds, 53°C for 60 seconds, and 65°C for 50 seconds, followed by a final extension at 65°C for 10 minutes and a 12°C hold. Droplets were imaged using an EVOS Cell Imaging System (ThermoFisher Scientific) under 10x and 20x objectives equipped with EVOS GFP and FITC LED light sources.

[0223] cell culture A budding yeast Saccharomyces cerevisiae strain expressing yellow fluorescent protein (YSP) fluorescence was grown in standard rich medium (YPD) at 30°C, and cell density was measured using a NanoDrop (ThermoFisher Scientific). PAA particles were washed with 0.5% Triton in YPD and centrifuged to remove excess water. A diluted yeast suspension was prepared to achieve a Poisson distribution of cell occupancy per droplet. 1 μL of yeast suspension, 20 μL of particles, and 25 μL of HFE-7500 oil containing 2% (w / w) PEG-PFPE amphiphilic block copolymer surfactant were mixed thoroughly by tapping in a 1.7 mL Eppendorf tube. The mixture was vortexed at 2,300 rpm for 30 seconds. A hole was pierced in the tube lid to allow oxygen exchange of the yeast cells, and 1 mL of YPD medium was added. Cells were incubated at 30 °C for 10 h and imaged using EVOS Cell Imaging under a 20x objective with EVOS RFP and FITC LED light sources.

[0224] Scale-up of monodisperse emulsion production Emulsions were generated by resuspending monodisperse PAA particles in 0.3% IGEPAL and adding 20 μL of the resuspended PAA particles to each well of a 96-well plate. The combined mixture was vortexed at 2900 rpm for 1 min or pipetted 30 times to obtain 96 monodisperse emulsions.

[0225] Formation of two-phase emulsions (liposomes) using PTE Single-phase emulsions were formed using polyacrylamide beads in an inner aqueous phase of 10 mM TrisHCl pH 8, 137 mM NaCl, 2.7 mM KCl, 10 mM EDTA, and 0.01% TritonX100 by vortexing for 1 minute on a tabletop vortexer (VWR) at speed 10. Liposomes were formed by adding an outer aqueous solution of 5 mM TrisHCl pH 8 and 0.01% TritonX100, followed by vortexing for 20 seconds on a tabletop vortexer (VWR) at speed 7. Liposomes, a type of two-phase emulsion, were formed in the oil phase of a squalane mixture containing 5% (w / v) glyceryl monooleate and 5 mg / ml dipalmitoylphosphatidylcholine (DPPC), additionally containing a fluorescent lipid.

[0226] High-throughput scRNA-seq with PTE New technologies have expanded the capabilities of scRNA-seq by increasing throughput and simplifying the protocol described by Chemgene (see, for example, the Chemgenes website). Drop-seq beads were encapsulated in BAC polyacrylamide hydrogels using bis(acryloyl)cystamine as a crosslinker for polyacrylamide bead synthesis. Cells, proteinase K, and hybridization buffer were mixed with the BAC polyacrylamide beads at 4°C. Oil presaturated with 2-mercaptoethanol was added. The mixture was vortexed to emulsify. During dissociation of the droplet hydrogel, 2-Me diffused into the droplets, leading to dissociation of the BAC polyacrylamide particles and release of the Drop-seq beads. Cell lysis was performed by proteinase K incubation at 55°C for 15 minutes. RNA was captured on the Drop-seq beads. The Drop-seq beads were then recovered. Reverse transcriptase sequencing and data analysis were performed. Species mixing experiments Mouse 3T3 cells and human HEK293 cells were washed, resuspended, mixed at a 1:1 ratio, and stored in PBS buffer. Polyacrylamide particles containing Drop-seq beads were synthesized using the same protocol as polyacrylamide particle synthesis, with Drop-seq beads added to the solution, as described in more detail below. The synthesized particles were 125 μm in diameter.

[0227] Synthesis of hydrogel beads The BAC hydrogel mixture used for the synthesis of hydrogel particles was as follows: Tris pH 7.5 10 mM, EDTA 1 mM, NaCl 15 mM, acrylamide 6.2%, BAC (bis(acroylcystamine) (BAC) dissolved in ethanol) 0.54%, ammonium persulfate 0.3%, and HFE 2% (Weitz) with 1% TEMED in oil.

[0228] A standard Drop-seq device was used for hydrogel synthesis (blocking the cell inlet channel with a piece of silver solder). Drop-seq beads were resuspended at a concentration of 100 / μl in the BAC hydrogel synthesis mix, aiming to achieve 1 bead per 10 droplets. The flow rates were 2000 μl / h of aqueous solution and 3200 μl / h of oil. After droplet generation, droplets were left at room temperature for 4 hours before de-emulsification. The same washing protocol using TBEST buffer was followed and stored in TBEST buffer at 4°C.

