Composition for the treatment of optic nerve diseases, method of preparation thereof, and use thereof

Abstract

A tFNA-miR22 complex for treating optic nerve diseases is disclosed, which is composed of tetrahedral DNA and miR-22 according to a molar ratio of 1:(1-4). tFNA-miR22 can effectively inhibit the apoptosis of retinal ganglion cells and promote the release of brain-derived neurotrophic factor (BDNF), thereby achieving a good protective effect of retinal ganglion cells. The use of tFNA-miR22 in the preparation of optic nerve protective drugs promotes the treatment of neurodegenerative optic nerve diseases, including glaucoma, and tFNA-miR22 has great applicability.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine. In particular, the present invention relates to a complex for the treatment of optic nerve diseases, a method for preparing the same, and uses thereof.

Background Art

[0002] Glaucoma is a group of diseases that threaten and damage the optic nerve and its visual pathway, causing visual dysfunction, and is the leading cause of irreversible blindness in the world. Primary open-angle glaucoma is a specific type of optic nerve disease characterized by progressive damage to retinal ganglion cells (RGCs) and their axons, accompanied by characteristic optic nerve atrophy and visual field defects. Glaucoma tends to be insidious, progresses slowly, has no obvious symptoms initially, and the visual field gradually narrows until blindness occurs. There are nearly 21 million glaucoma patients in China, which will result in nearly 6.3 million blind people and more than 10 million visually impaired people.

[0003] Currently, the main treatment for glaucoma is to lower intraocular pressure (IOP) medically or surgically to delay damage to the optic nerve. However, simply lowering the IOP cannot completely and effectively prevent or recover optic nerve damage caused by retinal ganglion cell death. Among glaucoma patients, even if the IOP is controlled, the damage to retinal ganglion cells may continue to progress, and in some cases, the visual field may be completely lost if effective treatment is not carried out.

[0004] Optic nerve protection is both a challenge in the treatment of glaucoma and an active field at the forefront of recent ophthalmic research. Currently, clinically commonly used prostaglandins, β-receptor blockers, adrenergic agonists, carbonic anhydrase inhibitors, and miotics such as pilocarpine are all intraocular pressure-lowering drugs, and there is a lack of neuroprotective drugs at present.

[0005] Tetrahedral DNA (TDN), also known as tetrahedral framework nucleic acid (tFNA) or tetrahedral DNA nanostructure, is a tetrahedral nanostructure formed by four single-stranded DNA molecules undergoing denaturation and re-denaturation, resulting in complementary base pairs between the strands. It is easily synthesized, highly biocompatible, and commonly used as a carrier for certain drugs. Patent Document 1 discloses the use of tetrahedral DNA to promote the proliferation, differentiation, and / or migration of neural stem cells, but does not disclose the effect of tetrahedral DNA on optic nerve protection.

[0006] Patent Document 2 discloses the use of tetrahedral DNA for the preparation of a drug to prevent oxidative stress in retinal ganglion cells, and shows that tetrahedral DNA alone or in complex with miR-155 can be used for the treatment of wet macular degeneration (AMD).

[0007] miR-22, one of the most frequently studied microRNAs, is involved in various biological processes such as cardiac remodeling, cell cycle regulation, proliferation, and differentiation, and has various antineurodegenerative and antitumor effects, including suppression of neuronal apoptosis and regulation of brain-derived neurotrophic factor (BDNF)-related signaling pathways, as well as inhibition of the proliferation, invasion, and migration of various tumor cells. Romano et al. have shown that miR-22 is a target gene for predicting glaucoma, but the use of miR-22 as a target gene for treating glaucoma has not been disclosed (Non-Patent Literature 1).

[0008] In summary, there are no reports of using tetrahedral DNA or miR-22 in the treatment of glaucoma, and even fewer reports of using both in combination as optic neuroprotective agents for glaucoma treatment. To overcome the difficulties in treating glaucoma, further development of neuroprotective agents that can effectively treat optic nerve diseases is urgently needed. [Prior art documents] [Patent Documents]

[0009] [Patent Document 1] Chinese Patent Application Publication No. 109806275 Specification [Patent Document 2] Chinese Patent Application Publication No. 112007044 Specification [Non-patent literature]

[0010] [Non-Patent Document 1] Romano GL, Platania CB, Forte S, Salomone S, Drago F, Bucolo C. MicroRNA target prediction in glaucoma. Prog Brain Res. 2015;220:217-40. [Overview of the project] [Problems that the invention aims to solve]

[0011] The object of this invention is to provide a therapeutic agent for optic nerve diseases. [Means for solving the problem]

[0012] The present invention provides a complex for the treatment of optic nerve diseases, comprising tetrahedral DNA and miR-22 in a molar ratio of 1:(1 to 4).

