CRISPR / Cas-based genome editing compositions to restore dystrophin function

Abstract

Disclosed herein are CRISPR / Cas-based genome editing compositions and methods for treating Duchenne muscular dystrophy by restoring dystrophin function.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 833,759, filed April 14, 2019, which is incorporated by reference herein in its entirety. Statement on Federally Sponsored Research This invention was made with government support under Grant No. R01AR069085 awarded by the National Institutes of Health. The government has certain rights in the invention. The present disclosure is directed to CRISPR / Cas-based genome editing compositions and methods for treating Duchenne muscular dystrophy by restoring dystrophin function. [Background technology]

[0002] Introduction Duchenne muscular dystrophy (DMD) is the most common fatal genetic childhood disease, occurring in approximately 1:5000 newborn boys. Progressive muscle weakness, which leads to death in patients' mid-twenties, is the result of mutations in the dystrophin gene. In most cases (approximately 60%), the mutation consists of a deletion of one or more of the 79 exons from the dystrophin gene, resulting in a disruption of the reading frame. Previous therapeutic strategies typically aim to produce a truncated but partially functional dystrophin protein that recapitulates the genotype corresponding to Becker muscular dystrophy, which is associated with milder symptoms compared to DMD. For example, several groups have applied CRISPR / Cas9 technology for gene editing in cultured human DMD cells and the mdx mouse model of DMD to restore the dystrophin reading frame by deleting specific exons. However, there remains a need to develop gene editing strategies to restore a complete, fully functional dystrophin protein. Summary of the Invention

[0003] In one aspect, the present disclosure relates to a CRISPR / Cas-based genome editing system. The system may include one or more vectors encoding a composition comprising: (a) a guide RNA (gRNA) targeting a fragment of a mutant dystrophin gene, (b) a Cas protein or a fusion protein comprising a Cas protein, and (c) a donor sequence comprising a fragment of a wild-type dystrophin gene. In a further aspect, the system may include: (a) a guide RNA (gRNA) targeting a fragment of a mutant dystrophin gene, (b) a Cas protein or a fusion protein comprising a Cas protein, and (c) a donor sequence comprising a fragment of a wild-type dystrophin gene. In some embodiments, the fragment of the wild-type dystrophin gene is flanked by two gRNA spacers and / or PAM sequences. In some embodiments, the gRNA targets an intron juxtaposed to an exon of a mutant dystrophin gene, wherein the exon is selected from exons 1-8, 10, 11, 12, 14, 16-22, 43-59, and 61-66 of the mutant dystrophin gene. In some embodiments, the donor sequence comprises an exon of a wild-type dystrophin gene, or a functional equivalent thereof, wherein the exon is selected from exons 1-8, 10, 11, 12, 14, 16-22, 43-59, and 61-66 of the wild-type dystrophin gene. In some embodiments, the exon of the mutant dystrophin gene is mutated or at least partially deleted from the dystrophin gene or genome, or the exon of the mutant dystrophin gene is deleted, and the intron is juxtaposed to the location where the deleted exon would be in the corresponding wild-type dystrophin gene. In some embodiments, the exon is exon 52.In some embodiments, the gRNA binds to and targets a polynucleotide sequence comprising: a) SEQ ID NO: 17 or SEQ ID NO: 18; b) a fragment of SEQ ID NO: 17 or SEQ ID NO: 18; c) a complement of SEQ ID NO: 17 or SEQ ID NO: 18, or a fragment thereof; d) a nucleic acid substantially identical to SEQ ID NO: 17 or SEQ ID NO: 18, or a complement thereof; or e) a nucleic acid that hybridizes to SEQ ID NO: 17 or SEQ ID NO: 18 under stringent conditions, its complement, or a sequence substantially identical thereto. In some embodiments, the gRNA comprises or is encoded by the polynucleotide sequence of SEQ ID NO: 19 or SEQ ID NO: 20, or a variant thereof. In some embodiments, the Cas protein is a Streptococcus pyogenes Cas9 protein or a Staphylococcus aureus Cas9 protein. In some embodiments, the Cas protein comprises the amino acid sequence of SEQ ID NO: 1, 2, 3, or 4. In some embodiments, the two gRNA spacers independently comprise a sequence selected from SEQ ID NOs: 5-8 and 25-45. In some embodiments, the two gRNA spacers are identical. In some embodiments, the two gRNA spacers are different. In some embodiments, at least one of the two gRNA spacers comprises the sequence of SEQ ID NO:25 or SEQ ID NO:26. In some embodiments, the donor sequence comprises the polynucleotide of SEQ ID NO:21 or SEQ ID NO:22. In some embodiments, the vector is a viral vector. In some embodiments, the vector is an adeno-associated virus (AAV) vector. In some embodiments, the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV-10, AAV-11, AAV-12, AAV-13, or AAVrh.74 vector. In some embodiments, one of the one or more vectors comprises the polynucleotide sequence of SEQ ID NO:23 or 24. In some embodiments, the molar ratio between the gRNA and the donor sequence is 1:1, or 1:15, or 5:1 to 1:10, or 1:1 to 1:5.

[0004] In a further aspect, the present disclosure relates to a recombinant polynucleotide encoding a donor sequence or functional equivalent thereof comprising a fragment of a wild-type dystrophin gene, wherein the fragment or functional equivalent is flanked by two gRNA spacers. In some embodiments, the donor sequence comprises an exon of the dystrophin gene, wherein the exon is selected from exons 1-8, 10, 11, 12, 14, 16-22, 43-59, and 61-66. In some embodiments, the recombinant polynucleotide comprises the sequence of SEQ ID NO: 23 or 24. Another aspect of the present disclosure provides vectors comprising a recombinant polynucleotide as detailed herein. In some embodiments, the vector comprises a heterologous promoter driving expression of the recombinant polynucleotide.

[0005] Another aspect of the present disclosure provides a cell comprising a recombinant polynucleotide as detailed herein or a vector as detailed herein. Another aspect of the present disclosure provides a composition for restoring dystrophin function in a cell harboring a mutated dystrophin gene, comprising a system as detailed herein, a recombinant polynucleotide as detailed herein, or a vector as detailed herein.

[0006] Another aspect of the present disclosure provides a kit comprising a system as detailed herein, a recombinant polynucleotide as detailed herein, or a vector as detailed herein, or a composition as detailed herein. Another aspect of the present disclosure provides a method for restoring dystrophin function in cells or subjects with a mutant dystrophin gene.The method can include contacting cells or subjects with the system described herein, the recombinant polynucleotide described herein, or the vector described herein, or the composition described herein.In some embodiments, the dystrophin function is restored by inserting exon 52 of the wild-type dystrophin gene.In some embodiments, the subject suffers from Duchenne muscular dystrophy.

[0007] Another aspect of the present disclosure provides a method for restoring dystrophin function in cells or subjects with a disrupted dystrophin gene caused by one or more deleted or mutated exons.The method can include contacting cells or subjects with the system described herein, the recombinant polynucleotide described herein, or the vector described herein, or the composition described herein.In some embodiments, the dystrophin function is restored by inserting one or more wild-type exons of the dystrophin gene that correspond to one or more deleted or mutated exons.In some embodiments, one of the deleted or mutated exons is exon 52. [Brief explanation of the drawings]

[0008] [Figure 1] FIG. 1 is a schematic diagram of the exons encoding the dystrophin protein and their various interactions in the cell. [Figure 2] Schematic diagram of the dystrophin protein. [Figure 3] FIG. 1 shows the strategy for generating gRNA targeting hDMD-intron 51, which is upstream of hDMD-exon 52. [Figure 4A-4B] Figure 4A shows the primer numbers and expected band sizes for the Surveyor analysis shown in Figure 4B, and a gel showing the editing efficiency of gRNA targeting hDMD-intron 51, which is upstream of hDMD-exon 52. [Figure 5A-5B] FIG. 5A shows the HEK293T SNP results based on primer location, and the gel is shown in FIG. 5B. [Figures 6A-6B] Figure 6A is a gel image showing myoblasts electroporated with a plasmid encoding a redesigned gRNA with a 19-23 bp spacer, and further results are shown in Figure 6B. [Figure 7]1 is a gel showing the results of HEK293T transfection with gRNA expression plasmids or AAV-HITI donor plasmids. [Figure 8A-8B] Figure 8A is a gel showing nested PCR results to detect HITI-mediated integration of AAV plasmids (AAV-CMV-Cas9 plasmid and AAV-U6-gRNA-Ex52 plasmid) electroporated into primary myoblasts derived from hDMDΔ52 / mdx mice, and Figure 8B shows Sanger sequencing results with the expected HITI-mediated insertion. [Figure 9] FIG. 1 is a schematic diagram of the experiments used to confirm in vivo editing, determine the best gRNA / donor sequence combination, and determine the best ratio of AAV-Cas9 to AAV-donor plasmid. [Figures 10A-10B] Figure 10A is a gel showing targeted Ex52 insertion in mouse genomic DNA using primers downstream of the target cleavage site, and Figure 10B is a gel showing targeted Ex52 insertion in mouse genomic DNA using primers upstream of the target cleavage site. [Figure 11] 10 is a gel showing targeted Ex52 insertion in mRNA of treated hDMDΔ52 / mdx mice. [Figure 12] FIG. 1 shows Western blot analysis confirming protein repair in treated mice. [Figure 13] FIG. 1 shows results from Illumina deep sequencing quantification of AAV-ITR genomic integration in edited mice. [Figures 14A-14B] Figure 14A is a gel showing amplification of cDNA from exon 45 to exon 69. Figure 14B is from a PacBio sequencing analysis of mRNA, showing that a sequencing read covering 118 bp between exon 51 and exon 53 matches the exon 52 sequence. DETAILED DESCRIPTION OF THE INVENTION

[0009] The present disclosure provides a CRISPR / Cas-based gene / genome editing composition and a method for treating Duchenne muscular dystrophy (DMD) by restoring dystrophin function.DMD is typically caused by a deletion in the dystrophin gene that disrupts the reading frame.It has been shown that internally truncated dystrophin proteins can remain partially functional, so many strategies for treating DMD aim to restore the reading frame by removing or skipping additional exons.This paper details AAV-based homology-independent targeted integration (HITI)-mediated gene editing therapy for correcting the dystrophin gene.Specifically, the inventors have adapted CRISPR / Cas9 gene editing technology to direct the targeted insertion of the missing exon into the dystrophin gene. As a therapeutically relevant target, we optimized a HITI-mediated genome editing strategy in a humanized mouse model of DMD (hDMDΔ52 / mdx mice), in which exon 52 was deleted in mice carrying the full-length human dystrophin gene. To achieve targeted integration, an AAV vector containing the deleted genomic sequence, including exon 52, was co-delivered with an AAV encoding a Cas9 / gRNA expression cassette. Targeted exon 52 integration was confirmed in cultured cells. In combination with AAV delivery, the HITI-mediated strategy for targeted insertion of the missing exon provides a method for restoring full-length dystrophin and improved functional outcomes.

[0010] 1.Definition As used herein, the terms "comprise(s)," "include(s)," "having," "has," "can," "contain(s)," and variations thereof are intended to be open-ended transitional phrases, terms, or words that do not exclude the possibility of additional actions or structures. The singular forms "a," "and," and "the" include plural references unless the content clearly dictates otherwise. The present disclosure also contemplates other embodiments that "comprising," "consisting of," and "consisting essentially of" the embodiments or elements presented herein, whether or not explicitly stated. For the recitation of numerical ranges herein, each intervening number therebetween is specifically contemplated to the same degree of precision. For example, in the range of 6 to 9, numbers 6 and 9 are contemplated as well as 7 and 8, and in the range of 6.0 to 7.0, numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are specifically contemplated.

[0011] As used herein, the term "approximately" or "about" refers to within an acceptable error range for a particular value as determined by one skilled in the art, which depends in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "approximately" can mean within 3 or more than 3 standard deviations, according to practice in the art. Alternatively, "approximately" can mean within 20%, preferably within 10%, more preferably within 5%, and even more preferably within 1% of a given value. Alternatively, particularly with respect to biological systems or biological processes, the term can mean within 10-fold, preferably within 5-fold, and more preferably within 2-fold of a value. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practicing or testing the present invention. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and are not intended to be limiting.

[0012] "Adeno-associated virus" or "AAV," as used interchangeably herein, refers to a small virus belonging to the Dependovirus genus of the Parvoviridae family that infects humans and some other primate species. AAV is not currently known to cause disease, and therefore, the virus induces a very mild immune response. As used herein, "binding region" refers to a region within a target region that is recognized and bound by a CRISPR / Cas-based genome editing system. As used herein, "chromatin" refers to the organized complex of chromosomal DNA associated with histones. "Clustered Regularly Interspaced Short Palindromic Repeats" and "CRISPR," used interchangeably herein, refer to loci containing multiple short direct repeats found in approximately 40% of sequenced bacterial and 90% of sequenced archaeal genomes.

