Topical and internal skin preparations containing an extract of sweet clover cultivated under irradiation with light having a specific wavelength range.

Abstract

To provide an external or internal skin preparation containing the extract of Melilotus officinalis cultivated by irradiation with artificial light having a specific wavelength range.SOLUTION: Melilotus officinalis of the present invention is cultivated by irradiation with artificial light having a specific wavelength range, the extract showing an excellent melanin production inhibitory effect, a collagen production promotion effect, a MMP inhibitory effect, a hyaluronic acid production promoting effect, a cell proliferation promoting effect, and an antioxidant effect, and an external or internal skin preparation containing the same being particularly effective.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a novel melilot and / or extract thereof, cultivated by irradiation with one or two types of light having a specific wavelength range, which exhibits excellent melanin production inhibitory effects, collagen production promoting effects, MMP inhibitory effects, hyaluronic acid production promoting effects, cell proliferation promoting effects, antioxidant effects, etc., for topical and internal skin preparations. [Background technology]

[0002] Generally, skin pigmentation such as age spots, freckles, and sunburn is thought to be caused by hormonal abnormalities or ultraviolet radiation stimulating melanin-producing cells in the skin to excessively produce melanin, which then deposits in the skin. One known method to prevent such pigmentation is to suppress the excessive production of melanin. Conventionally, ascorbic acid (vitamin C) and other substances have been used as whitening agents, both internally and externally, for the treatment of pigmentation (Patent Document 1).

[0003] The dermis contains fibroblasts and collagen, with type I collagen making up 80% of the total. Besides type I collagen, types III, V, XII, and XIV collagen are also known to exist. A decrease in type I collagen is one of the causes of wrinkles and sagging. Therefore, promoting the production of type I collagen is considered effective in preventing and improving wrinkles and sagging. Furthermore, promoting the production of type I collagen is also effective in improving the healing of skin wounds.

[0004] Furthermore, the skin is exposed daily to various physical and chemical stresses, including ultraviolet rays, dryness, cold, heat, and drugs. As a result, skin function deteriorates, and various signs of skin aging become apparent. Wrinkles are one such sign of skin aging. It is known that there are two types of wrinkles: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles, also called fine wrinkles, are temporary wrinkles that occur due to a decrease in the amount of water in the stratum corneum of the epidermis caused by skin dryness. On the other hand, dermal wrinkles are wrinkles that are formed by ultraviolet rays contained in sunlight and aging. The mechanisms of their formation include a decrease in the collagen synthesis ability of dermal fibroblasts due to ultraviolet rays and aging, and the promotion of collagen breakdown due to an increase in matrix metalloproteinases (MMPs).

[0005] Epidermal wrinkles caused by dryness and dermal wrinkles differ in histological morphology, onset mechanism, and treatment methods. Dermal wrinkles caused by UV radiation and aging are difficult to improve with the use of moisturizing cosmetics.

[0006] To date, several agents have been reported for the purpose of improving dermal wrinkles caused by ultraviolet radiation, including a skin wrinkle prevention and improvement agent containing hydrolyzed almond as an active ingredient (Patent Document 2), and a wrinkle improvement agent for ultraviolet irradiation containing extracts of Jochokei, Tenki, and Kisenosa as active ingredients (Patent Document 3).

[0007] MMPs play a major role in the interstitial infiltration of cancer cells, their invasion into blood vessels, and angiogenesis. The stroma is mainly composed of type I collagen, and the movement of cancer cells requires the destruction of this matrix by interstitial collagenases and other enzymes. For metastasis to be completed, it is necessary to destroy the vascular endothelial basement membrane and move within the stroma, and MMPs are also involved in this stage (Non-Patent Literature 1). Therefore, substances that have inhibitory activity against MMPs are expected to have an effect in suppressing angiogenesis and cancer metastasis in cancer tissue, and are considered useful in the prevention and treatment of cancer. Thus, inhibition of MMPs is useful in the prevention, treatment, and improvement of various diseases caused by increased MMP levels, such as cancer, ulcer formation, arteriosclerosis, rheumatoid arthritis, osteoporosis, and periodontitis.