[0229] The relationship between bead size (usually approximately droplet size) and Drop-seq loading efficiency was examined. To increase the percentage of beads loaded with Drop-seq, the hydrogel could be resuspended using 40% Ficoll, followed by centrifugation (500 g for 2 min). This step was repeated as necessary to achieve better loading efficiency.

[0230] This emulsion generation Single cell suspensions were prepared and diluted to the appropriate concentration. BAC hydrogel beads were washed with PTE-seq buffer (Drop-seq lysis buffer without sarkosyl, without DTT, and with 500 mM NaCl) to completely exchange the buffer.

[0231] The hydrogel beads were packed tightly by centrifugation and 20x Proteinase K (NEB) was used. The mixture was incubated on ice for 5 minutes for equilibration. bME oil was prepared by adding bME to 5% Weitz HFE oil (0.2%). The mixture was vortexed at maximum speed for 1 minute, mixed thoroughly, and stored on ice.

[0232] The concentration of close-packed beads was approximately 300 hydrogel beads per μl. The number of cells required to shake the emulsion was calculated based on the number of hydrogel beads. The cell input volume was adjusted to 10% of the number of hydrogel beads. The cells were added to the close-packed hydrogel beads and gently mixed. At least 2 volumes of bME oil hydrogel beads were added, followed by vortexing at speed 7 for 30 seconds. The emulsion quality was inspected using a microscope, and the emulsion was further vortexed if necessary. The hydrogel was dissociated for 15 minutes at room temperature, and the cells were lysed for 20 minutes at 55°C before being placed on ice for 20 minutes to capture RNA.

[0233] Drop-seq protocol Thirty ml of 6X SSC was added, and an additional 50 μl of 10% Sarkosyl was added on top of the emulsion, and the emulsion was broken with 1 ml of PFO. The Drop-seq protocol for bead cleanup, as well as RT reaction and sequencing analysis, was performed according to the protocols described on the website "mccarrolllab.com / dropseq / " preceded by "http: / / ".

[0234] Formation of core-shell microgels by PTE and target analysis Polyacrylamide beads were conjugated with oligonucleotides used as primers during PCR. The beads were immersed in PCR reagents. Excess aqueous solution was removed. Agarose, Triton, and cells were added, followed by oil. PTE was performed as described herein. The oil was transferred and thermocycling was performed. The emulsion was broken and washed. Positive beads were collected using FACS before genome recovery.

[0235] Polyacrylamide beads were modified with oligo (MH 075, final concentration 2 μM). B. subtilis (strain 168) was captured, and MH 100 and 101 were used for PCR. The fraction containing fluorescent-positive droplets corresponded to the template concentration of B. subtilis (strain 168). Fluorescent-positive droplets were sorted using a BD FACSAria II and observed under a microscope. Sorted beads fluoresced and were enclosed in an agarose shell after FACS. qPCR was performed to confirm genome recovery in the agarose shell. Four primer sets for different gene loci were used. A signal was observed after 35 cycles, indicating encapsulation of genomic DNA in the agarose shell.

[0236] MH075: / 5Acryd / / iSpPC / ATATTACTCTTTCCCTACACGACGCTCTTC (SEQ ID NO: 7)

[0237] MH100: CTCTTTCCCTACACGACGCTCTTCCGATCACGAACTGGACAAGAA (SEQ ID NO: 8)

[0238] MH101: / 56-FAM / ATGGAGCGTTCAAGGTTCTCAA (SEQ ID NO: 9)

[0239] Example 1: Generation of monodisperse single-phase emulsions using particle-templated emulsification (PTE) result Hydrogel particles that were greater than 95% aqueous were used for templating, ensuring that the final droplets were largely aqueous, as needed for biochemical reactions within the resulting droplets. The particles, along with oil and surfactant, were added to the solution to be encapsulated, and the mixture was vortexed (Figure 2, panels A–C and Figure 3, panels A–E). The hydrogel particles were permeable to molecules with a hydrodynamic diameter smaller than the pore size, such as small molecules, but impermeable to larger molecules, such as genomic DNA, which remained within a thin layer of aqueous solution surrounding the particles in the droplets. While vortexing, the particles were continuously dispersed into smaller droplets until each droplet contained only a single particle and a thin shell of aqueous solution, as shown in Figure 3, panel E. Beyond this point, further droplet collapse was inhibited, as this would require crushing solid particles. The result was an emulsion in which the droplets were similar in size to the original monodisperse particles and were therefore monodisperse themselves.

