Globo-series single-domain antibodies that specifically bind glycans.

Abstract

The present invention relates to the field of single domain antibodies (sdAbs) directed against globo series glycans, in particular globo H. More specifically, the present invention relates to sdAbs that specifically bind one or more glycans selected from globo H, Gb3, Gb4, and Gb5. The present invention also provides polypeptides comprising multimeric single domain antibodies and T cell chimeric antigen receptors comprising said anti-glycan sdAbs. Accordingly, the present invention provides polypeptides that can be used to target and / or treat several types of cancer associated with cells overexpressing said globo H and / or Gb3, Gb4, or Gb5. The present invention also relates to recombinant nucleic acid sequences encoding said polypeptides, as well as expression vectors and host cells comprising the recombinant nucleic acid sequences encoding said polypeptides.

Description

Detailed description of the invention

[0001] [Field of Invention] The present invention relates to the field of single-domain antibodies (sdAbs) directed toward the globo series of glycans, particularly globoH. More specifically, the present invention relates to sdAbs that specifically bind one or more glycans selected from globoH, Gb3, Gb4, and Gb5. The present invention also provides polypeptides comprising multimeric single-domain antibodies, and T-cell chimeric antigen receptors comprising the anti-glycan sdAbs. Thus, the present invention provides polypeptides that can be used to target and / or treat several types of cancer associated with cells overexpressing globoH and / or Gb3, Gb4, Gb5. The present invention also relates to recombinant nucleic acid sequences encoding the polypeptides, as well as expression vectors and host cells comprising the recombinant nucleic acid sequences encoding the polypeptides.

[0002] [Background of the Invention] The Globo series of glycans comprises a group of neutral sphingoglycolipids in which ceramide is bound to a glycan having the basic structure of GalNAcβ3Galα4Galβ4Glc. Generally, these glycans are retained in the plasma membrane and cluster in lipid rafts. The endogenous function of this glycan family is largely unknown. However, their expression is thought to occur in the early stages of development and mediate cell contact and adhesion. Importantly, alterations in these glycans are observed throughout differentiation and during tumorigenesis. Two notable hexasaccharide members of this family are the time-specific embryonic antigen-4 (SSEA-4) and GloboH (Figure 2). These glycans share a common precursor, SSEA-3 (Galβ3GalNAcβ3Galα4Galβ4Glc), but differ in their terminal monosaccharides: SSEA-4 has β3-linked N-acetylneuraminic acid, while GloboH has α2-linked L-fucose.

[0003] SSEA-4 is expressed in many stem cell types, including induced pluripotent stem cells, embryonic cancer cells, breast cancer cells, and malignant glioma cells, which form the most aggressive and common brain tumors in adults. Consequently, antibodies against SSEA-4 may support the targeting of SSEA-4 in cancer vaccines.

[0004] GloboH is a hexasaccharide with the chemical formula Fucα1→2Galβ1→3GalNAcβ1→3Galα1→4Galβ1→4Glcβ1→O-Cer. GloboH expression has been observed in several epithelial cancers, such as endometrial cancer, colon cancer, ovarian cancer, gastric cancer, pancreatic cancer, lung cancer, prostate cancer, and breast cancer. In normal tissues, it is moderately present in the breast, colon, esophagus, small intestine, prostate, rectum, testes, and cervix, but is only present in apical epithelial cells at the luminal boundary. Wang et al. (PNAS, 2008) showed that both normal donors and breast cancer patients expressed high levels of antibodies against SSEA-3 using glycan arrays, but breast cancer patients expressed significantly higher levels of antibodies against GloboH than normal donors. Since the sites where either SSEA-3 or GloboH may be found in normal tissue are in areas that immune cells generally cannot access, both SSEA-3 and GloboH are attractive targets for cancer vaccines.

[0005] However, most carbohydrate antigens are often tolerated by the immune system, and as a result, the immunogenicity induced by carbohydrate antigens is limited. Furthermore, the production of antibodies against a particular immunogen generally involves cooperative interactions between two types of lymphocytes, namely B cells and helper T cells. Globo-H alone cannot activate helper T cells, which is also due to the low immunogenicity of Globo-H. Therefore, immunization with Globo-H alone often results in low titers of immunoglobulin M (IgM), failure of class switching to immunoglobulin G (IgG), and ineffective antibody affinity maturation. Recently, it has been demonstrated that antibodies against Globo-H, including class switching from IgM to IgG, can be induced by adding an appropriate adjuvant. Therefore, Globo-H is a promising therapeutic target for cancer vaccines. This approach has been tested in clinical trials at various stages for a range of cancers, including breast cancer, ovarian cancer, prostate cancer, and lung cancer.

[0006] The lack of single-domain antibody production in response to glycans is supported by previous studies showing that the anti-polysaccharide response in humans is clearly dominated by IgM and IgG1 types, while heavy-chain antibodies from camelids belong to the IgG2 and IgG3 classes (Daley et al., Clin Vaccine Immunol. 2010). Furthermore, it is known that the interaction between polysaccharides and individual binding sites in proteins is generally weak, and binding strength and specificity are enhanced by polymer interactions between polysaccharides and oligomeric polysaccharide-binding proteins. Since VHH is essentially a strictly monomeric binder, it is not well-suited for binding polysaccharides in this respect. Therefore, those skilled in the art would assume that it is very difficult to enhance light-chain-deficient immunoglobulins against globo-series glycans.

[0007] While conventional antibodies against GloboH have shown promise in the diagnosis and treatment of cancer (WO2015 / 143123A), there is still a need for superior anti-GloboH antibodies. For practical use, monoclonal antibodies, and preferably single-domain antibodies, are required. Single-domain antibodies (sdAb or VHH) that specifically bind globo-series sphingoglycolipids, such as GloboH or fragments of GloboH, have been attempted to be produced, but none have been disclosed in the art to date.

[0008] Patent application WO2015 / 143123A discloses conventional anti-GloboH antibodies for preventing or treating GloboH-positive cancer, and pharmaceutical compositions comprising these antibodies. However, these antibodies have CDR sequences that can give them chemical instability, which makes them undesirable for further production scale-up and clinical research.

[0009] International patent application WO2018 / 054353A discloses a therapeutic human conventional monoclonal antibody having a CDR sequence designed to conjugate GloboH and enhance stability against undesirable modifications and large aggregate formation that may occur under high-expression manufacturing conditions.

[0010] In contrast to conventional mammalian IgG antibodies, sdAbs contain only a heavy chain and lack a light chain. The antigen-binding domain of a single-domain antibody is called a VHH or Nanobody (registered trademark). VHHs have several general advantages over conventional antibodies. Firstly, they are only 13-15 kDa in size, about one-tenth the size of conventional IgG antibodies (150 kDa). They can approach epitopes better, even in crowded cellular environments, and penetrate tissues, organs, and animals better.

[0011] They have much higher chemical (e.g., up to 8 M urea) and thermal stability (up to 83 °C), and longer shelf lives compared to conventional antibodies. It is therefore an object of the present invention to provide single-domain antibodies that specifically bind to Globo H and globo-series glycans such as Gb3 (globotriaose), Gb4 (globotetraose), and Gb5 (globopentaose Gb5).

[0012] This object is solved by the teachings of the independent claims. Further advantageous features, aspects, and details of the invention are apparent from the dependent claims, the specification, the drawings, and the examples of the present application.

[0013] [Brief Description of the Invention] The present application is directed to a polypeptide that specifically binds to a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that is naturally lacking in a light chain and a constant region 1, or a variant of the variable domain, and wherein the at least one single-domain antibody binds to at least one globo-series glycan selected from Globo H, Gb3, Gb4, and Gb5.

[0014] In some embodiments, the polypeptide that specifically conjugates the globo-series glycan comprises at least one single-domain antibody having at least 90% sequence identity with a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:136, SEQ ID NO:137, and SEQ ID NO:138, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5. In certain embodiments, a polypeptide that specifically conjugates a globo-series glycan comprises at least one single-domain antibody, the at least one single-domain antibody selected from GloboH, Gb3, Gb4, and Gb5, and conjugates at least one globo-series glycan having at least 90% sequence identity with SEQ ID NO5.

[0015] In a particular embodiment, the polypeptide that specifically conjugates the globo-series glycan comprises at least one single-domain antibody as disclosed herein, and at least one effector molecule conjugated to the at least one single-domain antibody, wherein the effector molecule is selected from the group consisting of anti-cancer peptides, cell-lytic peptides, L-rhamnose, galactose-α-1,3-galactose, dinitrophenyl, serum-stabilizing molecules, fluorescent molecules, phosphorescent molecules, chemiluminescent molecules, bioluminescent molecules, radioisotopes, chromophores, disuccinimidyl adipate, and human Fc antibody fragments. In a more specific embodiment, the polypeptide that specifically conjugates the globo-series glycan comprises at least one single-domain antibody, wherein the at least one single-domain antibody conjugates at least one globo-series glycan selected from globo-H, Gb3, Gb4, and Gb5, and at least one lytic peptide selected from the group consisting of modified cysteine-deficient tachypressin-I, BMAP28A, and Polyvia-MP1. In a more specific embodiment, a polypeptide that specifically binds a globo-series glycan, comprising at least one single-domain antibody and further comprising at least one soluble peptide linked to at least one single-domain antibody, has at least 85% sequence identity with a sequence selected from SEQ ID NO: 19-63, 142-156, 179-226.

[0016] The present invention also relates to polypeptides that specifically conjugate globo-series glycans, comprising at least one single-domain antibody disclosed herein, wherein the single-domain antibody conjugates at least one globo-series glycan selected from globoH, Gb3, Gb4, and Gb5, and further comprises at least one extracellular hinge region, at least one transmembrane domain, at least one costimulatory domain, and at least one intracellular activation domain, wherein the single-domain antibody is ligated to the extracellular hinge region. The extracellular hinge region, transmembrane domain, costimulatory domain, and intracellular activation domain represent modules or elements of a T cell chimeric antigen receptor (CAR). The chimeric antigen receptors disclosed herein can be used to generate CAR T cells that specifically recognize globo-series glycans selected from globoH, Gb3, Gb4, and Gb5. Therefore, the CAR T cells can be used in the treatment of cancer, wherein the cancer cells express at least one globoseries glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells.

[0017] The present invention also provides a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the at least one single-domain antibody is a humanized single-domain antibody, and wherein the at least one single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5. Furthermore, the present invention provides a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the at least one single-domain antibody is a humanized single-domain antibody, and further comprises at least one effector molecule linked to the at least one humanized single-domain antibody, wherein the at least one humanized single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5. In accordance with the present invention, at least one single-domain antibody is humanized by substituting one or more amino acid residues located at positions 1, 5, 11, 28, and 30 of FR1, positions 44 and 45 of FR2, positions 74, 75, 76, 83, 84, 93, and 94 of FR3, and positions 104 and 108 of FR4, according to Kabat numbering.

[0018] The present invention also provides recombinant nucleic acid molecules encoding the polypeptide of the present invention, and vectors containing the recombinant nucleic acid molecules. Host cells containing the recombinant nucleic acid molecules or vectors of the present invention are also provided herein.

[0019] Furthermore, the present invention also relates to a pharmaceutical composition comprising a therapeutically effective amount of the polypeptide of the present invention that specifically conjugates a globo-series glycan, together with at least one pharmaceutically acceptable vehicle, excipients and / or diluents, and at least one single-domain antibody.

[0020] The present invention also provides the use of the polypeptide of the present invention in the treatment and / or diagnosis of cancer, or the use of a pharmaceutical composition according to the present invention, wherein the cancer cells of the cancer express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells. In other words, the present invention provides the use of the polypeptide of the present invention in the treatment and / or diagnosis of cancer, or the use of a pharmaceutical composition according to the present invention, wherein the cancer is characterized by cells expressing at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells.

[0021] The present invention also provides the use of polypeptides of the present invention in the treatment and / or diagnosis of cancer, or the use of pharmaceutical compositions according to the present invention, wherein the cancer cells of the cancer express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, wherein the cancer is selected from brain cancer, liver cancer, cholangiocarcinoma, kidney cancer, breast cancer, prostate cancer, lung cancer, small cell lung cancer, ovarian cancer, cervical cancer, esophageal cancer, gastric cancer, pancreatic cancer, and colorectal cancer.

[0022] The present invention also provides a diagnostic kit comprising a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the at least one single-domain antibody conjugates at least one globo-series glycan selected from globoH, Gb3, Gb4, and Gb5 for screening cancer characterized by cells expressing at least one globo-series glycan selected from globoH, Gb3, Gb4, and Gb5 on the surface of the cells.

[0023] Further embodiments of the present invention provide polypeptides as described above, wherein the number of single-domain antibodies conjugated to at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 is at least two. The two or more single-domain antibodies may have different or identical sequences.

[0024] A particular embodiment of the present invention provides a polypeptide as described above, wherein the number of single-domain antibodies conjugating at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 is 3, wherein the single-domain antibody has at least 90% sequence identity with SEQ ID NO: 5.

[0025] [Detailed description of the invention] definition Tumor-associated antigens (TACAs) and types Cancer cells can be distinguished from normal cells by exhibiting abnormal levels and types of carbohydrate structures on their surface. These carbohydrate structures are known as tumor-associated carbohydrate antigens (TACAs). TACAs have been considered promising targets for the design of anti-cancer vaccines. Unfortunately, carbohydrates alone can only induce low immunogenicity because they cannot induce the T-cell-dependent immune response crucial for cancer treatment.

[0026] Sphingoglycolipids (GSLs) represent a group of complex lipids consisting of a glycan structure attached to a lipid tail containing a sphingolipid ceramide. The basic structure of sphingoglycolipids is a monosaccharide, commonly glucose or galactose, which directly binds to the ceramide molecule, resulting in glucosylceramide (glucocerebroside; GlcCer) or galactosylceramide (galactocerebroside; GalCer), respectively. GSLs are ubiquitous in the cell membrane, where they are known to be involved in various functions among other cellular processes such as signaling, adhesion, and cell differentiation. Certain sphingoglycolipids highly expressed in tumor cells or tissues are defined by specific monoclonal antibodies, thereby being identified as tumor-associated carbohydrate antigens (TACAs) due to abnormal GSL synthesis in tumors. Tumor cells express abnormal glycosylation in GSLs, exhibiting either incomplete synthesis leading to precursor accumulation or further addition of glycan residues to form new structures.

[0027] Globotriosylceramide (Gb3Cer) and globoside (Gb4Cer) form the basis of the P blood group system, while galactosylgloboside (Gb5Cer) and sialylgalactosylgloboside (sialylGb5Cer), also known as stage-specific embryonic antigen-3 (SSEA-3) and SSEA-4, respectively, are widely used as cell surface markers to define human embryonic stem cells.

[0028] The Globo-series GSL has also been observed in tumors: Globo-H (fucosyl Gb5Cer) is overexpressed in many epithelial cancers, such as endometrial cancer, colon cancer, ovarian cancer, gastric cancer, pancreatic cancer, lung cancer, prostate cancer, and breast cancer.

[0029] As used herein, "GloboH" refers to the hexasaccharide of the formula Fucα1→2Galβ1→3GalNAcβ1→3Galα1→4Galβ1→4Glcβ1→O-cer, and its structure:

[0030] [ka] It has.

[0031] "GloboH-positive cancer" refers to cancers that include cancer cells that express GloboH on their cell surface. The study also reported the presence of cleavage forms or fragments of GloboH on the surface of cancer cells. These cleavage forms are Gb3 (globotriaose), Gb4 (globotetraose), and Gb5 (globopentaose) (Figure 2).

[0032] Antibodies (Abs) and immunoglobulins (Igs) are glycoproteins with the same structural characteristics. Antibodies exhibit binding specificity to a particular antigen, while immunoglobulins include both antibodies and other antibody-like molecules that generally lack antigen specificity. The terms "antibody" and "immunoglobulin" are used interchangeably in their broadest sense and include monoclonal antibodies (e.g., full-length or intact monoclonal antibodies), polyclonal antibodies, human antibodies, multispecific (or heteroconjugate) antibodies (e.g., bispecific antibodies), monovalent antibodies, multivalent antibodies, antigen-binding antibody fragments (e.g., Fab', F(ab')2, Fab, Fv, rIgG, scFv fragments, sdAbs, VHH), antibody fusions, and synthetic antibodies (or antibody mimics). Antibodies can be chimeric antibodies, human antibodies, humanized antibodies, and / or affinity-matured antibodies.

[0033] As used herein, the term “antigen” is defined as any substance that can induce an immune response. As used herein, the term “immunogenicity” refers to the ability of an immunogen, antigen, or vaccine to stimulate an immune response.

[0034] As used herein, the term “epitope” is defined as the portion of an antigen molecule that comes into contact with the antigen-binding site of an antibody or a T cell receptor. As used herein, the terms “specific binding” or “specifically binding” or “binds specifically” refer to the interaction between binding pairs (e.g., an antibody and an antigen). In various examples, specific binding occurs at approximately 10 -6 moles / liter, approximately 10 -7 moles / liter, or about 10 -8 It can be embodied by an affinity constant of moles / liter or less.

[0035] "Binding affinity" generally refers to the sum of the non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless otherwise indicated, as used herein, "binding affinity" refers to the intrinsic binding affinity that reflects the 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen). The affinity of molecule X for its partner Y can generally be expressed by a dissociation constant (Kd). Low-affinity antibodies generally tend to bind to antigens slowly and dissociate easily, while high-affinity antibodies generally tend to bind to antigens more quickly and remain bound for longer. Various methods for measuring binding affinity are known in the art, and any of them can be used for the purposes of the present invention. Specific exemplary embodiments are described below.

[0036] The "functional antigen-binding site" of an antibody is the site that can bind to a target antigen. The antigen-binding affinity of the antigen-binding site does not need to be as potent as that of the parent antibody from which the antigen-binding site is obtained, but the ability to bind to the antigen must be measurable using one of the various known methods for evaluating antibody binding to the antigen.

[0037] As used herein, the term “vector” is intended to refer to a nucleic acid molecule capable of transporting other nucleic acids to a nucleic acid molecule to which a vector is ligated. One type of vector is a “plasmid,” which refers to a circular double-stranded DNA loop to which an additional DNA fragment can be ligated. Another type of vector is a phage vector. Another type of vector is a viral vector, where an additional DNA fragment can be bound to a viral genome. Certain types of vectors can self-replicate in the host cell to which they are introduced. Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the host cell's genome upon introduction into the host cell, thereby replicating with the host genome. Furthermore, certain types of vectors can direct gene expression in the gene to which the vector is operably ligated. Such vectors are referred herein as “recombinant expression vectors” (or simply “expression vectors” or “recombinant vectors”). Generally, expression vectors useful in recombinant DNA technology are often in the form of plasmids. In this specification, since plasmids are the most commonly used form of vector, “plasmid” and “vector” may be used interchangeably.

[0038] In this specification, "recombinant polynucleotide" or "recombinant nucleic acid molecule" as interchangeable refers to a polymer of nucleotides of any length, including DNA and RNA. The nucleotides may be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or analogs thereof, or any substrate that can be incorporated into the polymer by DNA polymerase or RNA polymerase, or by a synthetic reaction. The polynucleotide may include modified nucleotides, such as methylated nucleotides and analogs of methylated nucleotides. If present, modifications to the nucleotide structure may be added before or after the assembly of the polymer. The nucleotide sequence may be hindered by non-nucleotide components. The polynucleotide may be further modified after synthesis, for example, by binding with a label. Other types of modifications include, for example, "caps," substitutions with one or more naturally occurring nucleotide analogs, internucleotide modifications, such as those having uncharged bonds (e.g., methylphosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and charged bonds (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant portions such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, ply-L-lysine, etc.), those containing intercalators (e.g., acridine, psoralens, etc.), those containing chelating agents (e.g., metals, radioactive metals, boron, metal oxides, etc.), those containing alkylating agents, those having modified bonds (e.g., alpha-anomeric nucleic acids, etc.), and unmodified forms of polynucleotides. Furthermore, any of the hydroxyl groups normally present on the sugar may be replaced with, for example, a phosphonic acid group, a phosphate group, or protected with a standard protecting group, or activated to prepare additional binding to additional nucleotides, or bonded to a solid or semi-solid support. The 5' and 3' terminal OH groups can be phosphorylated or substituted with an amine or an organic capping group moiety of 1 to 20 carbon atoms.Other hydroxyls may also be derivatized to standard protecting groups.

[0039] As used herein, “oligonucleotides” generally refer to synthetic polynucleotides that are short, typically less than approximately 200 nucleotides in length, and generally single-stranded, although this is not always the case. The terms “oligonucleotide” and “polynucleotide” are not mutually exclusive. The above description of polynucleotides is equally and fully applicable to oligonucleotides.

