Oligonucleotide for detecting Sclerotinia rot bacterium onion and detection method using the same

Abstract

To provide an oligonucleotide enabling accurate grasp of the initial onset of Welsh onion white rot and a method for detecting both group A and group B strains of Sclerotium cepivorum.SOLUTION: The detection method according to the present invention uses an oligonucleotide of 15-30 base-length that is capable of annealing to any one region, or a complementary region thereof, selected from gene regions of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), heat shock protein 60 (HSP60), and calmodulin (CaM) of plant-pathogenic Ascomycota, the region being conserved in both group A and group B strains of Sclerotium cepivorum and exhibiting polymorphisms in Botrytis, Dumontinia, Macrophomina, Sclerotinia, and Sclerotium., Sclerotinia, and Sclerotium.SELECTED DRAWING: Figure 7

Description

Technical Field

[0001] The present invention relates to the detection of pathogenic bacteria in agricultural crops by the PCR method.

Background Art

[0002] Onions are cultivated throughout Japan. The main production areas are Saitama Prefecture, Chiba Prefecture, Ibaraki Prefecture, and Gunma Prefecture. The mainstream is to cultivate white onions (long onions, deep-rooted onions) in the cropping patterns of "autumn-winter onions" or "spring-harvest onions" and ship them from autumn to spring. In recent years, the damage caused by onion black rot sclerotinia has been expanding. This disease infects the roots from the sclerotia of the pathogenic bacteria remaining in the soil, and then the infection spreads to the basal stem and leaf sheath (edible part of white onions), and parallel infection also occurs to adjacent plants. If the disease occurs early, growth failure due to root rot causes turf death. Even if it can grow until the harvest period, it causes the leaf sheath and basal stem to rot and turn brown in the soil that has been banked up (soil is banked up so that it covers up to the lower part of the branching part of the leaf blade to ensure a white and soft leaf sheath part). As a countermeasure for controlling onion black rot sclerotinia, inactivation of the sclerotia in the soil by soil disinfection is considered effective.

[0003] The pathogen of this disease is a filamentous fungus (onion black rot sclerotinia, Sclerotium cepivorum), which prefers low temperatures (soil temperature of 20°C or lower). Therefore, in the cropping pattern of "autumn-winter onions", infection and disease progress in the soil during autumn and winter when soil banking is carried out, and timely control is very difficult. In addition, since the sclerotia remaining in the soil after harvest become the infection source for the next crop, damage will flare up throughout the field within 2 to 3 years from the initial occurrence.

[0004] Traditionally, the diagnosis and identification of onion black rot sclerotinia disease has involved visual inspection, starting with pulling up poorly growing or dead plants from the field and observing the condition of the roots and disease symptoms (blackening, presence or absence of sclerotia). Subsequently, sclerotia formed on infected plants (mainly the leaf sheath) are cultured for 2-4 weeks, and a definitive diagnosis is made based on the culture characteristics (rate of mycelial growth, color and shape of the mycelium) and the appearance of sclerotia formation on the culture medium. Haq et al. also designed PCR primers to amplify the 5.8S rRNA gene and a portion of the nearby ITS region derived from Sclerotium cepivorum, the causative agent of onion black rot sclerotinia disease, and provided this as a method to confirm the presence of this fungus in onions in the early stages of infection (Non-Patent Literature 1). Woodhall et al. developed primers for real-time PCR to detect sclerotia from large amounts of soil by targeting the ITS region (Non-Patent Literature 2), and stated that this method is suitable for quantifying the level of Sclerotium cepivorum in soil samples. Furthermore, Iyozumi et al. developed primers for nested PCR to detect domestic strains of the disease (Shizuoka Prefecture) with high sensitivity (Non-Patent Literature 3). In addition, Amselem et al. sequenced the genomes of one strain of Sclerotinia sclerotiorum and two strains of Botrytis cinerea, which are closely related ascomycetes to the onion black rot pathogen, and constructed a phylogenetic tree of five gene loci including Glyceraldehyde-3-phosphate (G3PDH) and Heat shock protein 60 (HSP60) (Non-Patent Literature 4).

[0005] Regarding the sclerotia of Sclerotium cepivorum, Morikawa et al. reported that there are two types of sclerotia formation on culture media (Non-Patent Literature 5). Furthermore, the present inventors conducted molecular phylogenetic analyses of HSP60, G3PDH, and Calmodulin for Sclerotium cepivorum strains classified into two groups, A and B, based on morphological characteristics, and reported that the classification of groups A and B based on morphological characteristics was consistent with the results of the molecular phylogenetic analysis (Non-Patent Literature 6). [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Haq MA, Collin HA, Tomsett AB, Jones, MG (2003) Detection of Sclerotium cepivorum within onion plants using PCR primers. Physiological and Molecular Plant Pathology, 62(3), 185-189. [Non-Patent Document 2] Woodhall JW, Webb KM, Giltrap PM, Adams IP, Peters JC, Budge GE, Boonham N (2012) A new large scale soil DNA extraction procedure and real-time PCR assay for the detection of Sclerotium cepivorum in soil. European Journal of Plant Pathology, 134(3), 467-473. [Non-Patent Document 3] Hiroyuki Iyozumi, Masato Kawabe (2019) Detection of Sclerotium cepivorum Berkeley, a fungus that causes black rot in onions, by nested PCR of the DNA-ribosomal DNA-ITS region. Bulletin of the Kansai Plant Protection Association, 61: 133-136. [Non-Patent Document 4] Amselem J et al (2011) Genomic Analysis of the Necrotrophic Fungal Pathogens Sclerotinia sclerotiorum and Botrytis cinerea. PLos Genetics, 7(8): e1002230. [Non-Patent Document 5] Morikawa, T., Teranaka, S., Okuda, S., & Natsuaki, T. (1987). Formation process of sclerotia and miniature conidia of Sclerotium cepivorum on culture medium. Journal of the Plant Pathology Society of Japan, 53(1), Abstracts of the Autumn Kanto Branch Meeting, 118. [Non-Patent Document 6] Yoshihito Kataoka, Shinichi Miyata, Ok-Kyung Kim, Hiromitsu Negishi, and Hiroaki Shinohara (2018) Novel mycelial compatibility groups and molecular phylogenetic analysis of Sclerotinia rot fungus in Japanese onions. Journal of the Plant Pathology Society of Japan, 84(3), Abstracts of the 2018 Annual Meeting of the Plant Pathology Society of Japan, 257 [Overview of the project] [Problems that the invention aims to solve]

[0007] Inactivating the sclerotia of onion black rot disease through soil disinfection is difficult to achieve consistently in fields with moderate to severe outbreaks, and soil disinfection treatments requiring complete coverage are costly and labor-intensive. For these reasons, in areas where this disease occurs, a growing season control system is being established in which effective fungicides are drenched or sprayed during the onion growing season (at planting or hilling), making it possible to reduce damage. To utilize this control system more efficiently, it is important to accurately identify the initial stages of the outbreak.

[0008] Furthermore, it was unclear whether the PCR primer sets previously designed for detecting Sclerotia rot bacterium onion could detect all strains occurring in various regions. According to our research, existing primer sets (Non-Patent Documents 1 and 2 cited above) could detect Sclerotia rot bacterium group B, but showed false negatives for group A. A method capable of detecting both groups A and B is desired. [Means for solving the problem]

[0009] The present invention provides the following: [1] In any one selected from the group consisting of the glyceraldehyde 3-phosphate dehydrogenase (G3PDH) gene region, the heat shock protein 60 (HSP60) gene region, and the calmodulin (CaM) gene region of plant pathogenic fungi, It is preserved in both the A and B group strains of Sclerotium cepivorum, and Oligonucleotides of 15-30 nucleotides in length that can associate with the polymorphic regions of Botrytis cinerea, Botrytis squamosa, Dumontinia tuberosa, Macrophonina phaseolina, Sclerotinia homoeocarpa, Sclerotinia kitajimana, Sclerotinia minor, Sclerotinia nivalis, Sclerotinia sclerotiorum, Sclerotinia trifoliorum, Sclerotium fumigatum, and Sclerotium rolfsii. [2] Oligonucleotides as described in 1: The arrays with sequence numbers 25-30 are preserved, and Oligonucleotides capable of associating with the polymorphic region or its complementary region in the sequences of SEQ ID NOs. 5-24; The arrays with sequence numbers 51-56 are preserved, and Oligonucleotides capable of associating with the polymorphic region in sequences 31-50, or its complementary region; or The arrays with sequence numbers 77-82 are preserved, and Oligonucleotides capable of associating with the polymorphic region in sequences 57-76, or its complementary region. [3] A primer set capable of amplifying any one selected from the group consisting of the glyceraldehyde 3-phosphate dehydrogenase (G3PDH) gene region, the heat shock protein 60 (HSP60) gene region, and the calmodulin (CaM) gene region of plant pathogenic fungi, It is preserved in both the A and B group strains of Sclerotium cepivorum, and A primer set consisting of nucleotides, each 15-30 nucleotides long, capable of associating with polymorphic regions in Botrytis cinerea, Botrytis squamosa, Dumontinia tuberosa, Macrophonina phaseolina, Sclerotinia homoeocarpa, Sclerotinia kitajimana, Sclerotinia minor, Sclerotinia nivalis, Sclerotinia sclerotiorum, Sclerotinia trifoliorum, Sclerotium fumigatum, and Sclerotium rolfsii. [4] The primer set described in 3: It is capable of amplifying the G3PDH gene region, and is conserved in the sequences of SEQ ID NOs. 25-30, and A set of primers capable of associating with the polymorphic regions or their complementary regions in sequences 5-24; It is capable of amplifying the HSP60 gene region, and is conserved in the sequences of SEQ ID NOs. 51-56, and A primer set capable of associating with the polymorphic region in sequences 31-50, or its complementary region; or It is capable of amplifying the CaM gene region, and is conserved in the sequences of SEQ ID NOs. 77-82, and A primer set capable of associating with the polymorphic regions or their complementary regions in sequences 57-76. [5] A primer set as described in 3 or 4: It is capable of amplifying the G3PDH gene region. One primer can associate with a region containing positions 79 and 82 of sequence number 27, or a complementary region thereof. A primer set in which the other primer is capable of associating with a region containing positions 329, 335, and 338 of sequence number 27, or a complementary region thereof. [6] The primer set according to any one of items 3 to 5, wherein one primer is an oligonucleotide consisting of the sequence of SEQ ID NO: 1 or its complementary sequence, and the other primer is an oligonucleotide consisting of the sequence of SEQ ID NO: 2 or its complementary sequence. [7] The primer set according to any one of items 3 to 6 for diagnosing Sclerotinia sclerotiorum of green onion. [8] A step of extracting DNA from a sample; A step of performing PCR using the primer set according to any one of claims 3 to 7 with the extracted DNA as a template; A step of detecting an amplification product by PCR A method for detecting a pathogenic bacterium, comprising: when an amplification product is detected, it is determined that a pathogenic bacterium is present in the sample. [9] The method according to 8, wherein the sample is soil, or a plant body or a part thereof.

[10] The method according to 8 or 9, further comprising a step of cleaving an amplification product by PCR with a restriction enzyme.

[11] The method according to 10, using the primer set according to any one of items 3 to 7 and the restriction enzyme being MspI.

[0010]

[12] The oligonucleotide according to 1 or 2, or the primer set according to any one of items 3 to 7, which is used in the LAMP method.

[13] A kit for diagnosing Sclerotinia sclerotiorum of green onion, comprising the oligonucleotide according to 1 or 2, or the primer set according to any one of items 3 to 7. <0000​​​​​​​​(h) The B3 primer, which is an oligonucleotide consisting of the sequence of SEQ ID NO: 86 or its complementary sequence (i) LF, which is an oligonucleotide consisting of the sequence of SEQ ID NO: 87 or its complementary sequence (j) LB, which is an oligonucleotide consisting of the sequence of SEQ ID NO: 88 or its complementary sequence [Advantages of the Invention]

[0011] According to the present invention, Group A and Group B strains of the fungus causing black rot and sclerotinia of Allium fistulosum can be detected. According to the present invention, the fungus causing black rot and sclerotinia of Allium fistulosum can be specifically detected, distinguishable from other related species. According to the present invention, highly sensitive detection of the fungus causing black rot and sclerotinia of Allium fistulosum can be performed. According to the present invention, detection of the fungus causing black rot and sclerotinia of Allium fistulosum can be performed on a plant body or a part thereof. According to the present invention, Group A and Group B strains of the fungus causing black rot and sclerotinia of Allium fistulosum can be detected separately. According to the present invention, by the PCR method, the Sc strain occurring in Japan can be detected without fail specifically and highly sensitively, so that rapid and highly accurate detection and diagnosis of the fungus causing black rot and sclerotinia of Allium fistulosum in an Allium fistulosum production field can be performed.

[0012] The method for detecting Group A and Group B strains of the fungus causing black rot and sclerotinia of Allium fistulosum according to the present invention has the following advantages when it is a LAMP method using loop primers. · The detection result can be visually confirmed by turbidity or fluorescence. · The detection limit is lower compared to conventional PCR. · Even when a diseased tissue with soil attached is used as a sample, it can be detected without being inhibited by substances derived from the soil or the like. · It is easy to distinguish whether it is a false positive. [Brief Description of the Drawings]

[0013] [Figure 1]Phylogenetic analysis of fungal strains occurring in Japan. A molecular phylogenetic tree is shown using multiple genome-conserved regions (Hsp60 gene, G3PDH gene, Cal gene). The fungus that causes black rot onions (Sclerotium cepivorum, Sc) occurring in Japan can be broadly divided into two groups. The characteristics of Group A and Group B differ in the fungal flora on artificial culture media, mycelial compatibility, and sclerotial size. [Figure 2] Alignment of the G3PDH gene region. Underlined regions are Sc-specific (including potentially specific regions). Boxed sequences are for Taqman. [Figure 3] Alignment of the HSP60 gene region. Underlined regions are Sc-specific (including potentially specific regions). [Figure 4] Alignment of the base sequence of the CaM gene region. Underlined regions are Sc-specific (including possible regions). Boxed regions are A-specific. [Figure 5] Detection of Sc using previously reported primers. Conventional PCR was performed using the primers of Haq et al. (2003) with whole DNA as a template for Sc strains and Sc-related species. Top: PCR was performed on domestic isolates A and B of Sc, and strain A could not be detected. No PCR amplification products were detected from Sc-related species. [Figure 6] Detection of Sc using previously reported primers. Quantitative PCR was performed using the primers of Woodhall et al. (2012) with whole DNA from Sc strains and closely related species. Group B strains of Sc were detected, but Group A strains were not. [Figure 7] Detection of Sc using the primer set from the example. PCR was performed using the total DNA of newly identified Sc strains (groups A and B) and closely related species (gene bank preserved strains) as templates. The closely related species were not detected, but Sc group A and group B strains were detected. [Figure 8] Sensitivity of Sc-specific detection using primer set ScG3F / ScG3R. Total DNA (approximately 10 ng / μl) extracted from sclerotia (10 granules) of Sc strains (groups A and B) by CTAB was detectable even when diluted to 1 / 100th of its original concentration. [Figure 9]Specific detection of Sc using the primer set ScG3F / ScG3R. Quantitative PCR was performed using the total DNA of Sc strains (groups A and B) and closely related species as templates. Two strains of Sc (groups A and B) were detected with a cycle value (Ct value) of approximately 23. [Figure 10] Detection was performed using a primer set designed based on Hsp60. PCR was performed using the total DNA of Sc strains (groups A and B) and closely related species as templates. Two strains of Sc (groups A and B) were detected. Amplification was also observed in samples from Dumontinia tuberosa and Sclerotinia minor. [Figure 11] Discrimination of two Sc groups by restriction enzyme treatment after PCR. After performing PCR with the primer set ScG3F / ScG3R, restriction enzyme (MspI) treatment allowed for differentiation between group A and group B strains by agarose gel electrophoresis. [Figure 12] Detection from plant bodies: Sampling of diseased plants. The severity of onion black rot was classified into approximately three stages (mild, moderate, and severe), and samples were taken according to the distance from the roots, which is the site of pathogen entry. [Figure 13] Detection from plant tissue: PCR detection examples. Total DNA (plant tissue + pathogen) was extracted from diseased plants, and detection was attempted using the ScG3F / ScG3R primer set. Differences in detection efficiency depending on the DNA extraction method were also compared. Top panel: Extraction by CTAB method, Bottom panel: Extraction by Qiagen DNeasy Plant mini kit. [Figure 14] Sequence (G3PDH) of a new LAMP primer set for Sc-specific detection. The LAMP primer design utilized the sequences from the primer set ScG3F / ScG3R for F3 and B3. For FIP and BIP, primer positions were designed to exhibit single-nucleotide polymorphisms with closely related species. [Figure 15] Sample preparation of onion plants infected with Sc (DNA sample preparation for Sc detection) [Figure 16] Specific detection of Sclerotium cepivorum (Sc) using LAMP method with sclerotial DNA from related species. [Figure 17]Specific detection of Sc in Sc-infected onion plants by cPCR. Conventional PCR (cPCR, normal PCR) allows for accurate detection after washing the sample with water, but detection sensitivity decreases when soil is present due to contamination with inhibitors, etc. Medium 1-3: Another sample with moderate symptoms; Mild 1-3: Another sample with mild symptoms; None: Healthy onion without symptoms (negative control); sai02: Sclerotial DNA of the sai02 strain (positive control). [Figure 18] Specific detection of Sc from Sc-infected onion plants: Comparison of cPCR and LAMP methods. The results of conventional PCR (cPCR, normal PCR) and the LAMP method were almost identical, and for some sample DNA, the LAMP method showed higher detection sensitivity. [Modes for carrying out the invention]

[0014] [Oligonia, primers, probes] This invention relates to oligonucleotides for PCR capable of detecting plant pathogenic fungi. The oligonucleotides for PCR include primers, primer sets, and probes. The oligonucleotides, primers, and probes of this invention are particularly suitable for detecting Sclerotium cepivorum, the fungus that causes black rot onion.

[0015] The oligonucleotides of the present invention are capable of associating with any one selected from the group consisting of the glyceraldehyde triphosphate dehydrogenase (G3PDH) gene region, the heat shock protein 60 (HSP60) gene region, and the calmodulin (CaM) gene region of ascomycetes. The oligonucleotides of the present invention are also capable of associating with a region that is conserved in both group A and group B strains of Sclerotium cepivorum (Sc) and in which polymorphism is observed in closely related species of Sc.