[0013] The tetrahedral DNA of the present invention is a tetrahedral, three-dimensional DNA nanostructure formed by DNA base sequence design, the principle of complementary pairing, and the auto-hybridization combination of each strand. In the present invention, the four single-stranded DNAs have the nucleotide sequences shown in SEQ ID NO.1 to SEQ ID NO.4. A complex of tetrahedral DNA and microRNA is formed by ligating microRNA to the ends of the single strands of the tetrahedral DNA. In the present invention, the specific microRNA is miR-22.

[0014] Furthermore, the tetrahedral DNA is formed by four single-stranded DNA molecules via complementary base pairing; each of the four single-stranded DNA molecules has a sequence selected one-to-one from the sequences shown in SEQ ID NO. 1 to 4; one, two, three, or each of the ends of the single-stranded DNA molecules is ligated to miR-22; and miR-22 has the sequence shown in SEQ ID NO. 5.

[0015] Furthermore, the miR-22 is linked by one or more chemical bonds to one to four of the four single-stranded DNA molecules that form the tetrahedral DNA structure.

[0016] Furthermore, a linker sequence exists between miR-22 and single-stranded DNA (or multiple single-stranded DNA). The linker sequence is a nucleotide sequence, preferably a deoxyribonucleotide sequence, more preferably -TTTTT-, which is a sequence consisting of five consecutive thymine-deoxynucleotides.

[0017] Furthermore, the present invention provides a method for preparing the above-mentioned complex, comprising maintaining the four single-stranded DNAs of the tetrahedral DNA at a temperature sufficient to denature them for more than 10 minutes, then lowering the temperature to 2 to 8°C and maintaining it for more than 20 minutes; and ligating one or more of the above-mentioned four single-stranded DNAs to miR-22.

[0018] Furthermore, four single-stranded tetrahedral DNA molecules are maintained at 95°C for 10 minutes, then the temperature is lowered to 4°C and maintained for 20 minutes.

[0019] Furthermore, the present invention utilizes the above complex in the preparation of pharmaceuticals for treating optic nerve diseases. Moreover, the optic nerve disease therapeutic agent is an optic neuroprotective agent; preferably, the optic nerve disease is associated with retinal ganglion cell damage and / or retinal ganglion cell apoptosis. The agent can delay retinal ganglion cell damage, suppress retinal ganglion cell apoptosis, and promote retinal ganglion cell survival; more preferably, the retinal nerve disease is associated with brain-derived neuronal factor (BNDF)-related signaling pathways, and the agent can promote BDNF release.

[0020] Furthermore, the optic nerve disease is glaucoma, and in particular, primary open-angle glaucoma.

[0021] The present invention also provides a pharmaceutical composition for treating optic nerve diseases, which contains the above complex for treating optic nerve diseases and a pharmaceutically acceptable excipient.

[0022] The present invention also provides a method for treating and / or preventing optic nerve diseases, which includes administering an effective amount of the complex of tetrahedral DNA and miR-22 of the present invention or the pharmaceutical composition of the present invention to a patient who needs it. The optic nerve disease is preferably glaucoma.

[0023] As a result of the experiment, it was found that tFNA-miR22, which is a complex of tetrahedral DNA and miR-22 of the present invention, can effectively suppress the apoptosis of retinal ganglion cells induced by N-methyl-D-aspartic acid (NMDA), promote the release of brain-derived neurotrophic factor (BDNF), and fully exert the protective effect on retinal ganglion cells. By applying tFNA-miR22 to the preparation of an optic nerve protective drug, it is considered useful for the treatment of neurodegenerative optic nerve diseases including glaucoma, and a fairly high applicability is expected.

[0024] Of course, according to the above content of the present invention, it is obvious that various other forms of modification, substitution, or alteration can be made without departing from the above basic technical idea of the present invention and in accordance with the general technical common sense and conventional means in the art.

[0025] Hereinafter, the above content of the present invention will be described in more detail by specific embodiments according to examples. However, it should not be construed that the scope of the above problems of the present invention is limited to the following examples. All technologies implemented based on the above content of the invention belong to the scope of the present invention.