[0040] A "globo-series glycan-binding single-domain antibody (sdAb)" or "sdAb conjugating a globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5" refers to an sdAb that conjugates a globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 globo, which has sufficient affinity to be useful as a diagnostic and / or therapeutic agent by conjugating the target glycan. A "globoH-binding single-domain antibody (sdAb)" or "sdAb conjugating GloboH" refers to an sdAb that conjugates GloboH, which has sufficient affinity to be useful as a diagnostic and / or therapeutic agent by conjugating GloboH. A "Gb3-binding single-domain antibody (sdAb)" or "sdAb that binds Gb3" refers to an sdAb that binds Gb3 with sufficient affinity so that it can be useful as a diagnostic and / or therapeutic agent by binding Gb3. A "Gb4-binding single-domain antibody (sdAb)" or "sdAb that binds Gb4" refers to an sdAb that binds Gb4 with sufficient affinity so that it can be useful as a diagnostic and / or therapeutic agent by binding Gb4. A "Gb5-binding single-domain antibody (sdAb)" or "sdAb that binds Gb5" refers to an sdAb that binds Gb5 with sufficient affinity so that it can be useful as a diagnostic and / or therapeutic agent by binding Gb5.

[0041] The terms "full-length antibody," "intact antibody," or "whole antibody" are used interchangeably herein to refer to antibodies having a structure substantially similar to that of a naturally occurring antibody.

[0042] An "antibody fragment" refers to a portion of a full-length antibody that can bind the same antigen as a full-length antibody. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', F(ab')2; bispecific antibodies; linear antibodies; single-chain antibody molecules (e.g., scFv); single-domain antibodies; and multispecific antibodies formed from antibody fragments.

[0043] The “variable region” or “variable domain” of an antibody refers to the amino-terminal domain of the antibody’s heavy or light chain. The variable domains of the heavy and light chains (VH and VL, respectively) of natural antibodies generally have similar structures. A single VH or VL domain may be sufficient to confer antigen-binding specificity. In particular, the “variable region” or “variable domain” of single-domain antibodies disclosed herein refers to the amino-terminal domain of the heavy chain.

[0044] The term "variable" refers to the fact that certain portions of the variable domain differ widely in sequence among antibodies, and are used in the binding and specificity of each particular antibody for a particular antigen. However, variability is concentrated in three portions called complementarity-determining regions (CDRs) or hypervariable regions (HVRs) in the variable domains of both the light and heavy chains. The more highly conserved portions of the variable domain are called framework regions (FRs). The variable domains of the natural heavy and light chains each contain four FR regions, primarily employing a beta-sheet structure, connected by three CDRs, which form loop connections and, in some cases, form part of the beta-sheet structure. The CDRs in each chain, by the FR regions, bind in close proximity to CDRs from other chains, contributing to the formation of the antigen-binding site of the antibody (Kabat et al., Sequences of Proteins of Immunological Interest, 5th edition, National Institutes of Health, Bethesda, Maryland (1991)). The constant domain is not directly involved in antibody binding to antigens, but it exhibits various effector functions, such as the involvement of antibodies in antibody-dependent cytotoxicity.

[0045] As used herein, “hypervariable region” or “HVR” refers to each region in an antibody variable domain that is hypervariable in sequence and / or forms a structurally defined loop. Generally, a native antibody contains four chains with six HVRs, three of which are located in the heavy chain variable domain, VH(H1, H2, H3), and three in the light chain variable domain, VL(L1, L2, L3). A single-domain antibody contains only three HVRs in the heavy chain variable domain. HVRs consist of amino acid residues from the hypervariable loop and / or from the “complementarity-determining region” (CDR). Unless otherwise indicated, HVR residues and other residues (e.g., FR residues) in the variable domain are numbered herein according to Kabat et al., 1991.

[0046] As used herein, “complementarity-determining region” or “CDR” refers to a region within the hypervariable region of a variable domain that has the highest sequence variability and / or is involved in antigen recognition. Generally, natural antibodies consist of four chains with six CDRs, three of which are located in the heavy chain variable domain, VH(H1, H2, H3), and three in the light chain variable domain, VL(L1, L2, L3). Exemplary CDRs (CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3) are located at amino acid residues 24-34 of L1, 50-56 of L2, 89-97 of L3, 31-35 of H1, 50-65 of H2, and 95-102 of H3 (Kabat et al., 1991). For example, single-domain antibodies such as those disclosed herein lack a light chain and therefore consist only of CDR-H1 or CDR1, CDR-H2 or CDR2, and CDR-H3 or CDR3.

[0047] "Natural antibodies" refer to naturally occurring immunoglobulin molecules. For example, a natural IgG antibody is a heterotetrameric glycoprotein of approximately 150 daltons, composed of two identical disulfide-linked light chains and two identical heavy chains. From the N-terminus to the C-terminus, each heavy chain has a variable region (VH), also called a variable heavy chain domain or heavy chain variable domain, followed by three constant domains (CH1, CH2, and CH3). Similarly, from the N-terminus to the C-terminus, each light chain has a variable region (VL), also called a variable light chain domain or light chain variable domain, followed by a constant light chain (CL) domain. Based on the amino acid sequence of the constant domain, the light chains of an antibody may be assigned to one of two types called kappa (κ) or lambda (λ).

[0048] As used herein, “monoclonal antibody” refers to an antibody obtained from a substantially homogeneous population of antibodies; that is, the individual antibodies within the population are identical and / or conjugate the same epitopes, except for possible mutant antibodies (e.g., mutant antibodies containing mutations that occur spontaneously or during the production of monoclonal antibodies and are generally present in small amounts). In contrast to polyclonal antibody preparations, which generally contain different antibodies directed against different determinants (epitopes), each monoclonal antibody in a monoclonal antibody preparation is directed against a single determinant in the antigen. Therefore, the term “monoclonal” describes an antibody obtained from a substantially homogeneous population of antibodies and should not be interpreted as requiring antibody production by any particular method.

[0049] A "chimeric antibody" refers to an antibody in which part of the heavy chain and / or light chain originates from a specific source or species, while the remainder of the heavy chain and / or light chain originates from a different source or species.

[0050] A "humanized antibody" refers to a chimeric antibody containing an amino acid sequence from a non-human HVR and an amino acid sequence from a human FR. In one embodiment, the humanized antibody substantially comprises a single-domain antibody, where all or substantially all CDRs correspond to those of a non-human antibody, and all or substantially all FRs correspond to those of a human antibody. The humanized antibody may optionally contain at least a portion of the antibody constant region derived from a human antibody. The "humanized form" of an antibody, e.g., a non-human antibody, refers to an antibody that has undergone humanization.

[0051] "Human antibodies" refer to antibodies that are produced by humans or human cells, or that have an amino acid sequence corresponding to the amino acid sequence of an antibody derived from a non-human source that utilizes a sequence encoding the human antibody repertoire or other human antibodies. This definition of human antibodies specifically excludes humanized antibodies that contain non-human antigen-binding residues.

[0052] The "Human Consensus Framework" is a framework that represents the most commonly present amino acid residues in the selection of human immunoglobulin VL or VH framework sequences. Generally, the selection of human immunoglobulin VL or VH sequences is from subgroups of variable domain sequences. Generally, these subgroups in sequences are those described in Kabat et al., 1991.

[0053] As used herein, "polyvalent antibody" refers to an antibody containing three or more antigen-binding sites. The polyvalent antibody is preferably engineered to have three or more antigen-binding sites and is generally not a naturally occurring IgM or IgA antibody.

[0054] A "polyspecific antibody" is an antibody that has at least two different binding sites, each site having a different binding specificity. A polyspecific antibody can be a full-length antibody or an antibody fragment, and each different binding site can bind to a different antigen, or each different binding site can bind to two different epitopes of the same antigen.

[0055] The term "Fc region" or "Fc antibody fragment" refers to a dimeric complex containing the C-terminal polypeptide sequence of an immunoglobulin heavy chain, where the C-terminal polypeptide sequence is obtained by papain digestion of an intact antibody. The Fc region may contain native or mutant Fc sequences.

[0056] A "Fab fragment" refers to an antibody fragment containing the variable and constant domains of the light chain, as well as the variable and primary constant domains (CH1) of the heavy chain. Papain digestion of the antibody produces two identical "Fab" fragments, each with a single antigen-binding site, and a residual "Fc" fragment, the name of which reflects its ability to readily crystallize. Pepsin treatment produces an F(ab')2 fragment, which has two antigen-binding sites and still possesses the ability to crosslink antigens. The Fab' fragment is distinguished from the Fab fragment by the addition of a few residues at the carboxyl terminus of the heavy chain CH1 domain, which contains one or more cysteines from the antibody hinge region. The F(ab')2 antibody fragment was originally produced as a pair of Fab' fragments, with a hinge cysteine ​​between them. Other chemical bindings of antibody fragments are also known in the art.

[0057] The "Fv fragment" refers to an antibody fragment containing the complete antigen recognition and binding site. This region consists of a dimer of one tightly associated heavy-chain variable domain and one light-chain variable domain, which can spontaneously covalently bind in, for example, scFv. In this configuration, the region is characterized by the interaction of the three HVRs in each variable domain to define the antigen-binding site on the surface of the VH-VL dimer. In summary, six HVRs or a subset thereof confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of an Fv containing only three antigen-specific HVRs) has the ability to recognize and bind to an antigen, although generally with lower affinity than the entire binding site.

[0058] A "single-chain Fv" or "scFv" refers to an antibody fragment containing the VH and VL domains of an antibody, where these domains are present on a single polypeptide chain. Generally, Fv polypeptides further contain a polypeptide linker between the VH and VL domains, which allows the scFv to form a desired antigen-binding structure.

[0059] A "bispecific antibody" refers to a small antibody fragment having two antigen-binding sites. This fragment contains a heavy-chain variable domain (VH) bound to a light-chain variable domain (VL) on the same polypeptide chain (VH and VL). By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with a complementary domain on the other chain, creating two antigen-binding sites.

[0060] A "naked antibody" refers to an antibody that is not bound to a heterogeneous portion (e.g., a cytotoxic portion) or a radioactive label. "Isolated" antibodies are those identified, separated, and / or recovered from components of the natural environment. These natural environment contaminants may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes that would interfere with the research, diagnostic, or therapeutic use of the antibody. Typically, isolated antibodies will be prepared by at least one purification step.

[0061] As used herein, the terms “substantially similar,” “substantially identical,” “equivalent,” or “substantially equivalent” refer to a sufficiently high degree of similarity between two numerical values ​​(e.g., one numerical value relating to a test antibody and the other to a reference antibody), for example, a person skilled in the art would consider the difference between the two values ​​to be of little or no biological and / or statistical significance in relation to the biological feature measured by the said value (e.g., Kd value). The difference between the two values ​​is, for example, less than about 50%, less than about 40%, less than about 30%, less than about 20%, and / or less than about 10% as a function of the value of the reference / comparator numerator.

[0062] As used herein, “substantially different” means a sufficiently high degree of difference between two numerical values ​​(generally one numerical value relating to the molecule and the other to a reference molecule), for example, a person skilled in the art would consider the difference between the two values ​​to be statistically significant in relation to the biological feature measured by the said value (e.g., the Kd value). The difference between the two values ​​is, for example, greater than about 10%, greater than about 20%, greater than about 30%, greater than about 40%, and / or greater than about 50% as a function of the value of the reference / comparison molecule.

[0063] The present invention is directed to a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5.

[0064] Another embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the at least one single-domain antibody has at least 90% sequence identity with a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:136, SEQ ID NO:137, and SEQ ID NO:138 (Table 4). A preferred embodiment is a polypeptide that specifically conjugates a globo-series glycan, comprising at least one single-domain antibody, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and wherein the at least one single-domain antibody has at least 90% sequence identity with SEQ ID NO: 5 (Table 4). A preferred embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan, comprising at least one single-domain antibody, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and wherein the at least one single-domain antibody has at least 90% sequence identity with SEQ ID NO: 1. Another embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the at least one single-domain antibody has at least 90% sequence identity with SEQ ID NO:3.Another embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and wherein the at least one single-domain antibody has at least 90% sequence identity with SEQ ID NO:7. Another embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and wherein the at least one single-domain antibody has at least 90% sequence identity with SEQ ID NO:9. Another embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and wherein the at least one single-domain antibody has at least 90% sequence identity with SEQ ID NO:11. Another embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and wherein the at least one single-domain antibody has at least 90% sequence identity with SEQ ID NO:13.Another embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and wherein the at least one single-domain antibody has at least 90% sequence identity with SEQ ID NO:15. Another embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and wherein the at least one single-domain antibody has at least 90% sequence identity with SEQ ID NO:17. A further embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the at least one single-domain antibody has at least 90% sequence identity with SEQ ID NO:136. A further embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the at least one single-domain antibody has at least 90% sequence identity with SEQ ID NO:137.Further embodiments of the present invention are polypeptides that specifically conjugate globo-series glycans comprising at least one single-domain antibody, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the at least one single-domain antibody has at least 90% sequence identity with SEQ ID NO:138. The sequences SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:136, SEQ ID NO:137, and SEQ ID NO:138 (sdAb or VHH) are derived from heavy chain antibodies of alpacas (vicugna pacos) immunized against Globo H glycan.

[0065] The present invention also relates to recombinant nucleic acid molecules capable of encoding the polypeptide, as well as vectors and host cells containing the recombinant nucleic acid molecules. A single-domain antibody is an antibody whose complementarity-determining region is part of a single-domain polypeptide. Single-domain antibodies are disclosed, for example, in WO1994004678A1. For clear reasons, variable domains derived from naturally light-chain-deficient heavy-chain antibodies are referred to herein as VHH or sdAb (single-domain antibodies) to distinguish them from conventional VH of quadruple-chain immunoglobulins. Such VHH molecules may be derived from antibodies produced in camelid species, such as camels, dromedaries, llamas, alpacas, and guanacos. Non-camelid species may produce heavy-chain antibodies that naturally lack light chains.

[0066] According to one aspect of the present invention, the single-domain antibody used herein is a naturally occurring single-domain antibody known as a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain.

[0067] sdAb is approximately 13-15 kDa, making it roughly one-tenth the size of an IgG molecule. sdAb is a single polypeptide and is highly stable both during storage and use, meaning that the integrity of the antigen-binding protein is maintained under storage and / or use conditions that may include heating, freeze-thaw cycles, pH changes, or ionic intensity, UV irradiation, hazardous chemicals, and similar substances. Furthermore, sdAb is resistant to protease action and does not conform to conventional antibodies. Moreover, the single-domain antibody according to the present invention is readily produced in high yield in vitro, folds appropriately, and is functional. Furthermore, antibodies produced in alpacas, or more generally in camelids, will recognize epitopes other than those recognized by antibodies produced in vitro, either through the use of antibody libraries or by immunization of non-camelid mammals (WO2005044858A1). As a result, sdAbs against GloboH, Gb3, Gb4, or Gb5 may interact with the target antigen more efficiently than conventional antibodies, thereby enabling the detection or treatment of cancers characterized by cells expressing GloboH, Gb3, Gb4, or Gb5 with much higher efficiency. Since sdAbs are known to bind to abnormal epitopes such as lumens and grooves (WO 2005044858A1), the affinity of these antibodies may be suitable for therapeutic use.

[0068] Therefore, generally speaking, a single-domain antibody can be defined as an amino acid sequence having a (common) structure.

[0069] [ka]

[0070] Here, FR1 to FR4 refer to framework domain 1 to framework domain 4, respectively, and CDR1 to CDR3 refer to complementarity determination domain 1 to complementarity determination domain 3, respectively.

[0071] Therefore, the "single-domain antibody" according to the present invention comprises an amino acid sequence including FR1-FR4 and CDR1-CDR3, or a variant sequence thereof, and the binding specificity of the single-domain antibody to globo-series sphingolipids is given by the amino acid sequences of the three complementarity-determining regions CDR1, CDR2, and CDR3.

[0072] The sequences of FR1-FR4 and CDR1-CDR3 of the single-domain antibodies disclosed in this invention are SEQ ID NO: 64-126 and 157-177, respectively. The annotations in the FR and CDR regions are based on a specific numbering system by Kabat.

[0073] Accordingly, one embodiment of the present invention is also directed to a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the single-domain antibody comprises complementarity-determining regions CDR1, CDR2, and CDR3, wherein: (a) CDR1 contains an amino acid sequence selected from SEQ ID NO: 64-72, 157-159, or their variants; (b) CDR2 contains an amino acid sequence selected from SEQ ID NO: 73-81, 160-162, or their variants; (c) CDR3 contains an amino acid sequence selected from SEQ ID NO: 82-90, 163-165, or their variants.

[0074] Another embodiment of the present invention is directed to a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the single-domain antibody comprises complementarity-determining regions CDR1, CDR2, and CDR3, wherein: (a) CDR1 comprises an amino acid sequence having at least 90% sequence identity with a sequence selected from SEQ ID NO: 64-72, 157-159; (b) CDR2 comprises an amino acid sequence having at least 90% sequence identity with a sequence selected from SEQ ID NO: 73-81, 160-162; (c) CDR3 contains an amino acid sequence that has at least 90% sequence identity with a sequence selected from SEQ ID NO: 82-90, 163-165.

[0075] GloboH is the primary target according to the present invention. A single-domain antibody against the target is 10 -6 This refers to a single-domain antibody that can bind to the target with an affinity exceeding M.

[0076] The target may also be a fragment of the primary target. Therefore, the target can be a fragment of the target and can induce an immune response. The target is a fragment of the target and can bind to a single-domain antibody produced against the full-length target. Preferred fragments of the primary target GloboH are Gb3, Gb4, and Gb5.

[0077] Binding of the single domain antibody to a sphingolipid selected from Globo H, Gb3, Gb4, and Gb5 preferably occurs with high affinity. Generally, the dissociation constant of the binding between the single domain antibody and the globo-series target glycan is less than 10 -5 M, more preferably, the dissociation constant is less than 10 -6 M, even more preferably, the dissociation constant is less than 10 -7 M, and most preferably, the dissociation constant is less than 10 -8 M. Alternatively, the dissociation constant of the binding between the single domain antibody and Globo H is less than 10 -5 M, more preferably, the dissociation constant is less than 10 -6 M, even more preferably, the dissociation constant is less than 10 -7 M, and most preferably, the dissociation constant is less than 10 -8 M. Alternatively, the dissociation constant of the binding between the single domain antibody and Gb3 is less than 10 -5 M, more preferably, the dissociation constant is less than 10 -6 M, even more preferably, the dissociation constant is less than 10 -7 M, and most preferably, the dissociation constant is less than 10 -8 M. Alternatively, the dissociation constant of the binding between the single domain antibody and Gb4 is less than 10 -5 M, more preferably, the dissociation constant is less than 10 -6 M, even more preferably, the dissociation constant is less than 10 -7 M, and most preferably, the dissociation constant is less than 10 -8 M. Alternatively, the dissociation constant of the binding between the single domain antibody and Gb5 is less than 10 -5 M, more preferably, the dissociation constant is less than 10 -6 M, even more preferably, the dissociation constant is less than 10 -7 M, and most preferably, the dissociation constant is less than 10 -8 M.

[0078] <7000313>"Variant sequence" According to one aspect of the present invention, a polypeptide that binds to a glycan selected from GloboH, Gb3, Gb4, and Gb5 may be a variant sequence of a full-length polypeptide that binds to a glycan selected from GloboH, Gb3, Gb4, and Gb5. According to one aspect of the present invention, a polypeptide that binds to a glycan selected from GloboH, Gb3, Gb4, and Gb5 may include a sequence of a full-length polypeptide that binds to a glycan selected from GloboH, Gb3, Gb4, and Gb5.

[0079] According to one aspect of the present invention, a single-domain antibody contained in a polypeptide that binds to a glycan selected from GloboH, Gb3, Gb4, and Gb5 may be a complete single-domain antibody (e.g., sdAb or VHH) or a variant sequence thereof.

[0080] As used herein, the variant sequences of the present invention may include the addition, deletion, or substitution of one or more amino acids, which does not substantially alter the functional characteristics of the polypeptide of the present invention compared to the unmodified parent polypeptide, also known as the reference polypeptide.

[0081] The morphogenetic sequence according to the present invention may be, for example, a sequence found in other camelid species such as camels, dromedary camels, llamas, alpacas, and guanacos. The number of amino acid deletions or substitutions in the mutant sequence compared to the parent sequence is preferably a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 amino acids.

[0082] When a mutant sequence exhibits sequence identity, it means a mutant sequence exhibiting high sequence identity with the parent sequence, such as more than 70%, 75%, 80%, 85%, 90%, 95%, or 98%, preferably characterized by similarity to the parent sequence, i.e., affinity, and said identity is calculated as described below.

[0083] The percentage of “sequence identity” is determined by comparing two optimally aligned nucleic acid or polypeptide sequences across a “comparison window” over the entire length of the reference sequence. As used herein, the “comparison window” refers to the optimal sequence between the reference sequence and the variant sequence after the two sequences have been optimally aligned, where the variant nucleic acid or polypeptide sequence within the comparison window may contain no more than 20 percent, typically 5–15 percent, or 10–12 percent of additions or deletions (i.e., gaps) compared to the reference sequence (the reference sequence being free of additions or deletions). The percentage of identity is obtained by determining the number of positions where identical nucleic acid bases or amino acid residues exist in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the reference sequence (i.e., the entire length of the amino acids or nucleotides), and multiplying the result by 100 to obtain the percentage of sequence identity. Two nucleic acid or polypeptide sequences are said to be “identical” if the sequences of nucleotides or amino acids in the two sequences are the same when optimally aligned as described above.