[0240] The PTE allowed any reagents present in the initial solution to be encapsulated in droplets, enabling compartmentalized reactions similar to those typically achieved with microfluidics. Compounds smaller than the pore size of the hydrogel were absorbed prior to emulsification and thus present in the final droplet containing the hydrogel. Larger compounds formed a thin layer of aqueous solution surrounding the hydrogel, as shown in panel E of Figure 3. While other stirring techniques, such as pipetting and tube flicking, are compatible, a vortex was used for the PTE due to its reproducibility.

[0241] Example 2: Optimization of particle-templated emulsification result Emulsions prepared by vortexing in the absence of template particles were easy to prepare, but such emulsions were polydisperse, limiting their usefulness for accurate biology (Panel A, Figure 4). As shown in Panel A (left) of Figure 4, vortexed emulsions without particles produced polydisperse droplets with a wide size distribution, ranging from 8 to 218 µm in diameter (n = 561), with 4.3% of the droplets measuring 35 to 40 µm. On the other hand, microfluidic emulsions required specialized equipment and skill, but demonstrated excellent monodispersity and were highly valuable (Panel A, Figure 4). As shown in Panel A (right) of Figure 4, microfluidic emulsions produced monodisperse droplets: 95.7% of the droplets were 35 to 38 µm in diameter (n = 816). Therefore, an improved method for sample encapsulation would combine the simplicity of vortexing with the quality of microfluidics.

[0242] PTE achieved this by exploiting particle rigidity, which resists droplet collapse below the particle size, even when vortexing. As shown in Figure 4, Panel C, PTE produced droplets of similar size to the original PAA particles, with 58.2% of the droplets being 35–40 μm in diameter (n = 1421). The time to reach the final droplet size and the monodispersity of the resulting emulsion depended on fluid and particle properties. For example, particle properties such as size and autophilicity, as well as solution properties such as viscosity and interfacial tension, influenced the droplet templating process. To characterize the effect of these parameters on emulsion quality, PTE was performed using different hydrogel materials and solution interfacial tensions (Figure 4, Panel B). The particle size, carrier oil, and oil-soluble surfactant were fixed because these properties are typically dictated by the needs of biological reactions and are less flexible.

[0243] To adjust the interfacial tension, a water-soluble surfactant was added to the droplet phase, which is compatible with most biochemical reactions. When the aqueous phase surfactant was omitted, the vortexed droplets were polydisperse for all types of hydrogels (Figure 4, Panel B). While not intending to be bound by any particular theory, this may be due to the large, heterogeneous multicore droplets not collapsing due to interparticle affinity and large interfacial tension. Increasing the vortexing time up to 20 minutes did not noticeably change the emulsion quality. Multicore emulsions were observed, and the emulsions were polydisperse (Figure 5, Panel A). In contrast, when surfactant was included in the aqueous phase, particle affinity and interfacial tension decreased; monodisperse single-core droplets were generated with 30 seconds of vortexing (Figure 4, Panel B), and longer vortexing periods did not substantially change the appearance of the resulting emulsions (Figure 6, Panels A-D). PAA particles containing 0.5% Triton in HFE oil containing 2% fluorosurfactant were vortexed for 5 seconds (Panel A in Figure 6), 15 seconds (Panel B in Figure 6), 1 minute (Panel C in Figure 6), and 2 minutes (Panel D in Figure 6). Histograms show the droplet size distributions for different vortexing times.

[0244] As shown in Figure 4, panel B, PAA, PEG, or agarose particles were used as templates and emulsified with different surfactants. Monodisperse droplets were generated using aqueous-phase surfactants (Triton and IGEPAL). Of the particles tested, droplets formed from polyacrylamide (PAA) and polyethylene glycol methacrylate (PEG) particles produced the most uniform emulsions (Figure 4, panel B). Agarose particle emulsions were less uniform. While not intending to be bound by any particular theory, this may be due to their self-affinity. Other aqueous-phase surfactants were also used, although the required vortexing parameters and emulsion quality differed (Figure 5, panels B–E).

[0245] The PTE was scalable because the time required for emulsion generation was independent of emulsion volume (Figure 7, Panels A and B). The PTE enabled rapid and easy generation of monodisperse emulsions at the microliter to milliliter scale. Samples consisted of PAA particles suspended in 0.5% Triton in 1.25 volumes of HFE oil containing 2% (20 μL) or 5% (200 μL and 2 mL) fluorosurfactant (Figure 7, Panel A). Regardless of total volume, all emulsions were vortexed for 30 seconds to generate droplets. Histograms of droplet size distributions for the 200 μL and 2 mL emulsions demonstrated comparable monodispersity (Figure 7, Panel B).

