Use of miRNA-2911 molecules as nucleic acid stabilizers

MiRNA-2911 derivatives enhance nucleic acid stability by incorporating specific sequences and linkers, addressing degradation issues and improving serum stability, benefiting both oligonucleotides and mRNA drugs.

JP7823939B2Active Publication Date: 2026-03-04LNCTAC CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2022-12-13
Publication Date
2026-03-04

AI Technical Summary

Technical Problem

Nucleic acid drugs are susceptible to degradation by nucleases and have unstable affinity for targets, leading to potential safety issues and limited effectiveness in localization and transport.

Method used

Utilizing miRNA-2911 and its derivatives to stabilize nucleic acids by incorporating specific sequences and linkers, enhancing their resistance to degradation and improving stability in serum.

Benefits of technology

The method significantly improves the stability of nucleic acid drugs in serum, offering higher stability compared to conventional chemical and non-chemical modification methods, and is applicable to both oligonucleotides and ncRNA/mRNA drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007823939000002
    Figure 0007823939000002
  • Figure 0007823939000003
    Figure 0007823939000003
  • Figure 0007823939000004
    Figure 0007823939000004
Patent Text Reader

Abstract

The present invention relates to the use of miRNA-2911 molecules as nucleic acid stabilizing agents. Specifically, the structure of the miRNA-2911 molecule that improves the stability of a target nucleic acid is the following formula: GGX1X2GGGGG-(L) n -X3X4GGX5X6X7GGGX8 (SEQ ID NO: 1), in which X1, X2, X3, X4, X5, X6, X7, and X8 are independently selected from A, C, T, and U, n is 0 or 1, and L represents a linker group of 10 nucleotides or less in length.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure relates to the fields of biomedicine and biotechnology, and in particular to the use of miRNA-2911 molecules as nucleic acid stabilizers. [Background technology]

[0002] The ability of nucleic acids to bind to targets such as proteins has enabled the development of various nucleic acid tools or drugs, including ASO drugs, mRNA drugs, RNA aptamers, and regulatory RNAs. Among these, mRNA has been developed as an mRNA drug based on protein translation. Nucleic acid aptamers can bind to targets (proteins, small molecules, cells, etc.) and function similarly to "chemical antibodies," and are used in the field of nucleic acid drugs. However, these nucleic acid drugs are susceptible to degradation by nucleases, have unstable affinity for the target, and are difficult to localize and transport.

[0003] To prevent the degradation of nucleic acid drugs, various methods, including both chemical and non-chemical modification methods, have been developed against nuclease degradation. Currently, the most widely used methods are mainly chemical modifications, including phosphate backbone modifications, sugar modifications, phosphoric acid modifications, and base modifications, which are used to increase the stability of nucleic acid drugs. However, chemically modified nucleic acid drugs may have potential safety issues, such as inducing immune responses by activating Toll-like receptors, causing cytotoxicity (such as proteinuria caused by inducing apoptosis), impairing coagulation, and exacerbating thrombocytopenia.

[0004] Currently, there are very few non-chemical modification methods reported. In 1989, short oligonucleotides capable of forming highly stable secondary structures were reported. In 1993, Coulson's research group discovered a thermodynamically stable hairpin (GCGAAAGC) that could protect oligonucleotides from degradation by 3'-terminal exonucleases and optimized this hairpin to obtain the min-hairpin (GCGAAGC). However, the protective effect of this method is limited. In 2002, U.S. Patent No. 7,022,832 B2 disclosed that designing the 5' and / or 3' ends of oligonucleotides into hairpin structures provided protection in 10% inactivated serum and enabled gene knockdown in animals using nanomaterials. However, due to limited protective effect, this method has not been widely used. In 2002, U.S. Patent No. 6,121,434 A disclosed that oligonucleotides could be protected by consecutive G bases (0 to 10 Gs). However, this method is not widely used because it is usually used in combination with thio modifications. Similarly, mRNA is also susceptible to degradation by nucleases.

[0005] Zhang Chenyu's research group discovered highly stable miRNA-2911 in honeysuckle decoction and found that miRNA-2911 has antiviral activity, but it has not been reported whether miRNA-2911 can protect nucleic acids from degradation. Summary of the Invention [Problem to be solved by the invention]

[0006] Thus, there is an unmet need for materials and methods that improve the stability of nucleic acids and / or protect nucleic acids from degradation. [Means for solving the problem]

[0007] The present disclosure is based on the discovery that miRNA-2911 and its derivatives can be used to protect nucleic acids and improve nucleic acid stability in serum.

[0008] In a first aspect, the present disclosure provides miRNA-2911 and nucleic acid molecules derived therefrom that improve the stability of a nucleic acid of interest, characterized in that they comprise the following sequence: GGX1X2GGGGG-(L) n -X3X4GGX5X6X7GGGX8 (SEQ ID NO: 1) X1, X2, X3, X4, X5, X6, X7, and X8 are independently selected from A, C, T, and U; n is 0 or 1, L represents a linker group of 10 nucleotides or less in length.

[0009] In some embodiments, the linker group comprises G. In some embodiments, the linker group consists of one or more Gs. In some embodiments, the linker group is 1 to 5 nucleotides in length. In some embodiments, the linker group is GGGGG.

[0010] In some embodiments, the miRNA-2911 and nucleic acid molecules derived therefrom comprise the following sequence: GGX1X2GGGGGX3X4GGX5X6X7GGGX8 (SEQ ID NO: 3) X1, X2, X3, X4, X5, X6, X7, and X8 are independently selected from A, C, T, and U.

[0011] In some embodiments, X1, X2, X4, and X6 are the same. In some embodiments, X1, X2, X4, and X6 are the same and are each A, C, or U. In some embodiments, X3, X5, and X8 are the same. In some embodiments, X3, X5, and X8 are the same and are each A, C, or U. In some embodiments, X1, X2, X3, X4, X5, X6, and X8 are independently selected from A, C, and U, and X7 is independently selected from A, C, T, and U. In some embodiments, if any one of X1, X2, X3, X4, X5, X6, and X8 is U, then the remaining nucleotides of X1, X2, X3, X4, X5, X6, and X8 are each U. In some embodiments, X1, X2, X3, X4, X5, X6, X7, and X8 are each A, C, or U. In some embodiments, when X7 is T, X1, X2, X4, and X6 are each C, and X3, X5, and X8 are each A. In some embodiments, X1, X2, X3, X4, X5, X6, X7, and X8 are each A.