[0016] In relation to the present invention, when referring to a close relative of Sc, unless otherwise specified, it refers to any of the species selected from the group consisting of Botrytis cinerea, Botrytis squamosa, Dumontinia tuberosa, Macrophonina phaseolina, Sclerotinia homoeocarpa, Sclerotinia kitajimana, Sclerotinia minor, Sclerotinia nivalis, Sclerotinia sclerotiorum, Sclerotinia trifoliorum, Sclerotium fumigatum, and Sclerotium rolfsii.

[0017] Sc has been analyzed based on sclerotial morphology, culture characteristics, hyphae, and molecular phylogeny, and can be broadly classified into group A (forming large sclerotia) and group B (forming small sclerotia) based on MCG (mycelial fusion group) and molecular phylogeny (see Non-Patent Literature 6 above). Since there are clear differences in culture characteristics between group A and group B, if they can be detected separately, it is expected that the analysis of their impact on disease development will progress in the future.

[0018] The sequence listing shows the sequences of the G3PDH gene region of a closely related species as SEQ ID NOs: 5-24, the sequences of the G3PDH gene region of Sc as SEQ ID NOs: 25-30, the sequences of the HSP60 gene region of a closely related species as SEQ ID NOs: 31-50, the sequences of the HSP60 gene region of Sc as SEQ ID NOs: 51-56, the sequences of the CaM gene region of a closely related species as SEQ ID NOs: 57-76, and the sequences of the CaM gene region of Sc as SEQ ID NOs: 77-82.

[0019] In a preferred embodiment, the oligonucleotides are primers, and the primers may be a primer set used in pairs. In a particularly preferred embodiment, the primer set is capable of amplifying the G3PDH gene region and can associate with a region that is conserved in the sequences of SEQ ID NOs. 25-30 and polymorphic in the sequences of SEQ ID NOs. 5-24, or a complementary region thereof.

[0020] A more specific example of such a primer set is one that can amplify the G3PDH gene region, in which one primer can associate with the region containing positions 79 and 82 of the sequence of SEQ ID NO: 27, or its complementary region, and the other primer can associate with the region containing positions 329, 335 and 338 of the sequence of SEQ ID NO: 27, or its complementary region.

[0021] Specifically, one of the primers is one of the following oligonucleotides: (a) Oligonucleotides comprising a sequence of a contiguous portion of at least 15-30 nucleotides, preferably 18-25 nucleotides, including positions 79 and 82 of the sequence of Sequence ID No. 27, or a complementary sequence thereof; (b) An oligonucleotide consisting of a sequence in which 1 to 3 bases are substituted in the oligonucleotide sequence of (a).

[0022] The other primer is one of the following oligonucleotides: (c) Oligonucleotides comprising a sequence of a contiguous portion of at least 15-30 nucleotides in length, preferably 18-25 nucleotides in length, including positions 329, 335, and 338 of the sequence of Sequence ID No. 27, or a complementary sequence thereof; (d) Oligonucleotides consisting of sequences in which 1-3 bases are substituted in the oligonucleotide sequence of (c).

[0023] A more specific example of a primer is one of the following oligonucleotides: (a') Oligonucleotides consisting of the sequence of Sequence ID No. 1, or its complementary sequence; Oligonucleotides consisting of sequences in which 1-3 bases are substituted in the oligonucleotide sequence of (b') (a').

[0024] A more specific example of the other primer is one of the following oligonucleotides: (c') Oligonucleotides consisting of the sequence of Sequence ID No. 1, or its complementary sequence; Oligonucleotides consisting of sequences in which 1-3 bases are substituted in the oligonucleotide sequence of (d') (c').

[0025] In another preferred embodiment, the primer set is capable of amplifying the HSP60 gene region and can associate with a region that is conserved in the sequences of SEQ ID NOs. 51-56 and polymorphic in the sequences of SEQ ID NOs. 31-50, or a complementary region thereof.

[0026] In another preferred embodiment, the primer set is capable of amplifying the CaM gene region and can associate with a region that is conserved in the sequences of SEQ ID NOs. 77-82 and polymorphic in the sequences of SEQ ID NOs. 57-76, or a complementary region thereof.

[0027] Generally, PCR primers are designed with attention to four factors: Tm value, terminal stability of each primer region, GC content, and secondary structure. Furthermore, to prevent primer dimer formation, the 3' ends should not be complementary. The same applies to the primers of the present invention.

[0028] The distance between primers can be designed so that the amplified product is 120-400 base pairs long, for example, 200-300 base pairs long.

[0029] Each primer can be independently 15-30 nucleotides long, preferably 18-25 nucleotides long. Furthermore, if the primers are BIP or FIP in the LAMP method described later, each can be independently 30-60 nucleotides long, preferably 36-50 nucleotides long.

[0030] In another preferred embodiment, the oligonucleotide is a probe for detecting a specific sequence in the PCR amplification product. In another preferred embodiment, the probe can associate with a region related to the G3PDH gene region that is conserved in the sequences of SEQ ID NOs. 25-30 and polymorphic in the sequences of SEQ ID NOs. 5-24, or a complementary region thereof.

[0031] A more specific example of such a probe is one that can associate with a region or a complementary region containing any of the positions 79, 82, 329, 335, and 338 of the sequence of sequence number 27.

[0032] In another preferred embodiment, the probe can associate with a region related to the HSP60 gene region that is conserved in the sequences of SEQ ID NOs. 51-56 and polymorphic in the sequences of SEQ ID NOs. 31-50, or a complementary region thereof.

[0033] In another preferred embodiment, the probe can associate with a region related to the CaM gene region that is conserved in the sequences of SEQ ID NOs. 77-82 and polymorphic in the sequences of SEQ ID NOs. 57-76, or a complementary region thereof.

[0034] The probe should be designed to associate with the target polymorphism near the center, specifically in a region of 5 bases above and below the center of the nucleotide chain. The probe should be 15-30 bases long, preferably 18-25 bases. This length is effective for specific association with the intended complementary sequence.

[0035] The probe may be modified with a fluorescent molecule. Examples of fluorescent molecules that can be used include N-(3-Fluoranthyl)maleimide (FAM), fluorescein, dansil, Cascade Yellow, fluorescein, Oregon Green, pyrene, Texas Red, Pacific Blue, Marine Blue, Alexa, Lucifer Yellow, BODIPY, Coumarin, PyMPO, TET, JOE, Cy3, Cy5, Cy5.5, Cy7, ROX, VIC, HEX, TAMRA, SYBR Green, NBD, etc. Methods for attaching fluorescent molecules to oligonucleotides and methods for detecting fluorescence are well known in the art.

[0036] The present invention also provides a kit for diagnosing onion black rot sclerotinia, comprising a predetermined set of oligonucleotides and primers. The kit may include a container such as a microtube, a solution for DNA extraction from a sample, a diluent, a positive control, a manual, and the like.

[0037] [Detection method] The present invention also provides a method for detecting pathogenic bacteria using the primer set described above. The detection method of the present invention includes the following steps: The process of extracting DNA from a sample; The process of performing PCR using the primer set described above, with the extracted DNA as a template; A step in detecting the amplification product by PCR.

[0038] The present invention also provides a method for detecting pathogenic bacteria using the probe described above. The detection method of the present invention includes the following steps: The process of extracting DNA from a sample; The process of performing PCR using extracted DNA as a template and an appropriate primer set; A step of detecting the amplification product by PCR using the probe described above.

[0039] Furthermore, the detection method of the present invention allows for the determination that, if an amplification product is detected, a pathogenic bacterium, more specifically, Sclerotium cepivorum (Sc), which is the bacterium that causes black rot in onions, is present in the sample.

[0040] Examples of plants in which Sc can be detected by the detection method of the present invention include plants of the genus Allium. Examples of plants belonging to the genus Allium include green onions (Allium fistulosum L.), onions (A. cepa L.), leeks (A. porrum L.), garlic (A. sativum L.), shallots (A. chinensis G.Don), wild garlic (A. victorialis L.), chives (A. tuberosum Rottl.), dwarf chives (A. monanthum Maxim.), wild chives (A. togashii Hara), scallions (A. virgunculae F.Maek. et Kitam.), wild shallots (A. splendens Willden.), wild onions (A. macrostemon Bunge), wild shallots (A. thunbergii) G.Don, and chives (A. schoenoprasum L.). The detection method of the present invention is suitable for detecting Sc in green onions, onions, garlic, leeks, shallots, and chives, and is particularly suitable for detecting Sc in green onions.

[0041] When the analytical method of the present invention is applied to green onions, the variety, strain, and cultivation method of the green onions are not particularly limited. According to the present invention, white green onions (sometimes called long green onions or deep-rooted green onions), which are susceptible to the spread of green onion black rot disease, can also be suitably analyzed, even when produced under the "autumn / winter green onion" or "spring harvest green onion" cultivation methods. Examples of leek varieties to which the analytical method of the present invention can be applied include TA-4, MSN-TAM-1, Suzuwarabe, MSS-TA-4, TAM-3, Koiwarabe, Yumewarabe, TAM-1, MSK-TA-2, TA-2, Negi Intermediate Parent No. 1, Fuyuwarabe, Hikawa, Choetsu, Iwai, Bansei Shiobara, Benizome, Motoharu Bansei, Big Fellow, Futakko, Harukawa Okuta, Daikokuho, Shimodai, Kono Midori, Yoshiharu, Nishikizo, Shunto, Harumi, Kiyomidori, Natsu Fujin, Satsukihime, Yawaragi, T Nakajima Shiranaga, Sagayutaka, BL Manganbo, Ashinaga Bijin, Shonan Ippon, Hitachi Benikko, Tom One, Etchu Natsu Komachi, Etchu Fuyu Komachi, Natsu Genki, YSG No. 1, NR Shizuiku No. 1, Tokyo Komachi, Wase Kaminari, Akita Harukko, YSG No. 2, and Hyogo N-1, Natsu Moeka, Ryusho, Ryu Hikari No. 1, Ryu Hikari No. 2, Ryuki, and Ryumi are among the names that can be mentioned.

[0042] The samples to be tested can be microbial cells (sclerotia), soil, or plant bodies or parts thereof. Examples of plant body parts include roots and stem discs where Sc sclerotia are attached.

[0043] An extractant is used to extract DNA from the sample. The extractant can be prepared as a buffer containing a surfactant. The base buffer is selected from Tris buffer, phosphate buffer, Tricinel buffer, HEPES buffer, MOPS buffer, carbonate buffer, citrate buffer, borate buffer, MES buffer, and PIPES buffer, and contains 100-700 mM, preferably 500 mM, of NaCl, and the pH may be pH 6-10, preferably pH 7.4. Known surfactants can be used, for example, nonionic surfactants such as TritonX-100, NP-40, and Tween; amphoteric surfactants such as 7BzO, SB3-10, SB3-14, CHAPS, and amide sulfobetaine-14 (ASB14); and ionic surfactants such as cetyltrimethylammonium bromide (CTAB) and sodium dodecyl sulfate (SDS). However, amphoteric and ionic surfactants are preferred, and ionic surfactants are more preferred. Preferably, SDS or CTAB, more preferably CTAB, is used. The concentration of the surfactant in the extract is 0.5-1.5% by weight, preferably 1% by weight.

[0044] The extract can be added in a ratio of 0.1-30 ml, preferably 0.5-10 ml, and more preferably 0.75-3 ml per 1 g of sample.

[0045] The extraction method can be carried out by known techniques. The extractant is added to the ground sample and heated (e.g., 60°C) for several minutes to 1 hour, preferably 5 to 20 minutes. If necessary, the extraction process may be repeated multiple times, preferably twice.

[0046] The detection method of the present invention may further include a step of cleaving the PCR amplification product with a restriction enzyme. A preferred example of the restriction enzyme is MspI, because it can distinguish between group A and group B strains of Sc. MspI is a restriction enzyme derived from the Msp I gene isolated from Moraxella bacteria, and recognizes and cleaves the following sequence.

[0047] [ka]

[0048] Other restriction enzymes with the same function can be used. HpaII is one such example.

[0049] [Detection method using LAMP method] The detection method of the present invention can be performed as the LAMP (Loop-Mediated Isothermal Amplification) method. The LAMP method is a method of amplification using a strand displacement reaction with four types of primers that combine six regions selected from the sequence of the target gene. The design of LAMP primers is carried out using six regions in the region to be amplified (sometimes called the "template (nucleotide, DNA)") from the 5' end: F3 region, F2 region, F1 region, B1 region, B2 region, and B3 region. The regions complementary to these six regions are called the F3c region, F2c region, F1c region, B1c region, B2c region, and B3c region, respectively. In the basic LAMP method, four types of primers are used, more specifically two types of inner primers, namely FIP and BIP, and two types of outer primers, namely F3 primer and B3 primer.

[0050] In detail, FIP is designed to have an F2 region at its 3' end, which is a sequence complementary to the F2c region, and the same sequence as the F1c region at its 5' end; F3 Primer is designed to have an F3 region at its 3' end, which is a sequence complementary to the F3c region; BIP is designed to have a B2 region at its 3' end, which is a sequence complementary to the B2c region, and the same sequence as the B1c region at its 5' end; and B3 Primer is designed to have a B3 region at its 5' end, which is a sequence complementary to the B3c region. When designing primers for the LAMP method to perform detection according to the present invention, it is preferable to design either FIP, BIP, F3 primer, or B3 primer to associate with the polymorphic site.

[0051] Loop primers can be used in the LAMP method. Loop primers are typically designed to have a sequence complementary to the single-stranded portion of the 5' end loop of the dumbbell structure of the LAMP amplification product (between the B1 and B2 regions, or between the F1 and F2 regions). These are referred to as loop primer B (LB) and loop primer F (LF), respectively. By using loop primers, the number of starting points for DNA synthesis can be increased. In an amplification product with a typical six loops from the LAMP method, four loops are not utilized in the original method using four primers, but all loops become available by using loop primers. Loop primers LB and LF may also be used in the LAMP method for detection according to the present invention.

[0052] In relation to the present invention, when the terms F3 region, F2 region, F1 region, B1 region, B2 region, B3 region, FIP, F3 primer, BIP, B3 primer, loop primer B (LB), and loop primer F (LF) are used in the same sense as those used in the general LAMP method, unless otherwise specified (see below).

[0053] [Table 1]

[0054] Generally, compared to the PCR method, the LAMP method does not require a denaturation reaction from single-stranded to double-stranded molecules, the reaction proceeds at a constant temperature of 60-65°C, and does not require equipment such as a thermal cycler. Furthermore, it boasts a fast amplification rate and high specificity.

[0055] In a particularly preferred embodiment, the LAMP method of the present invention uses the following primer set (e)-(j). (e) FIP, which is an oligonucleotide consisting of the sequence of Sequence ID No. 83 or its complementary sequence. (f) BIP, which is an oligonucleotide consisting of the sequence of sequence number 84 or its complementary sequence. (g) F3 primer which is an oligonucleotide consisting of the sequence of Sequence ID No. 85 or its complementary sequence. (h) B3 primer which is an oligonucleotide consisting of the sequence of SEQ ID NO: 86 or its complementary sequence. (i) LF which is an oligonucleotide consisting of the sequence of Sequence ID No. 87 or its complementary sequence. (j) LB is an oligonucleotide consisting of the sequence of Sequence ID No. 88 or its complementary sequence.

[0056] In the LAMP method of the present invention, oligonucleotide probes may be used. Furthermore, primers and probes used in the LAMP method may be modified with fluorescent molecules or quenching molecules. Examples of fluorescent molecules are as described above. As quenching molecules, for example, non-fluorescent substances (called dark quenchers) such as 4-dimethylaminoazobenzene-4'-carboxylic acid (Dabcyl), QSY-7, QSY-21, QSY-35, BHQ-0, BHQ-1, BHQ-2, BHQ-3, and Eclipse may be used, or fluorescent substances having an absorption band in the wavelength range emitted by the above fluorescent molecules may be used as quenching molecules. Methods for binding fluorescent molecules and quenching molecules to oligonucleotides, and methods for detecting changes in fluorescence intensity are well known in the art. [Examples]

[0057] Development of PCR primers for I.Sc detection 1. Method [DNA extraction] Eight Sclerotium cepivorum (Sc) isolates were cultured on PDA agar plates at 20°C in the dark. Approximately 10 sclerotia were collected from each isolate, and DNA from each strain was extracted using the CTAB method. In addition, 11 strains of 13 closely related species of Sclerotium (Botrytis cinerea MAFF 615004, Botrytis squamosa MAFF 241966, Dumontinia tuberosa MAFF 241471, Macrohomina phaseolina MAFF 238567, Sclerotinia homoeocarpa MAFF 235856, Sclerotinia kitajimana MAFF 410428, Sclerotinia minor MAFF 238173, Sclerotinia nivalis MAFF 241342, Sclerotinia sclerotiorum MAFF 306236, Sclerotinia trifoliorum MAFF 305210, Sclerotium fumigatum MAFF 237402), and Sclerotium rolfsii MAFF 242770, which is found mixed in onion fields. The DNA of each strain of *Rolfsii var. delphinii* (MAFF 328254) was extracted using the CTAB method from one sclerotia or hyphae cultured on PDA agar plates. The extracted DNA was concentrated using Nanodrop (Thermo Fisher) and adjusted to 10-30 ng / μl. Each DNA sample was stored in a -25°C freezer until use.

[0058] [CTAB method] <Extraction Buffer> • CTAB extract (2% hexadecyltrimethylammonium bromide, 0.1M Tris-HCl pH 8.0, 20mM EDTA, 0.4M NaCl) • Phenol-chloroform solution (v / v=1:1)

[0059] <method> 1. Place the sclerotia or hyphae of each strain into a 1.5 ml microcentrifuge tube and crush the cells using a pestle or a 2 mm stainless steel ball. 2. Add 500 μL of CTAB extract and incubate at 60°C for 10 minutes. 3. Add 200 μL of phenol chloroform solution, mix well, and let stand for 10 minutes. 4. Centrifuge at 15,000 rpm for 10 minutes. 5. Transfer 200 μL of the upper layer to a new tube, add 200 μL of isopropanol, and mix by inverting. 6. Centrifugation at 15,000 rpm for 10 minutes. 7. Remove the supernatant and add 500 μL of 70% ethanol. 8. Centrifuge at 15,000 rpm for 10 minutes. 9. Remove the supernatant and dry the pellets. 10. After drying, add 20 μL of TE Buffer and measure the concentration using Nanodrop (Thermo Fisher), adjusting it to 10-30 ng / μl.