[0013] As used herein, "coding sequence" or "encoding nucleic acid" refers to a nucleic acid (RNA or DNA molecule) comprising a nucleotide sequence that encodes a protein. The coding sequence may further comprise initiation and termination signals operably linked to regulatory elements, including a promoter and polyadenylation signal, capable of directing expression in the cells of an individual or mammal to which the nucleic acid is administered. The coding sequence may be codon-optimized. As used herein, "complement" or "complement" with respect to nucleic acids means a nucleic acid that can form Watson-Crick (e.g., AT / U and CG) or Hoogsteen base pairing between nucleotides or nucleotide analogs of a nucleic acid molecule. "Complementarity" refers to the property shared between two nucleic acid sequences such that when aligned antiparallel to each other, the nucleotide bases at each position are complementary.

[0014] "Duchenne muscular dystrophy" or "DMD," as used interchangeably herein, refers to a recessive, fatal, X-linked disorder that results in muscle degeneration and ultimately death. DMD is a common, inherited, monogenic disease that affects 1 in 3,500 males. DMD is the result of inherited or spontaneous mutations that cause nonsense or frameshift mutations in the dystrophin gene. The majority of dystrophin mutations that cause DMD are exon deletions that disrupt the reading frame and cause premature translation termination of the dystrophin gene. DMD patients typically lose the ability to physically support themselves during childhood, become progressively frail during their teenage years, and die in their twenties. As used herein, "dystrophin" refers to a rod-shaped cytoplasmic protein that is part of a protein complex that connects the cytoskeleton of muscle fibers to the cell membrane through the surrounding extracellular matrix. Dystrophin provides structural stability to the dystroglycan complex in the cell membrane, which is responsible for regulating muscle cell integrity and function. The dystrophin gene, or "DMD gene," as used interchangeably herein, is 2.2 megabases long at locus Xp21. The primary transcript measures approximately 2,400 kb, and the mature mRNA is approximately 14 kb. 79 exons encode a protein of over 3,500 amino acids.

[0015] As used herein, "exon 52" refers to the 52nd exon of the dystrophin gene. Exon 52 is often adjacent to frame-breaking deletions in DMD patients. Exon 52 may comprise the polynucleotide of SEQ ID NO:21. Exon 52 may be contained within the polynucleotide of SEQ ID NO:22. As used herein, "enhancer" refers to a non-coding DNA sequence containing multiple activator and repressor binding sites. Enhancers range in length from 200 bp to 1 kb and can be either proximal, i.e., 5' upstream of the promoter or within the first intron of the regulated gene, or distal, i.e., in the introns of adjacent genes or intergenic regions far from the locus. Through DNA looping, active enhancers contact promoters, depending on the specificity of the core DNA-binding motif promoter. 4 to 5 enhancers may interact with a single promoter. Similarly, enhancers may regulate multiple genes without linkage limitations and may "skip" adjacent genes to regulate more distal ones. Transcriptional regulation may involve elements located in a different chromosome than the promoter. The proximal enhancer or promoter of an adjacent gene may serve as a platform for recruiting more distal elements.

[0016] As used herein, "functional" and "fully functional" describe a protein that has biological activity. A "functional gene" refers to a gene that is transcribed into mRNA, which is translated into a functional protein. As used herein, the term "fusion protein" refers to a chimeric protein created by joining two or more genes that originally encoded separate proteins. Translation of the fusion gene results in a single polypeptide possessing functional properties from each of the original proteins. As used herein, "genetic construct" refers to a DNA or RNA molecule containing a nucleotide sequence encoding a protein. The coding sequence includes a start and stop signal that can direct expression in the cells of an individual to which the nucleic acid molecule is administered, operably linked to regulatory elements including a promoter and a polyadenylation signal. As used herein, the term "expressible form" refers to a genetic construct that contains the necessary regulatory elements operably linked to a coding sequence encoding a protein, so that the coding sequence is expressed when present in the cells of an individual.

[0017] As used herein, "genome editing" refers to altering a gene. Genome editing can include repairing or correcting a mutated gene. Genome editing can alter a splice acceptor site. Genome editing can be used to treat disease or enhance muscle repair by altering a gene of interest. As used herein, the term "heterologous" refers to a nucleic acid comprising two or more subsequences that are not found in the same relationship to each other in nature. For example, a recombinantly produced nucleic acid typically has two or more sequences from unrelated genes, e.g., a promoter from one source and a coding region from another source, synthetically arranged to create a new functional nucleic acid. Thus, the two nucleic acids are heterologous to each other in this context. When added to a cell, the recombinant nucleic acid will also be heterologous to the endogenous genes of the cell. Thus, in a chromosome, a heterologous nucleic acid would include a non-native (non-naturally occurring) nucleic acid integrated within the chromosome or a non-native (non-naturally occurring) extrachromosomal nucleic acid. Similarly, a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a "fusion protein" in which the two subsequences are encoded by a single nucleic acid sequence). As used herein, "identical" or "identity" in the context of two or more nucleic acid or polypeptide sequences means that the sequences have a specified percentage of residues that are the same over a specified region. The percentage can be calculated by optimally aligning the two sequences, comparing the two sequences over a specified region, determining the number of positions where identical residues exist in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the specified region, and multiplying the result by 100 to obtain the percentage of sequence identity. If the two sequences are of different lengths, or if the alignment results in one or more staggered ends, and the specified comparison region contains only a single sequence, the residues of the single sequence are included in the denominator but not the numerator of the calculation. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. Identity can be performed manually or by using a computer sequence algorithm such as BLAST or BLAST 2.0.

[0018] As used interchangeably herein, the terms "mutant gene" or "mutated gene" refer to a gene that has undergone a detectable mutation. A mutant gene has undergone an alteration, such as the loss, gain, or exchange of genetic material, that affects the normal transmission and expression of the gene. As used herein, a "disrupted gene" refers to a mutant gene that has a mutation that causes a premature stop codon. A disrupted gene product is truncated compared to the full-length, undisrupted gene product. As used herein, a "normal gene" refers to a gene that has not undergone any alteration, such as loss, gain, or exchange of genetic material. A normal gene undergoes normal gene transmission and gene expression. For example, a normal gene can be a wild-type gene. As used herein, "nucleic acid" or "oligonucleotide" or "polynucleotide" refers to at least two nucleotides covalently linked together. The depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of the depicted single strand. Many variants of a nucleic acid can be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and their complements. A single strand provides a probe that can hybridize to a target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses a probe that hybridizes under stringent hybridization conditions.

[0019] Nucleic acids can be single-stranded or double-stranded, or can contain portions of both double-stranded and single-stranded sequences. Nucleic acids can be DNA (both genomic and cDNA), RNA, or hybrids, and can contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. Nucleic acids can be obtained by chemical synthesis methods or by recombinant methods. "Open reading frame" refers to a codon section that begins with a start codon and ends with a stop codon. In eukaryotic genes with multiple exons, introns are removed, and then the exons are joined together after transcription to obtain the final mRNA for protein translation. An open reading frame can be a continuous codon section. In some embodiments, the open reading frame only applies to spliced ​​mRNA for protein expression, and not to genomic DNA.

[0020] As used herein, "operably linked" means that the expression of a gene is under the control of the promoter to which it is spatially connected. The promoter may be located 5' (upstream) or 3' (downstream) of the gene under its control. The distance between the promoter and the gene may be approximately the same as the distance between the promoter and the gene it controls in the gene from which the promoter is derived. As is known in the art, variations in this distance can be accommodated without loss of promoter function. Nucleic acid or amino acid sequences are "operably linked" (or "operably linked") when they are placed into a functional relationship with each other. For example, a promoter or enhancer is operably linked to a coding sequence if it regulates or contributes to the modulation of the transcription of the coding sequence. Operably linked DNA sequences are typically contiguous, and operably linked amino acid sequences are typically contiguous and in the same reading frame. However, enhancers generally function when separated by up to several kilobases or more from the promoter, and intron sequences can be of variable length, so that some polynucleotide elements may be operably linked but not contiguous. Similarly, certain amino acid sequences that are non-contiguous in a primary polypeptide sequence may still be operably linked, for example, by virtue of folding of the polypeptide chain. With respect to fusion polypeptides, the terms "operably linked" and "operably linked" can refer to each of the components performing the same function when linked to the other components as if they were not so linked.

[0021] As used herein, "partially functional" describes a protein encoded by a mutant gene that has less biological activity than a functional protein but more than a non-functional protein. As used interchangeably herein, a "premature stop codon" or "out-of-frame stop codon" refers to a nonsense mutation in the sequence of DNA that results in a stop codon at a position not normally found in the wild-type gene. A premature stop codon can cause a protein to be truncated or shortened compared to the full-length version of the protein.

[0022] As used herein, "promoter" refers to a synthetic or naturally occurring molecule that can confer, activate, or enhance expression of a nucleic acid in a cell. A promoter can contain one or more specific transcriptional regulatory sequences to further enhance expression and / or alter its spatial and / or temporal expression. A promoter can also contain distal enhancer or repressor elements, which can be located as far as several thousand base pairs from the start site of transcription. Promoters can be derived from sources including viruses, bacteria, fungi, plants, insects, and animals. A promoter can regulate the expression of a gene component constitutively, differentially with respect to the developmental stage in which expression occurs with respect to the cell, tissue, or organ in which expression occurs, or in response to external stimuli such as physiological stress, pathogens, metal ions, or inducers. Representative examples of promoters include a bacteriophage T7 promoter, a bacteriophage T3 promoter, an SP6 promoter, a lac operator promoter, a tac promoter, an SV40 late promoter, an SV40 early promoter, an RSV-LTR promoter, a CMV IE promoter, an SV40 early promoter, or an SV40 late promoter, and a CMV IE promoter.

[0023] For example, the term "recombinant" as used in reference to a cell, or a nucleic acid, protein, or vector indicates that the cell, nucleic acid, protein, or vector has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, a recombinant cell expresses a gene not found within the native (naturally occurring) form of the cell, or expresses a second copy of a native gene that is otherwise normally or abnormally expressed, underexpressed, or not expressed at all. As used herein, "skeletal muscle" refers to a type of striated muscle that is under the control of the somatic nervous system and is attached to bones by bundles of collagen fibers known as tendons. Skeletal muscle is composed of individual components known as myocytes, or "muscle cells," and sometimes colloquially referred to as "myofibers." Muscle cells are formed from the fusion of developing myoblasts (a type of embryonic precursor cell that gives rise to muscle cells) in a process known as myogenesis. These long, columnar, multinucleated cells are also called myofibrils. As used herein, "skeletal muscle condition" refers to a condition associated with skeletal muscle, such as muscular dystrophy, aging, muscle degeneration, wound healing, and muscle weakness or atrophy.

[0024] "Subject" and "patient," as used interchangeably herein, refer to any vertebrate, including, but not limited to, mammals (e.g., cows, pigs, camels, llamas, hedgehogs, anteaters, platypuses, elephants, alpacas, horses, goats, rabbits, sheep, hamsters, guinea pigs, cats, dogs, rats, and mice, non-human primates (e.g., monkeys such as cynomolgus or rhesus monkeys, chimpanzees), and humans). In some embodiments, the subject can be human or non-human. The subject or patient may also be undergoing other forms of treatment. "Treat," "treating," or "treatment" are used interchangeably herein to describe reversing, alleviating, or inhibiting the progression of the disease to which such term applies, or one or more symptoms of such disease. Treatment can be performed in either an acute or chronic manner. The term also refers to reducing the severity of a disease or symptoms associated with such disease before the onset of the disease. Such pre-onset reduction of disease severity refers to administering an antibody or pharmaceutical composition to a subject who is not suffering from the disease at the time of administration. "Preventing" also refers to preventing the recurrence of a disease or one or more symptoms associated with such disease. "Treatment" and "therapeutic" refer to the act of treating, as defined above in "treating."

[0025] As used herein, "variant" with respect to a nucleic acid means (i) a portion or fragment of a referenced nucleotide sequence, (ii) the complement of the referenced nucleotide sequence or a portion thereof, (iii) a nucleic acid that is substantially identical to the referenced nucleic acid or its complement, or (iv) a nucleic acid that hybridizes under stringent conditions to the referenced nucleic acid, its complement, or a sequence substantially identical thereto. "Variant" refers to a peptide or polypeptide that differs in amino acid sequence by amino acid insertion, deletion, or conservative substitution but retains at least one biological activity. Variant can also refer to a protein having an amino acid sequence that is substantially identical to the reference protein and retains at least one biological activity. Conservative amino acid substitutions, i.e., replacing an amino acid with an amino acid of different properties (e.g., hydrophilicity, degree and distribution of charged regions), are recognized in the art as typically involving minor changes. These minor changes can be identified, in part, by considering the hydropathic index of the amino acid, as understood in the art. Kyte et al., J. Mol. Biol. 157:105-132 (1982). The hydropathic index of an amino acid is based on consideration of its hydrophobicity and charge. It is known in the art that substitution of amino acids with similar hydropathic indices can still retain protein function. In one embodiment, amino acids with hydropathic indices of ±2 are substituted. The hydrophilicity of amino acids can also be used to identify substitutions that result in proteins that retain biological function. Consideration of the hydrophilicity of amino acids in the context of a peptide allows for the calculation of the maximum local average hydrophilicity of the peptide. Substitutions can be made with amino acids that have hydrophilicity values ​​within ±2 of each other. Both the hydrophobicity index and hydrophilicity value of an amino acid are affected by the specific side chain of that amino acid. Consistent with this observation, it is understood that amino acid substitutions that are compatible with biological function depend on the relative similarity of amino acids, specifically the side chains of those amino acids, as revealed by hydrophobicity, hydrophilicity, charge, size, and other properties.