Brief Description of the Drawings

[0026] [Figure 1]Figure 1 is a schematic diagram showing the synthesis of tetrahedral DNA and miR-22. [Figure 2] Figure 2 shows the detection results obtained by capillary electrophoresis. [Figure 3] Figure 3 shows the detection results of tFNA-miR22, tetrahedral DNA, and multiple single strands (1:S1, 2:S2, 3:S3, 4:S3-miR22, 5:S4, 6:tFNA, 7:tFNA-miR22) by PAGE electrophoresis. [Figure 4A] Figure 4A shows an image of tetrahedral DNA obtained by transmission electron microscopy. [Figure 4B] Figure 4B shows an image of tetrahedral DNA obtained by atomic force microscopy. [Figure 4C] Figure 4C shows the detection results of the zeta potential of tetrahedral DNA. [Figure 4D] Figure 4D shows the detection results for the particle size of tetrahedral DNA. [Figure 5A] Figure 5A shows an image of tFNA-miR22 obtained by transmission electron microscopy. [Figure 5B] Figure 5B shows an image of tFNA-miR22 obtained by atomic force microscopy. [Figure 5C] Figure 5C shows the detection results of the zeta potential of tFNA-miR22. [Figure 5D] Figure 5D shows the particle size detection results of tFNA-miR22. [Figure 6A] Figures 6A to 6E show the establishment of in vivo and in vitro models of NMDA-induced optic nerve damage, as well as the detection of cellular activity in retinal ganglion cells treated with NMDA at different concentrations of tFNA-miR22. The data in Figures 6A to 6D represent the mean plus or minus standard deviation (sample size ≥ 3 for each group). Figure 6A shows the detection of CCK-8 activity and drug inhibition rates in cells stimulated with different concentrations of NMDA for 1 hour and cultured in complete medium for 3, 6, 12, and 24 hours. [Figure 6B] Figure 6B shows the detection of CCK-8 activity and drug inhibition rates in cells stimulated with different concentrations of NMDA for 1 hour and cultured in complete medium for 3, 6, 12, and 24 hours. [Figure 6C]Figure 6C shows the biosafety detection of tFNA-miR22. [Figure 6D] Figure 6D shows the detection of CCK-8 activity in cells treated with 4 nM NMDA followed by 24 hours of treatment with different concentrations of tFNA-miR22, tetrahedral DNA, and single-stranded miR-22. [Figure 6E] Figure 6E shows the morphology of each group of cells after the above treatment, as observed with a standard optical microscope. [Figure 7] Figure 7 is a schematic diagram illustrating the establishment of an in vivo model. [Figure 8] Figure 8 shows the results of hematoxylin-eosin staining. [Figure 9] Figure 9 shows images of immunofluorescence staining and data analysis of retinal flat mounts, with data representing the mean plus or minus standard deviation (sample size ≥ 3 for each group). [Figure 10AB] Figure 10AB is a graph showing the results of cell penetrometry for tFNA-miR22 and single-stranded miR-22 (Cy5 fluorescently labeled) detected by flow cytometry within 3, 6, 12, and 24 hours. [Figure 11] Figure 11 shows the 6-hour uptake results of tFNA-miR22 and single-stranded miR-22 (Cy5 fluorescently labeled) detected by immunofluorescence. [Figure 12] Figure 12 shows the effects of 62.5 nM tFNA-miR22, tetrahedral DNA, and single-stranded mi-R22 on the cell cycle as detected by flow cytometry, along with data analysis. Statistical data are shown as mean plus or minus standard deviation (sample size for each group is ≥3). [Figure 13] Figure 13 shows the apoptosis and statistical data analysis of cells in each group detected by flow cytometry, with statistical data showing the mean plus or minus the standard deviation (sample size ≥ 3 for each group). [Figure 14A] Figure 14A shows the expression of apoptosis-related proteins detected by Western blotting. [Figure 14B]Figure 14B shows the statistical analysis of the anti-apoptotic protein Bcl-2. [Figure 14C] Figure 14C shows the statistical analysis of the apoptotic protein Bax. [Figure 14D] Figure 14D shows the statistical analysis of the apoptotic protein caspase 3. [Figure 15] Figure 15 shows the immunofluorescence staining and statistical analysis of the anti-apoptotic protein Bcl-2. [Figure 16] Figure 16 shows the immunofluorescence staining and statistical analysis of the apoptotic protein Bax. [Figure 17] Figure 17 shows the immunofluorescence staining and statistical analysis of the apoptotic protein caspase 3. [Figure 18A] Figures 18A to 18E illustrate the detection of the TrKb-Creb-BDNF signaling pathway, with Figure 18A showing TrkB / BDNF protein expression analyzed by Western blotting (GAPDH as the internal reference). [Figure 18B] Figure 18B shows the relative expression levels of the TrkB protein. [Figure 18C] Figure 18C shows the relative expression levels of BDNF protein. [Figure 18D] Figure 18D shows the expression level of the Ntrk2 gene. [Figure 18E] Figure 18E shows the expression level of the BDNF gene. [Figure 19A] Figure 19A shows the expression of ERK1 / 2-CREB protein as analyzed by Western blotting. [Figure 19B] Figure 19B shows the relative expression levels of ERK1 / 2 and phosphorylated ERK1 / 2 proteins. [Figure 19C] Figure 19C shows the relative expression levels of CREB and phosphorylated CREB proteins. [Figure 20] Figure 20 shows the expression and statistical analysis results of TrkB selectively activated by tFNA-miR22, as detected by immunofluorescence. [Figure 21]Figure 21 shows the expression and statistical analysis results of BDNF detected by immunofluorescence. [Figure 22] Figure 22 shows the expression and statistical analysis results of p-ERK1 / 2 detected by immunofluorescence. [Figure 23] Figure 23 shows the expression and statistical analysis of p-CREB detected by immunofluorescence. [Figure 24] Figure 24 shows the expression results of TrkB protein and BDNF protein as determined by immunohistochemical staining. [Modes for carrying out the invention]