[0012] In some embodiments, the miRNA-2911 and nucleic acid molecules derived therefrom comprise or consist of one or more (e.g., two) sequences of SEQ ID NO:1 or SEQ ID NO:3 linked directly or indirectly by a linker. In some embodiments, the linker is 10 nucleotides or less in length. In some embodiments, the linker comprises G. In some embodiments, the linker consists of one or more Gs. In some embodiments, the linker is 1 to 5 nucleotides in length. In some embodiments, the linker is GGGGG.

[0013] In some embodiments, the miRNA-2911 and nucleic acid molecules derived therefrom comprise or are selected from the sequences of SEQ ID NOs: 4-10.

[0014] In some embodiments, the nucleic acid of interest is DNA or RNA. In some embodiments, the nucleic acid of interest is modified or unmodified (e.g., unthio-modified). In some embodiments, the miRNA-2911 and nucleic acid molecules derived therefrom are DNA or RNA.

[0015] In some embodiments, the miRNA-2911 and nucleic acid molecules derived therefrom are modified or unmodified (eg, thio-unmodified).

[0016] In some embodiments, the length of the target nucleic acid is 8 to 5000 nt, for example, 8 to 4000 nt, 8 to 3000 nt, 8 to 2000 nt, 8 to 1000 nt, 8 to 500 nt, 8 to 200 nt, 8 to 150 nt, 8 to 100 nt, 8 to 80 nt, 8 to 50 nt, 8 to 40 nt, 8 to 30 nt, 8 to 20 nt, 8 to 10 nt, 30 to 180 nt, 20 to 100 nt, and 30 to 50 nt.

[0017] In some embodiments, the miRNA-2911 and nucleic acid molecules derived therefrom are not the following RNA molecules: GGCCGGGGGACGGACUGGGA (SEQ ID NO: 2)

[0018] In a second aspect, the present disclosure provides a protected nucleic acid of interest, characterized in that the miRNA-2911 of the first aspect and a nucleic acid molecule derived therefrom, or a nucleic acid molecule having the following sequence, is conjugated to the 5' end, the 3' end, or both the 5' and 3' ends of the nucleic acid of interest, or inserted within the nucleic acid of interest, and the stability of the nucleic acid of interest is improved: GGCCGGGGGACGGACUGGGA (SEQ ID NO: 2)

[0019] In some embodiments, the length of the target nucleic acid is 8 nt or more. In some embodiments, the length of the target nucleic acid is 8 to 5,000 nt, for example, 8 to 4,000 nt, 8 to 3,000 nt, 8 to 2,000 nt, 8 to 1,000 nt, 8 to 500 nt, 8 to 200 nt, 8 to 150 nt, 8 to 100 nt, 8 to 80 nt, 8 to 50 nt, 8 to 40 nt, 8 to 30 nt, 8 to 20 nt, 8 to 10 nt, 30 to 180 nt, 20 to 100 nt, and 30 to 50 nt.

[0020] In some embodiments, the nucleic acid of interest is a nucleic acid for gene knockdown, a nucleic acid for gene knockout, a nucleic acid for gene activation, a nucleic acid for gene modification, a nucleic acid for gene editing, a nucleic acid for gene regulation, a nucleic acid for protein regulation, a nucleic acid for protein expression, a nucleic acid for bioassay, or a nucleic acid medicine.

[0021] In some embodiments, the nucleic acid of interest is an oligonucleotide, single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA, mRNA, or ncRNA (non-coding RNA).

[0022] In some embodiments, the oligonucleotide is an antisense oligonucleotide (ASO) or an aptamer. In some embodiments, the ncRNA is a microRNA (miRNA), a small interfering RNA (siRNA), a small activating RNA (saRNA), a PIWI protein-interacting RNA (piRNA), a long non-coding RNA (lncRNA), a circular RNA (circular RNA), a fragment thereof, or other regulatory RNA.

[0023] In some embodiments, the nucleic acid of interest is DNA or RNA.

[0024] In some embodiments, the target nucleic acid is modified or unmodified. In some embodiments, the miRNA-2911 and nucleic acid molecules derived therefrom are modified or unmodified. In some embodiments, the conjugate is a chemical covalent bond, preferably a phosphodiester bond.

[0025] In some embodiments, the method of construction of the protected nucleic acid of interest comprises chemical synthesis, genetic engineering based on the principles of PCR, or biosynthesis.

[0026] In a third aspect, the present disclosure provides a pharmaceutical composition comprising the protected nucleic acid of interest of the second aspect and a pharmaceutically acceptable carrier.

[0027] In a fourth aspect, the present disclosure provides a method for improving the stability of a target nucleic acid, characterized in that the miRNA-2911 of the first aspect and a nucleic acid molecule derived therefrom, or a nucleic acid having the following sequence, is conjugated to the 5' end, 3' end, or both the 5' end and 3' end of the target nucleic acid, or inserted into the target nucleic acid: GGCCGGGGGACGGACUGGGA (SEQ ID NO: 2)

[0028] In some embodiments, the length of the target nucleic acid is 8 nt or more, for example, 8 to 5000 nt, including 8 to 4000 nt, 8 to 3000 nt, 8 to 2000 nt, 8 to 1000 nt, and 8 to 500 nt, and is preferably 8 to 200 nt, including 8 to 150 nt, 8 to 100 nt, 8 to 80 nt, 8 to 50 nt, 8 to 40 nt, 8 to 30 nt, 8 to 20 nt, 8 to 10 nt, 30 to 180 nt, 20 to 100 nt, and 30 to 50 nt.

[0029] In some embodiments, the nucleic acid of interest is a nucleic acid for gene knockdown, a nucleic acid for gene knockout, a nucleic acid for gene activation, a nucleic acid for gene modification, a nucleic acid for gene editing, a nucleic acid for gene regulation, a nucleic acid for protein regulation, a nucleic acid for protein expression, a nucleic acid for bioassay, or a nucleic acid medicine.

[0030] In some embodiments, the nucleic acid of interest is an oligonucleotide, single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA, mRNA, or ncRNA.

[0031] In some embodiments, the oligonucleotide is an antisense oligonucleotide (ASO) or an aptamer.

[0032] In some embodiments, the ncRNA is a miRNA, siRNA, saRNA, piRNA, lncRNA, circRNA, a fragment thereof, or other regulatory RNA.

[0033] In some embodiments, the nucleic acid of interest is modified or unmodified. In some embodiments, the miRNA-2911 and nucleic acid molecules derived therefrom are modified or unmodified.

[0034] In some embodiments, the conjugate is a covalent chemical bond, preferably a phosphodiester bond.