[0246] These results differ from conventional microfluidic emulsification, where the generation time is proportional to the volume. The droplet generation times of the PTE and microfluidics were compared at a typical droplet generation rate of 1 kHz. The generation of a 20 μL emulsion with the PTE required the same time as the generation of a 2 mL emulsion (Figure 7, Panel C, top), whereas the generation of a 2 mL emulsion required approximately 11 hours using microfluidics (Figure 7, Panel C, bottom). The scalability of the PTE is advantageous for applications requiring the emulsification of large quantities of samples. Furthermore, because emulsion generation occurs in the sample reservoir, eliminating the need to shuttle the sample to the microfluidic device, the PTE is also scalable for emulsifying large numbers of samples.

[0247] Hydrogels with diameters ranging from approximately 30 μm to approximately 80 μm were used with similar results, and data for 50 μm hydrogels are shown. However, other particle types, including size, hydrogel chemistry, and porosity, may be compatible with the method. While fluorinated oil and surfactant were used in the carrier phase, other formulations containing silicone and hydrocarbon oils and surfactants may also be compatible. Other polar phases may also be used if they form stable emulsions, which may be valuable for generating core-shell structures. These properties may provide the flexibility needed to extend PTE to other areas, such as cost-effective and scalable encapsulation of compounds in two-phase emulsions.

[0248] In addition to the desired monodisperse droplets with sizes similar to those of the template particles, PTE produced extremely small "satellite droplets" that did not contain any particles. The number of satellite droplets depended on the amount of excess aqueous solution surrounding the particles, the interfacial tension of the emulsion, and the time and power of vortexing. To reduce their number, excess aqueous solution could be removed from the particle-sample mixture before vortexing. Nevertheless, although aesthetically unpleasant, satellite droplets typically comprised a relatively small fraction (<3%) of the total sample volume and therefore contributed little to the biological reactions taking place in the emulsion.

[0249] After considering factors such as vortex forces, surface tension, and particle size, the entrained volume could be predicted. Vortexing creates a velocity distribution within the sample, and each droplet experiences a random sampling of these velocities during emulsification. Vortexing is a reasonably controlled method for stirring fluids, and therefore, as shown herein, it was possible to identify forces that result in primarily single-core droplets with uniform entrained volumes.

[0250] A common challenge in droplet microfluidics has been the need to efficiently encapsulate discrete entities such as beads and cells. Microfluidic technologies typically encapsulate these entities randomly, resulting in inefficient Poisson loading, in which only a small fraction of droplets are properly loaded. A unique and valuable property of PTE is that all droplets of appropriate size contain a single template particle (Figure 4, Panel B). If these particles are essential components of the reaction, most droplets contain what is needed. However, other components, such as cells, beads, and DNA molecules, are randomly loaded. Indeed, efficient hydrogel encapsulation is a key step in a recently reported single-cell sequencing technology, which has been utilized in commercial instruments (Zhu Z, Yang CJ (2017), Hydrogel Droplet Microfluidics for High-Throughput Single Molecule / Cell Analysis, Acc Chem Res 50(1):22-31).

[0251] Example 3: Accurate DNA quantification by PTE using digital droplet PCR (ddPCR) result PTE enabled simple ddPCR without microfluidics. To illustrate this, we used PTE to encapsulate multiple DNA samples with different concentrations of target molecules (Figure 8, Panel A). As with microfluidic ddPCR, increasing the target concentration resulted in an increased number of fluorescent droplets. To determine whether this enabled concentration estimation, we followed traditional ddPCR analysis and quantified droplet fluorescence using imaging, plotting the results as fluorescence versus diameter (Figure 8, Panel B). Three droplet populations were visible: low fluorescence and small diameter (satellite droplets), the expected diameter of 30–40 μm and low fluorescence (PCR negative), and a similar size range with high fluorescence (PCR positive). We ignored satellite droplets and modeled the target concentration for appropriately sized droplets via Poisson statistics.

[0252] λ=-ln(1-p) where λ is the number of template copies per droplet and p is the positive fraction.

[0253] The measured concentrations followed the expected scaling over the three-decade range tested, demonstrating that PTE-based ddPCR (Panel C of Figure 8) functions like microfluidics-based ddPCR (Figure 9). The PTE method utilized hydrogel particles to template droplets created using microfluidics. PTE represented a substantial simplification of ddPCR, as one large batch of synthesized particles could be used to perform many analyses, even with microfluidically created particles.