[0084] Alternatively, the mutant sequence is given by the following formula: Ser is replaced by Ser, Thr, Gly, and Asn; Arg is substituted by one of the following: Arg, His, Gin, Lys, and Glu; Leu can be replaced by any of the following: Leu, Ile, Phe, Tyr, Met, or Val; Pro is replaced by one of the following: Pro, Gly, Ala, and Thr; Thr is replaced by any of the following: Thr, Pro, Ser, Ala, Gly, His, and Gin; Ala can be replaced by one of the following: Ala, Gly, Thr, or Pro; Val can be replaced by any of the following: Val, Met, Tyr, Phe, Ile, and Leu; Gly can be replaced by one of the following: Gly, Ala, Thr, Pro, or Ser; Ile can be replaced by any of the following: Ile, Met, Tyr, Phe, Val, and Leu; Phe is replaced by one of the following: Phe, Trp, Met, Tyr, lie, Val, and Leu; Tyr can be replaced by any of the following: Tyr, Trp, Met, Phe, Ile, Val, and Leu; His is replaced by one of the following: His, Glu, Lys, Gin, Thr, and Arg; Gln is substituted by one of the following: Gin, Glu, Lys, Asn, His, Thr, and Arg; Asn can be replaced by any of the following: Asn, Glu, Asp, Gin, and Ser; Lys can be replaced by any of the following: Lys, Glu, Gln, His, and Arg; Asp can be replaced by one of Asp, Glu, or Asn; Glu is replaced by one of the following: Glu, Asp, Lys, Asn, Gln, His, and Arg; Met is replaced by one of the following: Met, Phe, Ile, Val, Leu, and Tyr. Accordingly, it can be any amino acid sequence resulting from any number of permitted substitutions in the parent sequence.

[0085] The variants used herein may also be sequences in which each framework region FR and each complementarity-determining region CDR exhibit at least 80% identity, preferably at least 85% identity, more preferably 90% identity, and even more preferably 95% identity with the corresponding region in the reference sequence. In this case, sequence identity is determined as described above for FR1 variant vs. FR1 reference, CDR1 variant vs. CDR1 reference, FR2 variant vs. FR2 reference, CDR2 variant vs. CDR2 reference, FR3 variant vs. FR3 reference, CDR3 variant vs. CDR3 reference, and FR4 variant vs. FR4 reference.

[0086] In other embodiments, recombinant nucleic acid sequences encoding any of the above-described antigen-binding proteins or their variants are also part of the present invention. The present invention provides recombinant nucleic acid molecules encoding one or more polypeptides comprising an amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:136, SEQ ID NO:137, and SEQ ID NO:138.

[0087] Accordingly, the present invention provides recombinant nucleic acid molecules containing one or more nucleic acid sequences described in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:139, SEQ ID NO:140, and SEQ ID NO:141 (Table 4), or variants thereof. The present invention provides recombinant nucleic acid molecules containing the nucleic acid sequence described in SEQ ID NO:2, or a variant thereof. The present invention provides recombinant nucleic acid molecules containing the nucleic acid sequence described in SEQ ID NO:4, or a variant thereof. The present invention provides recombinant nucleic acid molecules containing the nucleic acid sequence described in SEQ ID NO:6, or a variant thereof. The present invention provides recombinant nucleic acid molecules containing the nucleic acid sequence described in SEQ ID NO:8, or a variant thereof. The present invention provides recombinant nucleic acid molecules containing the nucleic acid sequence described in SEQ ID NO:10, or a variant thereof. The present invention provides recombinant nucleic acid molecules containing the nucleic acid sequence described in SEQ ID NO:12, or a variant thereof. The present invention provides a recombinant nucleic acid molecule comprising the nucleic acid sequence described in SEQ ID NO:14 or a variant thereof. The present invention provides a recombinant nucleic acid molecule comprising the nucleic acid sequence described in SEQ ID NO:16 or a variant thereof. The present invention provides a recombinant nucleic acid molecule comprising the nucleic acid sequence described in SEQ ID NO:18 or a variant thereof. The present invention provides a recombinant nucleic acid molecule comprising the nucleic acid sequence described in SEQ ID NO:139 or a variant thereof. The present invention provides a recombinant nucleic acid molecule comprising the nucleic acid sequence described in SEQ ID NO:140 or a variant thereof. The present invention provides a recombinant nucleic acid molecule comprising the nucleic acid sequence described in SEQ ID NO:141 or a variant thereof.

[0088] Furthermore, the present invention provides a host cell comprising one or more recombinant nucleic acid molecules or their variants as described in one or more of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:139, SEQ ID NO:140, and SEQ ID NO:141. In particular, the present invention provides a cell comprising one or more recombinant nucleic acid molecules as described in SEQ ID NO:6, or their variants.

[0089] In another embodiment, the present invention provides recombinant nucleic acid molecules and variants thereof that encode polypeptides that specifically bind to at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the variant recombinant nucleic acid molecules are SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:139, SEQ ID NO:140, and SEQ ID For any of NO:141, it shares at least 70%, at least 75%, at least 80%, at least 85%, at least 87%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity, and the percentage of sequence identity is determined as described above. These values ​​are not intended to be limiting, and increments between the listed percentages are specifically assumed as part of this disclosure. Specifically, the present invention provides recombinant nucleic acid molecules and variants thereof that encode polypeptides that specifically bind to at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the variant recombinant nucleic acid molecules share at least 80% sequence identity with any of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:139, SEQ ID NO:140, and SEQ ID NO:141.More specifically, the present invention provides recombinant nucleic acid molecules and variants thereof that encode polypeptides that specifically bind to at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the variant recombinant nucleic acid molecules share at least 85% sequence identity with any of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:139, SEQ ID NO:140, and SEQ ID NO:141. More specifically, the present invention provides recombinant nucleic acid molecules and variants thereof that encode polypeptides that specifically bind to at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the variant recombinant nucleic acid molecules share at least 90% sequence identity with any of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:139, SEQ ID NO:140, and SEQ ID NO:141. More specifically, the present invention provides recombinant nucleic acid molecules and variants thereof that encode polypeptides that specifically bind to at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the variant recombinant nucleic acid molecules share at least 95% sequence identity with any of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:139, SEQ ID NO:140, and SEQ ID NO:141.More specifically, the present invention provides recombinant nucleic acid molecules and variants thereof that encode polypeptides that specifically bind to at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the variant recombinant nucleic acid molecules share at least 98% sequence identity with any of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:139, SEQ ID NO:140, and SEQ ID NO:141.

[0090] Polynucleotides or nucleic acid molecules complementary to any such sequence are also included in this disclosure. Nucleic acid molecules may be single-stranded (coding or antisense) or double-stranded, and may be DNA (genomic, cDNA, or synthetic) or RNA molecules. RNA molecules include HnRNA molecules containing introns and corresponding to DNA molecules in a one-to-one manner, and mRNA molecules without introns. Additional coding or non-coding sequences may, but are not required, be present within the polynucleotides of this disclosure, and polynucleotides may, but are not required, be ligated to other molecules and / or supporting materials.

[0091] Nucleic acid molecules may contain natural sequences (i.e., endogenous sequences encoding an antibody or a portion of an antibody) or variants of such sequences. Nucleic acid variants include one or more substitutions, additions, deletions, and / or insertions such that the immunoreactivity of an encoded polypeptide that specifically binds to at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 is substantially the same as that of a reference native immunoreactive polypeptide. The effect of the encoded polypeptide on immunoreactivity can generally be evaluated as described herein. In some embodiments, the nucleic acid variant exhibits at least about 70% identity with respect to a reference native single-domain antibody or a portion thereof, at least about 80% identity in some embodiments, at least about 85% identity in some embodiments, at least about 90% identity in some embodiments, and at least about 95% identity in some embodiments, where the percentage of sequence identity is determined as described above. These values ​​are not intended to be limiting, and increments between the enumerated percentages are specifically assumed as part of this disclosure.

[0092] Recombinant nucleic acid molecules in this disclosure can be obtained using chemical synthesis, recombination methods, or polymerase chain reaction (PCR). Methods for chemical polynucleotide synthesis are well known in the art and do not need to be described in detail herein. Those skilled in the art can use the sequences provided herein and commercially available DNA synthesizers to generate the desired DNA sequences. To prepare polynucleotides using recombination methods, polynucleotides containing the desired sequences can be inserted into a suitable vector, and the vector can then be introduced into a suitable host cell for replication and amplification, as further described herein. Polynucleotides may be inserted into host cells by any means known in the art. Cells are transformed by direct uptake and introduction of exogenous polynucleotides by endocytosis, transfection, mating, or electroporation. Once introduced, the exogenous polynucleotides can be maintained in the cell as a non-integrated vector (e.g., plasmid) or integrated into the host cell genome. The thus amplified polynucleotides can be isolated from host cells by methods well known in the art.

[0093] Appropriate cloning and expression vectors may contain various components, such as promoters, enhancers, and other transcriptional regulatory sequences. Vectors may be constructed to allow subsequent cloning of antibody-variable domains into different vectors. Appropriate cloning vectors may be constructed according to standard techniques or selected from a large number of cloning vectors available in the art. The selected cloning vector may differ depending on the host cell intended for use, but useful cloning vectors generally possess the ability to self-replicate, may have a single target for a specific restriction endonuclease, and / or may contain genes for markers that can be used to select clones containing the vector. Appropriate examples include plasmids and bacterial viruses, e.g., pUC18, pUC19, Bluescript (e.g., pBS SK) + These include , mp18, mp19, pBR322, pMB9, ColE1, pCR1, RP4, phage DNA, and shuttle vectors, such as pSA3 and pAT28. These, and many other cloning vectors, are available from commercial vendors such as Merck, BioRad, Stratagene, and Invitrogen.

[0094] Furthermore, the present invention also envisions an expression vector comprising a nucleic acid sequence encoding one of the single-domain antibodies or their variants disclosed herein, and a host cell containing such expression vector. It implies that the expression vector must be replicable in the host cell, either as an episome or as an integral part of chromosomal DNA. The vector components may, but are not limited to, include one or more of the following: a single sequence, an origin of replication, one or more marker genes, and appropriate transcriptional regulatory elements (e.g., promoters, enhancers, and terminators). For expression (i.e., translation), one or more translational regulatory elements, such as ribosome binding sites, translation initiation sites, and stop codons, are also usually required.

[0095] A vector containing the recombinant nucleic acid molecule of interest, and / or the recombinant nucleic acid molecule itself, can be introduced into host cells by any of several suitable methods, including electroporation, transfection using calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or other substances, particulate guns, irradiation, lipofection, and infection (for example, when the vector is an infectious pathogen such as vaccinia virus). The choice of a particular procedure will often depend on the characteristics of the host cell.

[0096] Suitable expression systems include constitutive and inducible expression systems in bacteria or yeast, viral expression systems such as baculovirus, Semlik Forest Fever virus, and lentivirus, or transient transfection in insect or mammalian cells. Particularly preferred is the pET expression vector (Novagen) for the cloning and expression of recombinant proteins in Escherichia coli (E. coli). In the pET system, the target gene is cloned in a pET plasmid under the control of potent bacteriophage T7 transcription and optionally translational signaling, and expression is induced by providing a source of T7 RNA polymerase in the host cell. Since T7 RNA polymerase is highly selective and active, once fully induced, almost all cellular sources are converted to target gene expression, and the desired product can contain more than 50% of the total cellular protein several hours after induction. The pET-22b(+) vector contains an N-terminal pelB signaling sequence for potential periplasmic localization, as well as an optional C-terminal His·Tag(registered trademark) sequence.

[0097] Suitable host cells include Escherichia coli (E. coli), Lactococcus lactis, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, and others. Suitable animal host cells include HEK293, COS, S2, CHO, NSO, DT40, and others. Particularly preferred are Arctic Express® Escherichia coli (E. coli) cells. Cloning, expression, and / or purification of antigen-binding proteins can be carried out according to techniques known to those skilled in the art, including baculovirus-infected insect cell lines.

[0098] [Functionality of single-domain antibodies] In addition to the optional multivalence and multispecificity of single-domain antibodies, a key advantage of single-domain antibodies (sdAbs) is their ability to be readily cloned and expressed with effector molecules on a single DNA plasmid. These extensions enable the use of sdAbs in a wide range of applications beyond antigen binding itself. Thanks to their single-domain nature, sdAbs can be readily equipped with various effector functions through molecular or biochemical engineering. Suitable effector molecules have many different functions, such as activation of antibody-dependent cytotoxicity, lysis of parasitic and cancer cell membranes, in vitro / in vivo imaging, and diagnostics. Particularly preferred effector molecules in this invention are anti-cancer peptides, soluble peptides, L-rhamnose, galactose-α-1,3-galactose, dinitrophenyl, serum stabilizing molecules, fluorescent molecules, phosphorescent molecules, chemiluminescent molecules, bioluminescent molecules, radioisotopes, chromophores, disuccinimidyl adipate, and human Fc antibody fragments.

[0099] Accordingly, embodiments of the present invention are directed to polypeptides that specifically conjugate globo-series glycans comprising at least one single-domain antibody or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and further comprises at least one effector molecule linked to the single-domain antibody. Here, the effector molecule is selected from the group consisting of anti-cancer peptides, soluble peptides, L-rhamnose, galactose-α-1,3-galactose, dinitrophenyl, serum stabilizing molecules, fluorescent molecules, phosphorescent molecules, chemiluminescent molecules, bioluminescent molecules, radioisotopes, chromophores, disuccinimidyl adipate, and human Fc antibody fragments.

[0100] Specifically, the effector molecule is preferably ligated to the C-terminus of a single-domain antibody. Furthermore, the effector molecule is preferably ligated to the C-terminus of the single-domain antibody using a linker. Preferred linkers are selected from the group including GS_linker (SEQ ID NO:127:GGGGSGGGGS), GSAA_linker (SEQ ID NO:128:GGGGSEAAAKGGGGS), SRGS_linker (SEQ ID NO:178:SRGSSGSSSSGSSGGSG), and GGGGS_linker (SEQ ID NO:228:GGGGSGGGGSGGGGS). Preferably, a "short linking sequence" (SEQ ID NO:227:AAXX, where X can be any amino acid) containing two alanine and two amino acid "XX" sequences corresponding to the enzyme restriction site, where X can be any amino acid, is ligated to the C-terminus of the single-domain antibody prior to the linker sequence.

[0101] "Anti-cancer peptides" are peptides discovered in plants, animals, and other organisms for their antimicrobial activity. These peptides can kill bacteria and cancer cells through membrane interactions. The difference between bacterial or cancer cells and healthy mammalian cells is evident in the charge of their membranes. Both bacterial and cancer cells have membranes that are negatively charged overall. Due to the similarity between the membranes of bacterial and cancer cells, it is thought that the mechanisms by which membrane disruption occurs and induce cell death are also similar. Examples of antimicrobial peptides with anti-cancer activity include LL-37, lactoferricin, or the C-terminus of platelet factor 4 (PF4). Single-domain antibodies (sdAbs) and anti-cancer peptides are preferably conjugated and expressed using linkers, which are preferably different repeats of the (Gly4Ser)n or (Gly2Ser)n unit, or different repeats of the sequence GGGGSEAAAKGGGGS. Preferred linkers are the GS_linker (SEQ ID NO:127:GGGGSGGGGS), the GSAA_linker (SEQ ID NO:128:GGGGSEAAAKGGGGS), and the SRGS_linker (SEQ ID NO:178:SRGSSGSSSSGSSGGSG). More specifically, the linker and anti-cancer peptide are ligated to the C-terminus of the sdAb. Furthermore, a "short linking sequence" (SEQ ID NO:227:AAXX, where X can be any amino acid) containing two alanines and two amino acid "XX" sequences corresponding to the enzyme restriction site, where X can be any amino acid, is preferably ligated to the C-terminus of the single-domain antibody prior to the linker sequence.

[0102] The "soluble peptide" according to the present invention includes modified cysteine-deficient tachyplesin-I (KWFRVYRGIYR, SEQ ID NO:130), BMAP28A (GGLRSLGRKILRAWKKYGPIIVPIIRIG, SEQ ID NO:131), and Polybia-MP1 (IDWKKLLDAAKQIL, SEQ ID NO:132).

[0103] Tachypressin-I is an antimicrobial peptide isolated from horseshoe crabs that inhibits the growth of various types of bacteria by using its ability to permeate cell membranes. Following the previously reported linear tachypressin analog lacking cysteine ​​(cysteine-deficient tachypressin, CDT, KWFRVYRGIYRRR-CONH2), Wang et al. (Int J Pept Res Ther. 2014) found that removing two C-terminal arginine residues from CDT retains antimicrobial activity but reduces hemolytic activity, resulting in a peptide with the desired selectivity for therapeutic use ([des-Arg 12,13 This indicates that it results in ]CDT). As used herein, modified cysteine-deleted tachypressin-I refers to the sequence KWFRVYRGIYR.

[0104] Polyvia-MP1 is a soluble peptide derived from Brazilian wasp venom, which possesses known anti-cancer properties. In vitro studies conducted with Polyvia-MP1 provide evidence of killing caused by acute cell injury, swelling, and necrosis resulting from rupture via membrane disruption or the formation of transmembrane pores.

[0105] BMAP-28 is a bovine antimicrobial peptide of the cathelicidine family that induces membrane permeability and death in human tumor cell lines and activated but non-quiescent human lymphocytes.

[0106] L-rhamnose, galactose-α-1,3-galactose (αGal), and dinitrophenyl (DNP) can successfully initiate antibody-dependent cell-mediated cytotoxicity regardless of the presence of fragment crystallizable (Fc) regions, which are absent in single-domain antibodies. Indeed, L-rhamnose, galactose-α-1,3-galactose (αGal), and dinitrophenyl (DNP) can recruit naturally produced antibodies against tumor cells. Cells thus targeted are recognized as foreign by the immune system and marked for destruction. The recruitment of endogenous antibodies against tumor cells enables destruction by two antibody effector mechanisms: complement-dependent cell-mediated cytotoxicity (CDC) and antibody-dependent cell-mediated cytotoxicity (ADCC).

[0107] [ka]

[0108] Accordingly, preferred embodiments of the present invention are directed toward a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and further comprises at least one effector molecule linked to the single-domain antibody, wherein the effector molecule is at least one soluble peptide selected from the group comprising cysteine-deficient tachypressin-I, BMAP28A, and Polyvia-MP1.

[0109] A particularly preferred embodiment of the present invention is directed to a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and further comprises at least one effector molecule linked to the single-domain antibody, wherein the effector molecule is a soluble peptide selected from the group including cysteine-deficient tachypressin-I, BMAP28A, and polyvia-MP1, wherein the soluble peptide is conjugated to the C-terminus of the single-domain antibody using a linker. Preferred linkers are selected from the group including GS_linker (SEQ ID NO:127:GGGGSGGGGS), GSAA_linker (SEQ ID NO:128:GGGGSEAAAKGGGGS), and SRGS_linker (SEQ ID NO:178:SRGSSGSSSSGSSGGSG). Preferably, a short linking sequence (SEQ ID NO:227:AAXX, where X can be any amino acid) is ligated to the C-terminus of the single-domain antibody prior to the linker sequence.

[0110] A particularly preferred embodiment of the present invention is directed to a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and further comprises at least one effector molecule linked to the single-domain antibody, wherein the effector molecule is a soluble peptide selected from the group including cysteine-deficient tachypressin-I, BMAP28A, and polyvia-MP1, wherein the soluble peptide is conjugated to the C-terminus of the single-domain antibody using a linker. Preferred linkers are selected from the group including GS_linker (SEQ ID NO:127:GGGGSGGGGS), GSAA_linker (SEQ ID NO:128:GGGGSEAAAKGGGGS), and SRGS_linker (SEQ ID NO:178:SRGSSGSSSSGSSGGSG). Preferably, a short linking sequence (SEQ ID NO:227:AAXX, where X can be any amino acid) is ligated to the C-terminus of the single-domain antibody prior to the linker sequence.

[0111] A more preferred embodiment of the present invention is directed to a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and further comprises at least one effector molecule linked to the single-domain antibody, wherein the effector molecule is a soluble peptide selected from the group comprising cysteine-deficient tachypressin-I, BMAP28A, and polyvia-MP1, and the polypeptide has at least 85% sequence identity with a sequence selected from SEQ ID NO: 19-63, 142-156, and 179-226.

[0112] A more particularly preferred embodiment of the present invention is directed to a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and further comprises at least one effector molecule linked to the single-domain antibody, wherein the effector molecule is a soluble peptide selected from the group comprising cysteine-deficient tachypressin-I, BMAP28A, and Polyvia-MP1, wherein the soluble peptide is a GS_linker (SEQ ID NO:127:GGGGSGGGGS), a GSAA_linker (SEQ ID NO:128:GGGGSEAAAKGGGGS), and an SRGS_linker (SEQ ID The polypeptide is linked to the C-terminus of a single-domain antibody using a linker selected from the group including NO:178:SRGSSGSSSSGSSGGSG), and the polypeptide has at least 85% sequence identity with a sequence selected from SEQ ID NO:19-63, 142-156, and 179-226. Preferably, a short linking sequence (SEQ ID NO:227:AAXX, where X can be any amino acid) is ligated to the C-terminus of the single-domain antibody prior to the linker sequence.