[0035] In some embodiments, the method for constructing the protected nucleic acid of interest comprises chemical synthesis, genetic engineering based on the principles of PCR, or biosynthesis. In some embodiments, the nucleic acid of interest is DNA or RNA.

[0036] Embodiments of the present disclosure are described in detail in the following specification and examples. However, it should be understood that the present disclosure is not limited to the specific embodiments described herein and may therefore vary. Many modifications or variations are possible and accessible to those skilled in the art, and all such modifications or variations are within the scope of the present disclosure.

[0037] The above only describes the outline of the technical solution of the present disclosure. In order to make the technical solution of the present disclosure more clearly understandable, the present disclosure will be further described in detail below with reference to the accompanying drawings and specific embodiments. [Brief explanation of the drawings]

[0038] [Figure 1] FIG. 1 shows the stability of an RNA drug containing miRNA-2911 in serum. [Figure 2] FIG. 2 shows the stability in serum of an RNA drug containing a modified RNA based on miRNA-2911. [Figure 3] FIG. 3 shows the stability in serum of a nucleic acid drug chimera containing a modified RNA based on miRNA-2911. [Figure 4] FIG. 4 shows the stability in serum of a DNA medicine containing modified DNA based on miRNA-2911. [Figure 5] FIG. 5 shows the stability in serum of a nucleic acid drug chimera containing modified DNA based on miRNA-2911. [Figure 6] FIG. 6 shows the stability in serum of nucleic acid drugs with various sequences containing R2911A. [Figure 7] FIG. 7 shows the stability in serum of nucleic acid drugs of various lengths containing R2911A. [Figure 8] Figure 8 shows the results of verifying the stability of nucleic acid drugs containing R2911A in animals. [Figure 9]FIG. 9 shows the stability in serum of nucleic acid drugs containing R2911A at the 5' or 3' end and internally. [Figure 10] FIG. 10 shows an evaluation of the ability of siRNA containing R2911A to knock down target RNA in cells (Hep3B and 97H cell lines). [Figure 11] FIG. 11 shows the evaluation of the effect of mRNA containing R2911A on intracellular protein expression.

[0039] Some aspects of the present disclosure are described below with reference to application examples for illustrative purposes. It should be understood that numerous specific details, relationships, and methods are set forth to provide a thorough understanding of the present disclosure. However, those skilled in the relevant art will readily understand that the present disclosure can be practiced without one or more of the specific details.

[0040] In the prior art, methods for protecting nucleic acid drugs from degradation include chemical modification and non-chemical modification, but neither method is effective enough.The inventors of the present application have devised a method for protecting nucleic acid drugs using miRNA-2911 and its derivatives, which significantly improves the stability of nucleic acid drugs in serum.

[0041] Compared with the prior art, the present disclosure has the following beneficial effects: 1. The nucleic acid molecules and methods of the present disclosure can improve the stability of nucleic acid drugs in serum without modification; 2. The nucleic acid drugs of the present disclosure have been demonstrated to have the advantage of high stability in serum compared to existing conventional protection methods using chemical modification and non-chemical modification; and 3. The protection method disclosed herein is not only applicable to oligonucleotide drugs, but can also be used to protect ncRNA and mRNA, significantly improving the stability of ncRNA and mRNA, making it a valuable ally in the development of ncRNA and mRNA drugs. DETAILED DESCRIPTION OF THE INVENTION

[0042] The terms used herein are used only to describe particular embodiments and are not intended to limit the present disclosure. Unless otherwise defined herein, singular terms are intended to include the plural. Furthermore, open-ended terms such as "comprises" and "has" are intended to include elements and steps that are not listed. Note, however, that open-ended terms also include instances where only listed elements and method steps are included (i.e., when the closed-ended term "consisting of" is used).

[0043] In this specification, ranges are shorthand for representing each and every value within the range.Any value (e.g., integer value) within the range can be selected as the end point of the range.For example, the expression "10 or less nucleotides" means 1 or less, 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, and 10 or less nucleotides, as well as partial ranges within these values, such as 1-8nt, 2-5nt, 3-7nt, etc.

[0044] All scientific and technical terms used herein shall have the same meaning as commonly understood by those skilled in the art. In case of conflict, the definitions in this specification shall prevail. Below, some terms are explained to make the description of this disclosure easier to understand.

[0045] In this disclosure, the terms "nucleic acid," "nucleic acid molecule," and "nucleic acid drug" may be used interchangeably to refer to any DNA, RNA, or DNA / RNA chimera, which may be an oligonucleotide or polynucleotide, and may be unmodified RNA or unmodified DNA, or modified RNA or modified DNA. These terms include, but are not limited to, single-stranded and double-stranded DNA, DNA that is a mixture of single-stranded and double-stranded regions, single-stranded and double-stranded RNA, RNA that is a mixture of single-stranded and double-stranded regions, and hybrid molecules containing DNA and RNA that may be single-stranded or double-stranded, or may be a mixture of single-stranded and double-stranded regions.

[0046] In some embodiments, a nucleic acid may contain one or more modified nucleotides, modified linkages, etc. Examples of modified linkages or internucleotide linkages include phosphorothioates, phosphorodithioates, etc. In some embodiments, the nucleotide contains a phosphorus derivative. The phosphorus derivative (or modified phosphate group) attached to the sugar moiety or sugar analog moiety in the modified nucleotides of the present disclosure may include monophosphate, diphosphate, triphosphate, alkylphosphate, alkanephosphate, phosphorothioate, etc. Methods for preparing the aforementioned phosphate analogs and methods for incorporating them into nucleotides, modified nucleotides, and oligonucleotides are known and need not be described herein.

[0047] As used herein, "unmodified" or "natural" nucleotides include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleotides include nucleotides that occur rarely or only temporarily in natural nucleic acids, such as hypoxanthine, 6-methyladenine, and 5-Me pyrimidines, particularly 5-methylcytosine (also known as 5-methyl-2' deoxycytosine, often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosylated HMC, and gentiobiosyl HMC, as well as synthetic nucleotides such as 2-aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalkylamino)adenine, or other hetero-substituted alkyl adenines, including 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6(6-aminohexyl)adenine, and 2,6-diaminopurine. "Common" bases known in the art (eg, inosine) may be included.