[0254] Hydrogel microspheres with various compositions, sizes, and uniformities were available for purchase from commercial vendors. These spheres were typically sold as components for purification columns, and therefore were quality-controlled and free of contaminants that could interfere with droplet reactions. To demonstrate that PTE can be performed with commercially available monodisperse template particles (Figures 10A and 10B), we purchased monodisperse PAA spheres ranging in diameter from 45 to 90 µm. This size distribution, while larger than particles fabricated by microfluidics—typically less than 5%—was acceptable for most applications, including ddPCR. To demonstrate this, we performed ddPCR with PTE using the particles, and observed similar droplet fluorescence characteristics (Panel A, Figure 10B). Although the larger diameter distribution resulted in a wider variance in both size and fluorescence plots, positive and negative PCR populations were still distinguishable (Panel B, Figure 10B). Varying the target concentration and performing standard ddPCR analysis yielded accurate measurements across the same range (Panel C, Figure 10B). When droplet size variation was included using a multiple Poisson distribution weighted by droplet volume, the estimated copy number correction factors were small, ranging from 0.1% (for the lowest concentration) to 4.5% (for the highest concentration).

[0255] Microfluidic-generated particles were used to characterize PTEs because they are monodisperse and therefore allow for accurate measurement of droplet volume fluctuations. However, as shown herein, relatively uniform commercially available beads are sufficient for many applications.

[0256] Example 4: Multiplexed PTE-ddPCR result To demonstrate the feasibility of PTE-based ddPCR for multiplexing, we analyzed a mixture of lambda virus and S. cerevisiae genomic DNA. TaqMan probes targeting either the lambda virus (red) or yeast (green) genomes were used. The DNA of both organisms was mixed together, and the sample was emulsified with PTE. Many droplets were pure red or green, indicating that they contained lambda or yeast genomic DNA, respectively (Figure 11, Panel A). However, occasionally, droplets contained one of each target and were therefore double-positive, appearing yellow (merged in Figure 11, Panel A). Because these nucleic acids were not physically associated, the possibility of double-positive results can be explained by a Poisson double-enclosure process. Therefore, deviations from Poisson statistics represented sequence association.

[0257] Example 5: PTEs used in yeast cells result PTE was used to encapsulate single yeast cells using hydrogel spheres for templated droplet generation. PAA monodisperse template particles were added to the yeast suspension and emulsified by vortexing the mixture. Because the cells were suspended at a low concentration, most droplets were empty, but a small fraction contained single cells, similar to microfluidic cell encapsulation. The micron-scale yeast cells were unable to diffuse into the nanometer pores of the monodisperse template particles, resulting in an aqueous shell around the droplet periphery (Figure 11, Panel B). The number of encapsulated yeast cells per droplet could be adjusted by adjusting the cell concentration in the sample.

[0258] The droplet environment was compatible with yeast growth. Without intending to be bound by any particular theory, this is believed to be due to the fact that PAA is a biologically inert hydrogel containing over 95% water. As a result, when the encapsulated yeast cells were incubated for 10 hours, they grew into clonal microcolonies (Figure 11, panel B).

[0259] Example 6: RNAseq (theoretical experiment) Polyacrylamide hydrogel beads were first prepared by 9 More than 100 single-stranded oligonucleotides were synthesized in a bound state, followed by washing and resuspension. The bead fabrication procedure uses a "split-and-pool" method for on-bead barcode synthesis. The completed barcoded beads contain uniquely barcoded single-stranded DNA and other components, including a polyT tail and a T7 promoter sequence. These single-stranded DNAs can be released from the hydrogel beads upon UV exposure. The beads, cells, and RT mix are combined, and PETE is performed as described herein to encapsulate single cells into droplets with the reverse transcription mix. The emulsion is exposed to UV light and subsequently heated to a maximum of 50°C to perform the reverse transcription reaction. During the process, single-stranded DNA on the beads is released to serve as an RT primer, and RNA from the cells is released to serve as a template. The emulsion is then broken, and cDNA is recovered, followed by standard in vitro transcription and library preparation for next-generation sequencing to collect data for single-cell gene expression profiling.

[0260] Example 7: Scale-up of monodisperse emulsion production result Monodisperse polyacrylamide particles were first synthesized according to the method disclosed herein and then washed with IGEPAL. The monodisperse particles were added to a 96-well plate. PTE was performed as described, and 96 uniform single-cell emulsions were simultaneously generated (Figure 12).

[0261] Example 8: Generation of two-phase emulsions using particle-templated emulsification (PTE) result The technology described herein allows for precise control of the production of liposomes, a type of two-phase emulsion. As shown in panel A of Figure 13, polyacrylamide particles were provided in an inner aqueous phase (10 mM TrisHCl pH 8, 137 mM NaCl, 2.7 mM KCl, 10 mM EDTA, and 0.01% TritonX100) to generate two-phase emulsions (or liposomes) using PTE. As shown in panel B of Figure 13, an oil phase (a squalane mixture containing 5% (w / v) glyceryl monooleate and 5 mg / ml DPPC) was first added to form a single-phase emulsion. As shown in panel C of Figure 13, a two-phase emulsion was generated by adding an outer aqueous phase containing 5 mM TrisHCl pH 8 and 0.01% TritonX100 and vortexing. Liposomes were formed by phase separation. Liposomes formed with additional fluorescent lipids in the oil phase were imaged with an EVOS fluorescence microscope, as shown in Figure 13, panel D.