[0060] [Determination of base sequence] Conventional PCR was performed targeting three regions reported by Andrews et al. (2012): Glyceraldehyde-3-phosphate dehydrogenase (G3PDH), Heat shock protein 60 (HSP60), and Calmodulin (CaM). PCR for each region (G3PDH, HSP60, and CaM) was performed using Takara's EX taq. The volume of the reaction product was 10 × EX taq Buffer (Mg 2+The reagents were prepared as follows: 10 mM of (plus), 0.25 mM of dNTP Mixture, 0.2 μM of each primer, and 0.2 U of EX taq, for a total volume of 25 μL. The reaction conditions followed Andrews et al. (2012): a preliminary denaturing reaction at 95°C for 2 minutes, followed by denaturing at 95°C for 30 seconds, annealing at 30 seconds with varying temperatures for each primer (58°C for G3PDH, 53°C for HSP60, and 50°C for CaM), extension at 72°C for 1 minute for 35 cycles, and finally extension at 72°C for 5 minutes. The PCR reaction products were run on 1.5% agarose (Agarose LE, Analytical Grade), and size was determined using a 100 bp DNA Ladder (Nippon Genetics Co., Ltd.) as a size marker. The PCR reaction products were purified using the FastGene Gel / PCR Extraction Kit (Nippon Genetics Co., Ltd.) to obtain purified products for sequencing. The purified product was analyzed using a capillary sequencer to obtain individual base sequence data, which was then searched for using BLAST in NCBI.

[0061] [Primer design] Based on the report by Andrews et al. (2012), the nucleotide sequence information for each gene region of 13 closely related species of Sc (3 species of Botrytis, 4 species of Botryotinia, 4 species of Sclerotinia, and 2 species of Myriosclerotinia) was obtained from the DDBJ / EMBL / GenBank databases. Alignment was performed using the software Clustal W, and the alignment information was compared using MEGA ver.7. From this, species-specific nucleotide sequence information was designed based on the nucleotide sequence of each gene region so that it would be specific to either the upstream, downstream, or both. Three primer sets were designed for G3PDH, ten primer sets for HSP60, and four primer sets for CaM.

[0062] In addition, Figure 2, 3, and 4 show the alignments of the nucleotide sequences of G3PDH, HSP60, and CaM derived from representative Sc group A and group B strains, and Sc related species, respectively.

[0063] [Confirmation of Primer Specificity] PCR was performed on a total of 15 strains including 2 strains of S.cepivorum (MAFF239143 strain group A, Sai01 strain group B) and 13 strains of related species.

[0064] [PCR Reaction Conditions] Using Promega's Go taq Greenmaster mix, the test was conducted in a reaction system with a total volume of 25 μl according to the manual. The reaction cycle conditions were 30 cycles of 94°C for 15 seconds, 62°C for 15 seconds, and 72°C for 15 seconds after a preliminary reaction of 94°C for 2 minutes using TaKaRa PCR Thermal Cycler Dice (registered trademark) TP600 or TP650. The PCR reaction products were electrophoresed using 1.5% agarose (Agarose, LE, Analytical Grade), and 100bp DNA Ladder (Nippon Genetics Co., Ltd.) was used as the marker for judgment.

[0065] [Treatment of PCR Reaction Products] For the determination of bacterial groups using restriction enzyme treatment, MspI (Takara) was used and the cleavage enzyme treatment was performed according to Takara's manual. The restriction enzyme treatment reaction was incubated at 37°C for 15 minutes and then the enzyme was inactivated at 94°C for 10 minutes. The confirmation of the restriction enzyme treatment products after treatment was performed in the same manner as the PCR reaction test.

[0066] [Quantitative PCR] Using Nippon Gene's GeneAce SYBR qPCR Mixα, this was carried out according to the manual. The reaction conditions were 45 cycles of 94°C for 15 seconds, 62°C for 15 seconds, and 72°C for 15 seconds after a preliminary reaction of 94°C for 10 minutes using Takara's Tehermal Cycler Dice TP700.

[0067] [PCR Using Previously Reported Primers] The Sc-specific primers (SCAF / ITS2SCR) described in Haq et al. (2003) (Non-Patent Literature 1) were subjected to PCR against 37 strains of Sc-related species and 71 strains of S. cepivorum. The PCR reaction was performed in a 25 μl reaction system according to the manual for Promega's Go taq Greenmaster mix. The PCR reaction conditions followed those of Haq et al. PCR reaction products were electrophoresed using 1.5% agarose (Agarose, LE, Analytical Grade), and the marker was determined using a 100 bp DNA Ladder (Nippon Genetics Co., Ltd.).

[0068] The Sc-specific primers (Z996-340F / Z996-450R:Z996-382T) described in Woodhall et al. (2012) (Non-Patent Literature 2) were used for quantitative PCR against six Sc-related species. The PCR reaction was performed according to the Nippon Gene GeneAce Probe qPCR Mix II manual, and the PCR reaction conditions followed those of Woodhall et al. (2012).

[0069] 2. Results [Detection using previously reported primers] The results are shown in Figures 5 and 6. Conventional PCR was performed using the primers of Haq et al. (2003) with the total DNA of Sc and closely related species as templates. Group B strains were detected, but Group A strains were not. Furthermore, no amplification products were obtained from 37 strains of closely related species. Additionally, when PCR was performed using the primers of Woodhall et al. (2012) with the total DNA of Sc and closely related species as templates, Group B strains were detected, but Group A strains were not (Figure 6).

[0070] [Detection using ScG3F / ScG3R primer set] Using the designed primer set, we were able to perform PCR using the total DNA of Sc strains (groups A and B) and closely related species as templates. One of the primer sets created based on the GAPDH nucleotide sequence allowed for specific detection, specifically detecting Sc group A and B strains while failing to detect Sc closely related species. These results are shown in Figure 7.

[0071] The sequences of the ScG3F primer and the ScG3R primer are shown below. ScG3F:5'-CAAGGGCGATATCAAGGTCCTT-3'(SEQ ID NO:1) ScG3R:5'-GGAGATGACATCTGCTTCACCA-3'(SEQ ID NO:2)

[0072] [Sensitivity of Sc-specific detection using ScG3F / ScG3R primer set] From sclerotia (10 granules) of Sc strain (groups A and B), total DNA (approximately 10 ng / μl) extracted using the CTAB method described above was gradually diluted to 1 / 100th of its original volume, and PCR was performed on these samples.

[0073] The results are shown in Figure 8. Amplification products were detected in the diluted samples of both Group A and Group B strains.

[0074] [Quantitative PCR] Figure 9 shows the results of PCR using the ScG3F / ScG3R primer set. Only the two Sc strains (Group A and Group B) had a cycle value (Ct value) of approximately 23, allowing them to be detected distinctly from closely related Sc species.

[0075] [Designing PCR primers based on Hsp60] PCR was performed using PCR primers designed based on Hsp60, with the total DNA of Sc strains (groups A and B) and closely related species as templates. The results are shown in Figure 10. Two Sc strains (groups A and B) were detected. Amplification was also achieved from Dumontinia tuberosa and Sclerotinia minor.

[0076] The primer sequence is shown below. F:5'- ACTGTTGGTGAACAGATGGTG -3'(SEQ ID NO:3) R:5'- GCGACTTGTGCGATTTCCTCGCTG -3'(SEQ ID NO:4)

[0077] [Discrimination between two groups using ScG3F / ScG3R primer sets] The study used MAFF239143, Chi01, and Chi07 strains as Group A, and Sai01 and Shi01 strains as Group B. PCR was performed using the ScG3F / ScG3R primer set, followed by restriction enzyme (MspI) treatment at 37°C for 15 or 60 minutes, and then agarose gel electrophoresis. The results are shown in Figure 11. Group A and Group B could be distinguished by agarose gel electrophoresis of the enzyme-treated samples. In Figure 11, the left side of the molecular weight marker represents a reaction time of 15 minutes, and the right side represents a reaction time of 60 minutes; detection was possible in both cases.

[0078] [Detection of pathogens from plants] Total DNA (plant + pathogen) was extracted from diseased plants, and detection was attempted using the ScG3F / ScG3R primer set. Differences in detection efficiency between different DNA extraction methods were also compared.

[0079] In detail, the severity of onion black rot was classified into approximately three stages (mild, moderate, and severe), and samples were taken according to the distance from the root, which is the site of pathogenic fungal invasion (Figure 12). Total DNA was extracted from diseased plants using the CTAB method described above, or the Qiagen DNeasy Plant mini kit, following the instructions included with the kit. PCR was performed according to the conditions described above.

[0080] The results are shown in Figure 13. When extracted using the CTAB method, the virus was detected in the stem plate area where the symptoms were "moderate," and in the roots, stem plate area, and a location 10 cm away from the roots where the symptoms were "severe."

[0081] II. Development of the LAMP method 1. Method [Development of a primer set] Primers for the LAMP method to specifically detect Sc were designed using PrimerExplorer V5, LAMP method primer design support software from Eiken Chemical Co., Ltd. For the LAMP method primer F3, the sequence of primer ScG3F designed in step I was used, but with a Tm value taken into consideration, resulting in a sequence two bases shorter. Furthermore, the polymorphism position at ScG3R was incorporated into the BIP. For FIP, the primer position was designed to produce a single-base polymorphism with closely related species (see Figure 14).

[0082] The sequence of the LAMP primer set designed is shown in the table below.

[0083] [Table 2]

[0084] [Sample preparation] Samples were prepared from onion plants infected with Sc and exhibiting different levels of disease progression (see Figure 15 and the table below). Total DNA was extracted from each sample (infected onion plant or sclerotia) using the CTAB method described in "Development of PCR Primers for I.Sc Detection".

[0085] [Table 3]

[0086] Specifically, samples were prepared from the onion plant as follows: 1. Cut the diseased tissue (approximately 1 cm square: red frame) of the diseased plant in half. 2. For samples with soil still attached, the entire DNA was extracted using the CTAB method. 3. For "washing with water," the samples were washed with tap water, thoroughly dried, and then all DNA was extracted.

[0087] [Implementation of LAMP method and cPCR method] LAMP method: Add the reagents from the LAMP method kit (Loopamp® DNA amplification reagent kit D (Eiken Chemical Co., Ltd.) or Isothermal Master Mix (Nippon Gene Co., Ltd.)), total DNA (approximately 1 μl), and the designed primers to a 0.2 ml Eppendorf tube, and perform the amplification reaction according to the manual included with the kit. The instrument used was Takara Real time PCR48 (Takara Bio Inc.).

[0088] Conventional PCR (cPDR) method: This was performed according to the method described in "Development of PCR primers for I.Sc detection".

[0089] 2. Results [Specific detection of Sc using the LAMP method with sclerotinia DNA] The results are shown in Figure 16. DNA amplification was confirmed by the turbidity of the reaction solution. Amplification products were detected in both Group A and Group B strains using the LAMP method.

[0090] [Specific detection of Sc using cPCR in plant tissue] The results are shown in Figure 17. Conventional PCR (cPCR, normal PCR) allows for accurate detection after washing the sample with water, but the detection sensitivity decreases when soil is present due to contamination with inhibitory substances, etc.

[0091] [Specific detection of Sc from plant tissue: Comparison of cPCR and LAMP methods] The results are shown in Figure 18. The results for conventional PCR (cPCR, normal PCR) and the LAMP method were almost identical, and for some sample DNAs, the LAMP method showed higher detection sensitivity. [Industrial applicability]

[0092] This invention makes it possible to diagnose onion black rot disease at its initial stage, and therefore it can be used in onion production sites, extension and guidance centers and public research stations in each prefecture that receive consultations from production sites, and the seed and seedling industry.

[0093] This invention allows for the measurement of sclerotia density in soil and the diagnosis of contamination levels, making it applicable to soil pest and disease diagnosis.

[0094] For DNA extraction from plant tissue, sclerotia, and fungal cells, the orthodox method (CTAB method) has good detection sensitivity, and no special conditions are required for PCR, so there are considered to be almost no technical limitations for practical application. [Sequence Listing Free Text]

[0095] SEQ ID NO:1 ScG3F Primer SEQ ID NO:2 ScG3R Primer SEQ ID NO:3 Primer SEQ ID NO:4 Primer SEQ ID NOs: 5-24 Closely related species: G3PDH SEQ ID NOs: 25-30 Sc G3PDH SEQ ID NOs: 31-50 Closely related species: HSP60 SEQ ID NOs: 51-56 Sc HSP60 SEQ ID NOs: 57-76 Closely related species: CaM SEQ ID NOs: 77-82 Sc CaM SEQ ID NO:83 FIP SEQ ID NO:84 BIP SEQ ID NO:85 F3 primer SEQ ID NO:86 B3 primer SEQ ID NO:87 LF SEQ ID NO:88 LB