[0027] The raw materials and equipment used in this invention are well-known and commercially available products.

[0028] Example 1. Synthesis of a tFNA-miR22 complex. Four single-stranded DNA molecules (one of which is connected to miR22 at its end) (S1, S2, S3-miR22, S4) were dissolved in TM Buffer (10 mM Tris-HCl, 50 mM MgCl2, pH=8.0) to a final concentration of 1000 nM for each of the four DNA molecules. The solutions were thoroughly mixed, rapidly heated to 95°C and maintained for 10 minutes, then rapidly cooled to 4°C and maintained for at least 20 minutes to obtain tFNA-miR22. The sequences of the four single strands (5'→3') were as follows:

[0029] S1: ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGA (SEQ ID NO.1)

[0030] S2: ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTC (SEQ ID NO.2)

[0031] S3: ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATC (SEQ ID NO.2)

[0032] S3: ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATC (SEQ ID NO.3)

[0033] S4: ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCC (SEQ ID NO.4)

[0034] miR-22: AAGCUGCCAGUUGAAGAACUG (SEQ ID NO.5)

[0035] S3-miR22-3p: AAGCUGCCAGUUGAAGAACUGU-TTTTT-ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATC (SEQ ID NO.6)

[0036] Here, a Cy5 fluorescent labeling group was optionally attached to the 5' end of S1 to track tFNA-22.

[0037] 2.Identification Capillary electrophoresis and PAGE electrophoresis detected multiple single-strand DNA molecules and synthetic tFNA-miR22. The morphology of tFNA and tFNA-miR22 was detected by transmission electron microscopy. The zeta potential and particle size of tFNA and tFNA-miR22 were detected by dynamic light scattering.

[0038] 3. Identification Results As shown in Figures 1 to 3, the electrophoretic results showed that the molecular weight of the tFNA-miR22 band was considerably higher than that of single-stranded DNA and tetrahedral DNA, indicating that the single-stranded DNA was aggregated as a single unit.

[0039] As shown in Figures 4A to 5D, tetrahedral particles were detected using a transmission electron microscope. Dynamic light scattering revealed that the zeta potential of tFNA was 5.6 and the particle size was 17.96 nm, while the zeta potential of tFNA-miR22 was 8.23 ​​mV and the particle size was 17.18 nm, indicating that tFNA-miR22 was synthesized normally and was stable.

[0040] The beneficial effects of the present invention will be further explained below with reference to experimental examples. The tFNA used in the experimental examples was prepared by the method of Example 1.