[0026] As used herein, "vector" refers to a nucleic acid sequence containing a replication origin. The vector may be a viral vector, a bacteriophage, a bacterial artificial chromosome, or a yeast artificial chromosome. The vector may be a DNA or RNA vector. The vector may be a self-replicating extrachromosomal vector, preferably a DNA plasmid. For example, the vector may encode a CRISPR / Cas-based genome editing system described herein, including a polynucleotide sequence encoding a Cas protein or a fusion protein, and / or a gRNA targeting at least one gRNA nucleotide sequence of SEQ ID NO: 19 or SEQ ID NO: 20, or a nucleotide sequence comprising SEQ ID NO: 17 or SEQ ID NO: 18.

[0027] 2. CRISPR / Cas-based genome editing system for dystrophin restoration Provided herein is a CRISPR / Cas-based genome editing system for use in restoring dystrophin gene function. In some embodiments, the CRISPR / Cas-based genome editing system comprises a Cas protein or fusion protein and at least one guide RNA (gRNA) that binds to and targets a polynucleotide sequence corresponding to SEQ ID NO: 17 or SEQ ID NO: 18. In some embodiments, the at least one guide RNA (gRNA) comprises or is encoded by a polynucleotide of SEQ ID NO: 19 or SEQ ID NO: 20. The fusion protein can comprise two heterologous polypeptide domains. In some embodiments, the fusion protein comprises a Cas protein and a base editing domain or a domain with other enzymatic function. In some embodiments, at least one gRNA binds to and targets a polynucleotide sequence corresponding to: a) a fragment of SEQ ID NO: 17 or SEQ ID NO: 18; b) a complement of SEQ ID NO: 17 or SEQ ID NO: 18, or a fragment thereof; c) a nucleic acid substantially identical to SEQ ID NO: 17 or SEQ ID NO: 18, or a complement thereof; or d) a nucleic acid that hybridizes to SEQ ID NO: 17 or SEQ ID NO: 18 under stringent conditions, its complement, or a sequence substantially identical thereto.

[0028] a) dystrophin gene Dystrophin is a rod-shaped cytoplasmic protein that is part of a protein complex that connects the cytoskeleton of muscle fibers to the cell membrane through the surrounding extracellular matrix (Figure 1). Dystrophin provides structural stability to the dystroglycan complex in the cell membrane. The dystrophin gene spans 2.2 megabases at locus Xp21. The primary transcript measures approximately 2,400 kb, and the mature mRNA is approximately 14 kb. Seventy-nine exons contain approximately 2.2 million nucleotides and encode a protein of over 3,500 amino acids (Figure 2). Normal skeletal muscle tissue contains only small amounts of dystrophin, but its absence due to abnormal expression can lead to the development of severe and incurable symptoms. Some mutations in the dystrophin gene result in the production of defective dystrophin and a severe dystrophic phenotype in affected patients. Some mutations in the dystrophin gene result in a partially functional dystrophin protein and a much milder dystrophic phenotype in affected patients.

[0029] DMD is the result of inherited or spontaneous mutations that cause nonsense or frameshift mutations in the dystrophin gene. DMD is the most common fatal genetic childhood disease, affecting approximately 1 in 5,000 newborn boys. DMD is characterized by progressive muscle weakness, often resulting in death in the patient's mid-twenties due to the lack of a functional dystrophin gene. Most mutations are deletions in the dystrophin gene that disrupt the reading frame. Naturally occurring mutations and their consequences are relatively well understood for DMD. It is known that in-frame deletions in the exon 45-55 region contained within the rod domain can produce a highly functional dystrophin protein, and many carriers are asymptomatic or display mild symptoms. Dystrophin exons 45-55 are a mutation hotspot. Furthermore, more than 60% of patients could theoretically be treated by targeting exons in this region of the dystrophin gene. Efforts have been made to restore the disrupted dystrophin reading frame in DMD patients by skipping nonessential exons during mRNA splicing (e.g., exon 45 skipping), resulting in an internally deleted but functional dystrophin protein. Deletions of internal dystrophin exons (e.g., exon 45 deletion) retain the proper reading frame and can result in an internally truncated but partially functional dystrophin protein. Deletions between exons 45 and 55 of dystrophin result in a much milder phenotype compared to DMD.

[0030] The dystrophin gene can be a mutant dystrophin gene. The dystrophin gene can be a wild-type dystrophin gene. The dystrophin gene can have a sequence that is functionally identical to that of the wild-type dystrophin gene, for example, the sequence can be codon-optimized but still encode the same protein as wild-type dystrophin. The mutant dystrophin gene can contain one or more mutations compared to the wild-type dystrophin gene. The mutation can include, for example, a nucleotide deletion, substitution, addition, transversion, or a combination thereof. The mutation can include the deletion of at least one intron and / or exon, in whole or in part. An exon of the mutant dystrophin gene can be mutated or at least partially deleted from the dystrophin gene. An exon of the mutant dystrophin gene can be completely deleted. The mutant dystrophin gene can have a portion or fragment corresponding to the corresponding sequence in the wild-type dystrophin gene. In some embodiments, the disrupted dystrophin gene caused by a deleted or mutated exon can be repaired in DMD patients by adding back the corresponding wild-type exon. In some embodiments, the disrupted dystrophin caused by a deleted or mutated exon 52 can be repaired in DMD patients by adding back the wild-type exon 52. In certain embodiments, adding exon 52 to restore the reading frame ameliorates the phenotype in DMD patients, including DMD patients with deletion mutations. In certain embodiments, one or more exons can be added and inserted into the disrupted dystrophin gene. One or more exons can be added and inserted to repair the corresponding mutation or deleted exon in dystrophin. In addition to adding and inserting exon 52, one or more exons can be added and inserted into the disrupted dystrophin gene. In certain embodiments, exon 52 of the dystrophin gene refers to the 52nd exon of the dystrophin gene.Exon 52 is frequently adjacent to frame-breaking deletions in DMD patients and has been targeted in clinical trials for oligonucleotide-based exon skipping.

[0031] The genetic constructs (e.g., vectors) disclosed herein can mediate highly efficient addition of exon 52 into the dystrophin gene (e.g., human dystrophin gene). The genetic constructs (e.g., vectors) disclosed herein can restore dystrophin protein expression in cells derived from DMD patients. Exon 52 is often adjacent to frame-disrupting deletions in DMD. Addition of exon 52 to dystrophin transcripts can be used to treat DMD patients. The genetic constructs (e.g., vectors) disclosed herein can be transfected into human DMD cells to mediate efficient gene modification and conversion to the correct reading frame. Protein repair can be simultaneous with frame repair and is detected in bulk populations of cells treated with a CRISPR / Cas-based genome editing system.

[0032] b) Fusion Proteins CRISPR / Cas-based gene editing system can comprise a fusion protein or a nucleic acid sequence encoding the fusion protein.The fusion protein can comprise a Cas protein and a gene / genome editing domain, or a domain with other enzymatic functions.In some embodiments, the nucleic acid sequence encoding the fusion protein is DNA.In some embodiments, the nucleic acid sequence encoding the fusion protein is RNA.

[0033] i) Cas proteins CRISPR / Cas-based gene editing systems can contain a Cas protein. The Cas protein forms a complex with the 3' end of the gRNA. The specificity of a CRISPR-based system depends on two factors: the target sequence and the protospacer adjacent motif (PAM). The target sequence is located at the 5' end of the gRNA and is the correct DNA sequence, known as the protospacer, designed to bind to base pairs on the host DNA. By simply exchanging the recognition sequence of the gRNA, the Cas protein can be directed to a new genomic target. The PAM sequence is located on the DNA to be modified and is recognized by the Cas protein. The PAM recognition sequence of the Cas protein can be species-specific. The Cas9 protein is a nucleic acid-cleaving endonuclease encoded by the CRISPR locus and involved in the type II CRISPR system. The Cas9 molecule can interact with one or more gRNA molecules and, in cooperation with the gRNA molecule, localizes to a target domain, a site containing a PAM sequence in certain embodiments. The ability of the Cas9 molecule to recognize a PAM sequence can be determined, for example, using a transformation assay known in the art. In some embodiments, the CRISPR / Cas-based gene editing system comprises a Cas9 protein derived from Streptococcus pyogenes. In some embodiments, the Cas9 protein comprises the amino acid sequence of SEQ ID NO: 1. In some embodiments, the CRISPR / Cas-based gene editing system comprises a Cas9 protein derived from Staphylococcus aureus. In some embodiments, the Cas9 protein comprises the amino acid sequence of SEQ ID NO: 2.

[0034] In some embodiments, the CRISPR / Cas-based gene editing system includes a catalytically dead dCas9. In some embodiments, the Cas9 protein may be mutated to inactivate nuclease activity. To silence gene expression by steric hindrance, an inactivated Cas9 protein (also referred to as "iCas9" or "dCas9") without endonuclease activity may be targeted to genes in bacteria, yeast, and human cells by gRNA. Exemplary mutations for inactivating nuclease activity, based on the Streptococcus pyogenes Cas9 sequence, include D10A, E762A, H840A, N854A, N863A, and / or D986A. A Streptococcus pyogenes Cas9 protein with a D10A mutation may comprise the amino acid sequence of SEQ ID NO:3. A Streptococcus pyogenes Cas9 protein with D10A and H849A mutations may comprise the amino acid sequence of SEQ ID NO:4. Exemplary mutations referenced to the S. aureus Cas9 sequence to inactivate nuclease activity include D10A and N580A.

[0035] The Cas9 protein or mutant Cas9 protein can be from any bacterial or archaeal species, such as Streptococcus pyogenes, Staphylococcus aureus, Streptococcus thermophiles, or Neisseria meningitides. In some embodiments, the Cas protein or mutant Cas9 protein is derived from Streptococcus, Staphylococcus, Brevibacillus, Corynebacter, Sutterella, Legionella, Francisella, Treponema, Filifactor, Eubacterium, Lactobacillus, Bacteroides, or any of the other species of bacteria. The Cas9 protein is derived from the bacterial genera Staphylococcus, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma, or Campylobacter.In some embodiments, the Cas9 protein or mutant Cas9 protein is effective against bacteria, including but not limited to, Streptococcus pyogenes, Francisella novicida, Staphylococcus aureus, Neisseria meningitidis, Streptococcus thermophilus, Treponema denticola, Brevibacillus laterosporus, Campylobacter jejuni, Corynebacterium diphtheriae, Eubacterium ventriosum, Streptococcus pasteurianus, Lactobacillus farciminis, Sphaerochaete globus, and the like. globus, Azospirillum, Gluconacetobacter diazotrophicus, Neisseria cinerea, Roseburia intestinalis, Parvibaculum lavamentivorans, Nitratifractor salsuginis, and Campylobacter lari.

[0036] In certain embodiments, the ability of a Cas9 molecule or mutant Cas9 protein to interact with and cleave a target nucleic acid is PAM sequence dependent. The PAM sequence is a sequence in the target nucleic acid. In certain embodiments, cleavage of the target nucleic acid occurs upstream from the PAM sequence. Cas9 molecules from different bacterial species can recognize different sequence motifs (e.g., PAM sequences). In certain embodiments, a Streptococcus pyogenes Cas9 molecule recognizes the sequence motif NGG (SEQ ID NO: 10), which directs cleavage of a target nucleic acid sequence 1-10, e.g., 3-5, bp upstream from that sequence (see, e.g., Mali 2013). In certain embodiments, a Staphylococcus aureus Cas9 molecule recognizes the sequence motif NNGRR (R = A or G) (SEQ ID NO: 12), which directs cleavage of a target nucleic acid sequence 1-10, e.g., 3-5, bp upstream from that sequence. In certain embodiments, the S. aureus Cas9 molecule recognizes the sequence motif NNGRRN (R = A or G) (SEQ ID NO: 13), which directs cleavage of a target nucleic acid sequence 1-10, e.g., 3-5 bp upstream from the sequence. In certain embodiments, the S. aureus Cas9 molecule recognizes the sequence motif NNGRRT (R = A or G) (SEQ ID NO: 14), which directs cleavage of a target nucleic acid sequence 1-10, e.g., 3-5 bp upstream from the sequence. In certain embodiments, the S. aureus Cas9 molecule recognizes the sequence motif NNGRRV (R = A or G, V = A or C or G) (SEQ ID NO: 15), which directs cleavage of a target nucleic acid sequence 1-10, e.g., 3-5 bp upstream from the sequence. In the foregoing embodiments, N can be any nucleotide residue, e.g., A, G, C, or T. Cas9 molecules can be engineered to alter their PAM specificity.