[0096] SEQUENCE LISTING <110> National Agriculture and Food Research Organization, The Yokohama Nursery Co., Ltd. <120> Oligonucleotides and methods for detecting Sclerotium cepivorum <130> 211906K <150> JP 2021-026543 <151> 2021-02-22 <160> 88 <170> PatentIn version 3.5 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PCR primer, ScG3F <400> 1 caagggcgat atcaaggtcc tt 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PCR primer, ScG3R <400> 2 ggagatgaca tctgcttcac ca 22 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 3 actgttggtg aacagatggt g 21 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 4 gcgacttgtg cgatttcctc gctg 24 <210> 5 <211> 756 <212> DNA <213> Botryotinia calthae strain LMK750 <400> 5 aggcatacat gttgaagtat gattccaccc acggtcaatt caagggtgac atcaaggtcc 60 tcgccgatgg attggaggtc aatggcaaga aggtcaagtt ctacactgag agagacccag 120 ccaacatccc atgggctgag tctgaggcat actacgtcgt cgagtccact ggtgttttca 180 ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gttatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaagggtg 300 atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacaccg 420 ccacccaaaa gaccgttgat ggtccatccg ctaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ctgccaaggc tgtcggaaag gtcatcccag 540 agcttaacgg caaactcacc ggaatgtcca tgcgcgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatt gagaagggtg cttcttatga tgagatcaag gccgttatca 660 agaaggctgc tgatggtcct ctcaagggta agctactcca ttactctttc tttggctcta 720 atttactaat cgtaacacag gcatattggc ttacac 756 <210> 6 <211> 756 <212> DNA <213> Botryotinia convoluta strain LMK755 <400> 6 aggcatacat gttgaagtat gattccaccc acggtcaatt caagggtgac atcaaggtcc 60 ttgccgatgg attggaggtc aatggcaaga aggtcaagtt ctacaccgag agagacccag 120 ccaacatccc atgggctgag tctgaggcat actacgtcgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggccaag gcacatttga agggtggtgc caagaaggtt gttatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacactggtg 300 atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacaccg 420 ctacccaaaa gaccgttgat ggtccatccg ctaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ctgccaaggc tgtcggaaag gtcatcccag 540 tccttaacgg caaactcacc ggaatgtcca tgcgtgttcc aactgccaat gtctcagttg 600 ttgacttgac tgtccgcatt gagaagggtg cttcttacga tgagatcaag gccgtcatca 660 agaaggctgc tgatggtcct ctcaagggta agttactcca ttactctttc ttcggctcta 720 atttgctaat cgtaacacag gcatattggc ttacac 756 <210> 7 <211> 756 <212> DNA <213> Botryotinia fuckeliana strain B05.10 <400> 7 aggcatacat gttgaagtat gattccaccc acggtcaatt caagggtgac atcaaggtcc 60 ttgccgatgg attggaggtc aatggcaaga aggtcaagtt ctacaccgag agagacccag 120 ccaacatccc atgggctgag tctgaggcat actacgtcgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggccaag gcacatttga agggtggtgc caagaaggtt gttatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacactggtg 300 atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacaccg 420 ctacccaaaa gaccgttgat ggtccatccg ctaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ctgccaaggc tgtcggaaag gtcatcccag 540 tccttaacgg caaactcacc ggaatgtcca tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatt gagaagggtg cttcttacga tgagatcaag gccgtcatca 660 agaaggctgc tgatggtcct ctcaagggta agttactcca ttactctttc ttcggctcta 720 atttgctaat cgtaacacag gcatattggc ttacac 756 <210> 8 <211> 756 <212> DNA <213> Botryotinia porri strain LMK19 <400> 8 aggcatacat gttgaagtat gattccaccc acggtcaatt caagggtgat atcaaggtcc 60 tttccgatgg attggaggtc aatggcaaga aggtcaagtt ctacaccgag agagacccag 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggccaag gcacatttga agggtggtgc caagaaggtt gttatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaagggtg 300 atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccat tcctacaccg 420 ccacccaaaa gaccgtcgat ggtccatccg ctaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ctgccaaggc cgtcggaaag gtcatcccag 540 agcttaacgg caaactcacc ggaatgtcca tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatt gagaagggtg cttcttatga tgagatcaag gccgtcatca 660 agaaggctgc tgatggtcct ctcaagggta agttactcta ttaatctttc ttccattcta 720 atttactaat cgtaatatag gcatattggc ttacac 756 <210> 9 <211> 901 <212> DNA <213> Botrytis cinerea DAOM:166439 <400> 9 aatatgccgt aagttccgc tatcggacct cccgcagatt gcaaggaccc gagctaatct 60 atcttatgta caggcataca tgttgaagta tgattccacc cacggtcaat tcaagggtga 120 tatcaaggtc ctttccgatg gattggaggt caatggcaag aaggtcaagt tctacactga 180 gagagaccca gccaacatcc catgggctga gtctgaggca tactacgttg tcgagtccac 240 cggtgttttc accaccaccg agaaggccaa ggcacatttg aagggtggtg ccaagaaggt 300 tgtatctct gctccttctg ccgatgcccc aatgtacgtt atgggtgtca acaacgagac 360 ctacaagggt gatgttgatg ttatctccaa cgcctcttgc acaaccaact gcttggctcc 420 tctcgccaag gtcatcaacg atgagttcac catcattgag ggtttgatga ccaccatcca 480 ctcctacacc gccacccaaa agaccgtcga tggtccatcc gctaaggatt ggcgtggagg 540 acgtaccgct gctcaaaaca tcatcccatc gagcaccggt gctgccaagg ccgtcggaaa 600 ggtcatccca gagcttaacg gcaaactcac cggaatgtcc atgcgtgttc caactgccaa 660 cgtctcagtt gttgacttga ctgtccgcat tgagaagggt gcttcttatg atgagatcaa 720 ggccgtcatc aagaaggctg ctgatggtcc tctcaagggt aagttactct attaatctct 780 ttttcatttc aatttactaa tcgtaatata ggcatattgg cttacactga ggacgacgtt 840 gtctccactg acatgaacgg tgacaaccac tcctccatct tcgatgctaa ggccggtatc 900 t 901 <210> 10 <211> 756 <212> DNA <213> Botrytis paeoniae strain LMK439 <400> 10 aggcatacat gttgaagtat gattccacccc acggtcaatt caagggtgac atcaaggtcc 60 ttgccgatgg attggaggtc aatggcaaga aggtcaagtt ctacaccgag agagacccag 120 ccaacatccc atgggctgag tctgaggcat actacgtcgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggccaag gcacatttga agggtggtgc caagaaggtt gttatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacactggtg 300 atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacaccg 420 ctacccaaaa gaccgttgat ggtccatccg ctaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ctgccaaggc tgtcggaaag gtcatcccag 540 tccttaacgg caaactcacc ggaatgtcca tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatt gagaagggtg cttcttacga tgagatcaag gccgtcatca 660 agaaggctgc tgatggtcct ctcaagggta agttactcca ttactctttc ttcggctcta 720 atttactaat cgtaacacag gcatattggc ttacac 756 <210> 11 <211> 756 <212> DNA <213> Botrytis tulipae strain LMK76 <400> 11 aggcatacat gttgaagtat gattccacccc acggtcaatt caagggtgat atcaaggtcc 60 tttccgatgg attggaggtc aatggcaaga aggtcaagtt ctacaccgag agagacccag 120 ccaacatccc atgggctgag tccgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 cgccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaagggtg 300 atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgaattcacc atcattgaag gtttgatgac caccattcac tcctacaccg 420 ccacccaaaa gaccgttgat ggtccatccg ctaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ctgccaaggc cgtcggaaag gtcatcccag 540 agcttaacgg caaactcacc ggaatgtcca tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatt gagaagggtg cttcttatga tgagatcaag gccgtcatca 660 agaaggctgc tgatggtcct ctcaagggtg agttactctc tcaacccttc ttccgttcta 720 atttactaat cataatacag gcatattggc ttacac 756 <210> 12 <211> 760 <212> DNA <213> Ciboria acerina strain LMK476 <400> 12 aggcatacat gttgaagtat gactccacccc acggtcaatt caagggtgat atcaaggtcc 60 tcgccgatgg attggaggtc aatggcaaga agatcaagtt ctacaccgag agagacccag 120 ccaacatccc atgggctgag actgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggccaag gctcacttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaagggtg 300 acgttgatgt tctctctaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatccacga tgagttcacc atcattgagg gtttgatgac caccatccac tcctacactg 420 ccacccaaaa gaccgttgac ggtccatccg ctaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ccgccaaggc cgtcggaaag gtcatcccag 540 agcttaacgg caagctcacc ggaatgtcca tgcgtgttcc aactgccaac gtttccgttg 600 ttgacttgac ctgccgcatt gagaagggtg cttcttacga ccaaatcaag gccgtcatca 660 agaaggccgc tgatggacct ctcaagggta agacctctat aaattttcaa cattcttatt 720 cataatacta acagtgatat ataggcatat tggcttacac 760 <210> 13 <211> 761 <212> DNA <213> Dumontinia tuberosa strain LMK749 <400> 13 aggcatacat gttgaagtat gactccactc acggtcaatt caagggcgaa atcaaggtcc 60 tttccgacgg attggaggtt aatggcaaga aagtcaagtt ctacactgag agagaccctg 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttccgc tgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaacggtg 300 aagcagatgt tatctccaac gcttcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgaattcacc atcattgaag gtttgatgac caccattcac tcctacactg 420 ccacccaaaa gaccgttgat ggtccatccg caaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat cattccatcg agcaccggtg ccgccaaggc cgtcggaaag gtcattccag 540 agcttaatgg caagctcacc ggaatgtcta tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatt gagaaggctg cttcttatga tgagatcaag gaggtcatca 660 agaaggctgc taatggtcct ctcaagggta agatacttca caaatattta ttacttttca 720 atttactaat aataacgatg tataggcata ttggcttaca c 761 <210> 14 <211> 758 <212> DNA <213> Lambertella subrenispora strain LMK5 <400> 14 aggcatacat gttgaagtac gactccaccc acggtcaatt caagggtgac atcaaggtcc 60 tccccgacgg attggaggtc aatggcaaga aggtcaaatt ctacaccgag agagatcccg 120 ccaacatccc atgggctgag tccgacgcat actacgttgt tgagtccact ggtgtcttca 180 ccaccaccga gaaggccaag gcccatctta agggtggtgc caagaaggtt gtcatctctg 240 ctccttctgc tgacgctcct atgtatgtca tgggtgtcaa caacgagacc tacaagtccg 300 atgttgatgt tatctccaac gcctcctgca caaccaactg cttggctcct ctcgccaagg 360 tcatccacga tgagttcacc atcatcgagg gtctcatgac caccattcac tcctacactg 420 ccacccaaaa gactgttgac ggtccatccg ccaaggactg gcgtggagga cgtaccgctg 480 ctcaaaacat cattcctagc agcactggtg ccgccaaggc cgtcggaaag gtcatcccag 540 acctcaacgg caagctcacc ggaatgtcca tgcgtgtgcc aacctccaac gtctccgttg 600 ttgacttgac tgtccgcatc gagaagggag cttcctacga tgagatcaag gctgtcatca 660 agaaggctgc tgatggtcct cttaagggta tgttgtgcgt tcacatatgc acggtggtca 720 gattacttac attgaatatt aggcatactc gcttacac 758 <210> 15 <211> 758 <212> DNA <213> Monilinia aucupariae strain LMK733 <400> 15 aggcatacat gttgaagtat gactccactc acggtcaatt caagggtgac atcaaggtcc 60 tcgccgatgg attggaggtc aatggcaaga aggtcaagtt ctacaccgag agagacccag 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgaagctacc ggtgttttca 180 ccaccaccga caaggccaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaagggtg 300 atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgagg gtttgatgac caccattcac tcctacaccg 420 ccacccaaaa gaccgttgac ggtccatccg caaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcactggtg ctgccaaggc cgtcggaaag gtcatcccag 540 agcttaacgg caagctcacc ggaatggcta tgcgtgtccc aactgccaac gtctccgttg 600 tcgacttgac ctgccgcatt gagaagggtg ctacttatga tgagatcaag gctgtcatca 660 agaaggctgc tgatggtcct cttaagggta agagctttcg tcaatctttt gtacttctcg 720 gcttactaat gatgatgtat aggcatattg gcttacac 758 <210> 16 <211> 757 <212> DNA <213> Monilinia fructicola strain LMK125 <400> 16 aggcatacat gttgaagtat gactccactc acggtcaatt caagggtgat atcaaggtcc 60 tcgccgatgg attggaggtc aatggcaaga aggtcaagtt ctacactgag agagaccctg 120 ccaacatccc atgggctgag actgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggccaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagagc tacaagggtg 300 acgtcgacgt tatctccaac gcttcttgca caaccaactg cttggctcct cttgccaagg 360 tcatcaacga tgagttcacc atcattgagg gtttgatgac cactatccac tcctacactg 420 ccacccaaaa gaccgttgac ggtccatccg caaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ctgccaaggc cgtcggaaag gtcatcccag 540 agcttaacgg caagctcacc ggaatgtcca tgcgtgtccc aactgccaac gtctccgttg 600 ttgacttgac ctgccgcatt gagaagggtg ctacttatga tgagatcaag gctgtcgtca 660 agaaggctgc cgagggtcct cttaagggta agagctttga tgatctttga tgttttccag 720 attactaatt atgataaaca ggcatattgg gttacac 757 <210> 17 <211> 761 <212> DNA <213> Monoline megalospora strain LMK415 <400> 17 aggcatacat gttgaagtat gactccactc acggtcaatt caagggtgac atcaaggttc 60 tcgccgatgg attggaggtc aacggcaaga aggtcaagtt ctacaccgag agagaccctg 120 ccagcatccc atgggctgag tccgaggcat actacgttgt cgaggccacc ggtgttttca 180 ccaccaccga gaaggccaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacacgggtg 300. atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 420. tcatcaacga tgagttcacc atcattgagg gtttgatgac caccattcac tcctacactg 480. cccccaaaa gaccgttgac ggtccatccg caaaggattg gcgtggagga cgtaccgctg ctcaaaacat catcccatcg agcaccggtg ctgccaaggc cgtcggaag gtcatcccag 540 agcttaacgg caagctcacc ggaatggcta tgcgtgtccc aactgccaac gtctccgttg 660. tcgacttgac ctgccgcatt gagaagggtg ctacttatga cgagatcaag gctgtcatca agaaggctgc tgagggtcct cttaagggta agagcattca tagtcttt gcgctttcca 720 gcttactaat gatgatgata tataggcata ttgggttaca c <210> 18 <211> 762 <212> DNA <213> Monilinia urnula strain LMK413 <400> 18 aggcatacat gttgaagtat gactccactc acggtcaatt caagggtgac atcaaggttc 60 tcgccgatgg attggaggtc aatggcaaga aggtcaagtt ctacactgag agagaccctg 120 ccagcatccc atgggctgag tccgaggcat actacgttgt cgaggccacc ggtgttttca 180 ccaccaccga taaggccaag gcacatttga agggtggtgc caagaaggtt gtcatttctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaagggtg 300 atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgagg gtttgatgac caccattcac tcctacactg 420 ccacccaaaa gaccgttgac ggtccatccg caaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ctgccaaggc cgtcggaaag gtcatcccag 540 agcttaacgg caagctcacc ggaatggcta tgcgtgtccc aactgccaac gtctccgttg 600 660. tcgacttgac ctgccgcatt gagaagggtg ctacttatga cgagatcaag gctgtcgtca agaaggctgc tgagggccct cttaagggta agagcattca tagtctttt gcgctttcca 720 gcttactaat gatgatatat atataggcat attgggttac ac <210> 19 <211> 759 <212> DNA <213> Myriosclerotinia curreyana strain LMK736 <400> 19 aggcatacat gttgaagtat gattccaccc acggccaatt caagggtgat attaaggtcc tccccgatgg attggaggtc aacggcaaga aggtcaagtt ctacacagag agagaccctg ccaacatccc atgggctgag tctaaggcat actacgttgt cgagtccacc ggtgttttca 180 240. ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa taacgagacc tacaagggtg 300 atgttgatgt tatctccaac gcttcttgca caaccaactg cttggctcct ctcgccaagg ttatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacactg 420 ccacccaaaa gaccgttgat ggtccatccg gaaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat tatcccatcg agcaccggtg ctgccaaggc cgtcggaaag gtcatcccag 540 agctcaacgg aaagctcacc ggaatgtcta tgcgtgtccc aactgccaac gtttctgttg 600 ttgatttgac ttgccgcatt gagaagggtg ctacttatga tgagatcaag gccgtcatca 660 agaaggctgc tgagggtccc cttaagggta agtgttttca ctcatcttga taattttcta 720 aaatactaac tggtgacata taggcatatt gggttacac 759 <210> 20 <211> 759 <212> DNA <213> Myriosclerotinia scirpicola strain LMK735 <400> 20 aggcatacat gttgaagtat gactccaccc acggccaatt caagggtgat attaaggtcc 60 tctccgacgg attggaggtc aacggcaaga aggtcaagtt ctacactgag agagaccctg 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ctaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaagggtg 300 atgttgatgt tatctccaac gcttcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacactg 420 ccacccaaaa gaccgttgat ggtccatccg gaaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat cattccatcg agcactggtg ctgccaaggc cgtcggaaag gtcatcccag 540 agcttaacgg aaagcttacc ggaatgtcta tgcgtgtccc aactgccaac gtttcagttg 600 ttgatttgac ttgccgcatt gagaagggtg ctacttatga tgagatcaag gccgtcatca 660 agaaggctgc tgagggtcct ctcaagggta cgtgtttttc atcaatcttt atcattttat 720 aatactaa tggtgatata taggcatatt gggttacac 759 <210> 21 <211> 758 <212> DNA <213> Sclerotinia glacialis strain LMK74 <400> 21 aggcatacat gttgaagtat gactccactc acggtcaatt caagggtgat atcaaggtcc 60 ttcccgacgg attggaggtt aatggcaaga aagtcaagtt ctacaccgag agagaccctg 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttccgc tgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacactggtg 300 aagctgatgt tatctccaac gcttcttgca caaccaactg cttggcccct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacactg 420 ccacccaaaa gaccgttgat ggtccatccg caaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat cattccatcg agcaccggtg ccgccaaggc cgtcggaaag gtcattccag 540 agcttaatgg caagcttacc ggaatgtcta tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatc gagaagcctg cttcttatga cgagatcaag gaggtcatca 660 agaaggctgc taatggtcct cttaagggta agatacttca tcaatattta ttacgtttca 720 attgactate aacgatgcat aggcatattg gcttacac 758 <210> 22 <211> 758 <212> DNA <213> Sclerotinia minor strain W10 <400> 22 aggcatacat gttgaagtat gactccactc acggtcaatt caagggtgac atcaaagtcc 60 tctccgacgg attggaggtt aatggcaaga aagtcaagtt ctacactgag agagaccctg 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ctaccaccga gaaggctaag gcacacttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttccgc cgatgcccca atgtacgtca tgggtgtcaa caacgagacc tacaatggtg 300 aagcagatgt tatctccaac gcttcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacactg 420 ccacccaaaa gaccgttgat ggtccatccg caaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat cattccatcg agcaccggtg ccgccaaggc cgtcggaaag gtcattccag 540 agcttaacgg caagctcacc ggaatgtcta tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatt gagaaggctg cttcttacga tgagatcaag gaggtcatca 660 agaaggctgc caatggtcct cttaagggta agcaacctgt caaatattca ttactcttca 720 atttactaat aacgctgtat aggcatattg gcttacac 758 <210> 23 <211> 757 <212> DNA <213> Sclerotinia sclerotiorum strain 1980 <400> 23 aggcatacat gttgaaatat gactccactc acggtcaatt caagggtgat atcaaagtcc 60 tctccgacgg attggaggtt aatggcaaga aagtcaagtt ctacactgag agagaccctg 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttccgc cgatgcccca atgtacgtca tgggtgtcaa caacgagacc tacaatggtg 300 aagcagatgt tatctccaac gcttcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccattcac tcctacactg 420 ccacccaaaa gaccgttgat ggtccatccg ctaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat cattccatcg agcaccggtg ccgccaaggc cgtcggaaag gtcattccag 540 agcttaacgg caagctcacc ggaatgtcta tgcgtgttcc aactgccaac gtctctgttg 600 ttgacttgac