[0041] Experimental Example 1: Uptake of tFNA-miR22 by damaged retinal ganglion cells

[0042] 1. Experimental Method 1.1 Verification of the optimal modeling concentration (in vitro simulation of optic ganglion cell damage) RGC-5 cells (a type of mouse retinal ganglion cell) were stored in a 96-well plate, with 1 x 10⁶ cells per well. 4 Cells were cultured individually. Each group was treated with different concentrations of N-methyl-D-aspartic acid (NMDA) for 1 hour, then cultured in complete medium for 24 hours, and cell activity was detected by the CCK-8 assay. The results showed that the drug inhibition rate of 4 mM NMDA was approximately 40%, and therefore 4 mM was selected as the optimal modeling concentration (Figures 6A and 6B). 1.2 Testing the optimal anti-cell damage concentration of the drug (cell proliferation experiment) RGC-5 cells were placed in a 96-well plate, 1 x 10⁶ cells per well. 4Cells were cultured individually. Each experimental group, excluding the blank group, was treated with 4 nM NMDA for 1 hour, and then cultured for a further 24 hours in culture media containing 0 nM, 62.5 nM, 125 nM, and 250 nM tFNA, as well as tFNA-miR22 prepared in Example 1 and single-stranded miR-22, respectively. Samples were collected and cell activity was detected by the CCK-8 assay. The results showed that 62.5 nM tFNA did not have a clear proliferation effect, but this concentration of tFNA-miR22 significantly promoted the proliferation of RGC-5 cells. Furthermore, the proliferation ratio of cells treated with tFNA-miR22 compared to the cell viability of the NMDA control group was even higher than the combined proliferation ratio of cells treated with miR22 or tFNA alone compared to the cell viability of the NMDA control group. This indicates that tFNA-miR22, a combination of miR22 and tFNA, plays a synergistic role in promoting the proliferation of NMDA-injured ganglion cells. Therefore, 62.5 nM was selected as the optimal drug concentration in this experiment (Figure 6D). 1.3 Tests on substance uptake by damaged cells RGC-5 cells treated with 4 mM NMDA for 1 hour were grouped, and then exposed and treated with Cy5-labeled single-stranded miR-22 (62.5 nM) and tFNA-miR22 (62.5 nM) for 3 hours, 6 hours, 12 hours, and 24 hours, respectively, and compared with a damaged group (i.e., untreated with tFNA and tFNA-miR22). All groups were washed three times with phosphate buffer and detected by flow cytometry. As a result, it was found that the fluorescence intensity of tFNA-miR22 peaked after 6 hours (Figure 11). Therefore, RGC-5 cells treated for 6 hours using the above method were selected to create cell slides, and the uptake of single-stranded miR-22 and tFNA-miR22 was observed by immunofluorescence staining.

[0043] 2.Results As shown in Figures 10A to 11, cell flow cytometry results confirmed that within 24 hours, the fluorescence intensity of tFNA-miR22 reached a peak of 55.3% at 6 hours and gradually decreased to 40.4% with increasing treatment time, while the fluorescence intensity of single-stranded miR-22 gradually increased with treatment time, reaching a peak of 33.5% at 24 hours. Immunofluorescence staining results in Figure 11 confirmed that tFNA-miR22 was widely accumulated in the cytoplasm and perinuclear regions of RGC-5 after 6 hours, and that single-stranded miR-22 was mainly attached to the surface of the cell membrane.

[0044] These results indicate that tFNA-miR22 is rapidly and efficiently taken up by damaged RGC-5 cells, while miR-22 that is not bound to tFNA is not easily taken up by RGC-5 cells.

[0045] Experimental Example 2: Suppression of NMDA-induced cell damage by tFNA-miR22

[0046] 1. Experimental Method RGC-5 cells were treated with 4 mM NMDA for 1 hour, then with 62.5 nM single-stranded miR-22, tFNA, or tFNA-miR22 for 24 hours, and detection was performed as follows: 1) Cell morphology was observed using a phase-contrast microscope; 2) The cell cycle was detected by flow cytometry; 3) The rate of cell apoptosis was detected by flow cytometry; 4) The expression of Bax, caspase 3, and Bcl-2 was detected by immunofluorescence and Western blotting.