[0048] Nucleic acid modification

[0049] (1) Nucleic acid structure

[0050] In some embodiments, nucleic acids (e.g., DNA-targeting RNAs) of the present disclosure contain one or more modifications (e.g., base modifications, backbone modifications, etc.) to confer new or enhanced properties (e.g., improved stability) to the nucleic acid. As known in the art, a nucleoside is a linkage between a base and a sugar. The base portion of a nucleoside is generally a heterocyclic base. Purines and pyrimidines are the two most common types of such heterocyclic bases. A nucleotide may also be a nucleoside that further includes a phosphate group covalently attached to the sugar portion of the nucleoside. For pentofuranosed nucleosides, the phosphate group can be linked to the 2', 3', or 5' hydroxyl moiety of the sugar. In forming an oligonucleotide, adjacent nucleosides are covalently linked by the phosphate groups to form a linear polymeric compound. The respective ends of the linear polymeric compound can then be further linked to form a cyclic compound. However, linear compounds are generally preferred. Additionally, linear compounds may fold to form fully or partially double-stranded compounds with internal nucleotide-base complementarity. Within oligonucleotides, the phosphate groups are commonly referred to as the internucleoside backbone that forms the oligonucleotide. The common linkage or backbone of RNA and DNA is the 3' and 5' phosphodiester bond.

[0051] (2) Modified backbone and internucleoside linkage

[0052] Preferred examples of modified nucleic acids include nucleic acids having modified backbones or non-natural internucleoside linkages. Nucleic acids (nucleic acids having modified backbones) include those that retain a phosphorus atom in the backbone and those that do not retain a phosphorus atom in the backbone.

[0053] Preferred modified oligonucleotides containing phosphorus atoms include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl phosphates and other alkyl phosphates, including 3'-alkylene phosphates, 5'-alkylene phosphates and chiral phosphates, phosphonates, phosphoramidates, including 3'-aminophosphoramidates and aminoalkylphosphoramidates, diaminophosphates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, borophosphates, and selenophosphates, including those with normal 3'-5' linkages, 2'-5' linked analogs thereof, and those with inverted polarity, wherein one or more internucleotide linkages are 3'-3', 5'-5', or 2'-2'. Preferred nucleic acids with inverted polarity contain a single 3' to 3' linkage at the 3' internucleotide linkage, i.e., a single reverse nucleoside residue with no base (the nucleobase is missing or replaced by a hydroxyl group). Various salts (such as potassium or sodium salts), mixed salts, and free acid forms are also included.

[0054] In some embodiments, the nucleic acids of the disclosure contain one or more phosphorothioate and / or heteroatom internucleoside linkages, particularly -CH2-NH-O-CH2-, -CH2-N(CH3)-O-CH2- (known as a methylene(methylimino) or MMI backbone), -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, and -ON(CH3)-CH2-CH2- (representing the natural phosphodiester internucleoside linkage as -O-P(=O)(OH)-O-CH2-).

[0055] Other backbone modifications include, for example, nucleic acids with morpholino backbone structures. For example, in some embodiments, the nucleic acids of the present disclosure contain a six-membered morpholino ring in place of the ribose ring. In some of these embodiments, the phosphodiester linkage is replaced by a diaminophosphate or other non-phosphodiester internucleoside linkage.

[0056] Preferred modified polynucleotide backbones that do not contain phosphorus atoms include those formed by short-chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short-chain heteroatom or heterocyclic internucleoside linkages. These backbones include those with morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide, and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, riboacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones with mixed N, O, S, and CH2 components.

[0057] Other backbone modifications include locked nucleic acids (LNAs), in which the 2'-hydroxyl is attached to the 4' carbon atom of the sugar ring to form a 2'-C,4'-C-oxymethylene linkage, forming a bicyclic sugar moiety. The chain may be methylene (-CH2-), a group bridging the 2' oxygen atom and the 4' carbon atom, where n is 1 or 2 (Singh et al., Chem. Commun., 1998, 4, 455-456). LNAs and LNA analogs exhibit exceptionally high duplex thermal stability (Tm = +3°C to +10°C) with complementary DNA and RNA, stability against 3' nuclease exonuclease degradation, and good solubility.

[0058] The synthesis and preparation of LNA adenine, cytosine, guanine, 5-methylcytosine, thymine and uracil monomers, along with their oligomerization and nucleic acid recognition properties, have been described in the prior art (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630).

[0059] (3) Modified sugar moiety

[0060] Nucleic acids of the present disclosure may further comprise one or more substituted sugar moieties. Preferred polynucleotides comprise sugar substituents selected from OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, where the alkyl, alkenyl, and alkynyl may be substituted or unsubstituted alkyl having 1 to 10 carbon atoms or alkenyl and alkynyl having 2 to 10 carbon atoms. Particularly preferred sugar substituents include O((CH2) n O) m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2, and O(CH2) n ON((CH2) nCH3)2, where n and m are from 1 to about 10. Other preferred polynucleotides contain sugar substituents selected from 1 to 10 carbon lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkylaryl, aralkyl, O-alkylaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkylaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving group, reporter group, intercalator, group for improving the pharmacokinetic properties of nucleic acids or group for improving the pharmacodynamic properties of nucleic acids, and other substituents with similar properties. Preferred modifications include 2'-methoxyethoxy (2'-O-CH2CHOCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504), i.e., an alkoxy-alkoxy group. Other preferred modifications include 2'-dimethylaminooxyethoxy, i.e., the O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, described in the Examples below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH3)2.

[0061] Other preferred sugar substituents include methoxyl (-O-CH), aminopropyloxyl (-OCHCHCHNH), allyl (-CH-CH=CH), -O-allyl (-O-CH-CH=CH), and fluoro (F). The 2'-sugar substituent may be at the arabinose (upper) or ribose (lower) position. A preferred 2'-arabino modification is 2'-F. Similar modifications may be made at other positions on the oligomeric compound, particularly the 3' position of the 3'-terminal nucleoside or sugar and the 5' position of the 5'-terminal nucleotide in 2'-5' linked oligonucleotides. Oligomeric compounds may also have sugar mimetics, such as a cyclobutyl moiety, in place of the pentofuranosyl group.

[0062] (4) Base modification and substitution

[0063] The nucleic acids of the present disclosure may contain modifications or substitutions of nucleobases (often referred to in the art simply as "bases"). As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C=C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines, 5-halo (especially 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine. Other modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine (1H-pyrimido(5,4-b)(1,4)benzoxazin-2(3H)-one) and phenothiazine cytidine (1H-pyrimido(5,4-b)(1,4)benzothiazin-2(3H)-one), G-clips such as substituted phenazine cytidines (e.g., 9-(2-aminoethoxy)-H-pyrimido(5,4-(b)(1,4)benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido(4,5-b)indol-2-one), and pyridoindole cytidine (H-pyrido(3',2':4,5)pyrrolo(2,3-d)pyrimidin-2-one).