tgtccgcatt gagaaggctg cttcttatga tgagatcaag gaggtcatca 660 agaaggccgc caatggtcct ctcaagggta agaaatttgt caatattcat tacttttcaa 720 tttactaaca acaatgtata ggcatattgg cttacac 757 <210> 24 <211> 758 <212> DNA <213> Sclerotinia trifoliorum strain LMK47 <400> 24 aggcatacat gttgaagtat gactctactc acggtcaatt caagggtgac atcaaagtcc 60 tccccgacgg attggaggtt aatggcaaga aagtcaagtt ctacactgag agagaccctg 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttccgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaatggtg 300 aagcagatgt tatctccaac gcttcttgca caaccaactg cttggctcct cttgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacactg 420 ccacccagaa gaccgttgat ggtccatccg caaaggattg gcgcggagga cgtaccgctg 480 ctcaaaacat cattccatcg agcactggtg ccgctaaggc cgtcggaaaa gtcattccag 540 agcttaacgg caagctcacc ggaatgcta tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatt gagaaggctg cttcttatga tgagatcaag gaggccatca 660 agaaggctgc caatggtcct cttaagggta agcaacctat caaatattca ttactcgtca 720 attactaac aacaatggat aggcatattg gcttacac 758 <210> 25 <211> 758 <212> DNA <213> Sclerotium cepivorum strain LMK1 <400> 25 aggcatacat gttgaagtat gactccactc acggtcaatt caagggcgat atcaaggtcc 60 ttccgacgg attggaggtc aatggcaaga aggtcaagtt ctacactgag agagaccctg 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttccgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaatggtg 300 aagcagatgt catctccaac gcttcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccattcac tcctacactg 420 ccacccaaaa gaccgttgat ggtccatccg caaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat cattccatcg agcaccggtg ccgccaaggc cgtcggaaag gtcattccag 540 agcttaacgg caagctcacc ggaatgtcta tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgttcgcatt gagaaggctg cttcttatga tgagatcaag gaggtcatca 660 agaaggctgc taatggtcct cttaagggta agatacttta caaatactta ttgcttttca 720 gtttactaat aacgatgttt aggcatattg gcttacac 758 <210> 26 <211> 758 <212> DNA <213> Sclerotium cepivorum strain LMK71 <400> 26 aggcatacat gttgaagtat gactccactc acggtcaatt caagggcgat atcaaggtcc 60 tttccgacgg attggaggtc aatggcaaga aggtcaagtt ctacactgag agagaccctg 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttccgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaatggtg 300 aagcagatgt catctccaac gcttcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccattcac tcctacactg 420 ccacccaaaa gaccgttgat ggtccatccg caaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat cattccatcg agcaccggtg ccgccaaggc cgtcggaaag gtcattccag 540 agcttaacgg caagctcacc ggaatgtcta tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgttcgcatt gagaaggctg cttcttatga tgagatcaag gaggtcatca 660 agaaggctgc taatggtcct cttaagggta agatacttta caaatactta ttgcttttca 720 gtttactaat aacgatgttt aggcatattg gcttacac 758 <210> 27 <211> 871 <212> DNA <213> MAFF239143(A) <400> 27 ccggacctcc caaaaacacc aaggacccga gctaatattc attgtttaca ggcatacatg 60 ttgaagtatg actccactca cggtcaattc aagggcgata tcaaggtcct tcccgacgga 120 ttggaggtca atggcaagaa ggtcaagttc tacactgaga gagaccctgc caacatccca 180 tgggctgagt ctgaggcata ctacgttgtc gagtccactg gtgttttcac caccaccgag 240 aaggctaagg cacatttgaa gggtggtgcc aagaaggttg tcatctctgc tccttccgcc 300 gatgccccaa tgtacgttat gggtgtcaac aacgagacat acaatggtga agcagatgtc 360 atctccaacg cttcttgcac aaccaactgc ttggctcctc tcgccaaggt catcaacgat 420 gagttcacca tcattgaagg tttgatgacc accattcact cctacactgc cactcaaaag 480 accgttgatg gtccatccgc aaaggattgg cgtggaggac gtaccgctgc tcaaaacatc 540 attccatcga gcaccggtgc cgccaaggcc gtcggaaagg tcattccaga gcttaacggc 600 aagctcaccg gaatgtctat gcgtgttcca actgccaacg tctcagttgt tgacttgact 660 gtccgcattg agaagggtgc ttcttatgat gagatcaaag gaggtcatca agaaggctgc 720 taatggtcct cttaagggta agatacttca caaatattta ttgcttttca atttactaat 780 aacgatgtac aggcatattg gcttacaccg aggacgatgt tgtttccact gacatgaacg 840 gtgacaacca ctcctccatc tcgatgccaa g 871 <210> 28 <211> 839 <212> DNA <213> chi01(A) <400> 28 caccaaggac ccgagctaat attcattgtt tacaggcata catgttgaag tatgactcca 60 ctcacggtca attcaagggc gatatcaagg tccttcccga cggattggag gtcaatggca 120 agaaggtcaa gttctacact gagagagacc ctgccaacat cccatgggct gagtctgagg 180 catactacgt tgtcgagtcc actggtgttt tcaccaccac cgagaaggct aaggcacatt 240 tgaagggtgg tgccaagaag gttgtcatct ctgctccttc cgccgatgcc ccaatgtacg 300 ttatgggtgt caacaacgag acatacaatg gtgaagcaga tgtcatctcc aacgcttctt 360 gcacaaccaa ctgcttggct cctctcgcca aggtcatcaa cgatgagttc accatcattg 420 aaggtttgat gaccaccatt cactcctaca ctgccactca aaagaccgtt gatggtccat 480 ccgcaaagga ttggcgtgga ggacgtaccg ctgctcaaaa catcattcca tcgagcaccg 540 gtgccgccaa ggccgtcgga aaggtcattc cagagcttaa cggcaagctc accggaatgt 600 ctatgcgtgt tccaactgcc aacgtctcag ttgttgactt gactgtccgc attgagaagg 660 gtgcttctta tgatgagatc aaggaggtca tcaagaaggc tgctaatggt cctcttaagg 720 gtaagatact tcaacaatat ttattgcttt tcaatttact aataacgatg tacaggcata 780 ttggcttaca ccgaggacga tgttgtttcc actgacatga acggtgacaa ccactcctc 839 <210> 29 <211> 937 <212> DNA <213> sai01(B) <400> 29 cttcatcgag actgaatatg ccgtaagtcg ccgctaccgg acctcccaaa gacaccatgg 60 acccgagcta attttcattg tttgcaggca tacatgttga agtatgactc cactcacggt 120 caattcaagg gcgatatcaa ggtcctttcc gacggattgg aggtcaatgg caagaaggtc 180 aagttctaca ctgagagaga ccctgccaac atcccatggg ctgagtctga ggcatactac 240 gttgtcgagt ccaccggtgt tttcaccacc accgagaagg ctaaggcaca tttgaagggt 300 ggtgccaaga aggttgtcat ctctgctcct tccgccgatg ccccaatgta cgttatgggt 360 gtcaacaacg agacctacaa tggtgaagca gatgtcatct ccaacgcttc ttgcacaacc 420 aactgcttgg ctcctctcgc caaggtcatc aacgatgagt tcaccatcat tgaaggtttg 480 atgaccacca ttcactccta cactgccacc caaaagaccg ttgatggtcc atccgcaaag 540 gattggcgtg gaggacgtac cgctgctcaa aacatcattc catcgagcac cggtgccgcc 600 aaggccgtcg gaaaggtcat tccagagctt aacggcaagc tcaccggaat gtctatgcgt 660 gttccaactg ccaacgtctc agttgttgac ttgactgttc gcattgagaa ggctgcttct 720 tatgatgaga tcaaggaggt catcaagaag gctgctaatg gtcctcttaa gggtaagata 780 ctttacaaat acttattgct tttcagttta ctaataacga tgtttaggca tattggctta 840 caccgaggac gatgttgtct ctactgacat gaacggtgac aaccactcct ccatcttcga 900 tgccaaggcc tggtatctcc ctcaacaaga acttctc 937 <210> 30 <211> 879 <212> DNA <213> shi01(B) <400> 30 cgctaccgga cctcccaaag acaccatgga cccgaagcta attttcattg tttgcaggca 60 tacatgttga agtatgactc cactcacggt caattcaagg gcgatatcaa ggtcctttcc 120 gacggattgg aggtcaatgg caagaaggtc aagttctaca ctgagagaga ccctgccaac 180 atcccatggg ctgagtctga ggcatactac gttgtcgagt ccaccggtgt tttcaccacc 240 accgagaagg ctaaggcaca tttgaagggt ggtgccaaga aggttgtcat ctctgctcct 300 tccgccgatg ccccaatgta cgttatgggt gtcaacaacg agacctacaa tggtgaagca 360 gatgtcatct ccaacgcttc ttgcacaacc aactgcttgg ctcctctcgc caaggtcatc 420 aacgatgagt tcaccatcat tgaaggtttg atgaccacca ttcactccta cactgccacc 480 caaaagaccg ttgatggtcc atccgcaaag gattggcgtg gaggacgtac cgctgctcaa 540 aacatcattc catcgagcac cggtgccgcc aaggccgtcg gaaaggtcat tccagagctt 600 aacggcaagc tcaccggaat gtctatgcgt gttccaactg ccaacgtctc agttgttgac 660 ttgactgttc gcattgagaa ggctgcttct tatgatgaga tcaaggaggt catcaagaaa 720 gctgctaatg gtcctcttaa gggtaagata ctttacaaat acttattgct tttcagttta 780 ctaataacga tgtttaggca tattggctta caccgaggac gatgttgtct ctactgacat 840 gaacggtgac aaccactcct ccatcttcga tgccaaggc 879 <210> 31 <211> 899 <212> DNA <213> Botryotinia calthae strain LMK750 <400> 31 aggagctcaa attcggtgtt gagggcagag cagctcttct tgctggtgtt gagactttgg 60 caaaagctgt tgctacaacc ttgggtccca aaggccgaaa tgttcttatt gagtcagcat 120 atggctcccc aaagatcact aaaggtttgc gaaactcccg gctacctagt ttcaaaattc 180 taattattgg tgaatagatg gtgtaaccgt tgccagagct atttccctca aggacaaatt 240 cgagaacctg ggtgctagac ttatccaaga tgttgcctcg aaaaccaacg agaccgctgg 300 tgatggaacc acaaccgcta ctgtccttgc taaatctatt ttctccgaga ccgtaaagaa 360 cgtcgccgca ggatgcaacc caatggactt gcgcagaggt acccaagccg ccgtggaggc 420 tgttgttgaa tttttgcaaa agaacaagcg tgatatcaca accagcgagg aaatcgcaca 480 agttgcgact atcagtgcaa acggtgatac ccacatcgga aaattgattg ccaacgctat 540 ggaaaaggtt ggaaaggaag gtgtcatcac agtcaaggaa ggaaaaacca tggaggatga 600 actcgatatt accgagggaa tgagatttga ccgcggttat gtttccccat actttatcac 660 cgataccaag tcgcaaaagg tggaattcga gaagccattg attctccttt ctgagaagaa 720 gatttcaaac gtccaagata ttatcccagc acttgaggcg tctactcaac ttcgccgtcc 780 tttggtcatc attgctgaag atattgatgg agaagctctc gctgtatgca ttcttaacaa 840 gctccgtggt caactccaag ttgccgctgt caaggccccc ggttcggtg acaaccgaa 899 <210> 32 <211> 899 <212> DNA <213> Botryotinia convoluta strain LMK755 <400> 32 aggagctcaa attcggtgtt gagggcagag cagctcttct tgctggtgtt gagactttgg 60 caaaagctgt tgctacaacc ttgggtccca aaggccgaaa tgttcttatt gagtcagcat 120 atggctcccc aaagatcact aaaggtttgc aaactcccg gctacctagt ttcaagattc 180 taattattgg tgaatagatg gtgtaaccgt tgccagagct atttccctca aggacaaatt 240 cgagaacctc ggtgctagac ttatccaaga tgttgcctcg aaaaccaacg agaccgctgg 300 tgatggaacc acaaccgcta ctgtccttgc taaatctatt ttctccgaga ccgtaaagaa 360 cgtcgccgca ggatgcaacc caatggactt gcgcagaggt acccaagctg ccgtggaggc 420 cgttgttgag tttttgcaaa agaacaagcg tgatatcaca acaagcgagg aaatcgcaca 480 agttgcgact atcagtgcaa acggtgatac ccacatcgga aaattgattg ccaacgctat 540 ggaaaaggtt ggaaaggaag gtgttatcac agttaaggaa ggaaagacca tggaggacga 600 actcgatatt accgagggaa tgagatttga ccgcggttat gtttccccat acttcatcac 660 cgataccaag tcgcaaaagg tggaattcga gaagccattg attctccttt ctgagaagaa 720 gatttcaaac gtccaagata ttatcccagc acttgaggcg tctactcaac ttcgtcgtcc 780 tttggtcatc attgctgaag atatcgatgg agaagctctc gcagtatgca ttcttaacaa 840 gctccgtggt caactccaag ttgccgctgt caaggccccc ggtttcggtg ataaccgag 899 <210> 33 <211> 899 <212> DNA <213> Botryotinia fuckeliana strain B05.10 <400> 33 aggagctcaa attcggtgtt gagggcagag cagctcttct tgctggtgtt gagactttgg 60 caaaagctgt tgctacaacc ttgggtccca aaggccgaaa tgttcttatt gagtcagcat 120 atggctcccc aaagatcact aaaggtttgc aaaactcccg gctacctagt ttcaagattc 180 taattattgg tgaatagatg gtgtaaccgt tgccagagct atttccctca aggacaaatt 240 cgagaacctc ggtgctagac ttatccaaga tgttgcctcg aaaaccaacg agaccgctgg 300 tgatggaacc acaaccgcta ctgtccttgc taaatctatt ttctccgaga ccgtaaagaa 360 cgtcgccgca ggatgcaacc caatggactt gcgcagaggt acccaagctg ccgtggaggc 420 cgttgttgag ttttgcaaa agaacaagcg tgatatcaca acaagcgagg aaatcgcaca 480 agttgcgact atcagtgcaa acggtgatac ccacatcgga aaattgattg ccaacgctat 540 ggaaaaggtt ggaaaggaag gtgttatcac agttaaggaa ggaaagacca tggaggacga 600 actcgatatt accgagggaa tgagatttga ccgcggttat gtttccccat acttcatcac 660 cgataccaag tcgcaaaagg tggaattcga gaagccattg attctccttt ctgagaagaa 720 gatttcaaac gtccaagata ttatcccagc acttgaggcg tctactcaac ttcgtcgtcc 780 tttggtcatc attgctgaag atatcgatgg agaagctctc gcagtatgca ttcttaacaa 840 gctccgtggt caactccaag ttgccgctgt caaggccccc ggttcggtg ataaccgaa 899 <210> 34 <211> 899 <212> DNA <213> Botryotinia porri strain LMK19 <400> 34 aggagctcaa attcggtgtt gagggcagag cagctcttct tgctggtgtt gagactttgg 60 caaaagctgt cgccacaacc ttaggtccca aaggccgaaa tgttcttatt gagtcagcat 120 atggctcccc aaagatcact aaaggtttgc aaaccccctg gctaccaagt tgtaaaattc 180 taattgttgg tgaatagatg gtgtaactgt tgccagagct atttccctca aggacaaatt 240 cgagaatctc ggtgctagac tcatccaaga tgttgcctcg aaaaccaacg agaccgctgg 300 tgatggtacc acaaccgcta ctgtccttgc caaatctatt ttctccgaga ccgtaaagaa 360 cgtcgccgca ggatgcaacc caatggactt gcgcagaggt acccaagccg ccgtggaggc 420 cgtcgttgag tttttgcaaa agaacaagcg tgatatcaca accagcgagg aaatcgcaca 480 agttgcgact atcagtgcaa acggtgatac ccacatcgga aaattgattg ccaacgctat 540 ggagaaggtt ggaaaggaag gtgtcatcac agtcaaggag ggaaagacca tggaggatga 600 actcgatatc accgagggaa tgagatttga ccgcggttat gtctccccat acttcatcac 660 cgataccaag tcgcaaaagg ttgaattcga gaaaccattg attctcctct ctgagaagaa 720 gatctcaaac gtccaagata ttatcccagc acttgaggca tctacccaac ttcgccgtcc 780 tttggtcatc attgctgaag atatcgatgg agaagctctc gctgtatgca ttcttaacaa 840 gctccgtggt caactccaag ttgccgctgt caaggccccc ggtttcggcg acaaccgaa 899 <210> 35 <211> 936 <212> DNA <213> Botrytis cinerea DAOM:166439 <400> 35 tcaagttcgg tgttgagggc agagcagctc ttcttgctgg tgttgagact ttggcaaaag 60 ctgttgccac aaccctaggt ccaaaaggcc gaaatgttct tattgagtca gcatatggct 120 ccccaaagat cactaaaggt tcgtgaaatc cctcggttac ctagttataa aattctaatg 180 tttgtgaata gatggtgtaa ctgttgccag agctatttcc ctcaaggaca aattcgagaa 240 tctcggtgct agactcatcc aagatgttgc ctcgaaaacc aacgagaccg ctggtgatgg 300 aaccacaacc gctactgtcc ttgctaagtc tatcttctcc gagactgtaa agaacgtcgc 360 cgcaggatgc aacccaatgg atttgcgcag aggtacccag gccgccgtgg aggccgtcgt 420 tgagttttg caaaagaaca agcgtgatat cacaaccagc gaggaaattg cacaagttgc 480 gactatcagt gcaaacggtg atacccacat cggaaagttg attgcaaacg ctatggagaa 540 ggttggaaag gaaggtgtca tcacagtcaa ggagggaaag accatggagg atgaactcga 600 tattaccgag ggaatgagat ttgaccgcgg ttgtctct catacttca tcaccgatac 660 caagtcgcaa aaagtggaat tcgagaagcc attgattctc ctctccgaga agaagatctc 720 aaacgtccaa gatatcatcc cagcacttga ggcatccact caacttcgcc gtcctttggt 780 catcattgct gaagatatcg atggagaggc cctcgctgta tgcatcctta acaagctccg 840 tggtcaactc caagttgccg ctgtcaaggc ccccggtttc ggtgataacc gaaagtccat 900 tctcggcgat ctcggtatct tgaccaatgc tactgt 936 <210> 36 <211> 899 <212> DNA <213> Botrytis paeoniae strain LMK439 <400> 36 aggagctcaa attcggtgtt gagggcagag cagctcttct tgctggtgtt gagactttgg 60 caaaagctgt tgctacaacc ttgggtccca aaggccgaaa tgttcttatt gagtcagcat 120 atggctcccc aaagatcact aaaggtttgc aaaactcccg gctacctagt ttcaagattc 180 taattattgg tgaatagatg gtgtaaccgt tgccagagct atttccctca aggacaaatt 240 cgagaacctc ggtgctagac ttatccaaga tgttgcctcg aaaaccaacg agaccgctgg 300 tgatggaacc acaaccgcta ctgtccttgc taaatctatt ttctccgaga ccgtaaagaa 360 cgtcgccgca ggatgcaacc caatggactt gcgcagaggt acccaagctg ccgtggaggc 420 cgttgttgag tttttgcaaa agaacaagcg tgatatcaca acaagcgagg aaatcgcaca 480 agttgcgact atcagtgcaa acggtgatac ccacatcgga aaattgattg ccaacgctat 540 ggaaaaggtt ggaaaggaag gtgttatcac agttaaggaa ggaaagacca tggaggacga 600 actcgatatt accgagggaa tgagatttga ccgcggttat gtttccccat acttcatcac 660 cgataccaag tcgcaaaagg tggaattcga gaagccattg attctccttt ctgagaagaa 720 gatttcaaac gtccaagata ttatcccagc acttgaggcg tctactcaac ttcgtcgtcc 780 tttggtcatc attgctgaag atatcgatgg agaagctctc gcagtatgca ttcttaacaa 840 gctccgtggt caactccaag ttgccgctgt caaggccccc ggttcggtg ataaccgaa 899 <210> 37 <211> 900 <212> DNA <213> Botrytis tulipae strain LMK76 <400> 37 aggagctcaa attcggtgtt gagggcagag cagctcttct tgctggtgtt gagactttgg 60 caaaagctgt cgccacaacc ctaggtccaa aaggccgaaa tgttcttatt gagtcagcat 120 acggctcccc gaagatcact aaaggtttgt gaaatcccccc ggccacctag ttgcaaaatt 180 ctaattgttg gtgaatagat ggtgtaactg ttgccagagc tatttccctc aaggacaaat 240 300. tcgagaatct cggtgctaga ctcatccaag atgttgcctc gaaaaccaac gagaccgctg gtgatggaac cacaaccgct actgtccttg ctaaatctat tttctccgag accgtaaaga atgtcgccgc aggatgcaac ccaatggact tgcgcagagg tacccaggcc gccgtggagg 420 ccgtcgttga gttttgcaa aaaaacaagc gtgatatcac aaccagcgag gaaatcgcac aagttgcgac tatcagtgca aacggtgata cccacatcgg aaaattgatt gccaacgcta tggagaaggt tggaagga ggtgtcatca cagtcaagga gggcaagacc atggaggatg aactcgatat taccgaggga atgagatttg accgcggtta tgtctcccca tacttcatca ccgataccaa gtcgcaaaaa gtggaattcg agaagccact gatcctcctc tccgagaaaa agatctcaaa cgtccaagat atcatcccag cacttgaggc atctactcaa cttcgccgtc ctttggtcat cattgctgaa gatatcgatg gagaggctct cgctgtatgc attctcaaca agctccgtgg tcaactccaa gttgctgctg tcaaggcccc cggttcggt gacaaccgaa 900 <210> 38 <211> 899 <212> DNA <213> Ciboria acerina strain LMK476 <400> 38 aggaactcaa gttcggtgtc gaaggcagag ctgccctcct cgctggtgtt gagactttgg 60 caaaggctgt tgccacaact ttgggaccta agggccgaaa tgttctcatt gagtcggcat 120 atggctctcc aaagattacc aaaggtttgc aaaatctcta gctatttatg tttaccattc 180 taattattgg taaccagatg gtgtaactgt cgcaagagcc atttccctca aagacaaatt 240 cgagaacctt ggtgcaagac ttattcaaga tgttgcctcg aaaaccaacg agactgccgg 300 tgacggaacc accagtgcaa ctgtccttgc taaatctatc ttctccgaga ccgtcaagaa 360 cgtcgctgct ggatgcaacc caatggactt acgtagaggt acccaagctg ctgtcgaagc 420 tgttgtcgac ttttgcaaa agaacaagcg cgatatcaca accagcgagg agatcgctca 480 agtcgcaacc atcagtgcaa acggtgacac tcacatcgga aaactgatcg caatgctat 540 ggagaaggtt ggaaaggaag gtgtgatcac agtcaaggaa ggaaagacca tggaggatga 600 actcgacatc accgagggaa tgagattcga ccgcggctac gtctctccat acttcatcac 660 tgacaccaag tctggaaagg ttgaattcga gaagccattg atcctcctct ccgagaagaa 720 gatctccaac gtccaagata tcatcccagc tcttgaggca tccacccagc tccgtcgtcc 780 tttggtcatc attgctgagg atatcgacgg tgaggctctc gctgtctgca ttcttaacaa 840 gctccgtggt caactccaag ttgcagctgt caaggcacca ggcttcggtg acaatcgaa 899 <210> 39 <211> 898 <212> DNA <213> Dumontinia tuberosa strain LMK749 <400> 39 aggagctcaa attcggtgtt gaaggcagag cagctcttct ggctggtgtt gagactttag 60 caaaggctgt tgccacaacc ttaggaccca aaggacgaaa tgttttgatt gagtcagcat 120 atggctcccc aaagatcacc aaaggttcgc aaactcttgg ctactttaat gcaaaattct 180 aactgttggt gaacagatgg tgtgacggtt gccagagcga ttactctcaa ggacaaattc 240 gagaatctcg gcgctagact aattcaagat gttgcctcaa aaactaacga gacagccggt 300 gatggaacca caaccgcaac tgtcctcgcc aaatctatct tctccgagac tgtaaagaac 360 gttgctgcag gatgcaaccc aatggacttg cgcaggggta cacaggctgc cgtggaagct 420 gttgttgagt ttttgcaaaa aaacaagcgt gatatcacaa ccagcgagga aatcgcacaa 480 gtcgcaacta tcagtgcaaa cggtgatacc catattggaa aattgattgc caacgccatg 540 gagaaggtgg gaaaggaggg tgtaatcaca gttaaggaag gaaagaccat ggaagatgaa 600 ctcgatatta ccgagggaat gagatttgac cgcggttatg tctcgccata cttcattact 660 gataccaagt cgcaaaaagt ggagttcgag aagccattga ttctcctctc cgagaagaag 720 atctcaaacg ttcaagacat tatcccagca ctcgaggcat ctacccaact tcgccgtcct 780 ttggttatca ttgctgaaga tattgacgga gaagctctcg cggtgtgcat tctcaataag 840 ctccgcggtc aactccaagt tgcagctgtc aaggcacccg gcttcggcga caaccgaa 898 <210> 40 <211> 902 <212> DNA <213> Lambertella subrenispora strain LMK5 <400> 40 aggaactcaa gtttggcgtt gaaggtagag cagctcttttt ggctggtgtt gaaactttgg 60 caaaggctgt cgccacaact ttgggaccga agggccgaaa cgttttgatc gagtctgcct 120 atggctcacc