[0047] 2.Results 1) Figure 6C shows that tFNA-miR22 did not exhibit significant cytotoxicity, demonstrating its good biological safety. 2) Figure 6E shows that tFNA-miR22 can significantly protect the morphology of retinal ganglion cells compared to tFNA and single-stranded miR-22. 3) Figure 12 shows that tFNA-miR22 significantly promotes cell regeneration by controlling cell division compared to tFNA and single-stranded miR-22. Furthermore, the division of NMDA-treated cells was affected, and it is clear that the proportion of G2-M phase cells was considerably reduced in the NMDA group compared to the control group, and the proportion of G2-M phase cells decreased even further after tFNA or miR22 treatment alone. However, treatment with tFNA-miR22 significantly increased the proportion of G2-M phase cells, to a level comparable to the control group without NMDA interference. This indicates that the combined use of tFNA and miR-22 has the opposite effect compared to using them alone. They exert a synergistic effect on each other and can significantly promote cell division and regeneration. 4) Figures 13 to 17 show that tFNA-miR22 can suppress NMDA-induced apoptosis compared to tFNA and single-stranded miR-22, specifically that tFNA-miR22 suppresses the increase in expression levels of NMDA-induced apoptotic proteins caspase and Bax, and suppresses the decrease in expression levels of the NMDA-induced anti-apoptotic protein BCL-2.

[0048] These results demonstrate that tFNA-miR22 has good biosafety and protective effects on retinal ganglion cells. Because tFNA-miR22 controls cell division, promotes cell regeneration, increases the expression of the anti-apoptotic protein BCL-2, and reduces the expression of the pro-apoptotic proteins caspase-3 and Bax, it reduces NMDA-induced cell damage and plays a more protective role, exhibiting significantly superior effects compared to tFNA or single-stranded miR-22 alone.

[0049] Experimental Example 3: Effect of tFNA-miR22 on the TrkB / BDNF signaling pathway

[0050] 1. Experimental Method RGC-5 cells were treated according to the method in Experimental Example 2 and detected as follows: 1) BDNF and Trkb proteins were detected by Western blotting and immunofluorescence; 2) The expression levels of BDNF and Ntrk2 were detected by RT-PCR; 3) ERK1 / 2, p-ERK1 / 2, CREB, and p-CREB proteins were detected by Western blotting and immunofluorescence.

[0051] 2.Results 1) Western blot detection in Figures 18A to 18C showed a significant increase in BDNF and TrkB levels in tFNA-miR22-treated cells. Real-time quantitative PCR results in Figures 18D and 18E showed a significant increase in Ntrk2 and BDNF gene expression in tFNA-miR22-treated cells compared to other groups. 2) Western blot detection in Figures 19A to 19C showed that total ERK and CREB proteins increased to some extent in tFNA-miR22-treated cells, indicating that phosphorylation of ERK1 / 2 and CREB can be promoted. 3) The detection results of the above proteins shown in Figures 20 to 23 by immunofluorescence were consistent with the detection results by Western blotting.

[0052] The purpose of this experiment is to further confirm the mechanism by which tFNA-miR22 exerts its optic nerve-protective effect.

[0053] Brain-derived growth factor (BDNF) is a substance that exerts potent neuroprotective effects, particularly on retinal ganglion cells. BDNF is one of the important neurotrophic factors in glaucoma. By binding to its receptor, TrkB, BDNF activates extracellular signal-regulated kinase (ERK), leading to phosphorylation of cAMP response element-binding protein (CREB), which in turn induces the transcription of various genes associated with neuronal survival, potentially promoting cell survival.

[0054] These results indicate that tFNA-miR22 selectively activates TrkB, which in turn activates the downstream signaling pathway (ERK-CREB), thereby promoting BDNF release, reducing cell damage, and promoting cell survival.

[0055] Experimental Example 4: Treatment of NMDA-induced optic nerve injury model mice with tFNA-miR22