[0113] In other words, a more particularly preferred embodiment of the present invention is directed to a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and further comprises at least one effector molecule linked to the single-domain antibody, wherein the effector molecule is a soluble peptide selected from the group comprising cysteine-deficient tachypressin-I, BMAP28A, and Polyvia-MP1, wherein the soluble peptide is a GS_linker (SEQ ID NO:127:GGGGSGGGGS), a GSAA_linker (SEQ ID NO:128:GGGGSEAAAKGGGGS), and an SRGS_linker (SEQ ID A linker selected from the group including NO:178 (SRGSSGSSSSGSSGGSG) is used to conjugate to the C-terminus of a single-domain antibody, where a short linkage sequence (SEQ ID NO:227, where X can be any amino acid) is ligated to the C-terminus of the single-domain antibody prior to the linker sequence, and the polypeptide has at least 85% sequence identity with a sequence selected from SEQ ID NO:19-63, 142-156, 179-226.

[0114] Because sdAbs lack an Fc region, they cannot induce Fc receptor-dependent effector function itself. However, human Fc antibody fragments can be ligated or fused to single-domain antibodies to restore their ability to interact with neonatal Fc receptors or FcRn. A key advantage of the sdAb-Fc fusion construct is the introduction of Fc receptor-dependent effector functions, such as antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cell-mediated phagocytosis (ADCP), and complement-dependent cytotoxicity (CDC). The Fc regions (CH2-CH3) of various human and mouse antibody subclasses are genetically fused to sdAbs. Ligation or fusion of sdAbs to Fc antibody fragments also has the advantage of significantly increasing the serum half-life and enhancing target antigen binding through affinity effects.

[0115] Stabilization of single-domain antibodies Another strategy for extending the half-life of sdAbs is to bind sdAbs to long-lived serum proteins or to constituent units that target these long-lived proteins. The long serum half-life of serum albumin is due, for example, to its ability to escape catabolism after cellular uptake. Another approach involves fusing sdAbs to albumin-bound sdAbs.

[0116] Accordingly, the present invention also relates to a polypeptide further comprising certain antibodies (e.g., single-domain antibodies) directed against one or more serum proteins of interest, wherein the antibodies have a significantly extended half-life in the circulation of the polypeptide. The serum protein may be any suitable protein found in the serum or fragments thereof of interest. In one embodiment of the present invention, the serum protein is serum albumin, serum immunoglobulin, thyroxine-binding protein, transferrin, or fibrinogen. For example, the antibody may be directed against one of the above serum proteins depending on the intended use, such as a half-life required for effective treatment and / or compartmentalization of the target antigen.

[0117] CAR-T cell therapy based on single-domain antibodies As used herein, the term “chimeric antigen receptor” or “CAR” refers to an artificially constructed hybrid protein or polypeptide comprising an antigen-binding domain of an antibody (e.g., a single-chain variable fragment (scFv) or sdAb) ligated to a T cell transmembrane domain, which is then ligated to an intracellular signaling or activation domain, the ligation between the antigen-binding domain and the transmembrane domain occurring via a hinge region. The domains of the CAR, or other functional or structural sequences, such as the transmembrane domain or the intracellular activation or signaling domain, are referred to as elements or modules of the CAR.

[0118] CARs utilize the antigen-binding properties of monoclonal antibodies to redirect T cell specificity and T cell reactivity toward a selected target in an MHC-free method.

[0119] The antigen recognition module of CAR T cells, also known as the ectodomain, is typically an scFv and is linked to a hinge region, transmembrane region, costimulatory domain, and cytoplasmic activation domain, such as the CD3-zeta or FcRγ intracellular signaling domain. However, scFvs do not always fold efficiently and may be prone to aggregation. In contrast, the variable region of heavy-chain-only antibodies (VHH or sdAb) is a small, stable single-domain antibody fragment with affinity comparable to conventional scFvs.

[0120] The main challenge in developing CAR T cells for cancer treatment is the lack of target antigens (Xie et al., 2018). Most antigens proposed as CAR T cell targets for cancer treatment are limited to specific cancer types, and the limited information on cancer-specific antigens for the majority of cancers leads to inadequate CAR T cell therapies.

[0121] Therefore, a particular aspect of the advantages of the present invention is to provide a CAR that specifically targets globo-series glycans such as Globo H, Gb3, Gb4, or Gb5, which are expressed in various cancers and can be used to manipulate anti-glycan CAR T cells, which can then be used to treat several different cancers.

[0122] Accordingly, embodiments of the present invention are polypeptides that specifically conjugate a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and further comprises at least one extracellular hinge region, at least one transmembrane domain, at least one costimulatory domain, and at least one intracellular activation domain, wherein the single-domain antibody is ligated to the extracellular hinge region. The polypeptide is a T cell chimeric antigen receptor, in which at least one single-domain antibody conjugating at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, at least one extracellular hinge region, at least one transmembrane domain, at least one costimulatory domain, and at least one intracellular activation domain are included in the chimeric antigen receptor in the direction from N-terminus to C-terminus.

[0123] In other words, embodiments of the present invention are polypeptides that specifically conjugate a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and further comprises at least one CAR extracellular hinge region, at least one CAR transmembrane domain, at least one CAR costimulatory domain, and at least one CAR intracellular activation domain in the N-terminal to C-terminal direction, wherein the single-domain antibody is ligated to the CAR extracellular hinge region.

[0124] More specifically, embodiments of the present invention are polypeptides that specifically conjugate a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and further comprises at least one extracellular CD8-alpha hinge region, at least one CD8-alpha or CD28 transmembrane domain, at least one CD28,4-IBB,ICOS costimulatory domain, and at least one CD3-zeta intracellular activation domain, wherein the single-domain antibody is ligated to the extracellular hinge region.

[0125] A further embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and further comprises at least one extracellular hinge region, at least one transmembrane domain, at least one costimulatory domain, and at least one intracellular activation domain, wherein the single-domain antibody is linked to the extracellular hinge region, wherein the at least one single-domain antibody has SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID The sequence has at least 90% sequence identity with sequences selected from the group consisting of NO:136, SEQ ID NO:137, and SEQ ID NO:138.

[0126] A more preferred embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and further comprises at least one extracellular hinge region, at least one transmembrane domain, at least one costimulatory domain, and at least one intracellular activation domain, wherein the single-domain antibody is linked to the extracellular hinge region, wherein the at least one single-domain antibody is a humanized single-domain antibody. It is also disclosed that single-domain antibodies can be humanized by substituting one or more amino acid residues located at positions 1, 5, 11, 28, and 30 of FR1, positions 44 and 45 of FR2, positions 74, 75, 76, 83, 84, 93, and 94 of FR3, and positions 104 and 108 of FR4, according to Kabat numbering.

[0127] The present invention is also directed to recombinant nucleic acid molecules encoding polypeptides that specifically conjugate globo-series glycans comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and further comprises at least one extracellular hinge region, at least one transmembrane domain, at least one costimulatory domain, and at least one intracellular activation domain, wherein the single-domain antibody is ligated to the extracellular hinge region. Furthermore, the present invention provides a vector comprising a recombinant nucleic acid molecule encoding a polypeptide that specifically conjugates a globo-series glycan containing at least one single-domain antibody, and a host cell, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and further comprises at least one extracellular hinge region, at least one transmembrane domain, at least one costimulatory domain, and at least one intracellular activation domain, wherein the single-domain antibody is ligated to the extracellular hinge region.

[0128] A more preferred embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from globoH, Gb3, Gb4, and Gb5, and further comprises at least one extracellular hinge region, at least one transmembrane domain, at least one costimulatory domain, and at least one intracellular activation domain, wherein the single-domain antibody is ligated to the extracellular hinge region for use in the treatment of cancer, wherein the cancer cells express at least one globo-series glycan selected from globoH, Gb3, Gb4, and Gb5 on the surface of the cancer cells.

[0129] A more preferred embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and conjugates at least one extracellular hinge region, at least one The antibody further comprises a transmembrane domain, at least one costimulatory domain, and at least one intracellular activation domain, wherein the single-domain antibody is ligated to an extracellular hinge region for use in the treatment of cancer, wherein the cancer cells express at least one globoseries glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, wherein the cancer is selected from brain cancer, liver cancer, cholangiocarcinoma, kidney cancer, breast cancer, prostate cancer, lung cancer, small cell lung cancer, ovarian cancer, cervical cancer, esophageal cancer, gastric cancer, pancreatic cancer, and colorectal cancer.

[0130] The hinge region of the chimeric antigen receptor is typically derived from a human CD8-alpha chain (exemplary SEQ ID NO:4 of WO2016019300 A1, or the fragment described in US 20160303166 A1).

[0131] The transmembrane domain of a chimeric antigen receptor crosses the plasma membrane and links the extracellular domain to the intracellular signaling domain. Examples of transmembrane domains include, but are not limited to, human CD28 (exemplary sequence: residues 153-179 of SEQ ID NO: 4 in US 20160303166 A1) and CD8-alpha (exemplary sequence: SEQ ID NO: 12 in WO2016019300 A1).

[0132] The intracellular activation domain transmits signals necessary for the effector function of CAR T cells. More specifically, when the extracellular domain binds to the target Globo H-series glycan, the extracellular activation domain transmits signals necessary for cell activation. The intracellular activation domain is typically human CD3-zeta (exemplary sequence SEQ ID NO:18 or SEQ ID NO:20 of WO2016019300 A1).

[0133] As used herein, a “costimulatory domain” (CSD) refers to a portion of a CAR that enhances the proliferation, survival, and / or development of memory cells. The CAR of the present invention may comprise one or more costimulatory domains. Each costimulatory domain may include, for example, CD28 (exemplary sequence SEQ ID NO: 44 of WO2016019300 A1), 4-1BB (CD137, exemplary sequence SEQ ID NO: 14 of WO2016019300 A1), and ICOS (exemplary sequence SEQ ID NO: 263 of WO2016014553A1).

[0134] Methods for constructing chimeric antigen receptors are described in prior art, such as US 20160303166 A1, WO2016014553 A1, and Xie et al. PNAS2018.

[0135] Furthermore, the present invention also describes a method for generating genetically modified chimeric antigen receptor T-cells (CAR T-cells), which includes the following: a) To generate a chimeric antigen receptor (CAR) construct having at least one single-domain antibody, wherein the single-domain antibody is conjugated to at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, at least one extracellular hinge region, at least one transmembrane domain, at least one costimulatory domain, and at least one intracellular activation domain in the chimeric antigen receptor, wherein the single-domain antibody is ligated to the extracellular hinge region. b) Transfecting T cells removed from the target blood, c) Express a CAR construct that generates a functional CAR in T cells in order to generate CAR T cells that specifically recognize at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5.

[0136] The recombinant T cells that can express the CAR of the present invention include, but are not limited to, T lymphocytes (T cells), naive T cells (TNs), memory T cells (e.g., central memory T cells (TCMs), effector memory cells (TEMs)), natural killer cells, hematopoietic stem cells, and / or pluripotent embryonic / inducible stem cells capable of producing progeny related to therapy. In embodiments, the recombinant cells are autologous cells. For example, the individual T cells in the present invention are CD4 + / CD8 - CD4 - / CD8 + CD4 - / CD8 - , or CD4 + / CD8 + It is possible. T cells are CD4 + / CD8 - Cells and CD4 - / CD8 +This may be a mixed population of cells or a population of single clones. CD4 of the present invention + When T cells are co-cultured in vitro with cells expressing a target antigen (i.e., cancer cells expressing Globo H series glycans), they can produce IL-2, IFNγ, TNFα, and other T cell effector cytokines. (CD8 of the present invention) + When T cells are co-cultured in vitro with target cells (i.e., cancer cells expressing Globo H series glycans), they can lyse antigen-specific target cells.

[0137] Finally, the present invention also describes a method for treating a subject having cancer, wherein the cancer cells express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, and the method comprises administering to the subject having cancer chimeric antigen receptor T cells (CAR T cells) that specifically recognize at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the CAR T cells express a functional CAR polypeptide comprising a single-domain antibody conjugating at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, at least one extracellular hinge region, at least one transmembrane domain, at least one costimulatory domain, and at least one intracellular activation domain, in an amount effective for treating the subject having cancer.

[0138] Humanization of single-domain antibodies The mutant sequences in this invention may include single-domain antibodies that specifically bind at least one glycan selected from the humanized GloboH, GB3, Gb4, and Gb5. The humanization of sdAb aims to further reduce the possibility of undesirable immune responses in human individuals upon administration. One embodiment of the present invention relates to a modified single-domain antibody based on an alpaca antibody, wherein amino acid residues of sdAb that do not affect the domain's innate affinity for the target are modified to reduce the immunogenicity of sdAb in humans.

[0139] More specifically, the present invention relates to sdAbs modified for administration to humans, and the use of such “humanized” sdAbs in the treatment of human diseases. Humanizing a single-domain antibody according to the present invention involves the step of substituting one or more alpaca amino acids with human counterparts as found in the human consensus sequence, so that the single-domain antibody does not lose its typical characteristics, i.e., the humanization does not significantly affect the antigen-binding ability of the resulting single-domain antibody, or the polypeptide containing the resulting single-domain antibody. The method is known to those skilled in the art.

[0140] Humanization of alpaca single-domain antibodies, or more generally, camelid single-domain antibodies, requires the introduction of a limited number of amino acids into a single polypeptide chain and mutagenesis.

[0141] Accordingly, one embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the at least one single-domain antibody is a humanized single-domain antibody.

[0142] Generally, humanized single-domain antibodies are obtained by substituting any of the following residues, either individually or in combination, in an alpaca single-domain antibody, as described in EP1687338 B1: FR1 is characterized by amino acids at positions 1, 5, 11, 28, and 30. FR2 is characterized by amino acids at positions 44 and 45. FR3 is characterized by amino acids at positions 74, 75, 76, 83, 84, 93 and 94. FR4 is characterized by amino acids at positions 103, 104, 108, and 111: Here, the numbering follows Kabat numbering.

[0143] Humanization of residues in FR1, FR3, and FR4 would have minimal impact on the function and stability of single-domain antibodies, while mutations in FR2 at positions 44 and 45 would even stabilize single-domain antibodies (Vincke et al., J. Biol. Chem. 2009). However, EP 1687338 B1 reports that mutagenesis of Q108L at FR4 can lead to decreased production levels in E. coli. Position 108 is exposed to the VHH solvent in camels, but in human antibodies, this position is buried at the VH-VL interface. The introduction of nonpolar hydrophobic Leu instead of polar uncharged Gln can dramatically affect the intrinsic folding / stability of the molecule. Single-domain antibody characteristic residues at positions 37 and 47 of FR2 cannot be humanized because they significantly affect the integrity of antigen interaction (Vincke et la., 2009).

[0144] Table 1 reports the characteristic residues of the alpaca sdAb of the present invention, as described in US 7807162 B2, and the amino acid residues at the corresponding positions of the most closely related human VH domain VH3. This table shows that the characteristic amino acids at positions 103 and 111 of the alpaca single-domain antibody disclosed herein are the same as the most common residues of human VH3.

[0145] Accordingly, a further embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the at least one single-domain antibody is humanized by substituting one or more amino acid residues located at positions 1, 5, 11, 28, and 30 of FR1, positions 44 and 45 of FR2, positions 74, 75, 76, 83, 84, 93, and 94 of FR3, and positions 104 and 108 of FR4, according to Kabat numbering.

[0146] Therefore, the humanized polypeptide exhibits high amino acid sequence homology to the human VH framework region, and the polypeptide can be administered directly to humans without anticipating an undesirable immune response and without the burden of further humanization. The present invention also relates to recombinant nucleic acids that can encode the humanized polypeptide.

[0147] A preferred embodiment of the present invention is a globo-series glycan-binding polypeptide comprising at least one single-domain antibody that specifically binds at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the at least one single-domain antibody is located at positions 1, 5, 11, 28, and 30 of FR1, positions 44 and 45 of FR2, positions 74, 75, 76, 83, 84, 93, and 9 of FR3, and position 10 of FR4. The present invention further comprises at least one effector molecule that is humanized by substituting one or more amino acid residues located at positions 4 and 108 and is linked to the single-domain antibody, wherein the effector molecule is selected from the group consisting of anti-cancer peptides, soluble peptides, L-rhamnose, galactose-α-1,3-galactose, dinitrophenyl, serum stabilizing molecules, fluorescent molecules, phosphorescent molecules, chemiluminescent molecules, bioluminescent molecules, radioisotopes, chromophores, disuccinimidyl adipate, and human Fc antibody fragments. A more preferred embodiment of the present invention is a globo-series glycan-conjugated polypeptide comprising at least one single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the at least one single-domain antibody is humanized by substituting one or more amino acid residues located at positions 1, 5, 11, 28, and 30 of FR1, positions 44 and 45 of FR2, positions 74, 75, 76, 83, 84, 93, and 94 of FR3, and positions 104 and 108 of FR4, and further comprises at least one effector molecule linked to the single-domain antibody, wherein the effector molecule is a soluble peptide selected from the group comprising modified cysteine-deficient tachypressin-I, BMAP28A, and Polyvia-MP1.

[0148] [Table 1] TIFF0007832106000005.tif92169

[0149] Pharmaceutical composition A "pharmaceutical composition" refers to a form of preparation in which the biological activity of the active ingredient is effective and which does not contain additional ingredients that are toxic to the target of administration.

[0150] As used herein, the terms “pharmaceutically acceptable,” “physiologically tolerable,” and their grammatical variations are used interchangeably to indicate that a material can be administered to or to a mammal without producing undesirable physiological effects, such as nausea, dizziness, stomach upset, and the like.

[0151] The pharmaceutical composition is designed to facilitate the administration of the polypeptide of the present invention, which contains a single-domain antibody, in an effective manner. A "pharmaceutically acceptable vehicle" refers to a component of a pharmaceutical preparation other than the active ingredient that is non-toxic to the target of administration. A pharmaceutically acceptable vehicle includes, but is not limited to, buffers, stabilizers, or preservatives.

[0152] Examples of suitable vehicles or excipients include lactose, dextrose, sucrose, glucose, powdered sugar, sorbitol, mannitol, xylitol, starch, acacia gum, xanthan gum, guar gum, tara gum, mesquite gum, fenugreek gum, locust bean gum, gutt gum, tragacanth gum, inositol, molasses, maltodextrin, Irish moss extract, panwar gum, isapol shell mucus, bee gum, larch alabogalactan, calcium silicate, calcium phosphate, The present invention includes, but is not limited to, dicalcium phosphate, calcium sulfate, kaolin, sodium chloride, polyethylene glycol, alginate, gelatin, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, physiological saline, syrup, methylcellulose, ethylcellulose, hydroxypropyl methylcellulose, carboxymethylcellulose, polyacrylic acids such as Carbopol 941, Carbopol 980, Carbopol 981, and gum bases such as Pharmagum (trademark) (SPI Pharma Group; Newcastle, Delaware), and similar materials. Typically, the compositions of the present invention comprise about 10% to about 90% by weight of a vehicle, excipient, or combination thereof.

[0153] Preferably, the pharmaceutical composition comprises about 0.001% to about 90% by weight, preferably about 0.01% to about 75% by weight, more preferably about 0.1% to 50% by weight, and even more preferably about 0.1% to 10% by weight of the polypeptide of the present invention, with the remainder consisting of a suitable pharmaceutical vehicle, excipients, and / or diluents.

[0154] Pharmaceutical compositions can be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, oral dosage forms, topical formulations, suppositories, or sterile injectable solutions, such as those aerosolized by conventional methods. When formulated, pharmaceutical compositions can be prepared using diluents or excipients, such as commonly used fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants.

[0155] In a pharmaceutical composition, a solid preparation for oral administration may be a tablet, pill, powder, granule, or capsule. The solid preparation may further contain excipients. Excipients may be, for example, starch, calcium carbonate, sucrose, lactose, or gelatin. Furthermore, the solid preparation may further contain a lubricant, such as magnesium stearate or talc. In a pharmaceutical composition, a liquid preparation for oral administration may be the best suspension, solution, emulsion, or syrup. The liquid preparation may contain water or liquid paraffin. With respect to excipients, the liquid preparation may contain, for example, a humectant, sweetener, fragrance, or preservative. For parenteral administration purposes, the composition containing the polypeptide of the present invention is preferably dissolved in distilled water, and the pH is preferably adjusted to about 6 to 8.

[0156] Useful preparations in the compositions of the present invention for parenteral administration also include sterile aqueous and non-aqueous solvents, suspensions, and emulsions. Examples of useful non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils, fish oils, and injectable organic esters.

[0157] Embodiments of the present invention are pharmaceutical compositions comprising a polypeptide that specifically conjugates a globo-series glycan containing at least one single-domain antibody, together with at least one pharmaceutically acceptable vehicle, an excipient, and / or diluent, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5.