[0262] Example 9: High-throughput RNAseq with PTE As shown in Figures 14A-14C, we developed a protocol that enables single-cell RNA sequencing (scRNA-seq) without microfluidics, allowing transcriptome profiling from thousands of single cells with simple reagents. By utilizing a combination of a proteinase-based lysis approach, chemically triggered hydrogel depolymerization, and barcoded RNA capture beads, droplet formation, cell lysis, and RNA capture were achieved in a single step. This technology extends the capabilities of scRNA-seq by increasing throughput and simplifying traditional protocols.

[0263] Drop-seq beads (Figure 14A; panel A of Figure 15) were first encapsulated in a BAC polyacrylamide hydrogel using bis(acryloyl)cystamine (BAC) as a crosslinker for polyacrylamide bead synthesis, followed by washing and resuspension. The beads, cells, proteinase K, and hybridization buffer were combined. Oil pre-saturated with 2-mercaptoethanol (2-Me) was added, and PTE was performed as described herein to encapsulate single cells into droplets (Figure 14B; panel B of Figure 15). Cells were lysed with proteinase K. To avoid lysis prior to droplet formation, no detergent was used for cell lysis. Proteinase K requires longer time and higher temperatures to efficiently lyse cells, and was therefore well suited to this method. Following the addition of proteinase K and droplet formation, the temperature was increased from 4 °C to 55 °C to promote proteinase K activation and cell lysis. After cell lysis and RNA capture, the emulsion was broken, the proteinase K was washed away, and the Drop-seq beads were recovered (Figure 14C).

[0264] In Figure 15, microscopy images show calcein green stained cells encapsulated in droplets before (Panel C of Figure 15) and after (Panel D of Figure 15). Data from a human-mouse mixed cell experiment demonstrated the effectiveness of the scRNA-seq workflow described herein (Panel E of Figure 15).

[0265] Example 10: Formation of core-shell microgels by PTE and target analysis As shown in Figure 16, we developed a method for creating core-shell microgels using this emulsion technology that combines affinity-based PTE and target analysis. The core-shell microgels created using this emulsion technology can be used to retain various biomaterials and reagents, potentially broadening the scope of applications of this emulsion technology. Polyacrylamide beads (panel A of Figure 17) were conjugated with oligonucleotides used as primers during PCR. Such target analysis using this emulsion technology by functionalizing template particles with DNA enables a wide range of applications, such as targeted (specific cell type) scRNA-seq from heterogeneous cell populations. While this example utilized oligo-functionalized beads, other functionalization, such as with antibodies or their binding fragments, can be readily envisioned by those skilled in the art. The beads were immersed in PCR reagents. Excess aqueous solution was removed. Agarose, Triton, and cells were added, followed by oil. PTE was performed as described herein. The oil was transferred and thermocycling was performed. Panel B of Figure 17 shows ddPCR of polyacrylamide core beads with agarose shells at two dilution factors. The fraction containing fluorescent-positive droplets corresponds to the template concentration. Images of the polyacrylamide core beads with agarose shells showed the polyacrylamide core beads surrounded by agarose shells after droplet disruption and washing. Panel C of Figure 17 shows images of droplets after FACS, in which fluorescent-positive droplets were sorted, collected, and viewed under a microscope. The sorted beads fluoresced and were surrounded by an agarose shell after FACS. qPCR was performed to confirm genome recovery in the agarose shells (Panel D of Figure 17). Four primer sets for different loci were used. A signal was observed after 35 cycles, indicating genomic DNA was encapsulated in the agarose shells.

[0266] While the present invention has been described with reference to specific embodiments thereof, it should be understood by those skilled in the art that various modifications may be made and equivalents substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the claims appended hereto.