[0064] Heterocyclic base moieties also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Other nucleobases include those disclosed in The Concise Encyclopedia of Polymer Science and Engineering, pp. 858-859, Kroschwitz, J. L, ed., John Wiley & Sons, 1990; those disclosed in Angewandte Chemie, International Edition, 1991, pp. 30-613; and those disclosed in Sanghvi, Y. S, Chapter 15, Antisense Research and Applications, pp. 289-302, Crooke, ST and Lebleu, B., ed., CRC Press, 1993.Some of these nucleobases are useful for increasing the binding affinity of the oligomeric compound. These nucleobases include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-Methylcytosine substitutions have been shown to increase nucleic acid duplex stability at 0.6°C to 1.2°C (Sanghvi et al., Eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, 276-278), and are a preferred base substitution, for example, when combined with a 2'-O-methoxyethyl sugar modification.

[0065] (5) Conjugates

[0066] Other possible modifications of the nucleic acids of the present disclosure involve chemical conjugation with one or more moieties or conjugates that enhance activity, cellular distribution, or cellular uptake of the oligonucleotide to the polynucleotide. The moieties or conjugates may include conjugate groups that covalently attach functional groups, such as primary or secondary hydroxyl groups. Conjugate groups include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of the oligomer, and groups that enhance the pharmacokinetic properties of the oligomer. Preferred conjugate groups include, but are not limited to, cholesterol, lipids, phospholipids, biotin, phenazine, folic acid, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin, and dyes. Groups that enhance pharmacodynamic properties include groups that improve uptake, increase resistance to degradation, and / or enhance sequence-specific hybridization with the nucleic acid of interest. Groups that enhance the pharmacokinetic properties include groups that improve uptake, distribution, metabolism, or excretion of the nucleic acids of the disclosure.

[0067] Conjugate moieties include lipid moieties, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), thiocholesterols (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), palmityl moieties (Mishra et al., Biochim. Biophys.Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).

[0068] In some embodiments, a nucleic acid molecule of the disclosure comprises or consists of SEQ ID NO: 1 or 3. In some embodiments, a nucleic acid molecule of the disclosure comprises or consists of two or more of SEQ ID NO: 1 or 3 linked directly or indirectly by a linker (i.e., a dimer, trimer, etc. of SEQ ID NO: 1 or 3).

[0069] In the present disclosure, the terms "linker group" and "linker" may be used interchangeably and may refer to an oligonucleotide sequence used to link different portions of a base sequence. The oligonucleotide sequence may contain unmodified or modified natural or non-natural nucleotides. In some embodiments, the linker group or linker includes A, T, C, G, and / or U. In some embodiments, the linker group or linker includes G. In some embodiments, the linker group or linker consists of one or more Gs. In some embodiments, the length of the linker group or linker is 1 to 10 nucleotides, e.g., 1 to 5 nucleotides, e.g., 3 to 5 nucleotides. In some embodiments, the linker group or linker is GGGGG. In some embodiments, the protective effect of the nucleic acid molecules of the present disclosure is not affected by the presence or absence of the linker group or linker.

[0070] In this disclosure, the terms "conjugate" and "linked" are used interchangeably and refer to a linkage by a chemical bond.

[0071] As used herein, the stability of a nucleic acid in serum refers to the stability of the nucleic acid in various concentrations of serum, such as 50% serum. As used herein, improved stability refers to improved stability of the nucleic acid of interest, for example, in serum, compared to a nucleic acid of interest that is not protected by a nucleic acid molecule of the present disclosure or that is protected by another method. In some embodiments, the nucleic acid of interest has the same or similar activity as a nucleic acid of interest that is not protected by a nucleic acid molecule of the present disclosure or that is protected by another method, but has improved stability. In some embodiments, the activity of the nucleic acid of interest remains unchanged.

[0072] As used herein, the term "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents, absorption delaying agents, and the like, that are compatible with drug delivery. Preferred carriers are described in the latest edition of Remington's Pharmaceutical Sciences, a standard reference publication in the art, which is incorporated herein by reference. Preferred examples of such carriers or diluents include, but are not limited to, water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. The use of such carriers and agents is well known in the art. Any conventional carrier or agent may be used in the compositions, unless it is incompatible with the material provided herein.

[0073] The following specific examples are only for illustrating the solutions of the present disclosure and are not intended to limit the technical solutions of the present disclosure. Those skilled in the art will understand that the present disclosure allows further modifications and equivalent replacements. Any modifications or partial replacements without departing from the intent and scope of the present disclosure shall be within the protection scope of the present disclosure. [Example]

[0074] Unless otherwise specified, all materials used in the examples herein are commercially available. The various specific experimental methods used herein are either conventional in the art or follow the steps and conditions suggested by the manufacturer, and can be appropriately determined by those skilled in the art as needed. The serum used in the examples herein was Gibco Premium fetal bovine serum. The degradation system contained the oligonucleotide drug, 1x PBS, 50% serum, and water. The electrophoresis conditions were 180 V, 20 minutes, and a loading amount of 2 μg to 5 μg. Unless otherwise specified, the miRNA-2911 sequence and its derivatives in the examples herein are attached to both ends of the sequences to be protected.

[0075] [Example 1] Improved stability of RNA medicine containing miRNA-2911 in serum

[0076] A specific sequence (miRNA-2911) was added to the 5' and 3' ends of the protecting RNA (R1) to form miRNA2911-R1 (shown as mi2911-R1 in Figure 1). Random sequence RRs were selected as a negative control (because oligonucleotides are short and prone to degradation). A random control sequence of essentially the same length as the protected sequence was selected. This resulted in a nearly linear electrophoretic pattern, making comparisons easier. The above sequences were incubated in serum for 6, 12, and 24 hours and then analyzed by 3% agarose gel electrophoresis. The results are shown in Figure 1. Here, random sequence RRs without the specific sequence (miRNA-2911) of the present disclosure were used as a negative control (NC), which was completely degraded after 6 hours. However, miRNA-2911-R1 had the complete sequence and was not degraded even after 12 hours, indicating that miRNA-2911 at both ends significantly improved the ability of R1 to resist degradation by nucleases in serum and enhanced the stability of R1 in serum.