[0158] Another embodiment of the present invention comprises a globo-series glycan-conjugating polypeptide containing at least one single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, together with at least one pharmaceutically acceptable vehicle, an excipient, and / or diluent, and further comprises at least one effector molecule linked to the single-domain antibody, wherein the effector molecule is selected from the group consisting of anti-cancer peptides, soluble peptides, L-rhamnose, galactose-α-1,3-galactose, dinitrophenyl, serum stabilizing molecules, fluorescent molecules, phosphorescent molecules, chemiluminescent molecules, bioluminescent molecules, radioisotopes, chromophores, disuccinimidyl adipate, and human Fc antibody fragments.

[0159] Other specific embodiments of the present invention include a globo-series glycan-conjugating polypeptide comprising at least one single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, together with at least one pharmaceutically acceptable vehicle, an excipient, and / or diluent, and further comprising at least one effector molecule linked to the single-domain antibody, wherein the effector molecule is a soluble peptide selected from the group comprising cysteine-deficient tachypressin-I, BMAP28A, and polyvia-MP1.

[0160] A more specific embodiment of the present invention is a pharmaceutical composition comprising a globo-series glycan-conjugated polypeptide containing at least one single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, together with at least one pharmaceutically acceptable vehicle, an excipient, and / or diluent, and further comprising at least one effector molecule linked to the single-domain antibody, wherein the effector molecule is a soluble peptide selected from the group including cysteine-deleted tachypressin-I, BMAP28A, and polyvia-MP1, and the polypeptide has at least 85% sequence identity with a sequence selected from SEQ ID NO: 19-63, 142-156.

[0161] A further embodiment of the present invention is a pharmaceutical composition comprising a globo-series glycan-conjugating polypeptide, which comprises at least one single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, together with at least one pharmaceutically acceptable vehicle, excipient, and / or diluent, wherein the at least one single-domain antibody is humanized by substituting one or more amino acid residues located at positions 1, 5, 11, 28, and 30 of FR1, positions 44 and 45 of FR2, positions 74, 75, 76, 83, 84, 93, and 94 of FR3, and positions 104 and 108 of FR4, according to Kabat numbering. To put it simply, one embodiment of the present invention is a pharmaceutical composition comprising a certain polypeptide including at least one humanized single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, together with at least one pharmaceutically acceptable vehicle, excipient, and / or diluent.

[0162] Use of single-domain antibodies against cancer Other embodiments of the present invention are directed to polypeptides that specifically conjugate globo-series glycans comprising at least one single-domain antibody for use in the treatment and / or diagnosis of cancer, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from globoH, Gb3, Gb4, and Gb5, wherein the cancer cells express at least one globo-series glycan selected from globoH, Gb3, Gb4, and Gb5 on the surface of the cancer cells.

[0163] Other embodiments of the present invention relate to a polypeptide, or a variant thereof, for use in the treatment and / or diagnosis of cancer, which specifically conjugates a globo-series glycan comprising at least one single-domain antibody, or a pharmaceutical composition comprising the polypeptide, wherein the single-domain antibody conjugates at least one globo-series glycan selected from globoH, Gb3, Gb4, and Gb5, wherein the cancer cells express at least one globo-series glycan selected from globoH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, wherein the cancer is selected from brain cancer, liver cancer, cholangiocarcinoma, kidney cancer, breast cancer, prostate cancer, lung cancer, small cell lung cancer, ovarian cancer, cervical cancer, esophageal cancer, gastric cancer, pancreatic cancer, and colorectal cancer.

[0164] Furthermore, one aspect of the present invention is directed to a globo-series glycan-conjugated polypeptide for use in the treatment and / or diagnosis of cancer, comprising at least one single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the at least one single-domain antibody is humanized by substituting one or more amino acid residues located at positions 1, 5, 11, 28, and 30 of FR1, positions 44 and 45 of FR2, positions 74, 75, 76, 83, 84, 93, and 94 of FR3, and positions 104 and 108 of FR4, according to Kabat numbering, wherein the cancer cells express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells. One embodiment of the present invention can be slightly paraphrased as relating to a globo-series glycan-conjugating polypeptide comprising at least one humanized single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 for use in the treatment and / or diagnosis of cancer, wherein the cancer cells of the cancer express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells.

[0165] Furthermore, one aspect of the present invention is directed to a pharmaceutical composition comprising a globo-series glycan-conjugated polypeptide for use in the treatment and / or diagnosis of cancer, comprising at least one single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the at least one single-domain antibody is humanized by substituting one or more amino acid residues located at positions 1, 5, 11, 28, and 30 of FR1, positions 44 and 45 of FR2, positions 74, 75, 76, 83, 84, 93, and 94 of FR3, and positions 104 and 108 of FR4, according to Kabat numbering, wherein the cancer cells express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells.

[0166] A preferred embodiment of the present invention is a globo-series glycan-conjugated polypeptide for use in the treatment and / or diagnosis of cancer, comprising at least one single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, where the at least one single-domain antibody is located at positions 1, 5, 11, 28, and 30 of FR1, positions 44 and 45 of FR2, and FR3 Humanized by substituting one or more amino acid residues located at positions 74, 75, 76, 83, 84, 93, and 94 of FR4, and positions 104 and 108 of FR4, wherein the cancer cells of the cancer express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, wherein the cancer is selected from brain cancer, liver cancer, cholangiocarcinoma, kidney cancer, breast cancer, prostate cancer, lung cancer, small cell lung cancer, ovarian cancer, cervical cancer, esophageal cancer, gastric cancer, pancreatic cancer, and colorectal cancer.

[0167] A more preferred embodiment of the present invention is a globo-series glycan-conjugated polypeptide for use in the treatment of cancer, comprising at least one single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, where the at least one single-domain antibody is located at positions 1, 5, 11, 28, and 30 of FR1, positions 44 and 45 of FR2, and positions 74, 75, 76, 83, 84, and 9 of FR3. The antibody further comprises at least one effector molecule that is humanized by substituting one or more amino acid residues located at positions 104 and 108 of FR4, and ligated to the single-domain antibody, wherein the effector molecule is a soluble peptide selected from the group including cysteine-deficient tachypressin-I, BMAP28A, and Polyvia-MP1, wherein the cancer cells express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells.

[0168] A more preferred embodiment of the present invention is a globo-series glycan-conjugated polypeptide for use in the treatment of cancer, comprising at least one single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the at least one single-domain antibody is one or more amino acid residues located at positions 1, 5, 11, 28, and 30 of FR1, positions 44 and 45 of FR2, positions 74, 75, 76, 83, 84, 93, and 94 of FR3, and positions 104 and 108 of FR4. The present invention further comprises at least one effector molecule that is humanized by substitution of a group and linked to the single-domain antibody, wherein the effector molecule is a soluble peptide selected from the group comprising cysteine-deficient tachypressin-I, BMAP28A, and Polyvia-MP1, wherein the cancer cells express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, wherein the cancer is selected from brain cancer, liver cancer, cholangiocarcinoma, kidney cancer, breast cancer, prostate cancer, lung cancer, small cell lung cancer, ovarian cancer, cervical cancer, esophageal cancer, gastric cancer, pancreatic cancer, and colorectal cancer.

[0169] Further embodiments of the present invention are directed to polypeptides for use in the treatment of cancer that specifically conjugate a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and further comprises at least one CAR extracellular hinge region, at least one CAR transmembrane domain, at least one CAR costimulatory domain, and at least one CAR intracellular activation domain, wherein the single-domain antibody is ligated to the CAR extracellular hinge region, wherein the cancer cells express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells.

[0170] Further embodiments of the present invention are directed toward a polypeptide specifically conjugating a globo-series glycan comprising at least one single-domain antibody for use in the treatment of cancer, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5. The antibody further comprises at least one extracellular CD8-alpha hinge region, at least one CD8-alpha or CD28 transmembrane domain, at least one CD28,4-IBB,ICOS costimulatory domain, and at least one CD3-zeta intracellular activation domain, wherein the single-domain antibody is ligated to the CAR extracellular hinge region, and wherein the cancer cells of the cancer express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells.

[0171] Further embodiments of the present invention are directed toward a polypeptide specifically conjugating a globo-series glycan comprising at least one single-domain antibody for use in the treatment of cancer, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and at least one CAR extracellular hinge region. The antibody further comprises at least one CAR transmembrane domain, at least one CAR costimulatory domain, and at least one CAR intracellular activation domain, wherein the single-domain antibody is ligated to the extracellular hinge region of the CAR, wherein the cancer cells express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, wherein the cancer is selected from brain cancer, liver cancer, cholangiocarcinoma, kidney cancer, breast cancer, prostate cancer, lung cancer, small cell lung cancer, ovarian cancer, cervical cancer, esophageal cancer, gastric cancer, pancreatic cancer, and colorectal cancer.

[0172] Further embodiments of the present invention are directed toward a polypeptide specifically conjugating a globo-series glycan comprising at least one single-domain antibody for use in the treatment of cancer, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and at least one extracellular CD8-alpha hinge region, at least one CD The antibody further comprises an 8-alpha or CD28 transmembrane domain, at least one CD28, 4-IBB, ICOS costimulatory domain, and at least one CD3-zeta intracellular activation domain, wherein the single-domain antibody is ligated to the extracellular hinge region of the CAR, wherein the cancer cells express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, wherein the cancer is selected from brain cancer, liver cancer, cholangiocarcinoma, kidney cancer, breast cancer, prostate cancer, lung cancer, small cell lung cancer, ovarian cancer, cervical cancer, esophageal cancer, gastric cancer, pancreatic cancer, and colorectal cancer.

[0173] Furthermore, this specification describes a method for treating cancer, wherein the cancer cells of the cancer express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, and the method comprises administering a therapeutically effective amount of a polypeptide disclosed herein, or a therapeutically effective amount of a pharmaceutical composition containing the polypeptide, to a patient suffering from the cancer.

[0174] Specifically, a method for treating cancer is described, wherein the cancer cells of the cancer express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, and the method comprises administering to a patient suffering from the cancer a therapeutically effective amount of polypeptide that specifically conjugates a globo-series glycan and includes at least one single-domain antibody, or a therapeutically effective amount of a pharmaceutical composition containing the polypeptide, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, and wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5.

[0175] Furthermore, a method for treating cancer is described herein, wherein the cancer cells of the cancer express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, and the method comprises administering a therapeutically effective amount of a polypeptide disclosed herein, or a therapeutically effective amount of a pharmaceutical composition comprising the polypeptide, to a patient suffering from the cancer, wherein the cancer is selected from brain cancer, liver cancer, bile duct cancer, kidney cancer, breast cancer, prostate cancer, lung cancer, small cell lung cancer, ovarian cancer, cervical cancer, esophageal cancer, gastric cancer, pancreatic cancer, and colorectal cancer.

[0176] Specifically, a method for treating cancer is described, wherein the cancer cells of the cancer express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, and the method comprises administering to a patient suffering from the cancer a therapeutically effective amount of a globo-series glycan-conjugated polypeptide containing at least one single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, or a therapeutically effective amount of a pharmaceutical composition containing the polypeptide, wherein the at least one single-domain antibody is humanized by substituting one or more amino acid residues located at positions 1, 5, 11, 28, and 30 of FR1, positions 44 and 45 of FR2, positions 74, 75, 76, 83, 84, 93, and 94 of FR3, and positions 104 and 108 of FR4, according to Kabat numbering.

[0177] Furthermore, a method for treating cancer is described, wherein the cancer cells of the cancer express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, and the method comprises administering to a patient suffering from the cancer a therapeutically effective amount of a globo-series glycan-conjugated polypeptide containing at least one single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, or a therapeutically effective amount of a pharmaceutical composition containing the polypeptide, wherein the at least one single-domain antibody is Kabat numbered (Kabat Humanization is performed by substituting one or more amino acid residues located at positions 1, 5, 11, 28 and 30 of FR1, positions 44 and 45 of FR2, positions 74, 75, 76, 83, 84, 93 and 94 of FR3, and positions 104 and 108 of FR4, according to numbering, where the cancer is selected from brain cancer, liver cancer, cholangiocarcinoma, kidney cancer, breast cancer, prostate cancer, lung cancer, small cell lung cancer, ovarian cancer, cervical cancer, esophageal cancer, gastric cancer, pancreatic cancer, and colorectal cancer.

[0178] More specifically, a method for treating cancer is described, wherein the cancer cells of the cancer express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, and the method is to administer a therapeutically effective amount of a globo-series glycan-conjugated polypeptide comprising at least one single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, or a therapeutically effective amount of a pharmaceutical composition comprising the polypeptide to the cancer The treatment comprises administering to a patient suffering from the disease, wherein the at least one single-domain antibody is humanized by substituting one or more amino acid residues located at positions 1, 5, 11, 28, and 30 of FR1, positions 44 and 45 of FR2, positions 74, 75, 76, 83, 84, 93, and 94 of FR3, and positions 104 and 108 of FR4, and further comprises at least one effector molecule linked to the single-domain antibody, wherein the effector molecule is a soluble peptide selected from the group including cysteine-deficient tachypressin-I, BMAP28A, and polyvia-MP1.

[0179] More specifically, a method for treating cancer is described, wherein the cancer cells of the cancer express at least one globo-series glycan selected from globoH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, and the method comprises administering to a patient suffering from the cancer a therapeutically effective amount of a globo-series glycan-conjugated polypeptide containing at least one single-domain antibody that specifically conjugates at least one globo-series glycan selected from globoH, Gb3, Gb4, and Gb5, or a therapeutically effective amount of a pharmaceutical composition containing the polypeptide, wherein the at least one single-domain antibody The main antibody further comprises at least one effector molecule that is humanized by substituting one or more amino acid residues located at positions 1, 5, 11, 28, and 30 of FR1, positions 44 and 45 of FR2, positions 74, 75, 76, 83, 84, 93, and 94 of FR3, and positions 104 and 108 of FR4, and linked to the single-domain antibody, wherein the effector molecule is a soluble peptide selected from the group including cysteine-deficient tachypressin-I, BMAP28A, and polyvia-MP1, where the cancer is selected from brain cancer, liver cancer, cholangiocarcinoma, kidney cancer, breast cancer, prostate cancer, lung cancer, small cell lung cancer, ovarian cancer, cervical cancer, esophageal cancer, gastric cancer, pancreatic cancer, and colorectal cancer.

[0180] Furthermore, a method for treating cancer is described, wherein the cancer cells of the cancer express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, and the method comprises administering a therapeutically effective amount of a globo-series glycan-conjugated polypeptide to a patient suffering from the cancer, comprising at least one single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, and further comprising at least one CAR extracellular hinge region, at least one CAR transmembrane domain, at least one CAR costimulatory domain, and at least one CAR intracellular activation domain, wherein the single-domain antibody is conjugated to the CAR extracellular hinge region.

[0181] Furthermore, a method for treating cancer is described, wherein the cancer cells of the cancer express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, and the method comprises administering a therapeutically effective amount of a globo-series glycan-binding polypeptide containing at least one single-domain antibody that specifically binds at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 to a patient suffering from the cancer, and at least one C The AR further comprises an extracellular hinge region, at least one CAR transmembrane domain, at least one CAR costimulatory domain, and at least one CAR intracellular activation domain, wherein the single-domain antibody is ligated to the CAR extracellular hinge region, and the CAR further comprises at least one extracellular CD8-alpha hinge region, at least one CD8-alpha or CD28 transmembrane domain, at least one CD28, 4-IBB, ICOS costimulatory domain, and at least one CD3-zeta intracellular activation domain, wherein the single-domain antibody is ligated to the CAR extracellular hinge region.

[0182] More specifically, a method for treating cancer is described, wherein the cancer cells of the cancer express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, and the method comprises a therapeutically effective amount of globo-series glycan binding, comprising at least one single-domain antibody that specifically binds at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5. The method comprises administering a synthetic polypeptide to a patient suffering from the aforementioned cancer, and further comprising at least one CAR extracellular hinge region, at least one CAR transmembrane domain, at least one CAR costimulatory domain, and at least one CAR intracellular activation domain, wherein a single-domain antibody is ligated to the CAR extracellular hinge region, and wherein the cancer is selected from brain cancer, liver cancer, cholangiocarcinoma, kidney cancer, breast cancer, prostate cancer, lung cancer, small cell lung cancer, ovarian cancer, cervical cancer, esophageal cancer, gastric cancer, pancreatic cancer, and colorectal cancer.

[0183] Furthermore, a method for treating cancer is described, wherein the cancer cells of the cancer express at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cancer cells, and the method comprises administering a therapeutically effective amount of a globo-series glycan-binding polypeptide containing at least one single-domain antibody that specifically binds at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 to a patient suffering from the cancer, and at least one CAR extracellular hinge region, at least one CAR transmembrane domain, at least one The single-domain antibody further comprises a CAR costimulatory domain and at least one CAR intracellular activation domain, wherein the single-domain antibody is ligated to the CAR extracellular hinge region, and further comprises at least one extracellular CD8-alpha hinge region, at least one CD8-alpha or CD28 transmembrane domain, at least one CD28,4-IBB,ICOS costimulatory domain, and at least one CD3-zeta intracellular activation domain, wherein the single-domain antibody is ligated to the CAR extracellular hinge region, wherein the cancer is selected from brain cancer, liver cancer, cholangiocarcinoma, kidney cancer, breast cancer, prostate cancer, lung cancer, small cell lung cancer, ovarian cancer, cervical cancer, esophageal cancer, gastric cancer, pancreatic cancer, and colorectal cancer.

[0184] Further embodiments describe a method for diagnosing cancer characterized by cancer cells expressing at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cells, and include the following steps: a) Contacting the sample with a polypeptide that specifically binds to at least one globo series glycan selected from Globo H, Gb3, Gb4, and Gb5, as disclosed herein. b) To detect the binding of the polypeptide to the sample. c) Compare the bindings detected in step b) to a standard, where the binding differences associated with the sample are cancer features characterized by cancer cells expressing at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cells.

[0185] "Disease" is any condition which would benefit from treatment using the substances / molecules or methods described herein. "Cell proliferation disorders" and "proliferative disorders" refer to diseases that involve a certain degree of abnormal cell proliferation, such as cancer.

[0186] "Cancer" and "malignant" refer to or describe a physiological condition in mammals typically characterized by a cell proliferative disorder. Cancer generally includes, but is not limited to, carcinoma, lymphoma (e.g., Hodgkin lymphoma and non-Hodgkin lymphoma), blastoma, sarcoma, and leukemia. More specific examples of cancer may include squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, pancreatic cancer, glioma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, liver cancer, breast cancer, colon cancer, colorectal cancer, endometrial or uterine cancer, salivary gland cancer, kidney cancer, liver cancer, prostate cancer, vulvar cancer, thyroid cancer, liver cancer, leukemia and other lymphoproliferative disorders, and various types of head and neck cancers.

[0187] "Tumor" refers to the growth and proliferation of all neoplastic cells, whether malignant or benign, and all precancerous and cancerous cells and tissues. The terms "cancer," "cancerous," "proliferative disorder," "proliferative disorder," and "tumor" are not mutually exclusive as used herein.

[0188] "Metastasis" refers to the spread of cancer and / or tumors from their primary site within an individual's body to other locations. "Treatment," "treat," or "treating" refers to a clinical intervention in an attempt to alter the natural course of a disease in an individual being treated, and may be carried out either for prevention or during the course of clinicopathology. Desired outcomes in treatment may include, but are not limited to, preventing the onset or recurrence of the disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of progression, improving or alleviating the disease state, and achieving remission or improving prognosis. For example, treatment may include administering to a patient a therapeutically effective amount of a pharmaceutical formulation containing an anti-globo H antibody to slow the development or progression of cancer, wherein the cancer cells of the cancer express at least one globo-series glycan selected from globo H, Gb3, Gb4, and Gb5 on the surface of the cancer cells.

[0189] A "pharmaceutical preparation" refers to a preparation in which the biological activity of the active ingredient is activated and which does not contain additional ingredients that are toxic to the target of administration. A "pharmaceutically acceptable carrier" refers to a component of a pharmaceutical preparation other than the active ingredient that is non-toxic to the target recipient of the pharmaceutical preparation. Pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, or preservatives.

[0190] "Therapeutic dose" refers to the amount of active ingredient or drug (e.g., formulation) necessary to achieve a desired therapeutic or preventive outcome in order to treat or prevent a disease or disorder. In the case of cancer, the therapeutic dose of a drug is the amount that reduces the number of cancer cells, reduces the size of the primary tumor, inhibits (i.e., slows, preferably stops) the invasion of cancer cells into peripheral tissues, inhibits (i.e., slows, preferably stops) tumor metastasis, inhibits tumor growth to some extent, and / or alleviates to some extent one or more signs associated with cancer. A drug may be cell proliferation inhibitory and / or cytotoxic to the extent that it can prevent the growth of cancer cells and / or kill existing cancer cells. In the case of cancer treatment, in vivo efficacy can be measured, for example, by evaluating survival, time to progression (TTP), response rate (RR), duration of response, and / or quality of life.

[0191] "Individual" or "subject" refers to mammals, including but not limited to livestock (e.g., cattle, sheep, cats, dogs, and horses), primates (e.g., humans, and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).