[0037] In some embodiments, the Cas9 protein or mutant Cas9 protein can recognize the PAM sequence NGG (SEQ ID NO: 10) or NGA (SEQ ID NO: 16). In some embodiments, the Cas9 protein or mutant Cas9 protein can recognize the PAM sequence NNNRRT (SEQ ID NO: 11). In some embodiments, the Cas9 protein or mutant Cas9 protein can recognize the PAM sequence ATTCCT (SEQ ID NO: 9). In some embodiments, the Cas9 protein or mutant Cas9 protein is a Staphylococcus aureus Cas9 protein and recognizes the sequence motifs NNGRR (R = A or G) (SEQ ID NO: 12), NNGRRN (R = A or G) (SEQ ID NO: 13), NNGRRT (R = A or G) (SEQ ID NO: 14), or NNGRRV (R = A or G) (SEQ ID NO: 15). In the foregoing embodiments, N can be any nucleotide residue, e.g., A, G, C, or T. Cas9 molecules can be engineered to alter their PAM specificity. Additionally or alternatively, a nucleic acid encoding a Cas9 molecule or a Cas9 polypeptide can contain a nuclear localization sequence (NLS). Nuclear localization sequences are known in the art.

[0038] c) gRNA A CRISPR / Cas-based genome editing system can include at least one gRNA. The gRNA can target a fragment of a dystrophin gene. The gRNA can target a fragment of a mutant dystrophin gene. The gRNA can target a fragment of a wild-type dystrophin gene. The fragment can be approximately 5 to approximately 200, approximately 10 to approximately 200, approximately 5 to approximately 300, or approximately 10 to approximately 300 nucleotides in length. The fragment can be at least approximately 5, at least approximately 10, at least approximately 15, at least approximately 20, at least approximately 30, at least approximately 40, at least approximately 50, or at least approximately 100 nucleotides in length. The gRNA can target a fragment or portion of a dystrophin gene containing a mutation or deletion, or sequences proximal or adjacent to it. The gRNA can target an intron juxtaposed to an exon of a dystrophin gene. The gRNA can target an intron juxtaposed to an exon of a mutant dystrophin gene. The fragment of the wild-type dystrophin gene may be flanked by two gRNA spacers and / or PAM sequences, as described in detail herein. Each gRNA spacer may comprise an amino acid sequence selected from SEQ ID NOS: 5-8 and 25-45. The two gRNA spacers may be identical. The two gRNA spacers may be different. In some embodiments, at least one of the two gRNA spacers comprises the sequence of SEQ ID NOS: 25 or 26. The exon may be selected from exons 1-8, 10, 11, 12, 14, 16-22, 43-59, and 61-66 of the dystrophin gene. In some embodiments, the exon is exon 52. The gRNA provides targeting for the CRISPR / Cas-based gene editing system. The gRNA is a fusion of two non-coding RNAs, namely, crRNA and tracrRNA. The sgRNA can target any desired DNA sequence by exchanging sequences encoding a 20 bp protospacer that confers targeting specificity with the desired DNA target through complementary base pairing.The gRNA mimics the naturally occurring crRNA:tracrRNA duplex involved in Type II effector systems. This duplex, which may contain, for example, a 42-nucleotide crRNA and a 75-nucleotide tracrRNA, serves as a guide for Cas9.

[0039] In some embodiments, at least one gRNA can target and bind to a target region. In some embodiments, 1 to 20 gRNAs can be used to modify a target gene, for example, to modify a splice acceptor site. For example, 1 to 20 gRNAs, 1 to 15 gRNAs, 1 to 10 gRNAs, 1 to 5 gRNAs, 2 to 20 gRNAs, 2 to 15 gRNAs, 2 to 10 gRNAs, 2 to 5 gRNAs, 5 to 20 gRNAs, 5 to 15 gRNAs, or 5 to 10 gRNAs can be included in a CRISPR / Cas-based gene editing system and used to modify a splice acceptor site. In some embodiments, at least 1 gRNA, at least 2 gRNAs, at least 3 gRNAs, at least 4 gRNAs, at least 5 gRNAs, at least 6 gRNAs, at least 7 gRNAs, at least 8 gRNAs, at least 9 gRNAs, at least 10 gRNAs, at least 11 gRNAs, at least 12 gRNAs, at least 13 gRNAs, at least 14 gRNAs, at least 15 gRNAs, or at least 20 gRNAs may be included in a CRISPR / Cas-based gene editing system and used to alter a splice acceptor site. In some embodiments, fewer than 30 gRNAs, fewer than 25 gRNAs, fewer than 20 gRNAs, fewer than 15 gRNAs, fewer than 10 gRNAs, fewer than 5 gRNAs, or fewer than 3 gRNAs may be included in a CRISPR / Cas-based gene editing system and used to alter a splice acceptor site.

[0040] CRISPR / Cas-based gene editing systems can use gRNAs of various sequences and lengths. The gRNA can include a complementary polynucleotide sequence of a target DNA sequence, such as a target sequence comprising SEQ ID NO: 17 or SEQ ID NO: 18, or a complementary polynucleotide sequence of a target sequence comprising SEQ ID NO: 17 or SEQ ID NO: 18, followed by NGG. The gRNA can include a "G" at the 5' end of the complementary polynucleotide sequence. The gRNA can include a complementary polynucleotide sequence of at least 10 base pairs, at least 11 base pairs, at least 12 base pairs, at least 13 base pairs, at least 14 base pairs, at least 15 base pairs, at least 16 base pairs, at least 17 base pairs, at least 18 base pairs, at least 19 base pairs, at least 20 base pairs, at least 21 base pairs, at least 22 base pairs, at least 23 base pairs, at least 24 base pairs, at least 25 base pairs, at least 30 base pairs, or at least 35 base pairs of a target DNA sequence, followed by NGG. The gRNA may comprise a polynucleotide sequence complementary to the target DNA sequence of less than 40 base pairs, less than 35 base pairs, less than 30 base pairs, less than 25 base pairs, less than 20 base pairs, or less than 15 base pairs, followed by NGG. The gRNA may target at least one of the promoter region, enhancer region, or transcribed region of the target gene.

[0041] At least one gRNA may bind to and target a nucleic acid sequence comprising SEQ ID NO: 17 or SEQ ID NO: 18. The target sequence may comprise a polynucleotide of SEQ ID NO: 17 or SEQ ID NO: 18, or a fragment thereof, or a truncation thereof, such as a 5' truncation. The truncation may be 1, 2, 3, 4, 5, 6, 7, 8, or 9 nucleotides shorter than the sequence of SEQ ID NO: 17 or SEQ ID NO: 18. The gRNA may comprise a polynucleotide corresponding to SEQ ID NO: 17 or SEQ ID NO: 18, its complement, a variant thereof, or a fragment thereof. The gRNA may be encoded by a polynucleotide sequence comprising SEQ ID NO: 17 or SEQ ID NO: 18. The portion of the gRNA that targets a target sequence in a genome may be referred to as a gRNA spacer or protospacer. A protospacer may be defined as a portion of the gRNA that is complementary to a targeting sequence in a genome. A protospacer may comprise a polynucleotide of SEQ ID NO: 17 or SEQ ID NO: 18, or a fragment thereof, or a truncation thereof, or a complement thereof. The gRNA may comprise a gRNA scaffold. The gRNA scaffold facilitates binding of Cas9 to the gRNA and endonuclease activity. The gRNA scaffold is a polynucleotide sequence that follows the portion of the gRNA that corresponds to the sequence targeted by the gRNA. The gRNA targeting portion and the gRNA scaffold together form a single polynucleotide. In some embodiments, the gRNA targeting portion and the gRNA scaffold together may comprise the polynucleotide sequence of SEQ ID NO: 19 or SEQ ID NO: 20, or a complement thereof. In some embodiments, the gRNA targeting portion and the gRNA scaffold together are encoded by the polynucleotide sequence of SEQ ID NO: 19 or SEQ ID NO: 20, or a complement thereof. The gRNA may be encoded by the polynucleotide of SEQ ID NO: 19, its complement, a variant thereof, or a fragment thereof, or SEQ ID NO: 20, its complement, a variant thereof, or a fragment thereof.

[0042] d) Donor sequence The CRISPR / Cas-based gene editing system may include at least one donor sequence. The donor sequence may include a fragment of a dystrophin gene. For example, the donor sequence may include a nucleic acid sequence encoding one exon or any combination of exons of a dystrophin gene. The donor sequence may include an exon of a wild-type dystrophin gene or a functional equivalent thereof. The exon may be selected from exons 1-8, 10, 11, 12, 14, 16-22, 43-59, and 61-66 of the dystrophin gene. In some embodiments, the exon is exon 52 of the dystrophin gene. The donor sequence may include a fragment of a wild-type dystrophin gene or a functional equivalent thereof, and the fragment or functional equivalent may be flanked by two gRNA spacers. The donor sequence may further include at least one additional polynucleotide corresponding to an intron sequence surrounding or near the exon to be inserted. The donor sequence may further comprise at least one additional polynucleotide corresponding to intronic sequence surrounding or near exon 52. The donor sequence may comprise at least one nucleic acid sequence of SEQ ID NO:21 or SEQ ID NO:22, a complement thereof, a variant thereof, or a fragment thereof. The gRNA and donor sequence can be present in various molar ratios. The molar ratio between the gRNA and donor sequence can be 1:1, or 1:15, or 5:1 to 1:10, or 1:1 to 1:5. The molar ratio between the gRNA and donor sequence can be at least 1:1, at least 1:2, at least 1:3, at least 1:4, at least 1:5, at least 1:6, at least 1:7, at least 1:8, at least 1:9, at least 1:10, at least 1:15, or at least 1:20. The molar ratio between the gRNA and donor sequence can be less than 20:1, less than 15:1, less than 10:1, less than 9:1, less than 8:1, less than 7:1, less than 6:1, less than 5:1, less than 4:1, less than 3:1, less than 2:1, or less than 1:1.

[0043] 3. Compositions for restoring dystrophin function Disclosed herein is a composition for restoring dystrophin function. The composition can restore dystrophin function by adding one or more exons to restore the dystrophin reading frame. For example, the added exon can be exon 52. The composition can include the above-mentioned CRISPR / Cas-based gene editing system. The composition can also include a viral delivery system. For example, the viral delivery system can include an adeno-associated viral vector or a modified lentiviral vector. Methods for introducing nucleic acids into host cells are known in the art, and any known method can be used to introduce nucleic acids (e.g., expression constructs) into cells. Suitable methods include, for example, viral or bacteriophage infection, transfection, conjugation, protoplast fusion, polycation or lipid:nucleic acid conjugates, lipofection, electroporation, nucleofection, immunoliposomes, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct macroinjection, nanoparticle-mediated nucleic acid delivery, and the like. In some embodiments, compositions can be delivered by mRNA delivery and ribonucleoprotein (RNP) complex delivery.

[0044] a) Constructs and Plasmids The above-described compositions or systems may include a genetic construct encoding the CRISPR / Cas-based gene editing system disclosed herein. A genetic construct, such as a plasmid or expression vector, may include at least one nucleic acid and / or gRNA encoding the CRISPR / Cas-based gene editing system. The above-described compositions may include a genetic construct encoding a modified adeno-associated virus (AAV) vector and a nucleic acid sequence encoding the CRISPR / Cas-based gene editing system disclosed herein. In some embodiments, the above-described compositions may include a genetic construct encoding a modified adenoviral vector and a nucleic acid sequence encoding the CRISPR / Cas-based gene editing system disclosed herein. A genetic construct, such as a plasmid, may include a nucleic acid encoding the CRISPR / Cas-based gene editing system. The above-described compositions may include a genetic construct encoding a modified lentiviral vector. A genetic construct, such as a plasmid, may include a nucleic acid encoding a Cas protein or fusion protein and at least one gRNA. The genetic construct can exist in the cell as a functional extrachromosomal molecule. The genetic construct can be a centromere, a telomere, or a linear minichromosome, including a plasmid or cosmid.

[0045] The gene construct can also be part of the genome of a recombinant virus vector, including recombinant lentivirus, recombinant adenovirus, and recombinant adenovirus-associated virus.The gene construct can be part of the genetic material in an attenuated living microorganism or a recombinant microorganism vector that lives in a cell.The gene construct can include regulatory elements for gene expression of the coding sequence of nucleic acid.The regulatory elements can be promoters, enhancers, start codons, stop codons, or polyadenylation signals.

[0046] The nucleic acid sequence may constitute a genetic construct, which may be a vector. The vector may be capable of expressing a Cas protein or a fusion protein, such as a CRISPR / Cas-based gene editing system, in mammalian cells. The vector may be recombinant. The vector may contain a heterologous nucleic acid encoding a Cas protein or a fusion protein, such as a CRISPR / Cas-based gene editing system. The vector may be a plasmid. The vector may be useful for transfecting cells with a nucleic acid encoding a CRISPR / Cas-based gene editing system, and the transformed host cells are cultured and maintained under conditions that allow expression of the CRISPR / Cas-based gene editing system. The coding sequence can be optimized for stability and high expression levels. In some cases, codons are selected to reduce secondary structure formation in RNA, such as those formed due to intramolecular binding.