taagattacc aagggttgc ccacctaccc caattgttct tggtagctct 180 ctgacttgtg tgttgtgtag atggtgtcac tgtggccaaa gccattaccc tccaagacaa 240 attcgaaaac ctcggtgctc gcctcatcca agatgtcgcc tcgaaaacaa acgagactgc 300 tggtgatgga accactaccg ctactgtgct tgcaaaatcc atcttctccg agactgtgaa gaatgttgcc gcaggatgca acccaatgga tctgcgaaga ggtacacaag ctgccgttga agcagttgtt gaatttttac aaaagaacaa gcgtgatatc actaccagcg aggaaattgc gcaagttgcc accatcagtg caaatggtga cacccacatt ggtaattga ttgccagcgc aatggagaaa gttggaaagg agggtgtcat cacagtcaag gaggaaga ctatggaaga tgagctagat gtcaccgaag gaatgagatt cgaccgaggt tatgtctcac catatttcat cacagacacc aaatcgcaga aagttgagtt tgagaagcca ttgatccttc tttctgagaa gaagatctct agcgttcaag atatcattcc cgcacttgaa gcttccacac aacttcgtcg tcctttggtt atcattgcag aggatatcga tggagaagct ctcgccgtgt gcatcctgaa 840 caagcttcgt ggtcaactcc aagtcgctgc tgtcaaggct cctggatttg gtgataaccg aa 902 <210> 41 <211> 900 <212> DNA <213> Monilinia aucupariae strain LMK733 <400> 41 aggagctcaa attcggtgtt gatgccagag cctctcttct cgtcggtgtt gagactttgg 60 caaaggctgt tgccacaact ttgggaccta agggccgtaa tgttctcatc gagtcagcat 120 atggctcccc aaagattacc aaaggtttgg caaaacttct agatatttat ggtcacaatt 180 ctaattcttc gtaaacagat ggtgtaactg ttgccagagc cattactctc aaggacaaat 240 ttgagaatct tggtgccaga cttattcaag atgttgcctc gaaaactaac gagactgctg 300 gtgatggaac tacaaccgca actgtccttg ccaaatctat cttctccgaa accgtaaaaa 360 atgttgctgc gggatgcaac ccaatggatt tgcgtagagg tacacaagct gctgtggaag 420 ctgttgtcga gttcttgcag aagaacaagc gcgatatcac aactagcgag gagatcgcac 480 aagttgcaac tattagtgca aatggtgata cccacgtcgg aaagttgatt gccaatgcta 540 tggaaagggt tggaaaggaa ggtgtgatca cagttaagga aggaaagacc atggaagatg 600 aactcgatat cactgaggga atgcgatttg accgcggtta tgtctcccca tacttcatca 660 ccgataccaa gtcgcagaag gtagaattcg agaagccgtt gatcctcctc tctgagaaga 720 agatctcgaa cgttcaagac attatcccag ctcttgaggc atccactcaa ctccgccgcc 780 cattggtcat tattgctgag gatattgatg gagaagctct cgctgtatgc atccttaaca 840 agcttcgtgg ccaacttcaa gttgctgctg tcaaggcccc cggcttcggc gacaaccgaa 900 <210> 42 <211> 899 <212> DNA <213> Monilinia fructicola strain LMK125 <400> 42 aggagctcaa attcggtgtt gaaggcagag cagctctcct cgccggtgtt gagactttgg 60 ccaaggctgt tgccacaact ttgggaccta aaggccgtaa tgttctcatt gagtcagcat 120 atggctctcc aaaaattacc aaaggtttgg aaacccgttc gacatctatg attacaactc 180 taattgttcg taaacagatg gtgtaacagt tgccagagct attactctta aagataaatt 240 cgagaatctt ggtgcaagac taattcaaga tgttgcctcc aaaaccaacg agactgccgg 300 tgatggaact acaaccgcaa ctgtccttgc aaaatccatc ttctccgaga ctgtaaagaa 360 tgttgccgca ggatgcaacc caatggactt gcgcagaggt acacaagctg ccgtggaagc 420 tgtcgttgag tttttgcaga agaacaagcg cgatatcaca actagcgaag aaatcgctca 480 agttgcaact atcagtgcaa atggtgatac ccatatcgga aagttgattg ccaatgctat 540 ggaaaaggtt ggtaaagaag gtgtgattac agttaaggaa ggaaagacca tggagagatga 600 acttgacatc accgagggta tgagatttga ccgcggttat gtatccccat acttcatcac 660 cgataccaag tcgcaaaag tagaattcga gaaaccattg atcctcctct ctgagaagaa 720 780. gatctcgac gtccaagaca ttattccagc tcttgaggca tctactcaac tccgtcgtcc attagtcatt attgctgaag acattgatgg agaagccctt gctgtatgca ttcttaacaa actccgtggt caactccaag ttgctgctgt caaagctccc ggctttggcg acaaccgaa <210> 43 <211> 899 <212> DNA <213> Monilinia megalospore strain LMK415 <400> 43 aggagctgaa attcggtgtt gaaggcagag ccgctctcct cgccggtgtt gagactttgg 120. caaaggctgt tgccacaact ttgggaccta aaggccgtaa tgttctcatt gagtcagcat atggctcccc aaagattact aaaggtttga aaaacttcta gatatttt gttacaattc tattgttcg taaacagatg gtgtaactgt tgccagagcc attactctca aggataatt tgagaatctt ggtgccagac ttattcaaga tgttgcctcg aaaaccaacg agactgctgg tgatggaact acaaccgcaa ctgtccttgc caaatccatc ttctccgaaa ctgtaaaaaa tgttgccgcg ggatgcaacc caatggattt gcgcagaggt acacaagctg ctgtggaagc 420 tgttgtcgag ttcttgcaga agagcaagcg cgatatcaca actagcgagg agatcgcaca 480 agttgcaact atcagtgcaa atggtgatac ccacgtcgga aaattgattg ccaatgctat 540 ggagagggt ggaaaggaag gtgtgatcac agttaaggaa ggaaagacca tggaagatga 600 actcgatgtc actgagggaa tgagatttga ccgcggttat gtctccccat acttcatcac 660 cgataccaag tcgcagaagg tagaattcga gaagccattg atcctcctct ctgagaagaa 720 gatctcgaac gtccaagaca ttatcccagc tcttgaggca tccactcaac tccgccgtcc 780 attggtcatt attgctgagg atattgatgg agaagctctc gctgtatgca tccttaacaa 840 gctccgtggt caactccaag ttgctgctgt caaggccccc ggctcggcg acaaccgaa 899 <210> 44 <211> 898 <212> DNA <213> Monoline urnula strain LMK413 <400> 44 aggagctcaa attcggtgtt gaaggcagag ccgctctcct cgccggcgtt gagactttgg 60 cgaaggctgt tgccacaact ttgggaccta aaggccgtaa tgttctcatt gagtcagcat 120 atggctcccc aaagattact aaaggtttgg aaaacttcta gatctttact gttacaactc 180 taattgtcgt aaacagatgg tgtaactgtt gccagagcca ttactctcaa ggacaaattt 240 gagaatcttg gtgccagact tattcaagat gttgcctcga aaaccaacga gactgctggt 300 gatggaacta caaccgcaac tgtccttgcc aaatctatct tctccgaaac cgtaaaaaat 360 gttgccgcgg gatgcaaccc aatggatttg cgcagaggta cacaagctgc tgtggaagct 420 gttgtcgagt tcttgcagaa aaataagcgc gatatcacaa ctagcgagga gatcgcacaa 480 gttgcaacta tcagtgcaaa tggtgatacc cacgtcggaa agttgatagc caatgctatg 540 gagagggttg gaaaggaagg tgtgatcaca gtcaaggaag gaaagaccat ggaagatgaa 600 ctcgacgtca ctgagggaat gagatttgac cgcggttatg tctccccata cttcatcacc 660 gataccaagt ctcagaaggt agaattcgag aagccattga ttctcctctc tgagaagaag 720 atctcgaacg ttcaagacat tatcccagct cttgaggcat ccactcaact ccgccgtcca 780 ttggtaatta ttgctgagga tattgatgga gaagctctcg ctgtatgcat ccttaacaag 840 ctccgtggtc aactccaagt tgctgctgtc aaggcccccg gcttcggcga caaccgaa 898 <210> 45 <211> 896 <212> DNA <213> Myriosclerotinia curreyana strain LMK736 <400> 45 aggaactcaa atttggtgtt gaaggcagag cagctctact tgctggtgtt gagactttgg 60 caaaggctgt tgccacaact ttgggaccaa aaggccgcaa tgttcttatt gagtcagcat 120 acggctcccc aaagatcacc aaaggtttgc aaacttcccc aattatgtgt acaattctaa 180 tcgttggtga ccagatggtg taactgttgc cagagccatt actctcaagg acaaattcga 240 gaatctcggt gctagactta ttcaagatgt cgcctcgaag accaacgaga ctgccggtga 300 tggaacca accgcaaccg tccttgccaa atctatcttc tccgagactg taagaacgt 360 tgctgcagga tgcaacccaa tggatttgcg cagaggtaca caagctgctg tggaggccgt 420 480 tgcaaccatc agtgcaaacg gcgacaccca catcggaaag ttaattgcca atgctatgga 540 gaaggttgga aaaggtg tgatcacagt caaggaagga aaaaccatgg aagacgaact 600 cgatattacc gaggaatga gatttgaccg cggttatgtc tctccatact tcatcactga 660 taccaagtcg caaaaggttg aattcgagaa accattgatc ctcctttctg agaagagat 720 ttcaaacgtt cagatatca tcccagcact tgaggcatcc actcaactcc gtcgtccttt 780 ggtcatcatt gctgagata tcgatggaga ggctctcgct gtgtgcattc ttaacaagct 840 ccgtggtcaa ctccaagttg cggctgttaa ggcaccagga tttggtgaca accgaa <210> 46 <211> 900 <212> DNA <213> Myriosclerotinia scirpicola strain LMK735 <400> 46 aggagctcaa attcggtgtt gaaggcagag cagctctcct tgctggtgtt gagactttgg 120. caaaagctgt tgccactact ttgggaccta aaggccgcaa tgttcttatt gagtcagcat atggctcccc aaaaatcacc aaaggtttgc aaaccttcct aattattggt gtgcgcaatt 180 ctaatcgatg gtgactagat ggtgtaactg ttgccagagc tattactctc aaggacaaat tcgagaatct cggtgctaga cttattcaag atgtcgcctc caagaccac gagactgccg gtgatggaac tacaaccgca accgtccttg ccaaatctat cttctccgag actgtaaaga atgttgctgc aggatgcaac ccaatggact tgcgcagagg tacacaagct gctgtggagg ccgttgttga gtttttgcaa aagaacaagc gtgatattac aactagtgag gaaatcgcac aagttgcaac tatcagtgca aacggcgaca cccacatcgg aaaattgatt gccaatgcca 540 tggagaaggt tggaaaggaa ggtgtgatca cagtcaagga aggaaagact atggaggatg 600 aacttgatat caccgaggga atgagatttg accgtggtta tgtctctcca tacttcatca 660 ctgatacaaa gtcgcaaaag gttgaattcg agaagccact gatcctcctc tctgagaaga 720 agatctcaaa cgttcaagat attatcccag cacttgaagc atccactcaa ctccgtcgtc 780 ctttggtcat cattgctgaa gatatcgatg gagaggctct cgctgtgtgc attctcaaca 840 agctccgtgg tcaactccaa gttgcggctg tcaaggcacc aggatttggc gacaaccgaa 900 <210> 47 <211> 899 <212> DNA <213> Sclerotinia glacialis strain LMK74 <400> 47 aggagctcaa attcggtgtt gaaggcagag cagctctcct ggctggtgtt gagactttag 60 caaaggctgt tgccacaacc ttaggaccca aaggacgaaa tgttttgatt gagtcagcat 120 atggctcccc aaagatcacc aaaggtttgc aaacccttga ctacttttaa tgcaaaaatc 180 taactgttgc tgaacagatg gtgtgactgt tgccagagcg attactctca aggacaaatt 240 cgagaatctc ggtgctagac ttatccaaga tgttgcctca aaaaccaacg agacagctgg 300 tgatggaacc acaactgcaa ctgtccttgc caaatctatc ttctctgaga ctgtaaagaa 360 cgttgctgca ggatgcaacc caatggactt gcgcaggggt acacaggctg ccgtggaagc 420 tgttgttgag tttttacaaa agaacaagcg tgatatcacg accagcgagg aaatcgcaca 480 agtcgcaact atcagtgcaa acggtgatac ccacattgga agattgattg ccaacgccat 540 ggagaaggtt ggaaaggaag gtgttatcac agttaaggaa ggaaagacca tggaagatga 600 actcgatatt accgagggaa tgagatttga ccgtggttat gtctcgccat acttcatcac 660 tgataccaag tcgcaaaaag tggagttcga gaagccattg attctcctct ccgagaagaa 720 gatctcaaac gttcaagaca ttatcccagc acttgaggca tctactcaac ttcgccgtcc 780 tttggtcatc attgctgaag atattgacgg agaagctctc gctgtgtgca ttctcaacaa 840 gctccgtggt caactccaag ttgcagctgt caaggcaccc ggctcggcg acaaccgaa 899 <210> 48 <211> 897 <212> DNA <213> Sclerotinia minor strain W10 <400> 48 aggagctcaa atttggtgtc gaaggcagag cagctcttttt ggctggtgtt gagactcttg 60 caaaggctgt tgctacaacc ttaggaccca aaggacgaaa tgttttgatt gagtcagcat 120 atggttcccc aaagatcacc aaaggtttgc aaattcctgg ccactttgaa tgcggaattc 180 taacttggta aacagatggt gtgactgttg ccagagcgat tactctcaag gacaaattcg 240 agaaccttgg tgctagactt attcaagatg tggcctcaaa aaccaacgag acagctggtg 300 atggaccac aaccgcaact gtgcttgcca aatctatctt ctccgagacc gtaaagaacg 360 ttgctgcagg atgcaaccca atggatctgc gcagaggtac acaagctgcc gtagaagctg 420 ttgttgagtt tttgcaaaag aacaagcgtg atatcacgac cagcgaggaa atcgcacaag 480 tcgcgaccat cagtgcaaat ggcgataccc acatcggaaa attgattgcg aacgccatgg 540 agaaggttgg aaaggaaggt gtaatcacag ttaaggaagg aaagaccatg gaagatgaac 600 tcgatattac cgaggggatg agatttgacc gcggttacgt ctcgccatac ttcatcaccg 660 acaccaagtc gcaaaaagtg gagttcgaga agccattgat tctcctctct gagaagaaga 720 tctcaaacgt tcaagacatt atcccagcac ttgaggcatc tactcaactt cgccgtcctt 780 tggtcatcat tgctgaagat attgacggtg aagcactcgc tgtgtgcatt ctcaacaagc 840 tccgtggtca gctccaagtt gcagctgtca aggcacccgg cttcggcgac aaccgag 897 <210> 49 <211> 904 <212> DNA <213> Sclerotinia sclerotiorum strain 1980 <400> 49 aggagctcaa attcggtgtt gaaggcagag cagctctttt ggctggtgtg gagactttag 60 caaaggctgt tgccacaacc ctaggaccca aaggacgaaa tgttttgatt gagtcagcat 120 atggctcccc aaagatcact aaaggtttgc aaattcttca aaaggcttct ttgaatgcac 180 aattctaact gttggtgaac agatggtgta actgttgcta gagcgattac tctcaaggat 240 aaattcgaga atctcggtgc tagacttatt caagatgttg cctcaaaaac caacgagaca 300 gctggtgatg gaaccacaac cgcaactgtc cttgccaaat ctatcttctc cgagactgta 360 aagaacgttg ctgcaggatg caacccaatg gacttgcgca ggggtacaca ggctgctgta 420 gaagctgttg ttgagttttt gcaaaagaac aaacgtgata tcacgaccag cgaggaaatt 480 gcacaagtcg caactatcag tgcaaatggc gatacccaca ttggaaaatt gattgccaac 540 gccatggaga aggttggaaa ggaaggtgta atcacagtta aggaaggaaa gaccatggaa 600 gatgaactcg acattaccga gggaatgaga tttgaccgcg gttacgtctc gccatacttc 660 atcaccgaca ccaagtcgca aaaagtggag ttcgagaagc cattgattct cctcttgag 720 aagaagatct caaacgttca agacattatc ccagcacttg aggcatctac tcaacttcgt 780 cgtcctttgg tcatcattgc tgaggatatt gatggagagg cactcgctgt gtgcattctc 840 aacaagctcc gtggtcaact ccaagttgca gctgtcaagg cacccggctt cggcgacaac 900 cgaa 904 <210> 50 <211> 897 <212> DNA <213> Sclerotinia trifoliorum strain LMK47 <400> 50 aggagctcaa attcggtgtt gaagccagag cagctcttttt ggctggtgtt gagactctag 60 caaaggctgt tgccacaacc ttaggaccca aaggacgaaa tgttttgatt gagtcagcat 120 atggctcccc aaagatcacc aaaggtttgc aaattcttgg ctagtttgaa tgcaaaattc 180 taacttggtg aacagatggt gtgactgttg ccagagcgat tactctcaag gacaaattcg 240 agaatctcgg tgctagactt attcaagatg tggcctcaaa aaccaacgag acagctggtg 300 atggaaccac aaccgcaact gtccttgcca aatccatctt ctccgagacc gtaaagaacg 360 ttgctgcagg atgcaaccca atggacttgc gcaggggtac acaggctgcc gtggaagctg 420 ttgttgagtt tttgcaaaag aacaagcgtg atatcacgac cagcgaggaa atcgcacaag 480 tcgcaaccat cagtgcaaat ggcgataccc acatcggaaa attgattgcc aacgccatgg 540 agaaggttgg aaaggaaggt gtaatcacag ttaaggaagg aaagaccatg gaagatgaac 600 tcgatattac cgaaggaatg agatttgacc gcggttacgt ctcgccatac ttcatcaccg 660 acaccaagtc actaaaagtg gagtttgaga agccattgat tctcctctct gagaagaaga 720 tctcaaacgt tcaagacatt atcccagcac ttgaggcatc tactcaactt cgccgtcctt 780 tggtcatcat tgctgaagat attgacggtg aagcactcgc tgtggcatc ctcaataagc 840 tccgtggtca actccaagtt gcagctgtca aggcacccgg cttcggcgac aaccgaa 897 <210> 51 <211> 900 <212> DNA <213> Sclerotium cepivorum strain LMK1 <400> 51 aggagctcaa attcggtgtt gaaggcagag cagctcttct ggctggtgtt gagactttag 60 caaaggctgt tgccacaacc ttaggaccca aaggacgaaa tgttttgatt gagtcagcat 120 atggctcccc aaagatcacc aaaggtttgt gaaactcttg gttactttaa atgcaaaatt 180 ctaactgttg gtgaacagat ggtgtgactg ttgccagagc gattactctc aaggacaaat 240 tcgagaatct cggtgctaga cttattcaag atgttgcctc gaaaaccaac gagacagctg 300 gtgatggaac cacaaccgca actgtccttg ccaaatctat cttctccgag actgtaaaaa 360 atgttgctgc aggatgcaac ccaatggact tgcgcagggg tacacaggct gccgtggaag 420 ctgttgttga gttttgcaa aagaacaagc gtgatatcac aaccagcgag gaaatcgcac 480 aagtcgcaac tatcagtgca aacggtgata cccacattgg aaaattgatt gccaacgcca 540 tggagaaggt tggaaaggaa ggtgtgatca cagttaagga aggaaagacc atggaggatg 600 aactcgatat taccgaggga atgagatttg accgcggtta tgtctcgcca tacttcatca 660 ctgataccaa gtcgcaaaag gtggagtttg agaagccatt gattctcctc tccgagaaga 720 agatctcaaa cgttcaagac attatcccag cacttgaggc atctactcaa cttcgccgtc 780 ctttggtcat cattgctgaa gatattgacg gagaagctct cgccgtgtgc attctcaaca 840 agctccgtgg tcaactccaa gttgcagctg tcaaggcacc cggcttcggc gacaaccgaa 900 <210> 52 <211> 900 <212> DNA <213> Sclerotium cepivorum strain LMK71 <400> 52 aggagctcaa attcggtgtt gaaggcagag cagctcttct ggctggtgtt gagactttag 60 caaaggctgt tgccacaacc ttaggaccca aaggacgaaa tgttgatt gagtcagcat 120 atggctcccc aagatcacc aaagtttgt gaactcttg gttactttaa atgcaaatt 180 ctaactgttg gtgaacagat ggtgtgactg ttgccagagc gattactctc aaggacaaat 240 tcgagaatct cggtgctaga cttattcaag atgttgccctc gaaaaccaac gagacagctg 300 gtgatggaac cacaccgca actgtccttg ccaatctat cttctccgag actgtaaaaa 360 atgttgctgc aggatgcac ccaatggact tgcgcagggg tacacaggct gccgtggaag 420 ctgttgttga gttttgcaa aagaacaagc gtgatatcac aaccagcgag gaatcgcac 480 aagtcgcaac tatcagtgca aacggtgata cccacattgg aaaattgatt gccaacgcca 540 height height gtgtgatca height height heightcc height 600 aactcgatat taccgaggga atgagatttg accgcggtta tgtctcgcca tacttcatca 660 ctgataccaa gtcgcaaaag gtggagtttg agaagccatt gattctcctc tccgagaaga 720 agatctcaaa cgttcaagac attatcccag cacttgaggc atctactcaa cttcgccgtc 780 ctttggtcat cattgctgaa gatattgacg gagaagctct cgccgtgtgc attctcaaca 840 agctccgtgg tcaactccaa gttgcagctg tcaaggcacc cggcttcggc gacaaccgaa 900 <210> 53 <211> 1004 <212> DNA <213> MAFF239143(A) <400> 53 atagatttgt ttaattgttt aaatttatgc taatcatttt gtcatttagg agctcaaatt 60 cggtgttgaa gccagagcag cctttctggc tggtgttgag actttagcaa aggctgttgc 120 cacaacctta ggacccaaag gacgaaatgt tttgattgag tcagcatatg gctccccaaa 180 gatcaccaaa ggtttgcaaa actcttggtt actttaaatg caaaatccta actgttggtg 240 aacagatggt gtgactgttg ccagagcgat tactctcaag gacaaattcg agaatctcgg 300 tgctagactt attcaagatg ttgcctcgaa aaccaacgag acagctggtg atggaaccac 360 aaccgcaact gtccttgcca aatctatctt ctccgagact gtaaaaaacg ttgctgcagg 420 atgcaaccca atggacttgc gcaggggtac acaggctgcc gtggaagctg ttgttgagtt 480 tttgcaaaag aacaagcgtg atatcacaac cagcgaggaa atcgcacaag tcgcaactat 540 cagtgcaaac ggtgataccc acattggaaa attgatagcc aacgccatgg agaaggttgg 600 aaaggaaggt gtgatcacag ttaaggaagg aaagaccatg gaggatgaac ttgatattac 660 cgagggaatg agatttgacc gcggttatgt ctcgccatac ttcatcactg ataccaagtc 720 gcaaaaggtg gagttcgaga agccattgat tctcctctcc gagaagaaga tctcaaacgt 780 tcaagacatt atcccagcac ttgaggcatc tactcaactt cgccgtcctt tggtcatcat 840 tgctgaagat attgacggag aagctctcgc tgtgtgcatt ctcaacaagc tccgtggtca 900 gctccaagtt gcagctgtca aggcacccgg cttcggcgac aaccgaaagt ccattcttgg 960 cgatctcggt atcttaacca atgccaccgt cttactgat gagc 1004 <210> 54 <211> 1004 <212> DNA <213> chi01(A) <400> 54 atagatttgt ttaattgttt aaatttatgc taatcatttt gtcatttagg agctcaaatt 60 cggtgttgaa gccagagcag cctttctggc tggtgttgag actttagcaa aggctgttgc 120 cacaacctta ggacccaaag gacgaaatgt tttgattgag tcagcatatg gctccccaaa 180 gatcaccaaa ggtttgcaaa actcttggtt actttaaatg caaaatccta actgttggtg 240 aacagatggt gtgactgttg ccagagcgat tactctcaag gacaaattcg agaatctcgg 300 tgctagactt attcaagatg ttgcctcgaa aaccaacgag acagctggtg atggaaccac 360 aaccgcaact gtccttgcca aatctatctt ctccgagact gtaaaaaacg ttgctgcagg 420 atgcaaccca atggacttgc gcaggggtac acaggctgcc gtggaagctg ttgttgagtt 480 tttgcaaaag aacaagcgtg atatcacaac cagcgaggaa atcgcacaag tcgcaactat 540 cagtgcaaac ggtgataccc acattggaaa attgatagcc aacgccatgg agaaggttgg 600 aaaggaaggt gtgatcacag ttaaggaagg aaagaccatg gaggatgaac ttgatattac 660 cgagggaatg agatttgacc gcggttatgt ctcgccatac ttcatcactg ataccaagtc 720 gcaaaaggtg gagttcgaga agccattgat tctcctctcc gagaagaaga tctcaaacgt 780 tcaagacatt atcccagcac ttgaggcatc tactcaactt cgccgtcctt tggtcatcat 840 tgctgaagat attgacggag aagctctcgc tgtgtgcatt ctcaacaagc tccgtggtca 900 gctccaagtt gcagctgtca aggcacccgg cttcggcgac aaccgaaagt ccattcttgg 960 cgatctcggt atcttaacca atgccaccgt ctttactgat gagc 1004 <210> 55 <211> 1001 <212> DNA <213> sai01(B) <400> 55 gatttacttg attgttcaat tttatgctaa tcttttgtc atttaggagc tcaaattcgg 60 tgttgaaggc agagcagctc ttctggctgg tgttgagact ttagcaaagg ctgttgccac 120 aaccttagga cccaaaggac gaaatgtttt gattgagtca gcatatggct cccaaagat 180 caccaaaggt ttgtgaaact cttggttact ttaaatgcaa aattctaact gttggtgaac 240 agatggtgtg actgttgcca gagcgattac tctcaaggac aaattcgaga atctcggtgc 300 tagacttatt caagatgttg cctcgaaaac caacgagaca gctggtgatg gaaccacaac 360 cgcaactgtc cttgccaaat ctatcttctc cgagactgta aaaaacgttg ctgcaggatg 420 caacccaatg gacttgcgca ggggtacaca gggctccgtg gaagctgttg ttgagttttt 480 gcaaaagaac aagcgtgata tcacaaccag cgaggaaatc gcacaagtcg caactatcag 540 tgcaaacggt gatacccaca ttggaaaatt