[0192] "Anticancer drugs" refer to drugs useful in treating cancer. Exemplary anticancer drugs include, but are not limited to, chemotherapeutic agents, growth inhibitors, cytotoxic agents, drugs used in radiotherapy, anti-angiogenic agents, apoptotic agents, antitubulin agents, and other drugs for treating cancer, anti-CD20 antibodies, platelet-derived growth factor inhibitors, COX-2 inhibitors, interferons, cytokines, antagonists that bind to one or more targets (e.g., PDGFR-beta, APRIL, BCMA receptor, TRAIL / Apo2), other bioactive substances and organic chemicals, and combinations thereof.

[0193] Use of single-domain antibodies for cancer diagnosis A further embodiment of the present invention is a diagnostic kit for detecting cells expressing at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cell, comprising a globo-series glycan-conjugated polypeptide containing at least one single-domain antibody that specifically conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain. In addition to the polypeptide conjugated to at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, the kit may further comprise reagents necessary for labeling and / or detecting and / or quantifying antigen-binding cells.

[0194] In other words, the present invention is also directed to a diagnostic kit comprising at least one single-domain antibody that specifically binds at least one globo-series glycan selected from globo-H, Gb3, Gb4, and Gb5, or a globo-series glycan-binding polypeptide comprising a variant of the variable domain, for screening cancer characterized by cells expressing at least one globo-series glycan selected from globo-H, Gb3, Gb4, and Gb5 on the surface of the cells, or a globo-series glycan-binding polypeptide comprising a variant of the variable domain.

[0195] Another aspect of the present invention is a diagnostic kit comprising a globo-series glycan-binding polypeptide for screening cancer characterized by the expression of at least one globo-series glycan selected from globo-H, Gb3, Gb4, and Gb5 on the surface of cells, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the at least one single-domain antibody is humanized by substituting one or more amino acid residues located at positions 1, 5, 11, 28, and 30 of FR1, positions 44, and 45 of FR2, positions 74, 75, 76, 83, 84, 93, and 94 of FR3, and positions 104, and 108 of FR4.

[0196] As described above, the single-domain antibody in the present invention can be used for diagnostic purposes when it is linked to an effector molecule that is a detectable label. Suitable detectable labels and techniques for binding, using, and detecting single-domain antibodies in the present invention will be apparent to those skilled in the art, for example, fluorescent molecules (e.g., fluorescein, isothiocyanates, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthalaldehyde, and fluorescein, as well as fluorescent metals such as Eu or other metals from the lantanide series), phosphorescent molecules, chemiluminescent molecules or bioluminescent molecules (e.g., luminal, isoluminol, theromatic acridinium esters, imidazole, acridinium salts, oxalates, dioxetane or GFP, and their analogs), radioisotopes, metals, metal chelates or metal cations, or other metals, or in vivo, in vitro, in situ Metal cations, as well as chromophores and enzymes (e.g., malate dehydrogenase, staphylococcal nuclease, delta-V-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, biotinavidin peroxidase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-VI-phosphate dehydrogenase, glucoamylase, and acetylcholinesterase) are particularly suitable for situ diagnosis and imaging.

[0197] Accordingly, a further embodiment of the present invention is a diagnostic kit comprising a polypeptide that specifically conjugates a globo-series glycan, including at least one single-domain antibody or a variant of the variable domain, for screening cancer characterized by cells expressing at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 on the surface of the cells, wherein the single-domain antibody further comprises at least one effector molecule linked to the single-domain antibody, conjugating at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the effector molecule is selected from the group including fluorescent molecules, phosphorescent molecules, chemiluminescent molecules, bioluminescent molecules, radioisotopes, and chromophores.

[0198] Polypeptides containing multimeric single-domain antibodies Embodiments of the present invention are polypeptides that specifically conjugate globo-series glycans comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from globoH, Gb3, Gb4, and Gb5, wherein the number of single-domain antibodies conjugating at least one globo-series glycan selected from globoH, Gb3, Gb4, and Gb5 is at least 2.

[0199] Polypeptides containing at least two single-domain antibodies have the advantage of higher affinity to the target, as demonstrated by the sdAb46 trimer (Figure 23).

[0200] A particular embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the number of single-domain antibodies conjugating at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 is at least two, wherein the two or more single-domain antibodies have different sequences.

[0201] A more specific embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the number of single-domain antibodies conjugating at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 is at least two, wherein the two or more single-domain antibodies have identical sequences.

[0202] A more specific embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the number of single-domain antibodies conjugating at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 is 3, wherein two or more single-domain antibodies have identical sequences.

[0203] A more specific embodiment of the present invention is a polypeptide that specifically conjugates a globo-series glycan comprising at least one single-domain antibody, wherein the single-domain antibody is a variable domain of a heavy-chain antibody that naturally lacks a light chain and a constant region 1, or a variant of the variable domain, wherein the single-domain antibody conjugates at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5, wherein the number of single-domain antibodies conjugating at least one globo-series glycan selected from GloboH, Gb3, Gb4, and Gb5 is 3, wherein the single-domain antibody has at least 90% sequence identity with SEQ ID NO5.

[0204] Single-domain antibodies may be conjugated to the globo-series glycans disclosed herein, specifically by methods known in the art or any future methods, to form one of the polypeptides comprising two or more single-domain antibodies. Single-domain antibodies may be conjugated non-covalently (e.g., using streptavidin / biotin combinations, antibody / tag combinations) or covalently. They may also be fused by chemical crosslinking by reacting amino acid residues with organic derivatizing agents.

[0205] Alternatively, single-domain antibodies can be genetically fused at the DNA level. One method of linking single-domain antibodies is via a genetic pathway, either directly or through a peptide linker, by ligating the single-domain antibody coding sequence. For example, the C-terminus of one single-domain antibody can be ligated to the N-terminus of the next single-domain antibody. This ligation method can be extended to link additional single-domain antibodies for the construction and generation of functional constructs such as tri-, tetra-, etc. Furthermore, single-domain antibodies can be ligated to form dimers via glutathione S-transferase (GST) (e.g., described in Smith DB, Johnson KS, Gene 1988; Tudyka T, Skerra A, Protein Sci 2008) and dodecamers (Bordeaux et al., Sci Rep 2020; CA3076791A1) that utilize the scaffold protein dodecine derived from Mycobacterium tuberculosis mtDod. [Drawing description] [Brief explanation of the drawing]

[0206] [Figure 1] This diagram shows the procedure used for the development of alpaca sdAbs of the present invention that specifically bind globo-series glycans. [Figure 2]The structures of the Globo series glycans GloboH, Gb3, Gb4, Gb5, SSEA3, and SSEA4 are shown. [Figure 3] This shows an electrophoretic blot for evaluating the load of CRM197 carrier protein on GloboH. [Figure 4] This shows the binding of serum antibodies to native globo-series glycans. Flow cytometry results of immunized alpaca serum from week 0 (red) and week 7 (blue, final week) show the generation of antibodies capable of binding to breast cancer cells (MCF-7) expressing globo-series glycans. [Figure 5]The printed pattern of the glycan array is shown. The glycans were printed three times on epoxy-coated slides. Each color indicates a specific glycan type. Controls and oligosaccharides are shown adjacent to each other in the grid and include galactose, 6× His-tagged sdAb, GloboH, and various types of glycosylphosphatidylinositol (GPI). Legend: control; PB, buffer; FS8, galactose; C6, rhamnose; 2 His-tagged, sdAb control for 6× His-specific antibody (Atto 6479);297, Fuc(a1-2)Gal(b1-3)GalNAc(b1-3)Gal(a1-4)Gal(b1-4)Glc(b1-1)aminopentanol-GloboH;221, Glc(a1-4)GalNac(b1-4)[Man-6-PEtN(a1-2)Man(a1-6)Man(a1-4)GlcN(a1-6)Ino(1-P)phosphothiohexanol-GPI;222, GalNac(b1-4)[Man-6-PEtN(a1-2)Man(a1-6)]Man(a1-4)GlcN(a1-6)Ino(1-P)phosphothiohexanol-GPI29(T.Gondii); 223, GalNac(b1-4)[Man-6-PEtN(a1-2)Man(a1-6)]Man-2-PEtN(a1-4)GlcN(a1-6)Ino(1-P)phosphothiohexanol-GPI32(mammal); 224, GalNac(b1-4)[Man(a1-2)Man(a1-6)]Man(a1-4)GlcN(a1-6)Ino(1-P)phosphothiohexanol-G PI37 (unnatural); 228, GlcN(a1-6)Ino(1-P)phosphothiohexanol-GPI pseudodisaccharide; 225, Glc(a1-4)GalNAc(b1-4)Man(a1-1)aminopentanol-GPI substructure; 226, Glc(a1-4)GalNAc(b1-4)[Man(a1-2)Man(a1-1)aminopentanol-GPI substructure; 227, Glc(a1 -4)GalNAc(b1-4)[Man-6-PEtN(a1-2)Man(a1-6)]Man(a1-1)aminopentanol-GPI substructure; 172, Gal(b1-3)GalNAc(b1-3)Gal(a1-4)Gal(b1-4)Glc(b1-1)aminopentanol-GB5(aminolinker); 174, Gal(a1-4)Gal(b1-4)Glc(b1-1)aminopentanol-GB3(A Minolinker); 371, GlcNAc(b1-3)Gal(a1-4)Gal(b1-4)Glc(b1-1)aminopentanol; 11, Gal(b1-4)Glc(b1-1)aminohexanol-lactose (aminolinker); Positions D2-D10, E3, F4-F6 indicate the positions of the stock compounds on the 96-plate, which are used by the printing robot to individualize the position of each sample. [Figure 6] This report presents quantitative glycan array results showing a gradual increase in the immune response to synthetic GloboH and Gb5 in immunized alpacas over several weeks. [Figure 7] This image shows a glycan array (with diagrams of structures) from week 7 (the final week) of a serological test demonstrating the specific binding of serum antibodies to various globo family synthetic glycans. Black stars indicate control glycan structures. [Figure 8] This graph shows the analysis of GloboH binding of affinity-eluted antibodies using a glycan array. The bars in the graph represent the average fluorescence intensity of antibodies eluted from empty (red) and GloboH-coated (blue) beads. The results demonstrate the specificity of the affinity-purified antibodies, which were then subjected to gel electrophoresis to separate sdAb. [Figure 9] This shows gel electrophoresis separation of affinity-purified antibodies. The green arrow indicates 13kDa sdAb(VHH) extracted from the gel for further trypsin digestion and mass spectrometry. [Figure 10] This shows recombinant expression of selected single-domain antibody sequences in Escherichia coli (E. coli). A) Gel electroporation of samples obtained after various purification and washing steps of cell extracts from Arctic Express® Escherichia coli (E. coli) designed to express sdAb46. Precipitate (P) and lysate (L), flow-through (FT), washing fraction 1 and washing fraction 2 (W1 and W2), eluate after nickel-NTA (E), and final sdAb product (sdAb) of Arctic Express® Escherichia coli (E. coli) are shown. Arrows indicate the final washing step and the presence of high-purity sdAb samples. B) The lower panel shows S200 size exclusion chromatography of sdAb46, showing expression in high yield (50 mAU) and high elution rate correlated with 14 kDa protein (arrows). [Figure 11] This shows the binding of purified sdAb to synthetic GloboH. Synthetic GloboH glycan was immobilized on a C1 surface plasmon resonance chip, and the binding of various sdAb was tested. Among the various sdAb tested, sdAb37 (Figure 11) is shown. SdAb46 showed the highest affinity, with an average affinity of 54 nM. [Figure 12]This shows the binding of purified sdAb to synthetic GloboH. Synthetic GloboH glycan was immobilized on a C1 surface plasmon resonance chip, and the binding of various sdAb was tested. Among the various sdAb tested, sdAb46 (Figure 12) is shown. SdAb46 showed the highest affinity, with an average affinity of 54 nM. [Figure 13] This shows the binding of purified sdAb to synthetic GloboH. Synthetic GloboH glycan was immobilized on a C1 surface plasmon resonance chip, and the binding of various sdAb was tested. Among the various sdAb tested, sdAb62 (Figure 13) is shown. SdAb46 showed the highest affinity, with an average affinity of 54 nM. [Figure 14A] This shows the binding of purified sdAbs to naturally occurring globo-family glycans expressed by cancer cells. Flow cytometry (FACS) analysis was performed to test the binding of various sdAbs to cancer cells (MCF-7) expressing globo-family glycans (top panel). Positive results were further verified using confocal microscopy (bottom panel). A commercially available anti-globoH antibody VK9 was used as a positive control, and only the secondary antibody was used to exclude nonspecific binding of the secondary antibody (bottom right panel). [Figure 14B] This shows the binding of purified sdAbs to naturally occurring globo-family glycans expressed by cancer cells. Flow cytometry (FACS) analysis was performed to test the binding of various sdAbs to cancer cells (MCF-7) expressing globo-family glycans (top panel). Positive results were further verified using confocal microscopy (bottom panel). A commercially available anti-globoH antibody VK9 was used as a positive control, and only the secondary antibody was used to exclude nonspecific binding of the secondary antibody (bottom right panel). [Figure 15] A graph of FACS results showing the binding levels of expressed and purified sdAbs to MCF-7 cancer cells is shown. [Figure 16]This shows the binding specificity of various globo-series glycans tested by FACS binding analysis. Specific binding of sdAbs to various cancer cells differs depending on the expression levels of globo-family glycans on the surface of the analyzed cancer cells. The specificity of sdAb62 was tested in cancer cell lines expressing various globo-series glycans. The results show a clear difference in binding population size due to Gb3 expression in HEK293 kidney cells (black curve). [Figure 17] This shows the purification of GloboH-bound sdAbs. SdAbs were expressed in SHuffle cells (registered trademark), extracted by French press cell lysis, and purified by Ni2+-NTA affinity chromatography and size exclusion chromatography (SEC). a) SDS-PAGE of a sample taken during the purification of sdAb46 is shown. The gel was stained with PageBlue Protein Staining Solution. M represents the PageRuler Prestained Protein Ladder 10-180kDa. FT represents the flow-through. W1 represents the first wash fraction. W2 represents the second wash fraction. b) The SEC chromatogram shows the UV absorbance at 280 nm, which is used to detect protein elution. A HiLoad 16 / 600 Superdex 75 (S75) prep-grade column was used in the FPLC system. An asterisk (*) indicates the fraction used for SDS-PAGE. [Figure 18A]The binding epitope and binding structure of Globo-H to sdAb46, as analyzed by saturation transfer difference nuclear magnetic resonance (STD NMR), are shown. a) STD NMR experiments reflecting the interaction between sdAb46 and Globo-H are shown. From top to bottom: (1) Reference spectrum of Globo-H. Isolated signals indicating magnetization transfer are highlighted in bold. (2) STD spectrum of 4 mM Globo-H in the presence of 60 μM sdAb46. (3) STD spectrum of 4 mM Globo-H in the presence of 110 μM sdAb46. (4) STD spectrum of 4 mM Globo-H. Residual water signals were not suppressed to allow observation of Fuc and Gal3 anomeric protons. [Figure 18B] The binding epitope and binding structure of Globo-H to sdAb46, analyzed by saturation-transition-difference nuclear magnetic resonance (STD NMR), are shown. b) The binding epitope of Globo-H bound to sdAb46 from a single saturation time of 4 seconds is shown. STD amplification constants for protons not shown are unavailable due to signal overlap. STD NMR experiments were obtained at 600 MHz and 277 K. XXX = 100-67%, XX = 67-33%, X = 33-0%. [Figure 18C] The binding epitope and binding structure of Globo-H to sdAb46, as analyzed by saturated migration difference nuclear magnetic resonance (STD NMR), are shown. c) The NOE increase rate of Globo-H versus mixing time (ms) at 600 MHz and 298 K with and without sdAb46 is shown. The curves represent the binding affinity within pyranose (Fuc-CH3 / Fuc-H5) and between pyranoses (Fuc-H1 / Gal5-H2). The sdAb to carbohydrate ratio is 1:16.4. I) Globo-H + sdAb46, Fuc-CH3 / Fuc-H5, II) Globo-H + sdAb46, Fuc-H1 / Gal5-H2, III) Globo-H free, Fuc-CH3 / Fuc-H5, IV) Globo-H free, Fuc-H1 / Gal5-H2. [Figure 19A]The generation and purification of the trivalent sdAb46 fusion protein are shown. a) A schematic diagram of the molecular cloning strategy is shown. Mutagenic PCR was performed to exclude the expression of the cell-lysic peptide TACHY, and a stop codon (*) was inserted. b) Agarose gel electrophoresis of the PCR product (left) and restriction enzyme digestion product (right) is shown. L indicates the 1kb DNA ladder. [Figure 19B] c) The generation and purification of the trivalent sdAb46 fusion protein are shown. c) Expression testing of the sdAb46 trimer construct in shuffled cells is shown. SDS-PAGE of bacterial precipitates before (pre) and after (post) IPTG induction is shown. d) Solubility testing of the sdAb46 trimer construct is shown. SDS-PAGE of precipitates and lysates after cell lysis by sonication is shown. e)~f) Ni2+-NTA purification of sdAb46 trimer inclusions using FPLC is shown. Chromatograms are shown in e), and SDS-PAGE gel images of input, flow-through (FT), and elution fractions 1-4 are shown in f). M represents the Page Ruler Prestained Protein Ladder 10-180 kDa. [Figure 20A] This shows the binding of sdAb46 monomer and sdAb46 trimer to cancer cells. a)-c) IMR5 neuroblastoma cells (negative control) and MCF7 breast cancer cells were stained with sdAb46 monomer, sdAb46 trimer, or the commercially available Globo H-specific antibody VK9, followed by staining with anti-6×His-AF647 or anti-IgG-Atto635 secondary antibodies, respectively. a) Flow cytometry histograms show the frequency of fluorescently labeled IMR5 cells (upper panel) and MCF7 cells (lower panel). The control with secondary antibody only is shown in gray on the left. The graph on the left was obtained using the VK9 antibody, and the graph on the right was obtained using sdAb46. The data represent three independent experiments, each performed two or three times. [Figure 20B]This shows the binding of sdAb46 monomer and sdAb46 trimer to cancer cells. a)-c) IMR5 neuroblastoma cells (negative control) and MCF7 breast cancer cells were stained with sdAb46 monomer, sdAb46 trimer, or the commercially available Globo H-specific antibody VK9, followed by staining with anti-6×His-AF647 or anti-IgG-Atto635 secondary antibodies, respectively. b) This shows the frequency of positive cells based on the gate shown in a). [Figure 20C] The binding of sdAb46 monomer and sdAb46 trimer to cancer cells is shown. a)-c) IMR5 neuroblastoma cells (negative control) and MCF7 breast cancer cells were stained with sdAb46 monomer, sdAb46 trimer, or the commercially available Globo H-specific antibody VK9, followed by staining with anti-6×His-AF647 or anti-IgG-Atto635 secondary antibodies, respectively. c) Confocal laser scanning microscope images of MCF7 (left) and IMR5 (right) are shown. Red indicates detection of signals generated by anti-6×His-AF647 or anti-IgG-Atto635 secondary antibodies. Cell nuclei were stained using DAPI (BLUE channel). TM light shows transmitted light images. White scale bar indicates 20 μm. [Modes for carrying out the invention]

[0207] The following embodiments are included to demonstrate preferred embodiments of the present invention. Those skilled in the art will understand that the techniques disclosed in the following embodiments represent techniques discovered by the inventors to function well in the implementation of the present invention and can therefore be considered to constitute a preferred form for such implementation. However, those skilled in the art will understand that many modifications can be made in light of this disclosure to the specific embodiments disclosed, and that similar or comparable results can be obtained without departing from the scope of the present invention.

[0208] Further modifications and alternative embodiments of the invention in various aspects will be apparent to those skilled in the art through consideration of this specification. Consequently, this specification should be interpreted as illustrative only and is intended to teach those skilled in the art general ways of carrying out the invention. It should be understood that the forms of the invention shown and described herein should be considered examples of embodiments. Elements and materials may be used instead of those described and described herein, parts and processes may be reversed, and certain features of the invention may be used independently, all of which will be apparent to those skilled in the art after benefiting from this specification of the invention. Modifications to the elements described herein may be made without departing from the scope of the invention, as described in the following claims.

[0209] [Examples] method: Preparation of CRM197-thiol GloboH complex carbohydrates for alpaca immunization. 1 mg of GloboH, functionalized using a thiol linker, was reduced in 120 μl of water at 1500 rpm for 1 hour with 0.6 equivalents (eq.) of resin-bound tris(2-carboxyethyl)phosphine (TCEP). The resin was removed by filtration through a 0.22 μm syringe filter, and the filter was washed five times with 50 μl of water. The final wash was analyzed by thin-layer chromatography and sugar staining to confirm that no GloboH remained on the filter. The filtrate and all washing fractions were lyophilized together. 100 eq. succinimidyl 3-(bromoacetamide)propionate was dissolved in 30 μl of dimethylformamide (DMF) and added dropwise with stirring to a solution containing 1 mg of CRM197 in 750 μl of coupling buffer (0.1 M Na2HPO4 / NaH2PO4 pH 7.4). After 1 hour, the solution was washed four times with 350 μl of water on a 0.5 ml equilibrated centrifuge filter (Amicon Ultra, MWCO=10k) at 10,000 rpm for 8 minutes. Before the final wash, a 10 μl aliquot was collected for mass spectrometry. Subsequently, the solution was washed with 350 μl of conjugation buffer (0.1 M Na2HPO4 / NaH2PO4 at pH 8.0), and collected in a new tube by centrifugation at 1,000 rpm for 2 minutes with the filter inverted. The lyophilized and reduced GloboH was returned to the conjugation buffer (pH 8) and added to the protein solution. The reaction solution was allowed to stand slowly and agitated for 24 hours.