[0047] The vector may contain a heterologous nucleic acid encoding a CRISPR / Cas-based gene editing system and may further contain a start codon, which may be upstream of the coding sequence of the CRISPR / Cas-based gene editing system, and a stop codon, which may be downstream of the coding sequence of the CRISPR / Cas-based gene editing system. The start and stop codons may be in-frame with the coding sequence of the CRISPR / Cas-based gene editing system. The vector may also contain a promoter operably linked to the coding sequence of the CRISPR / Cas-based gene editing system. The promoter may be a ubiquitous promoter. The promoter may be a tissue-specific promoter. The tissue-specific promoter may be a muscle-specific promoter. The CRISPR / Cas-based gene editing system may be under light- or chemical-inducible control to enable dynamic control of gene / genome editing in space and time. The promoter operably linked to the coding sequence of the CRISPR / Cas-based gene editing system can be a promoter derived from simian virus 40 (SV40), a mouse mammary tumor virus (MMTV) promoter, a human immunodeficiency virus (HIV) promoter such as the bovine immunodeficiency virus (BIV) long terminal repeat (LTR) promoter, a Moloney virus promoter, an avian leukosis virus (ALV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate-early promoter, an Epstein-Barr virus (EBV) promoter, or a Rous sarcoma virus (RSV) promoter. The promoter can also be a promoter derived from a human gene, such as human ubiquitin C (hUbC), human actin, human myosin, human hemoglobin, human muscle creatine, or human metallothionein. The promoter can also be a natural or synthetic tissue-specific promoter, such as a muscle- or skin-specific promoter. Examples of such promoters are described in U.S. Patent Application Publication No. US20040175727, the contents of which are incorporated herein in their entirety.The promoter may be, for example, a CK8 promoter, an Spc512 promoter, or an MHCK7 promoter.

[0048] The vector may also include a polyadenylation signal downstream of the CRISPR / Cas-based gene editing system. The polyadenylation signal may be an SV40 polyadenylation signal, an LTR polyadenylation signal, a bovine growth hormone (bGH) polyadenylation signal, a human growth hormone (hGH) polyadenylation signal, or a human β-globin polyadenylation signal. The SV40 polyadenylation signal may be the polyadenylation signal from the pCEP4 vector (Invitrogen, San Diego, CA).

[0049] The vector may also contain an enhancer upstream of the CRISPR / Cas-based gene editing system or sgRNA. The enhancer may be necessary for DNA expression. The enhancer may be human actin, human myosin, human hemoglobin, human muscle creatine, or a viral enhancer such as those derived from CMV, HA, RSV, or EBV. Polynucleotide function enhancers are described in U.S. Patent Nos. 5,593,972, 5,962,428, and WO94 / 016737, the contents of each of which are incorporated by reference in their entirety. The vector may also contain a mammalian origin of replication to maintain the vector extrachromosomally and generate multiple copies of the vector in cells. The vector may also contain regulatory sequences that may be well-suited for gene expression in mammalian or human cells to which the vector is administered. The vector may also contain a reporter gene such as green fluorescent protein ("GFP") and / or a selectable marker such as hygromycin ("Hygro").

[0050] The vector may be an expression vector or system for producing a protein by routine techniques and readily available starting materials, including Sambrook et al., Molecular Cloning and Laboratory Manual, Second Ed., Cold Spring Harbor (1989), which is fully incorporated by reference. In some embodiments, the vector may contain a nucleic acid sequence encoding a CRISPR / Cas-based gene editing system, including a nucleic acid sequence encoding a Cas protein or fusion protein and a nucleic acid sequence encoding at least one gRNA, including a gRNA, a variant, or fragment thereof, that targets the nucleic acid sequence of SEQ ID NO: 19, its complement, a variant, or a fragment thereof, or the nucleic acid sequence of SEQ ID NO: 20, its complement, a variant, or a fragment thereof, or the nucleic acid sequence of SEQ ID NO: 17 or SEQ ID NO: 18. In some embodiments, two vectors may contain nucleic acid sequences encoding a CRISPR / Cas-based gene editing system, including a first vector containing a nucleic acid sequence encoding a Cas protein or fusion protein and a second vector containing a nucleic acid sequence encoding at least one gRNA. In some embodiments, the composition is delivered by mRNA and a protein / RNA complex (ribonucleoprotein (RNP)). For example, purified Cas protein or a fusion protein can be combined with a guide RNA to form an RNP complex. The methods described herein may also require delivery of a DNA donor sequence as described herein.

[0051] b) Modified lentiviral vectors The composition for adding or inserting exon 52 can include a modified lentiviral vector. The modified lentiviral vector includes a first polynucleotide sequence encoding a Cas protein or a fusion protein and a second polynucleotide sequence encoding at least one gRNA. The first polynucleotide sequence can be operably linked to a promoter. The promoter can be a constitutive promoter, an inducible promoter, a repressible promoter, or a regulatable promoter. The second polynucleotide sequence encodes at least one gRNA. For example, the second polynucleotide sequence may encode at least 1 gRNA, at least 2 gRNAs, at least 3 gRNAs, at least 4 gRNAs, at least 5 gRNAs, at least 6 gRNAs, at least 7 gRNAs, at least 8 gRNAs, at least 9 gRNAs, at least 10 gRNAs, at least 11 gRNAs, at least 12 gRNAs, at least 13 gRNAs, at least 14 gRNAs, at least 15 gRNAs, at least 16 gRNAs, at least 17 gRNAs, at least 18 gRNAs, at least 19 gRNAs, or at least 20 gRNAs. For example, the second polynucleotide sequence may encode less than 30 gRNAs, less than 25 gRNAs, less than 20 gRNAs, less than 15 gRNAs, less than 10 gRNAs, less than 5 gRNAs, or less than 3 gRNAs. The second polynucleotide sequence may be operably linked to a promoter. The promoter can be a constitutive promoter, an inducible promoter, a repressible promoter, or a regulatable promoter. At least one gRNA can bind to a target gene or locus, such as a target region corresponding to exon 52.

[0052] c) Adeno-associated virus vectors AAV can be used to deliver compositions to cells using various construct configurations.For example, AAV can deliver Cas protein or fusion protein and gRNA expression cassette on separate vectors.Alternatively, Cas protein or fusion protein and up to two gRNA expression cassettes can be combined in a single AAV vector within the packaging limit of 4.7 kb. The above-mentioned composition comprises a modified adeno-associated virus (AAV) vector.The modified AAV vector can deliver and express site-specific nuclease in mammalian cells.For example, the modified AAV vector can be an AAV-SASTG vector (Piacentino et al. (2012) Human Gene Therapy 23:635-646).The modified AAV vector can be based on one or more of several capsid types, including AAV1, AAV2, AAV5, AAV6, AAV8 and AAV9. The modified AAV vectors may be based on AAV2 pseudotypes with alternative muscle-tropic AAV capsids, such as AAV2 / 1, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV2 / 9, AAV2.5, and AAV / SASTG vectors, which efficiently transduce skeletal or cardiac muscle via systemic and local delivery (Seto et al. Current Gene Therapy (2012) 12:139-151). The construct may comprise the polynucleotide sequence of SEQ ID NO:23. The construct may comprise the polynucleotide sequence of SEQ ID NO:24.

[0053] 4. Methods for restoring dystrophin function in subjects with a mutated dystrophin gene The presently disclosed subject matter provides methods for restoring dystrophin function (e.g., a mutant dystrophin gene, e.g., a mutant human dystrophin gene) in cells and / or subjects suffering from DMD and / or having a mutant dystrophin gene. The methods can include administering to the cells or subject a CRISPR / Cas-based gene editing system, a polynucleotide or vector encoding the CRISPR / Cas-based gene editing system, or a composition of the CRISPR / Cas9-based gene editing system, as described above. In some embodiments, the subject has Duchenne muscular dystrophy. In some embodiments, dystrophin function is restored by inserting one or more wild-type exons of the dystrophin gene corresponding to one or more deleted or mutated exons. In some embodiments, dystrophin function is restored by inserting exon 52 of the wild-type dystrophin gene.

[0054] The method can include administering a genetic construct (e.g., a vector) or a composition comprising the same disclosed herein to a cell or a subject. The method can include administering a genetic construct (e.g., a vector) or a composition comprising the same disclosed herein to the skeletal muscle and / or cardiac muscle of a subject for genome editing in the skeletal muscle and / or cardiac muscle, as described above. The use of a genetic construct (e.g., a vector) or a composition comprising the same disclosed herein to deliver a CRISPR / Cas-based gene editing system to skeletal muscle or cardiac muscle can restore fully functional or partially functional protein expression. The CRISPR / Cas-based gene editing system has the advantage of advanced genome editing, with a high rate of successful and efficient gene modification.

[0055] The method may include administering a CRISPR / Cas-based gene editing system, such as administering a Cas protein or fusion protein, a nucleotide sequence encoding said Cas protein or fusion protein, and / or at least one gRNA comprising, encoded by, or corresponding to SEQ ID NO: 19, its complement, variant, or fragment thereof, or at least one gRNA comprising, encoded by, or corresponding to SEQ ID NO: 20, its complement, variant, or fragment thereof, or a gRNA targeting the nucleic acid sequence of SEQ ID NO: 17 or SEQ ID NO: 18, its variant, or fragment thereof. The use of a gene construct (e.g., a vector) or a composition comprising the same disclosed herein to deliver a CRISPR / Cas-based gene editing system to a target muscle can, for example, restore the expression of a fully functional or partially functional protein using a repair template or donor DNA, which can replace the entire gene or a region containing a mutation. The CRISPR / Cas-based gene editing system can be used to introduce a site-specific double-strand break into a targeted genomic locus. The site-specific double-strand break is created by the CRISPR / Cas-based gene editing system binding to the target DNA sequence, thereby enabling the target DNA to be cleaved. This DNA break can stimulate natural DNA repair mechanisms, which can result in one of two possible repair pathways, for example, homology-directed repair (HDR) or non-homologous end joining (NHEJ).

[0056] The disclosed CRISPR / Cas-based gene editing system may involve the use of homology-directed repair or nuclease-mediated non-homologous end joining (NHEJ)-based correction methods, which allow efficient correction in growth-restricted primary cell lines that may not be amenable to homologous recombination or selection-based gene correction. This strategy incorporates the rapid and robust assembly of an active CRISPR / Cas-based gene editing system with efficient gene editing methods to treat genetic diseases caused by mutations in non-essential coding regions that cause frameshifts, premature stop codons, aberrant splice donor sites, or aberrant splice acceptor sites. Restoration of protein expression from endogenous mutant genes can be achieved by template-free NHEJ-mediated DNA repair. In contrast to transient methods that target target gene RNA, the correction of the target gene reading frame in the genome by a transiently expressed CRISPR / Cas-based gene editing system can result in permanently restored target gene expression by each modified cell and all of its progeny. In certain embodiments, NHEJ is nuclease-mediated NHEJ, which in certain embodiments refers to NHEJ initiated by Cas molecules that cleave double-stranded DNA. The method includes administering a gene construct (e.g., a vector) disclosed herein or a composition comprising the same to a subject's skeletal muscle or cardiac muscle for genome editing in skeletal muscle or cardiac muscle.

[0057] Nuclease-mediated NHEJ gene correction corrects mutated target genes and may offer several potential advantages over the HDR pathway. For example, NHEJ does not require a donor template, which can cause nonspecific insertional mutations. In contrast to HDR, NHEJ operates efficiently in all phases of the cell cycle and can therefore be effectively utilized in both cycling and postmitotic cells such as muscle fibers. This provides a robust, permanent alternative to oligonucleotide-based exon skipping or pharmacologically enforced stop codon readthrough, theoretically requiring only a single drug treatment. NHEJ-based gene correction using CRISPR / Cas-based gene editing systems, as well as other engineered nucleases, including meganucleases and zinc finger nucleases, can be combined with other existing ex vivo and in vivo platforms for cell- and gene-based therapies, in addition to the plasmid electroporation approach described herein. For example, delivery of CRISPR / Cas-based gene editing systems by mRNA-based gene transfer or as purified cell-permeable proteins can enable DNA-free genome editing approaches that would avoid any possibility of insertional mutagenesis.

[0058] Recently, the strategy of AAV delivery of CRISPR / Cas9 for homology-independent targeted integration (HITI) has led to genome editing of neurons in vivo. See Suzuki, K., Tsunekawa, Y., Hernandez-Benitez, R., et al. In vivo genome editing via CRISPR / Cas9 mediated homology-independent targeted integration. Nature 540, 144-149 (2016). AAV-based HITI-mediated gene editing therapy for correcting DMD is described herein. Such an AAV CRISPR / Cas9 delivery system can be used to provide efficient and functional correction in, for example, a humanized animal model of DMD.

[0059] 5. Pharmaceutical Compositions The CRISPR / Cas-based gene editing system can be in a pharmaceutical composition. The pharmaceutical composition can contain approximately 1 ng to approximately 10 mg of DNA encoding the CRISPR / Cas-based gene editing system. The pharmaceutical compositions detailed herein are formulated according to the mode of administration to be used. When the pharmaceutical compositions are injectable pharmaceutical compositions, they are sterile, pyrogen-free, and particle-free. An isotonic formulation is preferably used. Generally, additives for isotonicity can include sodium chloride, dextrose, mannitol, sorbitol, and lactose. In some cases, an isotonic solution such as phosphate-buffered saline is preferred. Stabilizers include gelatin and albumin. In some embodiments, a vasoconstricting agent is added to the formulation. Pharmaceutical compositions containing CRISPR / Cas-based gene editing systems can further comprise a pharmaceutically acceptable excipient. Pharmaceutically acceptable excipients can be functional molecules such as vehicles, adjuvants, carriers, or diluents. Pharmaceutically acceptable excipients can be transfection-facilitating agents, and can include surfactants such as immune-stimulating complexes (ISCOMS), Freund's incomplete adjuvant, LPS analogs including monophosphoryl lipid A, muramyl peptides, quinone analogs, vesicles such as squalene and squalene, hyaluronic acid, lipids, liposomes, calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known transfection-facilitating agents.