[0267] [References] 1. Costa, L. da F.; Rodrigues, FA; Cristino, AS Complex networks: The key to systems biology. Genet. Mol. Biol. 2008, 31, 591-601. 2. Blainey, PC; Quake, SR Dissecting genomic diversity, one cell at a time. Nat.Methods 2014, 11, 19-21. 3. Civelek, M.; Lusis, AJ Systems genetics approaches to understand complex traits. Nat. Rev. Genet. 2014, 15, 34-48. 4. Weaver, WM et al. Advances in high-throughput single-cell microtechnologies. Curr. Opin. Biotechnol. 2014, 25, 114-123. 5. Fritzsch, FSO; Dusny, C.; Frick, O.; Schmid, A. Single-Cell Analysis in Biotechnology, Systems Biology, and Biocatalysis. Annu. Rev. Chem. Biomol. Eng. 2012, 3, 129-155. 6. Soon, W. W.; Hariharan, M.; Snyder, M. P. High-throughput sequencing for biology and medicine. Mol. Syst. Biol. 2013, 9, 640. 7. Macosko, E. Z. et al. Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets. Cell 2015, 161, 1202-1214. 8. Mazutis, L. et al. Single-cell analysis and sorting using droplet-based microfluidics. Nat. Protoc. 2013, 8, 870-891. 9. Kimmerling, R. J. et al. A microfluidic platform enabling single-cell RNA-seq of multigenerational lineages. Nature Commun. 2016, 7, 10220. 10. Kim, J. H. et al. Droplet Microfluidics for Producing Functional Microparticles. Langmuir 2014, 30, 1473-1488. 11. Guo, M. T.; Rotem, A.; Heyman, J. A.; Weitz, D. A. Droplet microfluidics for high-throughput biological assays. Lab Chip 2012, 12, 2146-2155. 12. Joanicot, M.; Ajdari, A. Droplet control for microfluidics. Science 2005, 309, 887-888. 13. Tran, T. M.; Lan, F.; Thompson, C. S.; Abate, A. R. From tubes to drops: droplet- based microfluidics for ultrahigh-throughput biology. J. Phys. D. Appl. Phys. 2013, 46, 114004. 14. Abate, A. R. et al. DNA sequence analysis with droplet-based microfluidics. Lab Chip 2013, 13, 4864-4869. 15. Autour, A.; Ryckelynck, M. Ultrahigh-throughput improvement and discovery of enzymes using droplet-based microfluidic screening. Micromachines 2017, 8, 128. 16. Mashaghi, S.; Abbaspourrad, A.; Weitz, D. A.; van Oijen, A. M. Droplet microfluidics: A tool for biology, chemistry and nanotechnology. TrAC - Trends Anal. Chem. 2016, 82, 118-125. 17. Abbaspourrad, A. et al. Label-free single-cell protein quantification using a drop- based mix-and-read system. Sci. Rep. 2015, 5, 12756. 18. Baker, M. Digital PCR hits its stride. Nat. Methods 2012, 9, 541-544. 19. Kolodziejczyk, A. A.; Kim, J. K.; Svensson, V.; Marioni, J. C.; Teichmann, S. A. The Technology and Biology of Single-Cell RNA Sequencing. Mol. Cell 2015, 58, 610-620. 20. Zilionis, R. et al. Single-cell barcoding and sequencing using droplet microfluidics. Nat. Protoc. 2017, 12, 44-73. 21. Spencer, S. J. et al. Massively parallel sequencing of single cells by epicPCR links functional genes with phylogenetic markers. ISME J. 2016, 10, 427-436. 22. Tamminen, M. V.; Virta, M. P. J. Single gene-based distinction of individual microbial genomes from a mixed population of microbial cells. Front. Microbiol. 2015, 6, 195. 23. Katepalli, H.; Bose, A. Response of Surfactant Stabilized Oil-in-Water Emulsions to the Addition of Particles in an Aqueous Suspension. Langmuir 2014, 30, 12736-12742. 24. Abate, A. R.; Chen, C.-H.; Agresti, J. J.; Weitz, D. A. Beating Poisson encapsulation statistics using close-packed ordering. Lab Chip 2009, 9, 2628-2631. 25. Yan, K. S. et al. Intestinal Enteroendocrine Lineage Cells Possess Homeostatic and Injury-Inducible Stem Cell Activity. Cell Stem Cell 2017, 21, 78-90.e6. 26. Spies, N. et al. Genome-wide reconstruction of complex structural variants using read clouds. Nat. Methods 2017, 14, 915-920. 27. Hindson, B. J. et al. High-throughput droplet digital PCR system for absolute quantitation of DNA copy number. Anal. Chem. 2011, 83, 8604-8610. 28. Pinheiro, L. B. et al. Evaluation of a droplet digital polymerase chain reaction format for DNA copy number quantification. Anal. Chem. 2012, 84, 1003-1011. 29. Taly, V. et al. Multiplex picodroplet digital PCR to detect KRAS mutations in circulating DNA from the plasma of colorectal cancer patients. Clin. Chem. 2013, 59, 1722-1731. 30. Elnifro, E. M.; Ashshi, A. M.; Cooper, R. J.; Klapper, P. E. Multiplex PCR: Optimization and Application in Diagnostic Virology. Clin. Microbiol. Rev. 2000, 13, 559-570. 31. Lance, S. T.; Sukovich, D. J.; Stedman, K. M.; Abate, A. R. Peering below the diffraction limit: robust and specific sorting of viruses with flow cytometry. Virol J 2016, 13, 201. 32. Collins, D. J.; Neild, A.; deMello, A.; Liu, A-Q.; Ai, Y. The Poisson distribution and beyond: methods for microfluidic droplet production and single cell encapsulation. Lab Chip 2015, 15, 3439-3459. 33. Halldorsson, S.; Lucumi, E.; Gomez-Sjoberg, R.; Fleming, R. M. T. Advantagesand challenges of microfluidic cell culture in polydimethylsiloxane devices. Biosens. Bioelectron. 2015, 63, 218-231. 34. Bjork, S. M.; Sjostrom, S. L.; Andersson-Svahn, H.; Joensson, H. N. Metabolite profiling of microfluidic cell culture conditions for droplet based screening. Biomicrofluidics 2015, 9, 044128. 35. Brouzes, E. et al. Droplet microfluidic technology for single-cell high-throughput screening. Proc. Natl. Acad. Sci. U. S. A. 2009, 106, 14195-14200. 36. Zhu, Z.; Yang, C. J. Hydrogel Droplet Microfluidics for High-Throughput Single Molecule / Cell Analysis. Acc. Chem. Res. 2017, 50, 22-31. 37. Shembekar, N.; Chaipan, C.; Utharala, R.; Merten, C. A. Droplet-based microfluidics in drug discovery, transcriptomics and high-throughput molecular genetics. Lab Chip 2016, 16, 1314-1331. 38. Gielen, F. et al. Ultrahigh-throughput-directed enzyme evolution by absorbance- activated droplet sorting (AADS). Proc. Natl. Acad. Sci. U. S. A. 2016, 113, E7383-E7389. 39. Romero, P. A.; Tran, T. M.; Abate, A. R. Dissecting enzyme function with microfluidic-based deep mutational scanning. Proc. Natl. Acad. Sci. U. S. A. 2015, 112, 7159-7164. 40. Sukovich, D. J.; Lance, S. T.; Abate, A. R. Sequence specific sorting of DNA molecules with FACS using 3dPCR. Sci. Rep. 2017, 7, 39385. 41. Lim, S. W.; Abate, A. R. Ultrahigh-throughput sorting of microfluidic drops with flow cytometry. Lab Chip 2013, 13, 4563-4572. 42. Griffiths, A. D.; Tawfik, D. S. Miniaturising the laboratory in emulsion droplets. Trends Biotechnol. 2006, 24, 395-402. 43. Sandberg, J.; Stahl, P. L.; Ahmadian, A.; Bjursell, M. K.; Lundeberg, J. Flow cytometry for enrichment and titration in massively parallel DNA sequencing. Nucleic Acids Res. 2009, 37, e63.