[0210] The following day, the reaction solution was washed three times with 350 μl of water. Before the final wash, a 10 μl aliquot was collected for mass spectrometry. Subsequently, the solution was washed with 350 μl of conjugation buffer (pH 8), and 150 equivalents of cysteine ​​were added directly to the centrifuge filter. After 1 hour incubation, the reaction solution was washed three times with 350 μl of water. Before the final wash, a 10 μl aliquot was collected for mass spectrometry. Finally, the solution was washed with 350 μl of sterile phosphate-buffered saline, and collected in a new tube by centrifugation at 1,000 rpm for 2 minutes with the filter inverted. After mass spectrometry of the sample collected throughout the conjugation, the GloboH loading of CRM197 (shown below) was determined by comparing the mass peaks before and after conjugation (Figure 3).

[0211] [ka]

[0212] Alpaca immunization Adult female alpacas were immunized with CRM197-GloboH complex carbohydrates containing 15 μg of GloboH / dose in phosphate-buffered saline. The alpacas were subcutaneously injected along the base of the neck using a 22G needle. The total immunization period was 6 weeks, with a 2-week gap between the third and fourth injections, so the vaccination dates were 0 / 7 / 14 / 28 / 35 / 42. Whole blood extraction was performed 9 days after the last immunization (day 51).

[0213] Isolation of serum and peripheral blood mononuclear cells (PBMCs) Whole blood (150 ml) for serum separation was collected in a 50 ml tube, incubated at RT for 1 hour, and then centrifuged at 2,000 g / 10 min / RT. The serum was divided equally into sterile 15 ml tubes (7.5 ml each), rapidly frozen using liquid nitrogen, and further stored at -80°C.

[0214] For PBMC isolation, 100 ml of whole blood was collected in a 10 ml EDTA-coated tube (BD Vacutainer®) and inverted 10 times. PBMCs from the undiluted whole blood were isolated by uninterrupted centrifugation at 1000 g / 30 min / RT using UNI-SEPmaxi U16 (NOVAMED). The PBMC layer was separated into sterile 50 ml tubes, washed with PBS, and isolated by centrifugation three times at 400 g / 10 min / 4 c. The last 25 ml was centrifuged and dissolved in 14 ml of RNAlater®. Cells were divided into 5 vials. * 10 7 The sample was divided into 1.5 ml RNAse-free tubes using PBMC, stored in a slow-freezing container (Mr.Frosty®) at -80°C for 24 hours, and then stored at -80°C.

[0215] Glycan array for analyzing the binding of serum antibodies to synthetic Globo-series glycans. Glycan microarrays were printed in the laboratory on epoxy-coated glass slides using 0.2 mM synthetic glycans and 250 μg / mL His-tagged sdAb as a control. Each slide contained a repeating glycan grid, each containing 16 spots of a different glycan. The printed patterns are shown in Figure 5. The slides were blocked at 37°C for 1 hour in HEPES buffer (10 mM HEPES (pH 7.4), 1 mM CaCl2, 1 mM MgCl2) supplemented with 1% BSA. Simultaneously, solutions containing 50 μL of sdAb solutions at 4 μg / mL, 10 μg / mL, and 20 μg / mL in the same buffer were incubated in the dark at 30°C with a 1:5000 dilution of 6 × His-specific antibody (Atto647). The blocked slides were washed once with HEPES buffer without BSA and once with ddH2O. To remove all liquid, the slides were centrifuged at 300g for 3 minutes. The slides were assembled in a microplate holder so that single grids could be stained separately with different sdAbs. The sdAb / antibody mixture was pipetted into the wells, and the sdAb-glycan binding was left in a humidified chamber in the dark at 30°C for 1 hour. The wells were washed three times with HEPES buffer supplemented with 0.05% Tween, once with ddH2O, dried by centrifugation, and then directly scanned using a Glycan Array Scanner Axon GenePix® 4300A. Binding was analyzed using GenePix Pro 7.

[0216] VHHcDNA library construction and high-throughput sequencing RNA was isolated from alpaca PBMCs using the RNeasy MiniKit (Qiagen). cDNA was prepared using oligo-dT primers and the SuperScript II reverse transcriptase kit (Invitrogen). The VHH variable region was specifically amplified from the cDNA by two-step nested PCR. In the first step, primers CALL001:GTCCTGGCTGCTCTTCTACAAGG (leader sequence specific, SEQ ID NO: 132) and CALL002:GGTACGTGCTGTTGAACTGTTCC (CH2 specific, SEQ ID NO: 133) were used. Following gel purification and size selection of the 600bp region, and then MinElute cleanup (Qiagen), a second PCR was performed to extract the VHH region using primers VHH_back:GATGTGCAGCTGCAGGAGTCTGGRGGAGG (SEQ ID NO:134) and VHH_For:GGACTAGTGCGGCCGCTGGAGACGGTGACCTGG (SEQ ID NO:135), followed by gel extraction of the 400bp band.

[0217] Illumina sequencing libraries were prepared according to the TruSeq protocol without shearing, i.e., without starting with the end repair step. Each library was sequenced with 2 × 250 bp chemistry on an Illumina MiSeq instrument, yielding 6.9 million / 6.6 million read pairs per sample. The original PCR fragments were reconstructed by superimposing forward and reverse reads using BBmerge(https: / / github.com / BioInfoTools / BBMap / blob / master / sh / bbmerge.sh).

[0218] Affinity purification of GloboH-specific standard antibody and heavy chain-only antibody for isolating GloboH-bound VHH fragments from alpaca serum. Preparation of synthetic Globo H-binding beads 1 mg of GloboH, functionalized using a thiol linker, was reduced for 1 hour at 1500 rpm and RT with a solution containing 0.6 equivalents of resin-bound TCEP in 120 μl of water. The resin was removed by filtration through a 0.22 μm syringe filter, and the filter was washed five times with 50 μl of water. The final wash was analyzed by thin-layer chromatography and sugar staining to confirm that no GloboH remained on the filter. The filtrate and all washing fractions were freeze-dried together. The reduced GloboH was coupled to 1 ml of agarose bead sulfolink® coupling resin (Thermo Fisher Scientific) according to the manufacturer's instructions.

[0219] Separation of IgG and heavy chain antibodies using protein A / G beads To separate conventional IgG and heavy-chain-only antibodies, alpaca serum samples were thawed, and 7.5 ml aliquots were diluted with 67.5 ml of 20 mM sodium phosphate at pH=7 and filtered using a 0.22 mm filter. 3 ml of protein A / G electromagnetic beads (Pierce) were pre-washed with 20 mM sodium phosphate at pH=7. These samples were then incubated at RT for 1 hour with rotation. After collecting the flow-through, the beads were washed with 100 ml of 20 mM sodium phosphate at pH=7. The bound antibodies were eluted in 39 ml of 100 mM citrate at pH=2.75 into 50 ml tubes pre-filled with 11 ml of 1.5 M Tris (pH=8.8) to neutralize the eluted antibodies. The eluted samples were combined, concentrated by RT using Amicon 10kDa, and dialyzed overnight at pH=7.4 with 5L of 20mM sodium phosphate.

[0220] Isolation of GloboH-specific antibodies using synthetic glycan-binding beads. A Globo H-conjugated bead / empty bead control column was washed three times with water, followed by washing with 20 mM sodium phosphate at pH=7. The dialysis antibody sample obtained using A / G beads was then evenly distributed to the pre-equilibrated empty bead column and the Globo H-conjugated bead column with dialysis buffer and rotated at RT for 1 hour. The flow-through from each column was then switched between columns for another 1 hour at RT. Elution from both columns was performed using 20 mM sodium phosphate at pH=7, increasing the NaCl concentration (100 mM / 500 mM / 1 M / 3 M), followed by a final washing step with 20 mM NaH2PO4 adjusted to pH 5.2. 75 ml volumes of each washing step from both columns were concentrated using Amicon 10 kD and dialyzed overnight at 4°C against papain digestion buffer (20 mM sodium phosphate / 10 mM EDTA pH=7.1).

[0221] Papain cleavage of GloboH-specific antibodies A solution containing affinity-purified antibody in 20 mm sodium phosphate / 10 mm EDTA buffer was incubated with 5 mM L-cysteine ​​(Sigma-Aldrich) and 10–20 μl of papain-immobilized beads (Thermo Fisher Scientific) at 37c / 300 rpm for up to 90 minutes. The mixture was then centrifuged, and the supernatant was loaded onto a 4–20% acrylamide SDS-PAGE gel to extract the 13 kDa band corresponding to the VHH domain (Figure 9).

[0222] Mass spectrometry of affinity-purified VHH fragments VHH fragments separated by SDS-PAGE were excised from the gel and digested with trypsin. The resulting trypsin peptide was extracted from the gel and desalted using C18 Stage Tips. LC-MS / MS analysis was performed using an Orbitrap Fusion™ Lumos™ Tribrid™ mass spectrometer (Thermo Fisher Scientific) connected online to an Ultimate 3000 RSLCano Systems (Dionex, Thermo Fisher Scientific). The eluted peptides were ionized using an Easy-Spray Source (Thermo Fisher Scientific). Mobile phase A consisted of water and 0.1% v / v formic acid, and mobile phase B consisted of 80% v / v acetonitrile and 0.1% v / v formic acid. MS data was obtained in data-dependent mode using the highest speed option with a high-resolution Lumos instrument for both MS1 and MS2 spectra. HCD was applied for fragmentation. A peak list of the MS data was generated using MS transformation. Database searches against the high-throughput cDNA sequencing library were performed using a combination of a lab-modified Mascot search engine (Matrix Science) and a local installation of Llama Magic v1.0 with default parameters (https: / / github.com / FenyoLab / llama-magic).

[0223] Expression of Globo-series glycan-binding sdAbs Bacterial Transformation: The transformation plasmid vector (pET-22(+)b) contained an sdAb sequence fused to a C-terminal histidine tag, an IPTG-inducible regulatory system, ampicillin resistance, and a PelB periplasmic signaling sequence. The vector was transformed into Arctic Express® (DE3) competent Escherichia coli (E. coli) cells using heat shock transformation according to the manufacturer's protocol. 20 ng of DNA was added to 20–40 μL of bacteria. After heat shock, the transformed cells were incubated in SOC medium at 37°C for 1 hour, and then spread onto LB agar plates containing gentamicin resistance for Arctic Express® cells and ampicillin resistance for the expression plasmid with the desired sdAb sequence. The plates were incubated overnight at 37°C.

[0224] Colony PCR: Single colonies of transformed cells were tested for transformation efficiency by colony PCR. PCR reaction mixes were prepared on ice in PCR tubes using 2× PCR Master Mix, 0.1 μM forward and reverse primers, and nuclease-free water for 10 μL of reaction. Three clones from each transformation protocol were collected using a 10 μL pipette tip, directly pipetted into the reaction mix, and resuspended. PCR reactions were performed according to the manufacturer's recommended thermal cycling conditions shown in Table 2. 2 μL of 6× DNA loading dye was added to the PCR product and analyzed on a 1% agarose gel.

[0225] [Table 2]

[0226] Bacterial storage: Colonies of successfully transformed cells were inoculated and incubated overnight at 37°C in a shaking incubator (250 rpm) in 5 mL of LB medium supplemented with 50 μg / mL ampicillin and 20 μg / mL gentamicin. The following morning, 750 μL of the overnight culture was mixed with 750 μL of 50% glycerol, and the stock was stored at -80°C.

[0227] Expression and purification of GloboH sdAb from Arctic Express cells: Overnight cultures were initiated either by inoculating positive clones onto LB agar plates after transformation, or by inoculating from cryostocks onto LB medium supplemented with 50 μg / mL ampicillin and 20 μg / mL gentamicin. Starters were incubated overnight at 37°C with a shaker (250 rpm). The following morning, 150 mL or 1 L of main culture was subcultured with 50 μg / mL ampicillin and incubated overnight at a 1:100 dilution. These cultures were incubated at 30°C with shaking at 250 rpm until the OD600 reached 0.6. 500 μL of each culture was pipetted into a clean microcentrifuge tube for expression testing as an uninduced sample. The cultures were transferred to a 12°C shaker at 250 rpm, induced with 0.4 mM IPTG, and incubated for 24 hours. After incubation, an additional 500 μL sample was collected from each culture as the induced sample. Bacteria were collected by centrifugation at 6000 g at 4°C for 20 minutes, and the precipitate was stored at -20°C. To test expression efficiency, both the uninduced and induced samples were diluted in LB medium to 0.1 OD600 in 1 mL volumes. These suspensions were centrifuged at 14000 g for 5 minutes. The precipitate was dissolved in 20 μL of PBS and 5 μL of 5 × SDS sample buffer, and the samples were analyzed by SDS-PAGE.

[0228] Lysis of ArcticExpress® cells and purification of GloboH sdAb: The PelB signal sequence of the sdAb plasmid directed the secretion of the expressed sdAb into the E. coli periplasm. To obtain the periplasmic fraction of E. coli cells, only the outer membrane needs to be disrupted. The pellet from 150 mL of culture was thawed and resuspended in 300 μL of PBS supplemented with protease inhibitor mix. After six freeze-thaw cycles using dry ice and a 37 °C water bath, the sample was centrifuged at 3200 g for 1 h at 4 °C. The lysate was used directly for binding assays with MCF-7 cells. The pellet from 1 L of culture was thawed and resuspended in 20 mL of sodium phosphate sample buffer containing protease inhibitors. Freeze-thaw cycles were performed as described above, 20 units of DNAseI were added to the sample, and then the sample was centrifuged at 42000 g for 20 min at 4 °C. The lysate was used directly for further purification.

[0229] Nickel-NTA affinity chromatography: For affinity purification, 1 mL of nickel-NTA beads were loaded onto a chromatography column, washed with 2 CVs of ddH2O, and equilibrated with 2 CVs of sample buffer. Lysate obtained from 1 L of Escherichia coli (E. coli) Arctic Express® cells was added to the beads and incubated at RT for 90 minutes under rotation. The flow-through was then collected, and the beads were washed with 1 CV of sample buffer, 2 CVs of wash buffer 1, and 2 CVs of wash buffer 2. sdAb was eluted from the nickel beads using 2 CVs of elution buffer. Samples were collected from all purification and washing steps for subsequent SDS-PAGE analysis. The eluate was concentrated at 3200 g at 4°C using an Amicon® Ultra centrifugal filter unit with a size exclusion limit of 3 kDa, and the concentration was measured in-process by measuring the absorbance at 280 nm using Nanodrop®. If the concentration did not exceed 2.5 mg / mL, the eluate was concentrated to a final volume of less than 2 mL and dialyzed overnight at 4°C in PBS (pH 7.4) using a SnakeSkin® dialysis tube with a 3500 molecular weight cutoff.

[0230] SDS-PAGE to demonstrate the purification procedure (Figure 10A) To demonstrate the purification process of sdAb, the following samples were taken during the procedure: pellet (P) and lysate (L) of ArcticExpress® cells after centrifugation of the freeze-thaw sample, flow-through (FT), wash fractions 1 and 2 (W1 and W2) and eluate (E) after nickel-NTA, and the final sdAb product (sdAb), and / or other protein peaks shown in the FPLC chromatogram. Samples were prepared using 5× SDS sample buffer and denatured at 95 °C for 5 minutes. Discontinuous SDS-PAGE was performed as described by Laemmli, and the gel was stained with PageBlue™ protein staining solution for 15 minutes after rapid boiling in a microwave. Decolorization was performed using ddH2O, and the gel was imaged using a Gel Doc EZ imaging device.

[0231] Size exclusion chromatography (Figure 10B): Size exclusion was performed using FPLC (Fast Protein Liquid Chromatography) equipped with a HiLoad® Superdex® 16 / 600 75 pg column connected to an AKTA™ purifier. The dialysis sample was injected into a 2 mL loading loop and run at a flow rate of 0.75 mL / min with filtered and degassed PBS (pH 7.4). Protein peaks were measured at UV280, and 1 mL fractions were collected into a 96 deep well plate. SdAb was expected to elute at 75 - 85 mL, but samples from all protein-containing fractions were analyzed by SDS-PAGE. The sdAb-containing fractions were combined, concentrated using a 3 kDa cut-off Amicons® at 4 °C and 3200 g to a final concentration of ~1 mg / mL and used directly for further analysis or aliquoted, frozen in liquid nitrogen, and stored at -80 °C.

[0232] Surface Plasmon Resonance (SPR) SPR measurements were performed using a BIAcore T100 instrument (GE Healthcare). 7.5 μg of synthetic GloboH was immobilized onto a commercially available C1 sensor tip (GE Healthcare) by amine coupling chemistry. The tip was pre-activated with 100 mM glycine-NaOH (pH=12) supplemented with 0.3% Triton X-100. Immobilization was performed with 10 mM sodium acetate buffer (pH 5.5) at a flow rate of 15 μL / min for a contact time of 700 seconds. Each tip contained two flow cells, one of which functioned as a blank (flow cell 3), and the other with immobilized glycan (flow cell 4). SdAb was dialyzed overnight at 4°C with SPR running buffer (HEPES buffer). Contact, dissociation time, flow rate, and maximum test concentration varied for each sdAb and are shown in Table 3. Each sdAb was tested at five different concentrations, where the lowest concentration is a sequential 1:2 dilution of the maximum concentration shown. The same buffer solution supplemented with 2 M MgCl2 was used for regeneration after each binding event. Sensorgrams were analyzed using Biacore T200 control and evaluation software (GE Healthcare), and the signal difference between both flow cells was evaluated for data analysis. The equilibrium dissociation constant (KD) was determined by affinity and kinetic analysis. In affinity analysis, the binding response based on the steady-state binding level was plotted against the sdAb concentration to determine the equilibrium dissociation constant. Kinetic parameters were obtained by fitting sensorgrams to a 1:1 binding model using BIAevaluation software. The accuracy of the measurements was evaluated by the software, and the chi-squared value is displayed.

[0233] [Table 3]

[0234] Mammalian cell culture All cells were cultured at 37°C in 5% CO2. MCF-7 cells and HEK293T cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS), 1% penicillin / streptomycin (P / S), 2 mM glutamine, and 1% non-essential amino acids. They were then cultured in PBS (w / o Ca 2+ / Mg 2+ The cells were washed with ( ) and then trypsinized to detach adherent cells, and then subcultured every 2-3 days. The trypsinization was stopped using culture medium, and the cells were centrifuged at 300g for 5 minutes to remove the trypsin. The precipitate was resuspended in fresh medium, and the cells were seeded into new culture dishes in a ratio of 1:3 / 1:4 for MCF-7 and 1:6 / 1:8 for HEK293T cells. MDA-MB231 cells were cultured in RPMI1640 supplemented with 10% FBS and 1% P / S. The medium was refreshed every 2-3 days, and the cells were subcultured once a week in a ratio of 1:4 as described above.

[0235] To prepare frozen aliquots, use a confluent 75 cm 2 Cells were collected from the culture flask as described above, resuspended in 1 mL of medium supplemented with 5% DMSO, and frozen at -80°C in a freezer for 1 day. The frozen cells were transferred to liquid nitrogen. The cells were rapidly thawed at 37°C for 2 minutes and immediately resuspended in fresh medium. They were pelleted, the DMSO removed, resuspended in fresh medium, and refrozen at 75 cm³. 2 The seeds were sown in the culture flask.

[0236] Flow cytometry analysis of sdAb binding to cancer cells Establishing the optimal settings for FACS analysis: To analyze the binding of sdAbs to cancer cells by flow cytometry, the following parameters must be determined in advance: the concentration of the secondary antibody that detects sdAbs (anti-6×His tag labeled with Atto647), the concentration of the anti-GloboH antibody clone VK9 used as a positive control for each cell line tested, the voltage during flow cytometry measurement for forward and side scattering, and the FITC (fluorescein isothiocyanate) and APC (allophycocyanin) detectors. For each flow cytometry analysis, cells were harvested at a culture density of 70-80% as described in "Culture of Mammalian Cells" above. The cell precipitate was resuspended in PBS + 1% BSA and 0.5 x 10⁶ per condition. 6 The cells were transferred to 1.5 mL Ependorff tubes. After pelleting them again at 250 g for 5 minutes, one cell precipitate was diluted in PBS as a blank cell, and the other was resuspended in 250 μL of FACS buffer (PBS + 1% BSA + SYBR® Safe (released via FITC channel)). To adjust the dilution of anti-His antibody, 1:100, 1:500, 1:1000, and 1:5000 dilutions in PBS + 1% BSA were tested. The precipitates were resuspended in 50 μL of the corresponding solution and incubated at RT for 45 minutes. Simultaneously, the three precipitates were incubated in 50 μL of solution containing 5, 10, or 20 μg / mLVK9 in PBS + 1% BSA. The cells were then washed twice by centrifugation and resuspension in 500 μL of PBS + 1% BSA. VK9-treated samples were further stained with an anti-mouse secondary antibody (Alexa Fluor 635) by RT for 45 minutes, and then washed as described above. After the final centrifugation step, the stained cell precipitate was resuspended in 250 μL of FACS buffer. All samples were transferred to FACS tubes, and data acquisition was performed using a FACSCanto® II instrument (BD).