[0060] The transfection-facilitating agent is a polyanion, a polycation, including poly-L-glutamic acid (LGS), or a lipid. The transfection-facilitating agent is poly-L-glutamic acid, and more preferably, poly-L-glutamic acid is present in the pharmaceutical composition containing the CRISPR / Cas-based gene editing system at a concentration of less than 6 mg / ml. The transfection-facilitating agent may also include surfactants such as immune stimulating complexes (ISCOMS), Freund's incomplete adjuvant, LPS analogs, including monophosphoryl lipid A, muramyl peptides, quinone analogs, and vesicles such as squalene and squalene, and hyaluronic acid may also be used in conjunction with the gene construct. In some embodiments, the DNA vector encoding the CRISPR / Cas-based gene editing system may also include a transfection-facilitating agent, such as a lipid, liposomes, such as lecithin liposomes, or other liposomes known in the art, as a DNA-liposome mixture (see, e.g., WO9324640), calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known transfection-facilitating agents. Preferably, the transfection-facilitating agent is a polyanion, a polycation, including poly-L-glutamic acid (LGS), or a lipid.

[0061] 6.Delivery method Provided herein are methods for delivering pharmaceutical formulations of CRISPR / Cas-based gene editing systems to provide gene constructs and / or proteins of the CRISPR / Cas-based gene editing system. Delivery of the CRISPR / Cas-based gene editing system can be by transfection or electroporation of the CRISPR / Cas-based gene editing system as one or more nucleic acid molecules that are expressed in cells and delivered to the cell surface. CRISPR / Cas-based gene editing system proteins can be delivered to cells. Nucleic acid molecules can be electroporated using a BioRad Gene Pulser Xcell or Amaxa Nucleofector IIb device or other electroporation device. Several different buffers can be used, including BioRad electroporation solution, Sigma phosphate-buffered saline product number D8537 (PBS), Invitrogen OptiMEM I (OM), or Amaxa Nucleofector solution V (NV). Transfection can include a transfection reagent such as Lipofectamine 2000.

[0062] The vector encoding the CRISPR / Cas-based gene editing system protein can be delivered to mammals by in vivo electroporation, liposome-mediated, nanoparticle-facilitated, and / or DNA injection (also called DNA vaccination) with or without recombinant vectors.The recombinant vector can be delivered by any viral method.The viral method can be recombinant lentivirus, recombinant adenovirus, and / or recombinant adeno-associated virus. Nucleotides encoding CRISPR / Cas-based gene editing system proteins can be introduced into cells to induce gene expression of target genes. For example, one or more nucleotide sequences encoding CRISPR / Cas-based gene editing systems directed to target genes can be introduced into mammalian cells. When the CRISPR / Cas-based gene editing system is delivered to cells, and the vector is then delivered to mammalian cells, the transfected cells express the CRISPR / Cas-based gene editing system. The CRISPR / Cas-based gene editing system can be administered to mammals to induce or modulate gene expression of target genes in mammals. The mammal can be a human, non-human primate, cow, pig, sheep, goat, antelope, bison, buffalo, bovine, deer, hedgehog, anteater, platypus, elephant, llama, alpaca, mouse, rat, or chicken, preferably a human, cow, pig, or chicken.

[0063] When the gene construct or composition disclosed herein is delivered to tissue, and thus the vector is delivered into mammalian cells, the transfected cells express gRNA molecules and Cas9 molecules.The gene construct or composition can be administered to mammalian cells to change gene expression, or re-engineer or modify genome.For example, the gene construct or composition can be administered to mammalian cells to restore dystrophin function in mammalian cells.The mammalian cells can be human, non-human primate, cow, pig, sheep, goat, antelope, bison, buffalo, bovine, deer, hedgehog, anteater, platypus, elephant, llama, alpaca, mouse, rat, or chicken, preferably human, cow, pig, or chicken. Genetic constructs (e.g., vectors) encoding gRNA and Cas9 molecules can be delivered to mammals by in vivo electroporation, liposome-mediated delivery, nanoparticle-facilitated delivery, and / or DNA injection (also called DNA vaccination) with or without recombinant vectors. The recombinant vector can be delivered by any viral modality. The viral modality can be recombinant lentivirus, recombinant adenovirus, and / or recombinant adeno-associated virus.

[0064] The genetic constructs (e.g., vectors) disclosed herein or compositions comprising same can be introduced into cells to genetically repair the dystrophin function of a dystrophin gene (e.g., a human dystrophin gene). In certain embodiments, the genetic constructs (e.g., vectors) disclosed herein or compositions comprising same are introduced into myoblasts derived from a DMD patient. In certain embodiments, the genetic constructs (e.g., vectors) or compositions comprising same can be introduced into fibroblasts derived from a DMD patient, and the genetically corrected fibroblasts can be treated with MyoD to induce differentiation into myoblasts, which can then be transplanted into a subject, such as into the subject's injured muscle, to verify whether the corrected dystrophin protein is functional and / or to treat the subject. The modified cells can be induced pluripotent stem cells, bone marrow-derived progenitors, skeletal muscle progenitors, human skeletal myoblasts derived from a DMD patient, CD133 + They can also be stem cells, such as cells, mesoangioblasts, and cells transduced with MyoD or Pax7, or other myogenic progenitor cells. For example, CRISPR / Cas-based gene editing systems can induce neural or myogenic differentiation of induced pluripotent stem cells.

[0065] 7. Route of Administration The CRISPR / Cas-based gene editing system and its composition can be administered to a subject by various routes, including, for example, oral, parenteral, sublingual, transdermal, rectal, transmucosal, topical, via inhalation, via buccal administration, intrapleural, intravenous, intraarterial, intraperitoneal, subcutaneous, intramuscular, intranasal, intrathecal, and intraarticular, or a combination thereof. For veterinary use, the composition can be administered in a suitable, acceptable formulation according to standard veterinary practice. A veterinarian can easily determine the most appropriate dosage regimen and administration route for a specific animal. The CRISPR / Cas-based gene editing system and its composition can be administered by conventional syringe, needleless injection device, "microparticle bombardment gene gun", or other physical methods such as electroporation ("EP"), "hydrodynamic method", or ultrasound. The compositions can be delivered to mammals by several techniques, including in vivo electroporation, liposome-mediated, nanoparticle-facilitated, DNA injection (also called DNA vaccination) with or without recombinant vectors such as recombinant lentiviruses, recombinant adenoviruses, and recombinant adenovirus-associated viruses.

[0066] The genetic constructs (e.g., vectors) disclosed herein or compositions comprising the same can be administered to a subject by a variety of routes, including, for example, orally, parenterally, sublingually, transdermally, rectally, transmucosally, topically, via inhalation, via buccal administration, intrapleurally, intravenously, intraarterially, intraperitoneally, subcutaneously, intramuscularly, intranasally, intrathecally, and intraarticularly, or a combination thereof. In certain embodiments, the genetic constructs (e.g., vectors) or compositions disclosed herein are administered to a subject (e.g., a subject suffering from DMD) intramuscularly, intravenously, or a combination thereof. For veterinary use, the genetic constructs (e.g., vectors) or compositions disclosed herein can be administered in an appropriately tolerated formulation in accordance with standard veterinary practice. A veterinarian can readily determine the dosing regimen and route of administration that is most appropriate for a particular animal. The compositions can be administered by conventional syringe, needleless injection device, "microparticle bombardment gene gun," or other physical methods such as electroporation ("EP"), "hydrodynamic methods," or ultrasound.

[0067] The genetic constructs (e.g., vectors) or compositions disclosed herein can be delivered to mammals by several techniques, including in vivo electroporation, liposome-mediated, nanoparticle-facilitated, DNA injection (also called DNA vaccination) with or without recombinant vectors such as recombinant lentiviruses, recombinant adenoviruses, and recombinant adenovirus-associated viruses. The compositions can be injected into skeletal muscle or cardiac muscle. For example, the compositions can be injected into the tibialis anterior muscle or tail. In some embodiments, a genetic construct (e.g., a vector) or composition thereof disclosed herein is administered by: 1) tail vein injection into adult mice (systemic); 2) intramuscular injection into adult mice, e.g., local injection into a muscle such as the TA or gastrocnemius; 3) intraperitoneal injection into P2 mice; or 4) facial vein injection into P2 mice (systemic).

[0068] 8.Cell type Any of these delivery methods and / or routes of administration can be used to deliver a myriad of cell types, including, but not limited to, wild-type and DMD patient-derived lines, primordial DMD dermal fibroblasts, induced pluripotent stem cells, bone marrow-derived progenitors, skeletal muscle progenitors, human skeletal myoblasts from DMD patients, CD133 +Cell types currently being investigated for cell-based DMD treatments can be utilized, including immortalized myoblasts, such as cells, mesoangioblasts, cardiomyocytes, hepatocytes, chondrocytes, mesenchymal progenitor cells, hematopoietic stem cells, smooth muscle cells, and cells transduced with MyoD or Pax7, or other myogenic progenitor cells. Immortalized human myoblasts can be used for the clonal derivation of gene-corrected myoblasts. Cells can be modified ex vivo to isolate and expand clonal populations of immortalized DMD myoblasts that contain a gene-corrected or repaired dystrophin gene in the protein-coding region of their genome and lack mutations introduced by other nucleases. Alternatively, transient in vivo delivery of CRISPR / Cas-based systems via nonviral or nonintegrating viral gene transfer, or via direct delivery of purified protein and gRNA containing cell-penetrating motifs, may enable highly specific in situ correction and / or repair with minimal or no risk of exogenous DNA integration.

[0069] 9. Kit Provided herein is a kit that can be used to correct a mutated dystrophin gene and / or restore dystrophin function. The kit includes at least a gRNA containing or encoded by the polynucleotide sequence of SEQ ID NO: 19, its complement, variant, or fragment thereof, or a gRNA containing or encoded by the polynucleotide sequence of SEQ ID NO: 20, its complement, variant, or fragment thereof, or a gRNA targeting the polynucleotide sequence of SEQ ID NO: 17 or SEQ ID NO: 18, its complement, variant, or fragment thereof, and instructions for using a CRISPR / Cas-based editing system to restore dystrophin function. Also provided herein is a kit that can be used to edit the dystrophin gene in skeletal muscle or cardiac muscle. The kit includes the above-described gene construct (e.g., a vector) for genome editing in skeletal muscle or cardiac muscle or a composition containing the same, and instructions for using the composition.

[0070] The instructions included in the kit may be affixed to packaging materials or may be included as a package insert. The instructions are typically, but not limited to, written or printed matter. Any medium capable of storing such instructions and transmitting them to an end user is contemplated by the present disclosure. Such media include, but are not limited to, electronic storage media (e.g., magnetic disks, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. As used herein, the term "instructions" may include the address of an internet site providing the instructions. A genetic construct (e.g., a vector) or a composition comprising the same for restoring dystrophin function in skeletal or cardiac muscle may include a modified AAV vector comprising the above-described gRNA molecule and a Cas protein or fusion protein that specifically binds to and cleaves a region of the dystrophin gene. The above-described CRISPR / Cas-based gene editing system may be included in a kit to specifically bind to and target a particular region in the mutated dystrophin gene, such as exon 52. [Example]

[0071] 10. Working Example The foregoing description may be better understood by reference to the following examples, which are presented for purposes of illustration and are not intended to limit the scope of the invention. The present disclosure has multiple aspects and embodiments, which are illustrated by the accompanying non-limiting examples.

[0072] Example 1 Design and screening of SaCas9 gRNAs for targeting hDMD-intron 51 in HEK293T cells gRNAs targeting hDMD-intron 51, located upstream of SaCas9 hDMD-exon 52, were designed with a 21-bp spacer and cloned into individual expression plasmids (Figure 3). HEK293T cells in 24-well plates were transfected with a plasmid (375 ng) expressing SaCas9 under the CMV promoter and plasmids (125 ng) expressing individual gRNAs under the U6 promoter. Genomic DNA was extracted 3 days after transfection. Editing efficiency was assessed by Surveyor analysis (Figure 4A and Figure 4B). A negative control (NC) contained no gRNA. Excess bands associated with single nucleotide polymorphisms (SNPs) in HEK293T genomic DNA were also observed. These bands corresponded to the expected sizes based on the location of the SNPs (Figure 5A and Figure 5B). Testing continued with gRNA03, gRNA06, gRNA07, and gRNA09 using 19- to 23-bp spacers.

[0073] Example 2 Design and screening of SaCas9 gRNAs for targeting hDMD-intron 51 in human 8036 myoblasts Based on the editing activity of the gRNAs tested in HEK293T, the top gRNAs were redesigned with 19- to 23-bp spacers and cloned into individual expression plasmids. The redesigned gRNAs were screened in human 8036 myoblast cells. Human 8036 myoblast cells in 6-well plates were electroporated with 10 μg of a plasmid expressing SaCas9 under the CMV promoter and 10 μg of a plasmid expressing individual gRNAs under the U6 promoter. Genomic DNA was isolated 3 days after electroporation. Editing efficiency was assessed by surveyor analysis (Figure 6A, Figure 6B). A negative control (NC) contained no gRNA. Editing efficiency was also assessed by tidal analysis. gRNAs g12, g16, and g7 were selected to generate AAV integration vectors.