gattgccaac gccatggaga aggttggaaa 600 ggaaggtgtg atcacagtta aggaaggaaa gaccatggag gatgaactcg atattaccga 660 gggaatgaga tttgaccgcg gttatgtctc gccatacttc atcactgata ccaagtcgca 720 aaaggtggag tttgagaagc cattgattct cctctccgag aagaagatct caaacgttca 780 agacattatc ccagcacttg aggcatctac tcaacttcgc cgtcctttgg tcatcattgc 840 tgaagatatt gacggagaag ctctcgccgt gtgcattctc aacaagctcc gtggtcaact 900 ccaagttgca gctgtcaagg caccggctt cggcgacaac cgaaagtcca ttcttggcga 960 tctcggtatc ttgaccaatg ccaccgtctt tactgatgag c 1001 <210> 56 <211> 1011 <212> DNA <213> shi01(B) <400> 56 cataaacata gatttacttg attgttcaat tttatgctaa tcttttgtc atttaggagc 60 tcaaattcgg tgttgaaggc agagcagctc ttctggctgg tgttgagact ttagcaaagg 120 ctgttgccac aaccttagga cccaaaggac gaaatgtttt gattgagtca gcatatggct 180 ccccaaagat caccaaaggt ttgtgaaact cttggttact ttaaatgcaa aattctaact 240 gttggtgaac agatggtgtg actgttgcca gagcgattac tctcaaggac aaattcgaga 300 atctcggtgc tagacttatt caagatgttg cctcgaaaac caacgagaca gctggtgatg 360 gaaccacaac cgcaactgtc cttgccaaat ctatcttctc cgagactgta aaaaatgttg 420 ctgcaggatg caacccaatg gacttgcgca ggggtacaca ggctgccgtg gaagctggttg 480 ttgagttttt gcaaaagaac aagcgtgata tcacaaccag cgaggaaatc gcacaagtcg 540 caactatcag tgcaaacggt gatacccaca ttggaaaatt gattgccaac gccatggaga 600 aggttggaaa ggaaggtgtg atcacagtta aggaaggaaa gaccatggag gatgaactcg 660 atattaccga gggaatgaga tttgaccgcg gttatgtctc gccatacttc atcactgata 720 ccaagtcgca aaaggtggag tttgagaagc cattgattct cctctccgag aagaagatct 780 caaacgttca agacattatc ccagcacttg aggcatctac tcaacttcgc cgtcctttgg 840 tcatcattgc tgaagatatt gacggagaag ctctcgccgt gtgcattctc aacaagctcc 900 gtggtcaact ccaagttgca gctgtcaagg cacccggctt cggcgacaac cgaaagtcca 960 ttcttggcga tctcggtatc ttgaccaatg ccaccgtctt tactgatgag c 1011 <210> 57 <211> 425 <212> DNA <213> Botryotinia calthae strain LMK75 <400> 57 ttctccctct tcgtacgtta atattcccaa cttgatactc tcagccctat ggacacttgg 60 cagggcatgt ttgaagattt gaaagctaat agctgtgact ctacaggaca agaatggtga 120 tggttcgtac atccatatta ttcctttggc attgcagatc tcgaatatcc tcctgtgttt 180 acacacttgc cctctcgacc acccagccc ctatctcaa caatgtacc ataatgggg 240 acagcgacac aaatgggcag aacaacgtag agagacagca ctgatatatg gatctatagg 300 acaaatcact agcaggagt tgggcaccgt tatgcgatcc cttggtcaaa acccttccga 360 gtccgagttg caacatga tcaacgaggt cgatgctgac aacaacggta ccattgattt 420 pp. 425 <210> 58 <211> 424 <212> DNA <213> Botryotinia convoluted strain LMK755 <400> 58 ttctccctct ttgtacgtta atattcccta cttgatactc tcagccctt ggacacttgg 60 caggcatat tgaagattt gaaagctaat agctgtgact ctacaggaca agaatggtga 120 tggttcgtac ttccatatta ttccttgaca ttgcagatct cgaatatcct cctgtgttta 180 cacacttgcc ctctcgaccg ccccagcccc tatcccgaac aatcgtacca ataatgggga 240 caacgacgca aattggcaga acaatgtaga gaggcagcac tgatatatgg atttatagga 300 caaatcacta gcaaggagtt gggtaccgtc atgcgatccc ttggtcaaaa cccttccgag 360 tccgagttgc aagacatgat caacgaggtc gatgctgaca acaacggtac cattgatttc 420 ccag 424 <210> 59 <211> 425 <212> DNA <213> Botryotinia fuckeliana strain B05.1 <400> 59 ttctccctct ttgtacgttg atattcccta cttgatactc tcagccctat ggacacttgg 60 cagggcatat ttgaagattt gaaagctaat agctgtgact ctacaggaca agaatggtga 120 tggttcgtac ttccatatta ttcctttgaa attgcagatc tcgaatatcc tcctgtgttt 180 acacacttgc cctctcgacc gccccagccc ctatctcgaa caattgtacc aataatgggg 240 acagcgacgc aaatcggcag aacaatgtag agagacagca ctgatatatg gatctatagg 300 acaaatcact agcaaggagt tgggaaccgt catgcgatcc cttggtcaaa acccttccga 360 gtccgagttg caagacatga tcaacgaggt cgatgctgac aacaacggta ccattgattt 420 cccag 425 <210> 60 <211> 395 <212> DNA <213> Botryotinia porri strain LMK1 <400> 60 ggatactctc agccctatgg acacttggca gggcatgttt gaagttttga aggctaataa 60 gctgtgactt tacaggacaa gaatggcgat ggttcgtact tccaaatttt tcctttgaca 120 ttgcagatct cgagaatccc ccctgtgttc acatacttgc cctctcgacc aacccagccc 180 ctatgtcgaa caatagtacc ggcaatgggg acaacgacac agattggcca aacaatatag 240 aaggacaaca ctgatatatg gatctacagg acaaatcact agcaaggaat tgggaaccgt 300 catgcgatcc cttggtcaaa acccttccga gtccgagttg caagacatga tcaacgaggt 360 cgatgctgac aacaacggta ccattgattt cccag 395 <210> 61 <211> 499 <212> DNA <213> Botrytis cinerea DAOM:16643 <400> 61 gaggccttct ccctctttgt atgttcatat tcccacctcg acactctcag ccctatggac 60 acttggcagg gcatactga agatttgaaa actataataac tgtgacttta taggacaaga 120 atggtgatgg ttcgtacttc catgttgttc ctttgacatt gcagatctcg aagattcccc 180 tgtgttcata tacttgccct ctcgaccaag gcagccccta tctcaaacaa ttgtgacaac 240 aatggggac aaccacacaa tttggcataa caatacagga cagcactgat atatggatct 300 acaggacaaa tcactagcaa ggagttgggc actgttatgc gatccctcgg acagaaccct 360 tccgagtccg agttgcaaga catgatcaac gaggtcgatg ctgacaacaa cggcaccatt 420 gatttcccag gtatggcgca acacattgag gttcctgtct caaaatgctg acgcgattag 480 aatttcttac catgatggc 499 <210> 62 <211> 426 <212> DNA <213> Botrytis paeoniae strain LMK43 <400> 62 ttctccctct ttgtacgttg atattcccta cttgatactc tcagccctat ggacacttgg 60 cagggcatat ttgaagattt gaaagctaat agctgtgact ctacaggaca agaatggtga 120 tggttcgtac ttccatatta ttcctttgaa attgcagatc tcgaatatcc tcctgtgttt 180 acacacttgc cctctcgacc gcccccagcc cctatctcga acaattgtac caataatggg 240 gacaacgacg caaatcggca gaacaatgta gagagacagc actgatatat ggatctatag 300 gacaaatcac tagcaaggag ttgggcaccg tcatgcgatc ccttggtcaa aacccttccg 360 agtccgagtt gcaagacatg atcaacgagg tcgatgctga caacaacggt accattgatt 420 tcccag 426 <210> 63 <211> 422 <212> DNA <213> Botrytis tulipae strain LMK7 <400> 63 ttctccctat ttgtatgttc acaaacccac ctcgatactc tcagccctat ggacacttg 60 cagggcataa ttgaagattt gaaagctaat aagctgtgac tttgtaggac aagaatggcg 120 atggttcgta cttctataat attcctttga tattccagat ctcgaaaatc cccctgtggt 180 cacatacttg ccctctcgat cagcccctat ctcaaacaat cgtaaccaca atgggggaca 240 accacacaaa ttggcagaac aataaagaag gtcagcactg atatatggat ctacaggaca 300 aatcactagc aaggagttgg ggaccgttat gcgatccctt ggtcaaaatc cttccgagtc 360 cgagttgcaa gacatgatca acgaggtcga tgctgacaac aacggtacca ttgatttccc 420 of 422 <210> 64 <211> 428 <212> DNA <213> Ciboria acerina strain LMK476 <400> 64 ttctccctct ttgtaagtta tttatccaa ctttgcaact accatctcag ccctatggac 60 acttggcagg gcatattgga agatttggaa gctaataagt tgctacttct caggacaaaa 120 atggtgatgg ttagtactct cagcttggat actcgatggc atgaatccgc tatcttctcc 180 ttcattcacc tacttctgat ttcggtccaa cccctatatc gaacaactgt accaacaagg 240 atgacaacat tactatcaag catgacaatg catgagggct tggctgatat gcgatttcat 300 aggacaaatc actagcaagg agttgggcac cgttatgcga tcacttggac aaaacccttc 360 cgagtccgag ttgcaagaca tgatcaacga ggtcgatgcc gacaacaacg gtaccatcga 420 ttttccag 428 <210> 65 <211> 424 <212> DNA <213> Dumontinia tuberosa strain LMK74 <400> 65 ttctccctct tcgtaagttc atctttctaa cttttacaat ctcagctcta tggacacttg 60 gcagggtata tttgaagatt ggatagctaa taatttatga ctttatagga caaatggt 120 gatggttagt aatttcagat tatactttcc atatcctaga tcactctcc tcctttatct 180 acatgctaga catcctgacc gandacggccc ctatctcgaa cagttgtatt aacaaggggg 240 gcaatacac gattaagcat gatacag aggacagcgc tgatatatga attcatagga 300 caaatcacta gcaggagtt gggtaccgtt atgcgatccc ttgggcaaa cccttccgag 360 tctgagttgc aagacatgat taatgaggtc gacgccgata acaatggtac cattgatttc 420 page 424 <210> 66 <211> 412 <212> DNA <213> Lambertella subrenispora strain LMK5 <400> 66 ttctccctct ttgtaagtta tttagcacaa ccccatctc agccctatgg atacttggcg 60 accgaccgac atctgagac tggaagcta attatatgcg cttcaacagg acaaaaatgg 120 cgatggttgg tgcctacac tctaaaccac tatattgcat gcatgctgtc ttgggaaata 180 ctttctttcc tgctcgatat acccattc ccagcatact ccagcgacga gacggcatcg 240 aggcaaacgc gcaagttgtg gatgacac tgacatatat ttcaggaca attackagc 300 aaagagctgg gtaccgtcat gcgatccctc ggccaaacc catcagagtc tgaactccaa 360 gatatgatca acgaagtcga tgctgacac aacggcacta tcgactttcc ag 412 <210> 67 <211> 420 <212> DNA <213> Monilinia aucupariae strain LMK73 <400> 67 ttctccctct ttgtaagttc atcttgtata gcttcacag ctcatctc agggcatatc 60 tcaagcctgg gaagctata acttacgacc ttacaggaca agaatggtga tggttcgtac 120 tttcaatta tccttcaat gtcgcagatc aaccatctc ttcatccat ccatctacat 180 gcttcctatt ccggtccagc ccctatctcg aaaactgtc caacatcta ggaccacatt 240 accatcaaac atgacaacac atgagaagaa ctaagctgat atgcgagttc ataggacaaa 300 ttactagcaa ggagttgggt accgtcatgc gatcccttgg acaaaatcct tccgagtccg 360 agttacaaga tatgatcaac gaggtcgacg ctgacaacaa cggtaccatt gatttcccag 420 <210> 68 <211> 407 <212> DNA <213> Monilinia fructicola strain LMK12 <400> 68 ttctccctct ttgtaagttc atcttatata actctacatt ctcagcccta tggacacttg 60 gcagggcata tctgaagact tggaagctaa caattcatgg ctatatagga caagaatggt 120 gatggttcgt actttcaaac tatactttcg atgtcgcaga tagagctatc tacttctcat 180 ctagcccagc ccctatctcg aacattcgtg caaacaatta cgacaacatt actatccaac 240 ttaacaacac ttgagaacaa agctgatatg cgaatctata ggacaaatca ctagcaaaga 300 gttgggtacc gttatgcgat cccttggaca aaacccttcc gagtctgagc tgcaagatat 360 gatcaacgag gtcgacgccg ataacaacgg taccattgat ttcccag 407 <210> 69 <211> 418 <212> DNA <213> Monilinia megalospora strain LMK41 <400> 69 ttctcccttt ttgtaagttc catcttgtat aactttacaa gctcagctct cagggcgtat 60 ctgaagactt ggaagctaat aatttatgac tttacaggac aagaatggtg atggttcgta 120 ctttcaactt atacttttca tgtcgcagat caaatatctt cttctatcta tctgcgtgct 180 tcctatttcg gtccagcccc tatctcgaac aactgtgcaa aacatctagg acaacattac 240 cataaaatat gacaacacat gaggggaact aagctgatgt gcgagtccat aggacaaatt 300 actagcaagg agttgggcac cgtcatgcga tcccttggac aaaacccttc cgagtccgag 360 ttacaagata tgatcaacga ggtcgacgcc gacaacaacg gtaccattga tttcccag 418 <210> 70 <211> 392 <212> DNA <213> Monoline urnula strain LMK413 <400> 70 ttctccctct ttgtaagttc catcttgtat aactttacaa gctcagctct cagggcgtat 60 ctgaagactt ggaagctaat cattgatgac tttacaggac aagaatggtg atggttcgta 120 cttccaactt atgctttcga tgtcgcagat caactatctt cttctatcta tctacatgct 180 tcctatttcg gtccagcccc tatctcgaac aactgtgcaa acatggcaac acatgaggag 240 aactaagctg atgtgcgagt ccatagggca aattactagc aaggagttgg gcaccgtcat 300 gcgatccctt ggacaaaacc cttccgagtc cgagttacaa gatatgatca acgaggtcga 360 cgccgacaac aacggtacca ttgatttccc cg 392 <210> 71 <211> 432 <212> DNA <213> Myriosclerotinia curreyana strain LMK73 <400> 71 ttctccctct ttgtaagttc aaatttcccg actttatagc ttcagcccta tgaacacttg 60 gaagagcata tttaaagaca tgaaagctaa taatttatta ctttacagga caagaatggt 120 gatggttcgt tcttccaatt catattttca gttcgcaga tcggccgact attcccccct 180 tcatctgcat gttgctgtc tcgatccagt ccagccccta tctcgagtca tctcatcaat 240 aaggaggaca acaatactat tagacataac aatacatcag gacagcgctg atatatgaat 300 tcataggaca aattactagc aaggagttgg gcaccgttat gcgatccctt ggtcaaaatc 360 catccgagtc tgagttacaa gatatgatca atgaggttga tgccgataac aacggtacca 420 tcgatttcc ag 432 <210> 72 <211> 428 <212> DNA <213> Myriosclerotinia scirpicola strain LMK73 <400> 72 ttctccctct ttgtaagttc acatttccca actttattgc ttcagcccta tggacacttg 60 gcaagggcata ttcaaaggca tgaaagctaa taatttatga ctttacagga caagaatggt 120 gatggttcgt acttccaatt tatatcttca gtgtcgcaga tcgaccgact atcccccttc 180 atctgcatgt ttgctgtctc ggcccagccc agccctatc gaatagtctt atcaatcagg 240 aggacaacaa tcctattggg cataacaata cataagggca acgctgatat atgaatccat 300 aggacaaatt actagcaagg agttgggcac cgttatgcga tcccttggtc aaaacccttc 360 cgagtctgag ttgcaggata tgatcaatga ggttgatgcc gacaacaacg gtaccatcga 420 tttccctg 428 <210> 73 <211> 431 <212> DNA <213> Sclerotinia glacialis strain LMK7 <400> 73 ttctccctct ttgtaagttc atctttctac ctttcacaat ctcagcccta tggacacttg 60 gcagggtaca ttggatgata tggtagctaa cagttcatta ctttaaagga caagaatggt 120 gatggttagt aatttcagat tataatttcc atgtccagga tcgaatcctc ctttatctac 180 atgctagaca tcttgaccga cactgcccct atctcgaaca acggtaccaa caaaaggggc 240 aataacacaa taacacgatt gagcatgatt gagcagaacg acagcgctga tgtataaaat 300 catagggcaa atcactagca aggagttggg taccgttatg cgatcccttg gacaaaaccc 360 ttccgagtct gagttgcaag acatgatcaa tgaggtcgac gccgataaca acggtaccat 420 tgatttcccca g 431 <210> 74 <211> 441 <212> DNA <213> Sclerotinia minor strain W1 <400> 74 gtaagttcat ctccctgact tttataatct cagccctatg gacacttggc agggtatatt 60 tggagatttg gtagctaata atgtatgact ctacaggaca agaatggcga tggttagtaa 120 tttcaggtta tactttccat gtcccagatc gactctcctc tttatgtag atgctagaca 180 tcttgaccga caccgcccct atctcgagca attgtaccga caaagggggg agcaacacga 240 ttgagcatga tgacacagga cagggctgat gtataaatcc ataggacaaa ttactagcaa 300 ggagttgggt accgttatgc gatcccttgg acaaaacccc tccgagtctg agttgcaaga 360 catgatcaat gaggttgatg ccgataacaa cggtaccatt gatttcccag gtacggctaa 420 gcatgacata gtttatgact c 441 <210> 75 <211> 422 <212> DNA <213> Sclerotinia sclerotiorum strain 1980 <400> 75 ttctccctct ttgtaagttc atctctctaa cttttacaat ctcagcccta tggacacttg 60 gcagggtata tttgaagatt tggtagctaa taatttataa ctttacagga caagaatggt 120 gatggttagt aatttcagat tatactttcc atgtcccagt tcgactctcc tcttttatct 180 acgtgctaga catcttgacc gacaccgccc ctatctcgaa caattgtacc aaaaagggg 240 gcaataacac gattgagcat gatacag gtcagggttg atatataat tcataggaca 300 attackagc aaggagctgg gtaccgtcat gcgatcctt ggacaaaacc cttccgagtc 360 tgagttgca gatagatca atgaggtcga tgccgataac aacggtacca ttgatttccc 420 Page 422 <210> 76 <211> 440 <212> DNA <213> Sclerotinia trifoliorum strain LMK4 <400> 76 gtgagttcat ctccctaact tttacaatct cagccctatg vakacttggc agggtatatt 60 tgaagatatg gtagctgata atttatgact ttataggaca agaatggtga tggttagtaa 120 tttcagatta tactttccat gtcctagatc gactctcctc ctttatctac atgctagaca 180 tcttgaccga caccgcccct atctcgagca attgttcca aaggaggca atacacgat 240 tgagcatgat aacacaggac agggctgata tataaattca taggaxaat taccacac 300 gagtgggta ccgttatgcg atcccttgga caaaaccctt ccgagtctga gttgcaagac 360 atgatcaatg aggtcgatgc cgataacaac ggaaccattg atttcccagg tacggcgaag 420 cataatatag tttatgactc 440 <210> 77 <211> 422 <212> DNA <213> Sclerotium cepivorum strain LMK <400> 77 ttctccctct ttgtaagttc atctttccaa cttacaatt cagccctatg gacacttggc 60 agggtatatt tgaagatttg ggagctaata attatgact ttacaggaca agaatggtga 120 tggttagtac ttcggatta tactttccat gtcctagatc gactatcctc ctttatctac 180 atgctagaca tcttgaccga cacggcccct atctcgaaca attgtgccaa caaggggggc 240 atatacgat taagcatggt atacggaag gagagcgcta atatataaaa tcataggaca 300 aatcactagc aaggagctgg gtactgttat gcgatccctt gggcaaaatc cttccgagtc 360 tgagttgcaa gacatgatca atgaggtcga cgccgataac aacggtacca ttgatttccc 420 of 422 <210> 78 <211> 422 <212> DNA <213> Sclerotium cepivorum strain LMK7 <400> 78 ttctccctct ttgtaagttc atctttccaa cttacaatt cagccctatg gacacttggc 60 agggtatatt tgaagatttg ggagctaata attatgact ttacaggaca agaatggtga 120 tggttagtac ttcggatta tactttccat gtcctagatc gactatcctc ctttatctac 180 atgctagaca tcttgaccga cacggcccct atctcgaaca attgtgccaa caaggggggc 240 atatacgat taagcatggt atacggaag gagagcgcta atatataaaa tcataggaca 300 aatcactagc aaggagctgg gtactgttat gcgatccctt gggcaaaatc cttccgagtc 360 tgagttgcaa gacatgatca atgaggtcga cgccgataac aacggtacca ttgatttccc 420 of 422 <210> 79 <211> 477 <212> DNA <213> MAFF239143(A) <400> 79 ttacatctca gccagcccta tggacacttg gcaggtata ttgagat tgggactta 60 taatttatga ctttacagga caagaatggt gatggttagt acttcagat tatactttcc 120 atgtaccaga tcgactatcc tcctttacct atatgctgga catcttgacc gatagccc 180 ctatttcgaa cattgtgcc aacaaggggg gcaatacac gattaagcat gatacag 240 aaggagagcg ctgatatatata aattcgtagg acaaatcact agcaggagt tggtaccgt 300 tatgcgatcc cttgggcaaa acccttccga gtctgagttg cacacatga tcaatgaggt 360 cgatgccgat aacaacggta ccattgattt cccaggtacg gcaagtata atatagttta 420 tgactcacaa gttaaccga attagaattc ctcaccatga tggcatcaa gatgata 477 <210> 80 <211> 465 <212> DNA <213> chi01(A) <400> 80 height height height height height ataatttatg actttacagg acagaatgg tgatgttag tacttcaga tatatactttc 120 catgtaccag atcgactatc ctcctttacc tatatgctgg acatcttgac cgacatagcc 180 cctatttcga acaattgtgc siaaagggg ggcaataca cgattaagca tgatataca 240 gaaggagagc gctgatatat aaattcgtag gaaatcac tagcaggag tgggtaccg 300 ttatgcgatc ccttgggcaa aacccttccg agtctgagtt gcaagacatg atcaatgagg 360 tcgatgccga taacaacggt accattgat tcccaggtac ggcaaagtat atatagttt 420 atgactcaca aggttaaccg aattagaatt cctcaccatg atggc 465 <210> 81 <211> 470 <212> DNA <213> blood01(B) <400> 81 tttacattca gccctatgga cacttggcag ggtatattg aagatttggg agctaataat 60 tttgacttt acaggacaag aatggtgatg gttagtactt tcggattata ctttccatgt 120 cctagatcga ctatcctcct ttatctacat gctagacatc ttgaccgaca cggcccctat 180 ctcgaacaat tgtgccaaca aggggggcaa tatacgatta agcatggtaa tacggaagga 240 gagcgctaat atataaaatc ataggacaaa tcactagcaa ggagctgggt actgttatgc 300 gatcccttgg gcaaaatcct tccgagtctg agttgcaaga catgatcaat gaggtcgacg 360 ccgataacaa cggtaccatt gatttcccag gtacggcaca gcataatata gtttatgact 420 ctcaaggctg accggattag aattcctcac catgatggcc agaaagatga 470 <210> 82 <211> 470 <212> DNA <213> shi01(B) <400> 82 tttacattca gccctatgga cacttggcag ggtatatttg aagatttggg agctaataat 60 tttgacttt acaggacaag aatggtgatg gttagtactt tcggattata ctttccatgt 120 cctagatcga ctatcctcct ttatctacat gctagacatc ttgaccgaca cggcccctat 180 ctcgaacaat tgtgccaaca aggggggcaa tatacgatta agcatggtaa tacggaagga 240 gagcgctaat atataaaatc ataggacaaa tcactagcaa ggagctgggt actgttatgc 300 gatcccttgg gcaaaatcct tccgagtctg agttgcaaga catgatcaat gaggtcgacg 360 ccgataacaa cggtaccatt gatttcccag gtacggcaca gcataatata gtttatgact 420 ctcaaggctg accggattag aattcctcac catgatggca gaaaagatga 470 <210> 83 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthesized sequence <400> 83 tcagcccatg ggatgttggc agggtcgacg gattggattg gaggtcaatg 50 <210> 84 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Synthesized sequence <400> 84 ccgccgatgc cccaatgtac gttaagaagc gttggagatg ac 42 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthesized sequence <400> 85 caagggcgat atcaaggtcc 20 <210> 86 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthesized sequence <400> 86 gagccaagca gttggttgtg c 21 <210> 87 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthesized sequence <400> 87 ctctcagtgt agaacttgac c 21 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthesized sequence <400> 88 atgggtgtca acaacgagac 20