Claims

1. 1. A method for producing a monodisperse emulsion, said method comprising: mixing a plurality of monodisperse template particles, wherein 50% or more of the template particles have diameters that vary by less than 10-fold, with a first aqueous fluid comprising a plurality of target particles to provide a first mixture; mixing the first mixture with a second fluid that is immiscible with the first aqueous fluid to provide a second mixture; and shearing the second mixture by vortexing to encapsulate the plurality of monodisperse template particles into a plurality of monodisperse droplets having diameters of 0.1 to 1000 μm in the second fluid, thereby providing a plurality of monodisperse droplets comprising the first aqueous fluid, one of the monodisperse template particles, and one of the plurality of target particles; the template particle comprises agarose, polyethylene glycol (PEG), or polyacrylamide (PAA); the first aqueous fluid comprises a surfactant soluble in the first aqueous fluid, the surfactant being octylphenol ethoxylate (Triton™ X-100) and / or octylphenoxypolyethoxyethanol (IGEPAL®), and the second fluid is HFE-7500 fluorinated oil; A method that does not use a microfluidic device to generate droplets.

2. The method of claim 1 , wherein the second mixture is vortexed for at least 30 seconds.

3. 3. The method of claim 1 or 2, wherein the second mixture is vortexed for 30 seconds.

4. 4. The method of claim 1, wherein the diameters of 99% or more of the plurality of template particles vary by less than 10-fold.

5. 5. The method of claim 1, wherein the diameters of the droplets vary by less than 10-fold.

Citation Information

Patent Citations

  • Systems and methods for barcoding nucleic acids

    JP2017515469A

  • Substrate-mediated reactors for bioassays

    WO2015179848A1