[0074] Example 3 SaCas9 gRNA screening of AAV-HITI donor plasmids in HEK293T cells Based on the editing activity of the gRNAs tested in human 8036 myoblasts, the top gRNAs were cloned into AAV-HITI donor plasmids (gRNAs g12, g16, and g7). HEK293T cells in 24-well plates were transfected with a plasmid (375 ng) expressing SaCas9 under the CMV promoter and a plasmid (125 ng) expressing individual gRNAs under the U6 promoter or an AAV-HITI donor plasmid (125 ng) expressing individual gRNAs under the U6 promoter. Genomic DNA was extracted 3 days after transfection. Editing efficiency was assessed by surveyor analysis (Figure 7). Based on the editing activity of the AAV-HITI donor plasmids expressing individual gRNAs, the g7 and g12 donors were used in previous experiments to generate AAV-HITI donor plasmids.

[0075] Example 4 In vitro HITI-mediated integration of hDMD-exon 52 Primary myoblasts were isolated from hDMDΔ52 / mdx mice. These cells in 6-well plates were electroporated with the AAV-CMV-Cas9 plasmid (10 μg) and the AAV-U6-gRNA-Ex52 donor plasmid (10 μg) expressing individual gRNAs. Genomic DNA was extracted 6 days after electroporation. Nested PCR was used to detect HITI-mediated hDMD-Exon 52 integration (Figure 8A). The boxed band in the gRNA12-donor sample was excised and sent for Sanger sequencing (Figure 8B), confirming integration of the hDMD-Exon 52 donor at the target site.

[0076] Example 5 In vivo HITI-mediated integration of hDMD-exon 52 in the hDMDΔ52 / mdx mouse model Figure 9 shows a schematic of the experiments used to confirm in vivo editing, determine the best gRNA / donor sequence combination, and determine the best ratio of AAV-Cas9 to AAV-donor plasmid. Male 6- to 8-week-old hDMDΔ52 / mdx mice were injected with AAV-Cas9 and AAV-HITI donor via local intramuscular injection into the tibialis anterior (TA) muscle. Four weeks after injection, TA muscles were harvested and processed to assess HITI-mediated editing. PBS-injected mice served as negative controls; N = 4.

[0077] The targeted Ex52 insertion in the genomic DNA of hDMDΔ52 / mdx mice was investigated using a primer downstream of the target cleavage site (FIG. 10A) and a primer upstream of the target cleavage site (FIG. 10B). Genomic DNA was extracted from TA muscle. PCR analysis confirmed the presence of the Ex52 insertion at the target site. We investigated the targeted Ex52 insertion in the mRNA of treated hDMDΔ52 / mdx mice (FIG. 11). Total RNA was extracted from TA muscle and used to generate cDNA. PCR analysis confirmed the presence of the splicing-mediated Ex52 insertion in the RNA transcript.

[0078] Example 6 Dystrophin protein restoration in treated hDMDΔ52 / mdx mice Proteins were extracted from TA muscles and used for Western blot analysis. PBS and treated TA muscles were loaded with 25 μg of total protein. To serve as a positive control, 3.125 μg of total protein from hDMD / mdx TA muscles was loaded. Membranes were stained with anti-dystrophin (clone 2c6, MANDYS106) or anti-GAPDH (clone 14C10). Western blot analysis confirmed protein restoration in treated mice (Figure 12).

[0079] Example 7 Deep sequencing quantification of AAV-ITR sequence integration in edited hDMDΔ52 / mdx mice Figure 13 shows results from Illumina deep sequencing quantification of exon 52 genomic integration in edited mice. Genomic DNA was extracted from TA muscle. For unbiased sequencing analysis, genomic DNA was tagged using a Nextera Tn5 transposon. To enrich for targeted sequences, PCR was completed using a genome-specific primer upstream of the intron 51 target site and a reverse primer specific to the tag sequence inserted by the transposon. A second PCR was used to add the experimental barcode and Illumina adapter sequence. ITR integration was detected by next-generation sequencing. Bowtie analysis was used to detect the presence of ITR sequences matching the AAV vector and genome-specific sequences that matched the genomic DNA sequence between the genome-specific primer and the intron 51 target site.

[0080] Example 8 PacBio sequencing quantification of exon 52 insertions in edited hDMDΔ52 / mdx mouse mRNA Total RNA was extracted from TA muscle and used to generate cDNA (Figure 14A). To enrich for targeted sequences, PCR was completed using primers in exon 45 and exon 69. A second PCR was used to add experimental barcodes and PacBio adapter sequences. Exon 52 insertion was detected by PacBio sequencing (Figure 14B). 118-nt reads between the 3'-exon 51 and 5'-exon 53 sequences were quantified. These sequences were aligned with the exon 52 donor to confirm the intended editing. Sequencing reads containing 118 bp between exon 51 and exon 53 matched the exon 52 sequence.

[0081] For reasons of completeness, the various aspects are set out in the following numbered clauses: Clause 1. A CRISPR / Cas-based genome editing system comprising one or more vectors encoding a composition comprising: (a) a guide RNA (gRNA) that targets a fragment of a mutant dystrophin gene; (b) a Cas protein or a fusion protein that comprises a Cas protein; and (c) a donor sequence that comprises a fragment of a wild-type dystrophin gene. Clause 2. A CRISPR / Cas-based genome editing system comprising: (a) a guide RNA (gRNA) that targets a fragment of a mutant dystrophin gene; (b) a Cas protein or a fusion protein that comprises a Cas protein; and (c) a donor sequence that comprises a fragment of a wild-type dystrophin gene. Clause 3. The system of clause 1 or 2, wherein the fragment of a wild-type dystrophin gene is flanked by two gRNA spacer and / or PAM sequences. Clause 4. The system of any one of clauses 1-3, wherein the gRNA targets an intron juxtaposed to an exon of the mutant dystrophin gene, and the exon is selected from exons 1-8, 10, 11, 12, 14, 16-22, 43-59, and 61-66 of the mutant dystrophin gene.

[0082] Clause 5. The system of any one of clauses 1-3, wherein the donor sequence comprises an exon of a wild-type dystrophin gene or a functional equivalent thereof, wherein the exon is selected from exons 1-8, 10, 11, 12, 14, 16-22, 43-59, and 61-66 of the wild-type dystrophin gene. Clause 6. The system of clause 4, wherein an exon of the mutant dystrophin gene is mutated or at least partially deleted from the dystrophin gene, or an exon of the mutant dystrophin gene is deleted and an intron is juxtaposed to the location where the deleted exon would be in the corresponding wild-type dystrophin gene. Clause 7. The system of clause 4 or 5, wherein the exon is exon 52. Clause 8. The system of any one of clauses 1-7, wherein the gRNA binds to and targets a polynucleotide sequence comprising a) SEQ ID NO: 17 or SEQ ID NO: 18, b) a fragment of SEQ ID NO: 17 or SEQ ID NO: 18, c) the complement of SEQ ID NO: 17 or SEQ ID NO: 18, or a fragment thereof, d) a nucleic acid that is substantially identical to SEQ ID NO: 17 or SEQ ID NO: 18, or a complement thereof, or e) a nucleic acid that hybridizes to SEQ ID NO: 17 or SEQ ID NO: 18 under stringent conditions, a complement thereof, or a sequence substantially identical thereto.

[0083] Clause 9. The system of any one of clauses 1 to 8, wherein the gRNA comprises or is encoded by the polynucleotide sequence of SEQ ID NO: 19 or SEQ ID NO: 20, or a variant thereof. Clause 10. The system of any one of clauses 1 to 9, wherein the Cas protein is a Streptococcus pyogenes Cas9 protein or a Staphylococcus aureus Cas9 protein. Clause 11. The system of any one of clauses 1 to 10, wherein the Cas protein comprises the amino acid sequence of SEQ ID NO: 1, 2, 3, or 4. Clause 12. The system of any one of clauses 3-11, wherein the two gRNA spacers independently comprise a sequence selected from SEQ ID NOs: 5-8 and 25-45. Clause 13. The system of clause 12, wherein the two gRNA spacers are identical. Clause 14. The system of clause 12, wherein the two gRNA spacers are different. Clause 15. The system of any one of clauses 3 to 14, wherein at least one of the two gRNA spacers comprises the sequence of SEQ ID NO: 25 or SEQ ID NO: 26. Clause 16. The system of any one of clauses 1 to 15, wherein the donor sequence comprises the polynucleotide of SEQ ID NO: 21 or SEQ ID NO: 22.

[0084] Clause 17. The system of any one of clauses 1 and 3 to 16, wherein the vector is a viral vector. Clause 18. The system of clause 17, wherein the vector is an adeno-associated virus (AAV) vector. Clause 19. The system of clause 18, wherein the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV-10, AAV-11, AAV-12, AAV-13, or AAVrh.74 vector. Clause 20. The system of clause 18, wherein one of the one or more vectors comprises the polynucleotide sequence of SEQ ID NO: 23 or 24. Clause 21. The system of any one of clauses 1 to 20, wherein the molar ratio between the gRNA and the donor sequence is 1:1, or 1:15, or 5:1 to 1:10, or 1:1 to 1:5. Clause 22. A recombinant polynucleotide encoding a donor sequence comprising a fragment of a wild-type dystrophin gene or a functional equivalent thereof, wherein the fragment or functional equivalent thereof is flanked by two gRNA spacers.

[0085] Clause 23. The recombinant polynucleotide of Clause 22, wherein the donor sequence comprises an exon of a dystrophin gene, the exon being selected from exons 1-8, 10, 11, 12, 14, 16-22, 43-59, and 61-66. Clause 24. The recombinant polynucleotide of clause 22 or 23, wherein the recombinant polynucleotide comprises the sequence of SEQ ID NO: 23 or 24. Clause 25. A vector comprising the recombinant polynucleotide of any one of Clauses 22 to 24. Clause 26. The vector of Clause 25, wherein the vector comprises a heterologous promoter driving expression of the recombinant polynucleotide. Clause 27. A cell comprising a recombinant polynucleotide according to any one of clauses 22 to 24 or a vector according to clause 25 or 26.

[0086] Clause 28. A composition for restoring dystrophin function in a cell having a mutated dystrophin gene comprising the system of any one of clauses 1 to 21, the recombinant polynucleotide of any one of clauses 22 to 24, or the vector of clause 25 or 26. Clause 29. A kit comprising a system according to any one of clauses 1 to 21, a recombinant polynucleotide according to any one of clauses 22 to 24, or a vector according to clause 25 or 26, or a composition according to clause 28. Clause 30. A method for restoring dystrophin function in a cell or subject having a mutated dystrophin gene comprising contacting the cell or subject with a system of any one of clauses 1-21, a recombinant polynucleotide of any one of clauses 22-24, or a vector of clause 25 or 26, or a composition of clause 28. Clause 31. The method of clause 30, wherein dystrophin function is restored by insertion of exon 52 of the wild-type dystrophin gene.

[0087] Clause 32. The method of clause 30 or 31, wherein the subject suffers from Duchenne muscular dystrophy. Clause 33. A method for restoring dystrophin function in a cell or subject having a disrupted dystrophin gene caused by one or more deleted or mutated exons, comprising contacting the cell or subject with a system of any one of clauses 1-21, a recombinant polynucleotide of any one of clauses 22-24, or a vector of clause 25 or 26, or a composition of clause 28. Clause 34. The method of clause 33, wherein dystrophin function is restored by inserting one or more wild-type exons of the dystrophin gene corresponding to one or more deleted or mutated exons. Clause 35. The method of clause 34, wherein one of the deleted or mutated exons is exon 52. Another aspect of the present invention may be as follows. [1] (a) a guide RNA (gRNA) targeting a fragment of a mutant dystrophin gene; (b) a Cas protein or a fusion protein comprising a Cas protein, and (c) Donor sequence containing a fragment of the wild-type dystrophin gene A CRISPR / Cas-based genome editing system comprising one or more vectors encoding a composition comprising: [2] (a) a guide RNA (gRNA) targeting a fragment of a mutant dystrophin gene; (b) a Cas protein or a fusion protein comprising a Cas protein, and (c) Donor sequence containing a fragment of the wild-type dystrophin gene CRISPR / Cas-based genome editing systems, including [3] The system described in [1] or [2], wherein a fragment of a wild-type dystrophin gene is flanked by two gRNA spacer and / or PAM sequences. [4] The system described in any one of [1] to [3] above, wherein the gRNA targets an intron juxtaposed to an exon of the mutant dystrophin gene, and the exon is selected from exons 1 to 8, 10, 11, 12, 14, 16 to 22, 43 to 59, and 61 to 66 of the mutant dystrophin gene. [5] The system described in any one of [1] to [3] above, wherein the donor sequence comprises an exon of a wild-type dystrophin gene or a functional equivalent thereof, and the exon is selected from exons 1 to 8, 10, 11, 12, 14, 16 to 22, 43 to 59, and 61 to 66 of the wild-type dystrophin gene. [6] The system described in [4], wherein an exon of the mutant dystrophin gene is mutated or at least partially deleted from the dystrophin gene, or an exon of the mutant dystrophin gene is deleted and an intron is juxtaposed to the location where the deleted exon would be located in the corresponding wild-type dystrophin gene. [7] The system described in [4] or [5], wherein the exon is exon 52. [8] gRNA, a) SEQ ID NO: 17 or SEQ ID NO: 18, b) a fragment of SEQ ID NO: 17 or SEQ ID NO: 18; c) the complement of SEQ ID NO: 17 or SEQ ID NO: 18, or a fragment thereof; d) a nucleic acid substantially identical to SEQ ID NO: 17 or SEQ ID NO: 18, or a complement thereof; or e) a nucleic acid that hybridizes under stringent conditions to SEQ ID NO: 17 or SEQ ID NO: 18, its complement, or a sequence substantially identical thereto The system described in any one of [1] to [7] above, which binds to and targets a polynucleotide sequence comprising the following: [9] The system described in any one of [1] to [8], wherein the gRNA comprises or is encoded by the polynucleotide sequence of SEQ ID NO: 19 or SEQ ID NO: 20, or a variant thereof.