[0077] The sequence information of the nucleic acid fragment used in Example 1 is as follows: miRNA-2911: GGCCGGGGGACGGACUGGGA (SEQ ID NO: 2) R1: UGAAUGUAGAGAUGCGGUGG (SEQ ID NO: 11) RRs: ACCCGACCUCUUCUAUCUGGACCCGACCGUCUCUUUUUUGAGCCCACACUCUACUCGAC (SEQ ID NO: 12)

[0078] [Example 2] Improved serum stability of RNA medicines based on miRNA-2911-modified RNA

[0079] The inventors performed various modifications to the miRNA-2911 sequence, adding modified sequences to both ends of R1 (SEQ ID NO: 11) and evaluating the RNA protection capabilities of the modified sequences. Random sequence RRs were also selected as a negative control. The sequences were incubated in serum for 6, 12, and 24 hours and then analyzed by 3% agarose gel electrophoresis. The results are shown in Figure 2 (1), (2), and (3). Although the degradation rates of the various modified nucleic acid drugs in serum varied, all showed intact, undegraded RNA, indicating that the various modified sequences have protective capabilities. Furthermore, the results of incubating an RNA drug containing modified RNA based on miRNA-2911 in serum for up to 36 hours are shown in Figure 2 (4). After 36 hours, the RNA drug containing modified RNA based on miRNA-2911 showed intact, undegraded sequences, indicating that the RNA drug containing modified RNA based on miRNA-2911 has higher stability in serum.

[0080] The sequence information of the nucleic acid fragment used in Example 2 is as follows: R2911A: GGAAGGGGGAAGGAAAGGGA (SEQ ID NO: 4) R2911C: GGCCGGGGGCCGGCCCGGGC (SEQ ID NO: 5) R2911U: GGUUGGGGGUUGGUUUGGGU (SEQ ID NO: 6) R2911A-5G: GGAAGGGGGGGGGGAAGGAAAGGGA (SEQ ID NO: 7) R2911A-D: GGAAGGGGGAAGGAAAGGGAGGAAGGGGGAAGGAAAGGGA (SEQ ID NO: 8) RRs: ACCCGACCUCUUCUAUCUGGACCCGACCGUCUCUUUUUUGAGCCCACACUCUACUCGAC (SEQ ID NO: 12)

[0081] [Example 3] Improved serum stability of nucleic acid drug chimeras by modifying miRNA-2911 into DNA

[0082] To verify the ability of the modified sequence to protect DNA, the specific sequence R2911A was added to the 5' and 3' ends of the DNA to be protected (D1) to form R2911A-D1, and a random sequence RD was selected as a negative control. The sequence was incubated in serum for 4, 6, and 12 hours and then analyzed by 3% agarose gel electrophoresis. The results are shown in Figure 3. R2911A-D1 still retained the intact sequence after 12 hours, indicating that nucleic acid drug chimeras containing R2911A have higher stability in serum.

[0083] The sequence information of D1 and DRs used in Example 3 is as follows: D1: TGAATGTAGAGATGCGGTGG (SEQ ID NO: 13) RDs: UGAAUGUAGAGAUGCGGUGGTGAATGTAGAGATGCGGTGGUGAAUGUAGAGAUGCGGUGG (SEQ ID NO: 14)

[0084] [Example 4] Improved stability of DNA medicine in serum by modifying DNA with miRNA-2911

[0085] The miRNA-2911 sequence was modified into DNA (D2911 and D2911A) and added to both ends of D1 to form D2911-D1 and D2911A-D1, respectively, to evaluate the DNA protection ability of the modified sequences. Meanwhile, D1 and D2911A-D1 were used as negative controls. The sequences were incubated in serum for 12, 24, and 36 hours and then analyzed by 3% agarose gel electrophoresis. The results are shown in Figure 4(1) and (2). The stability of D2911-D1 and D2911A-D1 in serum was significantly improved. Figure 4(2) indicates that the improved stability of the nucleic acid drug is due to D2911A, not the D1 sequence itself.

[0086] The sequence information of the nucleic acid fragment used in Example 4 is as follows: D1: TGAATGTAGAGATGCGGTGG (SEQ ID NO: 13) D2911: GGCCGGGGGACGGACTGGGA (SEQ ID NO: 9) D2911A: GGAAGGGGGAAGGAAAGGGA (SEQ ID NO: 10) DDs:TGAATGTAGAGATGCGGTGGTGAATGTAGAGATGCGGTGGTGAATGTAGAGATGCGGTGG (SEQ ID NO: 14)

[0087] [Example 5] Improved stability of nucleic acid drugs in serum by modifying DNA with miRNA-2911

[0088] To verify the RNA protection ability of D2911A, the D2911A sequence was added to both ends of R1 to form D2911A-R1. Random sequence DRs were selected as a negative control. The above sequences were incubated in serum for 1 hour and then analyzed by 3% agarose gel electrophoresis. The results are shown in Figure 5. The nucleic acid drug chimera containing D2911A had a certain stability in serum.

[0089] The sequence information of the nucleic acid fragment used in Example 5 is as follows: D2911A-R1: GGAAGGGGGGAAGGAAAGGGAUGAAUGUAGAGAGAUGCGGUGGGGAAGGGGGAAGGAAAGGGA (SEQ ID NO: 15) DRs: ATTTGACCTCTTCTATCTGGACCCGACCGUCUCUUUUUUGAGCCCACACTCTACTCGACG (SEQ ID NO: 16)

[0090] [Example 6] Evaluation of the stability in serum of nucleic acid drugs with various sequences containing R2911A

[0091] The ability of R2911A to protect nucleic acid drugs of various sequences was verified. Specifically, nucleic acids R2 to R6 with different sequences were selected, and R2911A was added to both ends of R2 to R6 to form R2911A-R2, R2911A-R3, R2911A-R4, R2911A-R5, and R2911A-R6, respectively. Random sequence RRs were used as negative controls, and these were not protected using the disclosed method. The aforementioned sequences were incubated in serum for 6 hours and then analyzed by 3% agarose gel electrophoresis. The results are shown in Figure 6. The degree of degradation of nucleic acid drugs of various sequences containing R2911A in serum varied, but all showed intact, undegraded DNA. Combined with the protective ability against R1 in Example 1, nucleic acid drugs of various sequences containing R2911A were shown to be stable in serum, indicating that the method disclosed herein is universally applicable to the protection of nucleic acid sequences.