Claims

1. A method for designing oligonucleotides for detecting group A and group B strains of Sclerotium cepivorum, In any one of the groups selected from the heat shock protein 60 (HSP60) gene region, calmodulin (CaM) gene region, and glyceraldehyde triphosphate dehydrogenase (G3PDH) gene region of plant pathogenic fungi, It is preserved in both the A and B group strains of Sclerotium cepivorum, and A design method for designing oligonucleotides of 15-30 nucleotides in length that can associate with polymorphic regions or complementary regions in Botrytis cinerea, Botrytis squamosa, Dumontinia tuberosa, Macrophominina phaseolina, Sclerotinia homoeocarpa, Sclerotinia kitajimana, Sclerotinia minor, Sclerotinia nivalis, Sclerotinia sclerotiorum, Sclerotinia trifoliorum, Sclerotium fumigatum, and Sclerotium rolfsii.

2. The method according to claim 1: The design method is one of the following for the oligonucleotide to be designed: The arrays with sequence numbers 51-56 are preserved, and Oligonucleotides capable of associating with the polymorphic region or its complementary region in the sequences of SEQ ID NOs. 31-50; The arrays with sequence numbers 77-82 are preserved, and Oligonucleotides capable of associating with the polymorphic region in the sequences of SEQ ID NOs. 57-76, or its complementary region; or The arrays with sequence numbers 25-30 are preserved, and Oligonucleotides capable of associating with the polymorphic region or its complementary region in the sequences of SEQ ID NOs. 5-24.

3. A method for designing primers to be used in the LAMP method for diagnosing onion black rot, according to claim 1 or 2.

Images