[10] The system described in any one of [1] to [9] above, wherein the Cas protein is a Streptococcus pyogenes Cas9 protein or a Staphylococcus aureus Cas9 protein.

[11] The system described in any one of [1] to

[10] above, wherein the Cas protein comprises the amino acid sequence of SEQ ID NO: 1, 2, 3, or 4.

[12] The system described in any one of [3] to

[11] above, wherein the two gRNA spacers independently comprise sequences selected from SEQ ID NOs: 5 to 8 and 25 to 45.

[13] The system described in

[12] , wherein the two gRNA spacers are identical.

[14] The system described in

[12] , wherein the two gRNA spacers are different.

[15] The system described in any one of [3] to

[14] , wherein at least one of the two gRNA spacers comprises the sequence of SEQ ID NO: 25 or SEQ ID NO: 26.

[16] The system described in any one of [1] to

[15] above, wherein the donor sequence comprises the polynucleotide of SEQ ID NO: 21 or SEQ ID NO: 22.

[17] The system described in any one of [1] and [3] to

[16] above, wherein the vector is a viral vector.

[18] The system described in

[17] , wherein the vector is an adeno-associated virus (AAV) vector.

[19] The system described in

[18] , wherein the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV-10, AAV-11, AAV-12, AAV-13, or AAVrh.74 vector.

[20] The system described in

[18] , wherein one of the one or more vectors comprises the polynucleotide sequence of SEQ ID NO: 23 or 24.

[21] The system described in any one of [1] to

[20] above, wherein the molar ratio between the gRNA and the donor sequence is 1:1, or 1:15, or 5:1 to 1:10, or 1:1 to 1:5.

[22] A recombinant polynucleotide encoding a donor sequence or its functional equivalent comprising a fragment of a wild-type dystrophin gene, wherein the fragment or its functional equivalent is flanked by two gRNA spacers.

[23] The recombinant polynucleotide according to

[22] , wherein the donor sequence comprises an exon of a dystrophin gene, and the exon is selected from exons 1 to 8, 10, 11, 12, 14, 16 to 22, 43 to 59, and 61 to 66.

[24] The recombinant polynucleotide according to

[22] or

[23] , wherein the recombinant polynucleotide comprises the sequence of SEQ ID NO: 23 or 24.

[25] A vector comprising the recombinant polynucleotide according to any one of

[22] to

[24] above.

[26] The vector according to

[25] , wherein the vector comprises a heterologous promoter that drives expression of the recombinant polynucleotide.

[27] A cell comprising the recombinant polynucleotide according to any one of

[22] to

[24] above or the vector according to

[25] or

[26] above.

[28] A composition for restoring dystrophin function in a cell having a mutant dystrophin gene, comprising the system described in any one of [1] to

[21] , the recombinant polynucleotide described in any one of

[22] to

[24] , or the vector described in

[25] or

[26] .

[29] A kit comprising the system described in any one of [1] to

[21] , the recombinant polynucleotide described in any one of

[22] to

[24] , or the vector described in

[25] or

[26] , or the composition described in

[28] .

[30] A method for restoring dystrophin function in a cell or subject having a mutant dystrophin gene, comprising contacting the cell or subject with the system described in any one of [1] to

[21] , the recombinant polynucleotide described in any one of

[22] to

[24] , the vector described in

[25] or

[26] , or the composition described in

[28] .

[31] The method according to

[30] , wherein dystrophin function is restored by inserting exon 52 of the wild-type dystrophin gene.

[32] The method according to

[30] or

[31] , wherein the subject suffers from Duchenne muscular dystrophy.

[33] A method for restoring dystrophin function in a cell or subject having a disrupted dystrophin gene caused by one or more deleted or mutated exons, comprising contacting the cell or subject with the system described in any one of [1] to

[21] , the recombinant polynucleotide described in any one of

[22] to

[24] , the vector described in

[25] or

[26] , or the composition described in

[28] .

[34] The method according to

[33] , wherein dystrophin function is restored by inserting one or more wild-type exons of the dystrophin gene corresponding to one or more deleted or mutated exons.

[35] The method according to

[34] above, wherein one of the deleted or mutated exons is exon 52.

[0088] array Streptococcus pyogenes Cas9 (SEQ ID NO: 1)

[0089] Staphylococcus aureus Cas9 molecule (SEQ ID NO: 2)

[0090] Streptococcus pyogenes Cas9 (with D10A) (SEQ ID NO: 3)

[0091] Streptococcus pyogenes Cas9 (with D10A, H849A) (SEQ ID NO: 4)

[0092] PAM (SEQ ID NO: 9) ATTCCT PAM (SEQ ID NO: 10) NGG PAM (SEQ ID NO: 11) NNNRRT PAM (SEQ ID NO: 12) NNGRR (R=A or G) PAM (SEQ ID NO: 13) NNGRRN (R=A or G) PAM (SEQ ID NO: 14) NNGRRT (R=A or G) PAM (SEQ ID NO: 15) NNGRRV (R=A or G, V=A, C, or G) PAM (SEQ ID NO: 16) NGA

[0093] Target of gRNA7 (SEQ ID NO: 17) TCATTTATAATACAGGGGAAT gRNA12 target (SEQ ID NO: 18) TTAAGTAATCCGAGGTACTC gRNA7 (including target sequence and scaffold) (SEQ ID NO: 19) TCATTTATAATACAGGGGAATGTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGA

[0094] gRNA12 (including target sequence and scaffold) (SEQ ID NO: 20) TTAAGTAATCCGAGGTACTCGTTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGA Exon 52 (SEQ ID NO: 21) GCAACAATGCAGGATTTGGAACAGAGGCGTCCCCAGTTGGAAGAACTCATTACCGCTGCCCAAAATTTGAAAAACAAGACCAGCAATCAAGAGGCTAGAACAATCATTACGGATCGAA

[0095] Exon 52 with partial intron (SEQ ID NO: 22) GTTAAATTGTTTCTATAAACCCTTATACAGTAACATCTTTTTTATTTCTAAAAGTGTTTTGGCTGGTCTCACAATTGTACTTTACTTTGTATTATGTAAAAGGAATACACAACGCTGAAGAACCCTGATACTAAGGGATATTTGTCTTACAGGCAACAATGCAGGATTTGGAACAGAGGCGTCCCCAGTTGGAAGAACTCATTACCGCTGCCCAAAATTTGAAAAACAAGACC AGCAATCAAGAGGCTAGAACAATCATTACGGATCGAAGTAAGTTTTTTAACAAGCATGGGACACACAAAGCAAGATGCATGACAAGTTTCAATAAAAACTTAAGTTCATATATCCCCCTCACATTTATAAAAATAATGTGAAATAATTGTAAATGATAACAATTGTGCTGAGATTTTCAGTCCATAATGTTACCTTTTAATAAATGAATGTAATTCCATTGAATAGAAGAAATAC

[0096] AAV for gRNA7 (SEQ ID NO: 23) AAV genome for exon 52 donor sequence with gRNA7: [ka] JPEG0007827288000002.jpg183153

[0097] AAV for gRNA12 (SEQ ID NO: 24) AAV genome for exon 52 donor sequence with gRNA12: [ka] JPEG0007827288000004.jpg182152

[0098] SEQ ID NO: 25 gRNA7 spacer ATTCCCCTGTATTATAAATGA SEQ ID NO: 26: gRNA12 spacer GAGTACCTCGGATTACTTAA

[0099] [Table 1] TIFF0007827288000006.tif83153

Claims

1. A CRISPR / Cas-based genome editing system comprising one or more vectors, wherein the one or more vectors (a) a polynucleotide encoding a guide RNA (gRNA) that targets an intron connected to exon 52 of a mutant dystrophin gene; (b) a polynucleotide encoding a Cas protein or a fusion protein comprising a Cas protein; and (c) a polynucleotide encoding a donor sequence comprising exon 52 of a wild-type dystrophin gene; Including, the molar ratio between the polynucleotide encoding the gRNA and the polynucleotide encoding the donor sequence is 1:1 to 1:5; A genome editing system, wherein the donor sequence is flanked by two gRNA spacers independently comprising sequences selected from SEQ ID NOs: 5-7 and 25-45.

2. (a) A guide RNA (gRNA) targeting an intron connected to exon 52 of the mutant dystrophin gene; (b) a Cas protein or a fusion protein comprising a Cas protein, and (c) a donor sequence containing exon 52 of the wild-type dystrophin gene; A CRISPR / Cas-based genome editing system comprising: the molar ratio between the gRNA and the donor sequence is 1:1 to 1:5; A genome editing system, wherein the donor sequence is flanked by two gRNA spacers independently comprising sequences selected from SEQ ID NOs: 5-7 and 25-45.

3. 3. The system of claim 1, wherein the mutant dystrophin gene comprises a deletion of a nucleotide in exon 52, a substitution of a nucleotide in exon 52, an addition of a nucleotide in exon 52, a transversion of a nucleotide in exon 52, or a partial deletion of exon 52, or wherein the mutant dystrophin gene has a complete deletion of exon 52 and the intron connects to the location where the deleted exon 52 would be located in the corresponding wild-type dystrophin gene.

4. gRNA, a) SEQ ID NO: 17 or SEQ ID NO: 18, or b) the complement of SEQ ID NO: 17 or SEQ ID NO: 18; The system of any one of claims 1 to 3, which binds to and targets a polynucleotide sequence comprising:

5. The system of any one of claims 1 to 4, wherein the gRNA is encoded by a polynucleotide comprising the sequence of SEQ ID NO: 19 or SEQ ID NO:

20.

6. 6. The system of claim 1, wherein the Cas protein is a Streptococcus pyogenes Cas9 protein or a Staphylococcus aureus Cas9 protein.

7. The system of any one of claims 1 to 6, wherein the Cas protein comprises the amino acid sequence of SEQ ID NO: 1, 2, 3, or 4.

8. The system of any one of claims 1 to 7, wherein the two gRNA spacers are identical.

9. The system of any one of claims 1 to 7, wherein the two gRNA spacers are different.

10. The system of any one of claims 1 to 9, wherein at least one of the two gRNA spacers is encoded by a polynucleotide comprising the sequence of SEQ ID NO:25 or SEQ ID NO:

26.

11. The system of any one of claims 1 to 10, wherein the donor sequence comprises the polynucleotide of SEQ ID NO:21 or SEQ ID NO:

22.

12. The system according to any one of claims 1 and 3 to 11, wherein the vector is a viral vector.

13. The system of claim 12 , wherein the vector is an adeno-associated virus (AAV) vector.

14. 14. The system of claim 13, wherein the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV-10, AAV-11, AAV-12, AAV-13, AAVrh.74 vector, or a mutant thereof.

15. 14. The system of claim 13, wherein one of the one or more vectors comprises the polynucleotide sequence of SEQ ID NO: 23 or 24.

16. A vector encoding the system according to any one of claims 2 to 15.

17. 17. The vector of claim 16, wherein the vector comprises a heterologous promoter driving expression of the system.

18. A cell comprising the vector according to claim 16 or 17 or the system according to any one of claims 1 to 15.

19. 18. Use of a composition comprising the system of any one of claims 1 to 15 or the vector of claim 16 or 17 in the manufacture of a medicament for restoring dystrophin function in a cell having a mutated dystrophin gene.

20. A kit comprising the system according to any one of claims 1 to 15 or the vector according to claim 16 or 17.

21. A composition for restoring dystrophin function in a cell or subject having a mutated dystrophin gene, comprising the system of any one of claims 1 to 15 or the vector of claim 16 or 17.

22. 22. The composition of claim 21, wherein dystrophin function is restored by insertion of exon 52 of the wild-type dystrophin gene.

23. 23. The composition of claim 21 or 22, wherein the subject is suffering from Duchenne muscular dystrophy.

24. 18. A composition comprising the system of any one of claims 1 to 15 or the vector of claim 16 or 17, for use in restoring dystrophin function in a cell or subject having a disrupted dystrophin gene caused by one or more deleted or mutated exons.

25. 25. The composition for use of claim 24, wherein dystrophin function is restored by inserting one or more wild-type exons of the dystrophin gene corresponding to one or more deleted or mutated exons, wherein one of the deleted or mutated exons is exon 52.

Images