[0092] The sequence information of the nucleic acid fragment used in Example 6 is as follows: R2: ACGGGGUCAUUAGUUCAUAG (SEQ ID NO: 17) R3: UAAGAUACACCUGCAAAGGC (SEQ ID NO: 18) R4: GCUCUCCUCAAGCGUAUUCA (SEQ ID NO: 19) R5: GUCGAGCUGGACGGCGACGU (SEQ ID NO: 20) R6: UGACCCUGAAGUUCAUCUGC (SEQ ID NO: 21) RRs: ACCCGACCUCUUCUAUCUGGACCCGACCGUCUCUUUUUUGAGCCCACACUCUACUCGAC (SEQ ID NO: 12)

[0093] [Example 7] Evaluation of the stability of nucleic acid drugs of various lengths containing R2911A in serum

[0094] The ability of R2911A to protect nucleic acid drugs of various lengths was verified. Specifically, nucleic acids of different lengths, 80 nt (R80) and 2000 nt (R2K), were selected. R2911A was added to both ends of the nucleic acid drug to form R2911A-R80 and R2911A-R1K, respectively. Unprotected RNAs were used as negative controls (R80-RC and R2K-RC, respectively). The ability of the disclosed method to protect long RNAs (including mRNA and lncRNA) was verified using 2000 nt RNA. The aforementioned sequences were incubated in 10% serum for 1 hour and 20 minutes, respectively, and then analyzed by 3% agarose gel electrophoresis. The results are shown in Figure 7 (1) and (2). Although the degree of degradation of nucleic acids of various lengths containing R2911A in serum varied, all demonstrated intact, undegraded RNA. Combined with the ability to protect 20nt nucleic acids in Example 6, it was shown that nucleic acid drugs of various lengths containing RNA R2911A were all stable. Furthermore, the ability of R2911A to protect RNA of 5000nt in length was also verified. The results showed that R2911A has the ability to protect RNA of this length (not shown).

[0095] The sequence information of the nucleic acid fragment used in Example 7 is as follows: R2911A-R80:GGAAGGGGGAAGGAAAGGGAGCUGUGUGACUCCUGCAAAGUGUGGACAACUUCCCACGGAGGAAUUCCCGUAUCUAAAGGUGCAGCUGUAUCUUGUCUCCGGAAGGGGGAAGGAAAGGGA (SEQ ID NO: 22) R80-RC: AACCUCUUAGACAGGUGGGAGAUUAUGAUCAGAGUAAAAGGUAAUUACACAUUUUAUUUCCAGAAAGUCAGGGGUCUAUA (SEQ ID NO: 23)

[0096] [Example 8] Evaluation of the stability of nucleic acid drugs containing R2911A in animals

[0097] A nucleic acid drug containing R2911A (R2911A-R1, formed by adding the R2911A sequence to both ends of R1) was labeled with Cy5.5 to form Cy5.5-R2911A-R1. The Cy5.5-R2911A-R1 was diluted with saline before injection. Mice were weighed, their abdomens were depilated, and administered at a dose of 2 mg / kg. Subcutaneous injections into mice were performed as follows: The mice were held and immobilized, and the injection was administered into the skin between the two hind limbs. A weight-appropriate amount of drug was drawn into a syringe, gently inserted into the skin with the needle facing upward, and then slowly injected. A successful subcutaneous injection was confirmed by the skin swelling at the injection site, followed by smoothly withdrawing the needle in the opposite direction to the insertion direction. In vivo imaging was performed on days 0, 1, 2, and 3 after injection to observe the distribution and degradation of Cy5.5-R2911A-R1 in mice after subcutaneous injection. The stability of R2911A-R1 nucleic acid drug in animals was previously verified. The results are shown in Figure 8. In mice injected with R2911A-R1 nucleic acid drug, significant fluorescence was still detectable on day 3, whereas in mice injected with Cy5.5-RRs (a Cy5.5-labeled nucleic acid drug without R2911A, shown as Cy5.5-RS in Figure 8), almost no fluorescence was detectable after 3 days. This example demonstrates that nucleic acid drugs containing R2911A have good stability in animals.

[0098] [Example 9] Evaluation of serum stability of nucleic acid drugs containing R2911A at the 5'-end, 3'-end, or internally

[0099] To evaluate the stability in serum of nucleic acid drugs containing R2911A at the 5'-end, 3'-end, or internally, R2911A was added to the 5'-end or 3'-end of R1, or internally. On the other hand, unprotected RNA was used as a negative control (RRs"). These sequences were incubated in serum for 12 hours, 24 hours, and 1 hour, respectively, and then analyzed by 3% agarose gel electrophoresis. The results are shown in Figure 9 (1) and (2). When R2911A was added internally (Figure 9 (2)), the protective effect was insufficient. When R2911A was added to the 5' or 3' end (Figure 9-(1)), the intact sequence remained undegraded even after 24 hours, indicating that R2911A at the 5' or 3' end can improve the stability of RNA in serum. When combined with the protective ability of R1 in Example 2, it was shown that the stability of nucleic acid drugs in serum is more significantly improved when the protected nucleic acid molecule of the present disclosure is present at both ends of R1.

[0100] The sequence information of the nucleic acid fragment used in Example 9 is as follows: R2911A-M: UGAAUGUAGAGAUGCGGUGGGGAAGGGGGAAGGAAAGGGAUGAAUGUAGAGAUGCGGUGG (SEQ ID NO: 26) R2911A-L: GGAAGGGGGGAAGGAAAGGGAUGAAUGUAGAGAUGCGGUGG (SEQ ID NO: 27) R2911A-R: UGAAUGUAGAGAUGCGGUGGGGAAGGGGGAAGGAAAGGGA (SEQ ID NO: 28) RRs":ACCCGACCUCUUCUAUCUGGACCCGACCGUCUCUUUUUUG (SEQ ID NO: 29)

[0101] [Example 10] Evaluation of the knockdown effect of siRNA drugs containing R2911A on target RNA in cells

[0102] 1. FDA-approved inclisiran was used as a positive control (positive control is chemically modified siRNA). An unmodified siRNA drug containing R2911A (inclisiran-R2911A) was also prepared by adding R2911A to the 3' end of the RNA sequence. For siRNA transfection, Lipofectamine 2000 was used as follows: An appropriate amount of inclisiran-2911A was diluted with 50 μL of Opti-MEM, and 4.8 μL of Lipofectamine 2000 was diluted with 50 μL of Opti-MEM. The mixture was mixed by gentle spraying and left at room temperature for 5 minutes. The resulting Lipofectamine 2000 dilution was added to the inclisiran-2911A dilution to form a mixture, which was then incubated at room temperature for 20 minutes. Simultaneously, the medium of cells in 12-well plates (97H and Hep3B cells at a cell density of 50-60%) was replaced with antibiotic (penicillin-streptomycin)-free medium (DMEM). The mixture was added dropwise and gently mixed. After 5-6 hours, the medium was replaced with complete culture medium containing serum and antibiotics. After 48, 72, and 96 hours of transfection, the cells were harvested and total RNA was extracted. After 96 hours of transfection, the cell density was too high to continue culturing in the 12-well plate, so the cells were passaged into a 6-well plate and harvested 120 hours later for total RNA extraction.