[0237] Screening of antibodies that bind to globo-series glycans using MCF-7 cells As described above, the E. coli lysate obtained from 150 mL of culture was directly tested with MCF-7 cells. For this purpose, cells were collected as described above, and 0.5 x 10⁶ cells were used per sample. 6 The cells were transferred to 1.5 mL tubes. After centrifugation at 300 g for 5 minutes, the cell precipitate was resuspended in 50 μL of the corresponding lysate and incubated at RT for 45 minutes on a shaker. Furthermore, a negative control using PBS alone and a positive control using 5 μg / mLVK9 were included in all runs. Subsequently, the cells were washed twice, and after the final washing step, all precipitates except the VK9 control were resuspended in the anti-His antibody solution determined in the previous step (PBS + 1% BSA at 1:1000) and incubated at RT for a further 45 minutes on a shaker. VK9 stained cells were resuspended in 50 μL of a 1:400 dilution of the corresponding fluorescent anti-mouse antibody (AlexaFluor 635). After two further washes, the cells were fixed in 100 μL of 4% paraformaldehyde (PFA) solution in PBS, centrifuged, and the precipitate was resuspended in 250 μL of FACS buffer. Data were recorded using the settings determined in the previous step and analyzed using FlowJo® software. Recorded events were gated to select only single intact cells for analysis. By applying the gate to all samples and overlaying the APC histograms of sdAb-stained cells with the APC histograms of negative control cells, binding could be observed by peak shifts. To quantify the shifts and rank the strongest potential binders, an additional gate defining a positive gate for the binder was created in single-cell selection. APC on parent gate + The frequency of single cells was determined for all sdAbs using FlowJo® software.

[0238] Flow cytometry-linked analysis of purified sdAb in different cell lines After testing the binding of E. coli lysates as described above, sdAbs were purified from the identified positive binders and further tested for binding to MCF-7 cells. The procedure was the same as described in the screening, except that the cell precipitate was resuspended in 50 μL of a 0.4 mg / mL purified sdAb solution in PBS instead of E. coli lysates. By using the same concentrations, the binding strength of different sdAbs was compared. Furthermore, the same binding assay was performed in MDA-MB231 cells expressing all Globo family glycans and HEK293T cells that do not express GloboH.

[0239] Confocal laser scanning microscope (LSM) To verify the binding of sdAb to MCF-7 cells using a confocal microscope, 20,000 cells were seeded onto 12 mm coverslips in 24-well cell culture plates to 50–60% confluence for staining two days prior to analysis. The medium was aspirated, and the cells were rinsed twice with PBS and then fixed in 4% PFA at RT for 10 minutes. To remove the PFA, the wells were washed with PBS for 3 × 5 minutes, and then blocked in PBS + 1% BSA for 1 hour. 50 μL of purified sdAb at 1 μg / μL was dropped onto a piece of Parafilm and the coverslips with the attached cells were placed on top. One coverslip was placed in a well as a negative control, and a solution containing 5 μg / mL VK9 in PBS was used as a positive control. The coverslips with sdAb were incubated at RT in a humidified chamber for 1 hour. They were then returned to the wells and washed with PBS for 3 × 5 minutes. 200 μL of Atto647 anti-6×His antibody (1:5000 in PBS + 1% BSA) was added to the cells and incubated at RT for 1 hour with gentle shaking. VK9-positive control was stained with a 1:400 dilution containing mouse-IgG-specific (AlexaFluor635) secondary antibody in PBS + 1% BSA. After three further washes with PBS, 10 μL of mounting medium was pipetted onto a microscope slide, and the coverslip containing the stained cells was placed on top. The slide was dried overnight, and microscopic examination was performed the following day using an AxioImager M2 confocal LSM800 (Zeiss). The parameters for analysis were set based on VK9 staining as both a negative and positive control.

[0240] [Table 4-1]

[0241] [Table 4-2]

[0242] [Table 4-3]

[0243] Table 4-4

[0244] Table 4-5

[0245] Table 4-6

[0246] Table 4-7

[0247] Table 4-8

[0248] Table 4-9

[0249] Table 4-10

[0250] Table 4-11

[0251] Table 4-12

[0252] Table 4-13

[0253] [Table 4-14]

[0254] [Table 4-15]

[0255] [Table 4-16]

[0256] [Table 4-17]

[0257] Purification of recombinant Globo H-binding single-domain antibodies sdAb46, sdAb56, and sdAb59 Previously, GloboH sdAb was generated by immunizing alpacas with synthetic glycans. Each gene sequence was identified and obtained as a commercially synthesized vector for protein expression. The strongest GloboH binding agent was determined by previous screening using MCF7 cancer cells.

[0258] To verify and further characterize glycan binding, the most promising sdAbs were immediately analyzed in vitro for their binding to synthetic glycans. Frozen aliquots of purified sdAb37, sdAb62, and sdAb63 were already available. sdAb46, sdAb56, and sdAb59 had to be purified first. Therefore, the pET-28b(+)-sdAb plasmid was transformed into SHuffle E. coli competent cells® and grown in 1 L bacterial cultures. Protein expression was induced using 0.5 mM IPTG. To analyze aggregation or multimerization, recombinant sdAbs were His-tagged and Ni-tagged. 2+ -Purified by NTA affinity chromatography followed by size-exclusion chromatography (SEC). Precipitate, lysate, flow-through (FT), wash 1 (W1), wash 2 (W2), Ni 2+ Samples of protein-containing fractions eluted from NTA affinity chromatography and size-exclusion chromatography (SEC) were collected for SDS-PAGE. Figure 17a shows representative purified SDS-PAGE images and chromatograms from SEC. The theoretical molecular weight of sdAb46 is 16.8 kDa, which corresponds to the observed band. The purified nanobody monomers were partially dissolved, but a large amount of protein remained in the precipitate after dissolution. Wash buffer 2 contained 30 mM imidazole, which had already caused elution of some nanobodies and loss of product. However, other protein impurities remained and were also found in the eluate. For subsequent size-exclusion chromatography, a HiLoad® 16 / 600 Superdex® 75 (S75) preparation grade column, pre-washed with PBS, was used in an FPLC system.

[0259] Example 1: Generation and selection of sdAb Alpaca immunization For alpaca immunization, synthetic GloboH was conjugated to the carrier protein CRM197 (Cross-Reactive-Material-197), a variant of diphtheria toxin, where a single amino acid exchange of glycine at position 52 to glutamate renders the protein non-toxic. Alpacas were immunized using the GloboH-CRM197 conjugate (see Methods section for details) for a total 6-week immunization period, including a 2-week gap between the third and fourth injections. Whole blood was collected on day 51.

[0260] Evaluation of the immune response in immunized alpacas Serum samples collected before immunization (week 0) and at the end of immunization (week 7) were used to test binding to natural globo family glycans. Serum samples were directly incubated with MCF-7 cells, known to express globo family glycans, for 45 minutes at RT. The cells were then washed twice, resuspended in a solution containing FITC-conjugated anti-rama secondary antibody, and incubated for another 45 minutes at RT. After two further washes, the cells were fixed, resuspended in FACS buffer, and analyzed by flow cytometry. As shown in Figure 4, serum from alpacas immunized for 7 weeks contained antibodies capable of binding to mammary cancer cells (MCF-7). Furthermore, serum samples were tested using glycan arrays as described in the detailed methods section. Figure 6 shows the weekly stepwise increase in the immune response of immunized alpacas to synthetic globoH up to week 7. Figure 7 shows a glycan array image obtained using serum samples from the last 7 weeks, illustrating the specific binding of serum antibodies to different globo family synthetic glycans shown in the figure.

[0261] Library construction: Isolation of sdAb domains from alpaca serum All antibodies were isolated from immunized alpaca serum using protein A / G magnetic beads. These samples were then used to isolate GloboH-specific sdAbs by affinity purification using GloboH-coated beads and uncoated control beads. These antibodies were then tested for binding to GloboH by glycan array. Figure 8 shows the average fluorescence intensities obtained using antibody samples eluted from empty (black) and GloboH beads (gray) at different concentrations of sodium chloride. The highest fluorescence intensities were obtained with samples using 100 mM, 500 mM, and 1 M sodium chloride. The samples were then subjected to SDS-PAGE gel electrophoresis after papain cleavage to obtain 13 kDa single-domain antibodies (sdAbs). Figure 9 shows that, before degradation, samples obtained with 100 mM, 500 mM, and 1 M NaCl contained conventional IgG (150 kDa) and heavy-chain-only antibodies (55 kDa). After papain digestion, these samples contained Fc and Fab fragments (both approximately 25 kDa), undigested antibody fragments (approximately 50 kDa), and a 13 kDa single-domain antibody. Therefore, sdAb was extracted from these bands and subjected to mass spectrometry after trypsin digestion.

[0262] Searching for sdAb sequences using bioinformatics analysis The VHH variable region (sdAb) was specifically amplified by two-step nested PCR using cDNA from alpaca PBMCs, as described in the Methods section, and subsequently sequenced.

[0263] Bioinformatics analysis was performed by comparing two libraries obtained by high-throughput sequencing and mass spectrometry (peptides) of PBMCs (cDNA) (procedure shown in Figure 1) to obtain full-length sequences of affinity-purified sdAbs. For this purpose, we used "Llama magic software" v1.0 (https: / / github.com / FenyoLab / llama-magic) and an in-house modified version of Mascot software, a search engine for protein identification. The modified version of the software allows for the comparison of a very large database of high-throughput sequencing with a very large database of proteomics analysis, obtaining each peptide dissociation spectrum from MS and comparing it with the open reading frame generated by high-throughput sequencing.

[0264] This analysis allowed for the acquisition of 102 different sdAb sequences, of which 36 were selected for recombinant expression in Escherichia coli (E. coli) and further analysis through additional binding analysis.

[0265] Example 2: Expression of selected sdAbs in Escherichia coli (E. coli) and further analysis The selected sdAb sequences were expressed in ArctivExpress® cells (E. coli) as described in detail in the Methods section. Figure 10 (Panels A and B) shows the effectiveness of the procedure using sdAb46 as an example. The isolated sdAbs were then tested for binding to MCF-7 cells, which are known to express GloboH Gb4 and Gb5 at low levels, and by surface plasmon resonance (SPR). Figures 11–13 show the SPR results for sdAb37, sdAb46, and sdAb62. SdAb46 showed the highest affinity value with an average affinity of 54 nM. Furthermore, the binding of isolated sdAbs to Globo Series glycan-expressing cells was tested by flow cytometry (Figures 14, 15, 16). Furthermore, these experiments showed that sdAb46 is the antibody with the highest binding ability to GloboH.

[0266] These results demonstrate that isolated single-domain antibodies can bind with relatively high affinity to both the native globo family structures expressed on cancer cells, as well as to synthetic and well-characterized globoH structures on the SPR chip.

[0267] For example, sdAb62 was found to bind to HEK293 cells (Figure 16) with higher affinity than MCF-7 or MDA-MB-231 cells. This finding suggests that sdAb62 binds glycans Gb3 and Gb4, which are expressed by HEK293, with higher affinity than GloboH, which is expressed by MCF-7 but not by HEK293 cells.

[0268] Example 3: NMR characterizes the binding epitope and conformation of Globo-H to sdAb46. Saturated migration difference nuclear magnetic resonance (STD NMR) spectroscopy is a powerful technique for studying glycan-protein interactions at atomic resolution, examining the carbohydrate portion in contact with proteins.

[0269] To investigate the minimal recognition motif required for sdAb46 to bind, we mapped the binding epitope of sdAb46-binding Globo-H by STD NMR. A long saturation time of 4 seconds was required for precise magnetization transfer of saturation from the protein to the ligand. Almost all protons from the Fucα(1-2)Galβ moiety underwent saturation magnetization transfer from the protein, but due to signal overlap, STD amplification constants were obtained only for a subset of protons (Figure 18a). The corresponding binding epitope suggests that the Fucα(1-2)Galβ- motif is in closer contact with the protons in the protein binding pocket (Figure 18b). Gb5 showed no significant STD signal in the presence of 110 μM sdAb46, suggesting that fucose is required for ligand recognition.

[0270] To further support the binding of sdAb46 to Globo-H, we obtained the nuclear Overhauser effect (trNOE) transferred from Globo-H in the presence and absence of sdAb46. We observed a remarkably rapid rate of NOE build-up in Globo-H in the presence of sdAb46, further confirming the binding of Globo-H to proteins (Figure 18c).

[0271] In conclusion, the NMR results indicate that the selected single-domain antibodies specifically bind to clearly defined synthetic structures and to the cell surface containing these epitopes.

[0272] Example 4: Molecular cloning of the sdAb46 trimer To improve sdAb binding, the next objective was to construct a trivalent form of sdAb46. From another project, a commercially available expression plasmid encoding a fusion protein consisting of three sdAb46 units linked by a GS linker, an N-terminal His tag, and a C-terminal soluble peptide (tachypressin-I, abbreviated as TACHY) was available. The trivalent sdAb46 construct was generated by molecular cloning, excluding the TACHY peptide, with a stop codon inserted before the TACHY coding sequence during molecular cloning (Figure 19a). Mutagenic primers were designed, and PCR reactions were performed to generate DNA sequences containing the additional stop codon. The PCR reactions were confirmed using agarose gel electrophoresis, and a product with a size of ~1500 bp (expected size: 1448 bp) was observed. Both the PCR product and the plasmid were digested using the same restriction enzymes (XbaI, XhoI), and the products were again electrophoresed on agarose gels. For the digestion of the 6571bp plasmid, large fragments of 5192bp and 1385bp were expected, but slightly larger bands were observed around 6000bp and 1500bp. Nevertheless, the upper band was assumed to represent the skeleton and was extracted and ligated with the digested PCR product to function as an insert. The success of the cloning was confirmed by DNA sequencing.

[0273] Following transformation, the protein was successfully expressed in shuffled cells as shown by SDS-PAGE, where a band with the expected size of 46.2 kDa was observed (Figure 19b). Subsequently, the cell precipitate was lysed and the solubility of the sdAb46 trimer construct was evaluated. Unfortunately, the band corresponding to the trimer construct was observed only in the precipitate sample and not in the lysate, which suggested inclusion body formation. This had also been previously observed with the original sdAb46 trimer-TACHY construct. Attempts to optimize expression conditions (different IPTG concentrations, expression temperature, expression period) failed to improve the solubility of the TACHY construct, so we considered establishing a protocol for inclusion body isolation and refolding of the sdAb46 trimer. Isolation was performed based on the protocol by Li Xu et al. (Biotechnol Appl Bioc, 2017). After the washing step, a colorless precipitate was obtained, which was almost completely solubilized in 6 M urea. The solubilized inclusions were processed using a high-performance protein liquid chromatography (FPLC) system with a His Trap column, using Ni 2+ -Further purification was performed by NTA purification, and elution was performed using a 5-step imidazole gradient. The second elution step (~39 mM imidazole) was already sufficient to elute the sdAb46 trimer, which was observed chromatographically and confirmed by SDS-PAGE. The highest absorbance value at 280 nm, ~170 mAU, was reached at an imidazole concentration of ~97 mM, and higher imidazole concentrations resulted in only minimal elution of the remaining bound protein. Flow-through SDS-PAGE analysis showed that the majority of the target protein remained unbound. Despite this, although not all of the denatured single-domain antibody was refolded, 1.1 mg of folded protein was obtained.

[0274] Example 5: Cell binding of trivalent GloboH single-domain antibody In vitro binding analysis was performed using the GloboH-expressing breast cancer cell line MCF7. The GloboH-nonexpressing neuroblastoma cell line IMR5 was used as a negative control. These analyses were performed using flow cytometry and fluorescence microscopy.

[0275] For flow cytometry, cells were incubated with 0.4 mg / ml sdAb46 monomer or trimer solution. 5 μg / ml anti-GloboH IgG VK9 was used as a positive control. Anti-IgG-Atto635 and anti-6×His-AF647 were used as secondary antibodies. Fluorescence intensity measured by flow cytometry was plotted against a negative control with only the secondary antibody. Cell binding was quantified using a "positive cell" gate created based on the fluorescence intensity of the secondary antibody-only control (Figure 20a). As expected, VK9 binding was observed only in MCF7 cells (73.47±4.83%) and not in IMR5 cells (0.04±0.13%), confirming GloboH expression in MCF7 cells (Figure 20b). Consistent with previous data, two MCF7 populations were observed in the histogram, exhibiting different GloboH expression levels. A slight shift was observed in IMR5 cells incubated with sdAb46 monomer (1.17±0.71%) and sdAb46 trimer (4.19±3.92%), but MCF7 cells were more frequently bound by sdAb (3.65±0.51% for monomer (curve I) and 50.58±20.82% for trimer (curve II)). Two-sample t-tests showed that increased binding to MCF7 was significant for VK9 and both sdAb constructs. As expected, the sdAb46 trimer showed improved MCF7 binding compared to the sdAb46 monomer.

[0276] For a confocal laser scanning microscope-based assay (Figure 20c), cells were seeded on poly-L-lysine-coated coverslips and incubated with either a 0.4 mg / ml single-domain antibody solution or 0.5 μg / ml VK9. Anti-IgG-Atto635 and anti-6×His-AF647 were used as secondary antibodies, and cell nuclei were stained with DAPI. The secondary antibody control for MCF7 showed no fluorescence signal for either antibody, but nonspecific binding of anti-6×His-AF647 to IMR5 cells was observed. As expected, binding of VK9 to MCF7 rather than IMR5 was observed, and the two MCF7 populations detected in flow cytometry experiments could be distinguished by different fluorescence intensities on microscopic examination. sdAb46 binding was also confirmed, but surprisingly, no difference in fluorescence intensity was observed for monomers and trimers. Interestingly, the staining patterns of the two sdAb46 types differed from those of the VK9 antibody, as the two types of sdAb46 were observed primarily intracellularly, while VK9 was detected more strongly on the cell membrane, more as a patch. IMR5 cells were nonspecifically stained with anti-6×His-AF647, but increased fluorescence was observed in the sdAb46 monomer and trimer, showing weak Nb binding consistent with flow cytometry results.

Claims

1. A polypeptide that specifically binds globo H, comprising at least one single-domain antibody, wherein the complementarity-determining region of the at least one single-domain antibody is (a) The amino acid sequence of CDR1 is SEQ ID NO: 66, (b) The amino acid sequence of CDR2 is SEQ ID NO: 75, and (c) The amino acid sequence of CDR3 is SEQ ID NO: 84, A polypeptide in which three single-domain antibodies bind to Globo H.

2. The polypeptide according to claim 1, wherein the at least one single-domain antibody has the amino acid sequence of SEQ ID NO:

5.

3. The polypeptide according to claim 1 or 2, further comprising at least one extracellular hinge region, at least one transmembrane domain, at least one costimulatory domain, and at least one intracellular activation domain, wherein the single-domain antibody is ligated to the extracellular hinge region.

4. The polypeptide according to any one of claims 1 to 3, wherein the at least one single-domain antibody is a humanized single-domain antibody.

5. The polypeptide according to claim 4, wherein the single-domain antibody is humanized by substituting one or more amino acid residues located at positions 1, 5, 11, 28, and 30 of FR1, positions 44 and 45 of FR2, positions 74, 75, 76, 83, 84, 93, and 94 of FR3, and positions 104 and 108 of FR4, according to Kabat numbering.

6. A recombinant nucleic acid molecule encoding the polypeptide according to any one of claims 1 to 5.

7. A vector comprising the recombinant nucleic acid molecule described in claim 6.

8. A host cell comprising the recombinant nucleic acid molecule described in claim 6.

9. A pharmaceutical composition comprising a polypeptide according to any one of claims 1, 2, 4, and 5, together with at least one pharmaceutically acceptable vehicle, excipient, and / or diluent.

10. A polypeptide according to any one of claims 1 to 5, or a pharmaceutical composition according to claim 9, for use in the treatment and / or diagnosis of cancer, wherein the cancer cells express globo H on the surface of the cancer cells.

11. The polypeptide for use or pharmaceutical composition for use according to claim 10, wherein the cancer is selected from brain cancer, liver cancer, bile duct cancer, kidney cancer, breast cancer, prostate cancer, lung cancer, small cell lung cancer, ovarian cancer, cervical cancer, esophageal cancer, gastric cancer, pancreatic cancer, and colorectal cancer.

12. A diagnostic kit comprising the polypeptide according to any one of claims 1, 2, 4, and 5, for screening cancer characterized by cells expressing Globo H on the surface of the cells.

Images