[0056] 1. Experimental method: Establishment of an NMDA-induced optic nerve injury model 1) Selection and grouping of experimental animals: The subjects were healthy 6-week-old male C57BL / 6J mice with a body weight of 18 to 20 g. Examination revealed no obvious neck curvature, clear corneas, clearly visible iris blood vessels, large, round pupils, and sensitivity to light reflection. The experimental animals were randomly divided into five groups, A, B, C, D, E, and E, using a random number table, and were classified as a blank control group, an NMDA injury group, a tFNA-only treatment group (62.5 nM), a miR-22-only treatment group, and a tFNA-miR22 treatment group (62.5 nM), respectively. 2) Group treatment: After thoroughly anesthetizing the mice, both eyes of the mice in each group were used as experimental eyes, and the surface of the eyeball was disinfected with 10% iodine tincture. Under a surgical microscope, a 32G needle was inserted 1 mm from the lateral edge of the cornea, and 2 μL of the drug was injected into the vitreous cavity using a 10 μL microsyringe. Group A: Normal mice without surgery; Group B: Injected with 2 μL of NMDA prepared with physiological saline to a final concentration of 20 μM; Group C: Injected with 1 μL of NMDA (20 μM) + 1 μL of tFNAs (62.5 nM); Group D: Injected with 1 μL of NMDA (20 μM) + 1 μL of miR-22 (62.5 nM); Group E: Injected with 1 μL of NMDA (20 μM) + tFNAs-miR22 (62.5 nM). Postoperatively, erythromycin ophthalmic ointment was applied to the conjunctival sac. The animals were sacrificed seven days after surgery in which the eyeballs were removed while preserving a portion of the optic nerve. The following morphological examinations were performed: A) Tissue changes in the retina were observed using HE staining; B) Immunofluorescence staining of whole retinal flat mounts: RGC count; C) BDNF and Tkrb ​​expression was observed by immunohistochemical IHC staining of routine retinal sections.

[0057] 2.Results 1) As shown in Figure 8, HE staining results confirmed a significant increase in retinal thickness and a significant increase in the number of ganglion cells after tFNAs-miR22 treatment. 2) Figure 9 shows the results of immunofluorescence staining of flat-mount samples. After tFNA-miR22 treatment, the number of ganglion cells increased significantly with statistical significance. The number of ganglion cells in the tFNA-miR22 treatment group was significantly increased compared to the NMDA control group, while the number of ganglion cells after tFNA or miR22 treatment alone was almost unchanged compared to the NMDA treatment group. 3) Figure 24 shows the IHC staining results: After tFNAs-miR22 treatment, the expression of BDNF and Tkrb ​​in the retina significantly increased.

[0058] This indicates that the tFNA-miR22 group significantly increased the survival rate of optic ganglion cells compared to the other groups. Therefore, the tFNA-miR22 complex of the present invention has optic neuroprotective effects and can be used to treat neurodegenerative optic nerve diseases, including glaucoma. It shows significantly better effects than tFNA and miR-22 alone, demonstrating that the two have a synergistic effect.

[0059] Based on the above, the present invention provides a neuroprotective agent that can be used to treat neurodegenerative optic nerve diseases, including glaucoma, and comprises tFNA-miR22 containing tetrahedral DNA and miR-22 in a molar ratio of 1:(1 to 4). tFNA-miR22 is not only effectively taken up by damaged RGC-5 cells, but also effectively suppresses apoptosis of retinal ganglion cells, promotes the release of brain-derived neuronal factor (BDNF), and can exert a beneficial protective effect on retinal ganglion cells.

Claims

1. A composition for treating optic nerve damage, comprising tetrahedral DNA and miR-22 in a molar ratio of 1:(1 to 4), The tetrahedral DNA is formed from four single-stranded DNAs via complementary base pairing; the sequences of the four single-stranded DNAs are selected from the sequences shown in SEQ ID NO. 1 to 4; and the miR-22 has the sequence shown in SEQ ID NO.

5. A composition characterized in that the miR-22 is chemically bonded to the end of a single strand; the bonded single strand has the sequence shown in SEQ ID NO. 3; a linker sequence exists between the miR-22 and the bonded single-stranded DNA; and the linker sequence is -TTTTTT-.

2. A method for preparing the composition according to claim 1, characterized in that the four single-stranded DNAs forming the tetrahedral DNA are placed at a temperature sufficient to denature for more than 10 minutes, and then the temperature is lowered to 2 to 8°C and placed for more than 20 minutes, wherein one or more of the four single-stranded DNAs are linked to the miR-22.

3. The preparation method according to claim 2, characterized in that the four single-stranded DNAs forming the tetrahedral DNA are placed at 95°C for 10 minutes, and then the temperature is lowered to 4°C over 20 minutes.

4. Use of the composition according to claim 1 in the preparation of a drug for the treatment of optic nerve injury.

5. The use according to claim 4, characterized in that the agent for the treatment of the optic nerve injury is an optic nerve protective agent.

6. The use according to claim 4, characterized in that the optic nerve damage is optic nerve damage that occurs in glaucoma.

7. A pharmaceutical composition for treating optic nerve injury, characterized by containing the composition described in claim 1 and a pharmaceutically acceptable excipient.

Images