[0103] 2. Extraction of total cellular RNA

[0104] (1) Discard the medium and rinse the cells once with pre-chilled 1x PBS.

[0105] (2) Add 0.5 mL of Trizol to the cells in the 12-well plate, and add 1 mL of Trizol to the cells in the 6-well plate. Mix by spraying with a pipette to completely lyse the cells.

[0106] (3) Add 20% of the total volume of chloroform to the completely dissolved Trizol, cap the tube, shake vigorously to mix thoroughly, leave at room temperature for 2 minutes, and then centrifuge at 12,000 x g and 4°C for 15 minutes.

[0107] (4) Pipette approximately 200 μL (12-well plate) and 400 μL (6-well plate) of the aqueous phase into a new EP tube, add the same amount of isopropanol, mix, place in a low-temperature refrigerator at -80°C for half an hour, and then centrifuge at 12,000 × g and 4°C for 15 minutes.

[0108] (5) After centrifugation, a white precipitate (i.e., RNA) can be seen at the bottom of the tube. Remove the supernatant, add 1 mL of 75% ethanol to resuspend the precipitate, and then centrifuge at 7500 × g for 10 minutes at 4°C.

[0109] (6) Carefully aspirate the ethanol without pipetting the precipitate. Leave the tube at room temperature. After the ethanol has evaporated, add 50 μL of RNase-free H2O and incubate at 42°C for 2 minutes to fully dissolve the RNA. Then, remove a small amount of RNA, measure its concentration, and use TBE electrophoresis to detect the integrity of the RNA.

[0110] (7) 1 μg of total RNA is taken and reverse transcribed using 20 μL of reverse transcription system to obtain cDNA.

[0111] 3. Real-time fluorescent quantitative PCR

[0112] (1) Remove the cDNA from the -20°C refrigerator, dissolve it at room temperature, and then dilute it 10-fold with 180 μL of ddH2O.

[0113] (2) The qPCR reaction system was as follows: 20 μl 2x qPCR SYBR Green Mix Forward primer (10uM) 0.5μl Reverse primer (10uM) 0.5μl cDNA template 4 μl ddH2O 5 μl

[0114] The PCR conditions were as follows: 95°C for 3 minutes; 95°C for 10 seconds, 60°C for 10 seconds, and 72°C for 20 seconds (40 cycles of this program); 95°C for 15 seconds; 60°C for 60 seconds; the dissociation curve was determined by measuring the absorption of the fluorescent signal from 60°C to 95°C in 0.5°C increments; and 95°C for 10 seconds.

[0115] (3) PCR was performed using an ABI Step One Plus quantitative instrument, and the experimental data were analyzed according to the results of applying the △△Ct algorithm.

[0116] The knockdown ability of the PCSK9-targeting siRNA (inclisiran or 2911-conjugated inclisiran) used in this example was verified at the cellular level using 97H and Hep3B cell lines. Meanwhile, an equal amount of PBS was transfected as a negative control (mock), and inclisiran was used as a positive control.

[0117] The results (Figure 10) showed that the siRNA drug containing R2911A (inclisiran-R2911A) had good ability to knock down target genes in cells.

[0118] The information on the nucleic acid fragments used in this example is as follows: Inclisiran (fully modified sequence): TIFF0007823939000001.tif14170

[0119] Nucleotides underlined are methoxy-modified at the 2' position, nucleotides in italics are fluoro-modified (fluoro is the replacement of the hydroxyl group at the 2' position with a fluorine atom), and * indicates a thio-modification (replacement of the non-bridging oxygen atom in the phosphate bond with a sulfur atom). Inclisiran-R2911A:ACAAAAGCAAAACAGGUCUAGAAAAAGGAAGGGGGAAGGAAAGGGA

[0120] [Example 11] Evaluation of intracellular protein expression of mRNA containing R2911A

[0121] To evaluate the intracellular protein expression of mRNA drugs containing R2911A, R2911A was added to both ends of the firefly luciferase gene (mRNA1) to form R-mRNA1. Unprotected mRNA1 was used as a negative control (mRRs).

[0122] These sequences were transfected into 293U cells after in vitro transcription. After 24 hours, an equal volume of detection reagent (Promega, ONE-GloUM Luciferase Detection System, E6110) was added to the culture medium, and the luminescence signal was detected using a microplate reader (Thermo, Scientific VARioskan LUX). The results are shown in Figure 11. When R2911A was added to both ends of mRNA1, the intracellular protein expression level of R-mRNA1 was significantly higher than that of mRRs, indicating that the inclusion of R2911A significantly enhances the intracellular protein expression of mRNA drugs.

[0123] The sequence information used here is as follows:

[0124] Although only the preferred embodiments of the present disclosure have been described above, the present disclosure is not limited to any particular form. Simple modifications and equivalent replacements by those skilled in the art based on the technical content disclosed above are within the scope of protection of the present disclosure.

Claims

1. Adding miRNA-2911 and nucleic acid molecules derived therefrom to the 5' end and / or 3' end of a nucleic acid of interest, The miRNA-2911 and nucleic acid molecules derived therefrom have the sequence shown in SEQ ID NO: 2 and any one of SEQ ID NOs: 4 to 10. A method for improving the stability of a nucleic acid of interest.

2. the length of the target nucleic acid is 8 nt or more; The target nucleic acid is a nucleic acid for gene knockdown, a nucleic acid for gene knockout, a nucleic acid for gene activation, a nucleic acid for gene modification, a nucleic acid for gene editing, a nucleic acid for gene regulation, a nucleic acid for protein regulation, a nucleic acid for protein expression, a nucleic acid for bioassay, or a nucleic acid drug; A method for improving the stability of a target nucleic acid according to claim 1.

3. the length of the target nucleic acid is 8 to 5000 nt; The method for improving the stability of a target nucleic acid according to claim 2.

4. The target nucleic acid is (1) an oligonucleotide, (2) single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA, mRNA, or ncRNA; The ncRNA includes, but is not limited to, miRNA, siRNA, saRNA, piRNA, lncRNA, circRNA, fragments thereof, or other regulatory RNAs; A method for improving the stability of a target nucleic acid according to claim 1.

Citation Information

Patent Citations

  • Nucleic acid molecules and other molecules associated with plants

    US20040214272A1

  • Maize microrna sequences and targets thereof for agronomic traits

    WO2014151749A1

  • G-quadruplex-containing antisense oligonucleotides

    WO2017188898A1