[0008] Collagenase (MMP1), belonging to the MMP group, is an enzyme produced by fibroblasts and chondrocytes, and plays a major role in promoting collagen degradation. Collagen is a major structural protein that makes up about one-third of mammalian tissues and is an essential component of many matrix tissues such as cartilage, bone, tendons, gums, and skin. When collagen molecules are cleaved at one point by collagenase, the normally stable collagen molecules denature into single-chain gelatin, which is then broken down by various other proteases. As a result, the structural integrity of the matrix tissue is lost, leading to wrinkles, cancer, ulcer formation, osteoporosis, periodontitis, and other problems.

[0009] Materials possessing collagenase inhibitory activity have been proposed, such as cocoa husk extract (Patent Document 4), raspberry extract (Patent Document 5), and lactoferrin (Patent Document 6). Given the increasing concern for skin aging and oral hygiene, there is a growing need to discover materials with excellent collagenase inhibitory effects that are safe, have no side effects, and are highly effective in inhibiting collagenase activity.

[0010] Gelatinase (MMP2), belonging to the MMP group, is an enzyme produced by fibroblasts, endothelial cells, cancer cells, etc., and breaks down substrates such as collagen, gelatin, and elastin (structural proteins that make up special components of elastic tissues such as arteries, tendons, and skin). Therefore, when elastin is broken down by gelatinase, the risk of diseases such as cancer, arteriosclerosis, and rheumatoid arthritis, as well as injuries such as ligament rupture, increases.

[0011] Furthermore, fibroblasts produce proteins such as collagen and glycosaminoglycans such as hyaluronic acid to form dermal connective tissue, which maintains skin firmness. It is believed that wrinkles and sagging skin occur when this connective tissue loses its contractile and elastic properties.

[0012] Hyaluronic acid, in particular, is known as a high-molecular-weight polysaccharide widely distributed in connective tissue, exhibiting a gel-like form in the dermis and maintaining skin elasticity. Therefore, the deterioration and decrease of hyaluronic acid are considered important in skin aging. Furthermore, because hyaluronic acid is a high-molecular-weight substance, there has been a problem in that cosmetics containing it are not easily absorbed when applied directly to the skin. For this reason, there has been a search for topical skin preparations that can promote the production of collagen and hyaluronic acid by activating fibroblasts (Patent Document 7).

[0013] Hyaluronic acid is also present in joints and is known to play a role in cushioning the impact of joint loads and smoothing joint movement. The hyaluronic acid concentration in normal human synovial fluid is approximately 2.3 mg / mL, but in rheumatoid arthritis, the hyaluronic acid concentration in synovial fluid decreases to approximately 1.2 mg / mL, and the viscosity of the synovial fluid also decreases significantly (Non-Patent Literature 1). Furthermore, it is known that a decrease in hyaluronic acid content occurs in septic arthritis and gouty arthritis, similar to the case of rheumatoid arthritis (Non-Patent Literature 2). In the above diseases, increasing the amount of hyaluronic acid in synovial fluid is considered in order to improve lubrication function, cover and protect articular cartilage, suppress pain, and improve pathological synovial fluid. For example, it is known that joint injection of sodium hyaluronate in patients with rheumatoid arthritis improves the above symptoms (Non-Patent Literature 3). However, treatment for the above diseases is long-term. Therefore, there is a need for topical skin preparations, foods, and pharmaceuticals containing hyaluronic acid production promoters that can be easily used for prevention and treatment in daily life.

[0014] Floaters are a condition in which faint shadows resembling threads or mosquitoes appear in the field of vision. They are caused by opacities in the vitreous humor, which fills the inside of the eye, casting shadows on the retina. Floaters can be broadly divided into two types: physiological floaters, which develop due to factors such as aging, ultraviolet radiation, and reactive oxygen species, and pathological floaters, which appear as a symptom of diseases such as retinal detachment, retinal tears, vitreous hemorrhage, and uveitis. Physiological floaters are caused by liquefaction due to a decrease in hyaluronic acid, the main component of the vitreous humor, and the subsequent breakdown of collagen fibers, leading to opacity within the vitreous humor. Treatment options include vitrectomy surgery and laser treatment, but these procedures are not commonly performed in Japan due to safety concerns, and treatment abroad is very expensive. Therefore, there is a need for foods and medicines containing hyaluronic acid production promoters that can be used daily to prevent and improve physiological floaters.

[0015] Generally, the proliferation and division capacity of epidermal cells decreases with age, and the epidermal layer itself thins (Non-Patent Literature 4). Biological factors such as Epidermal Growth Factor (EGF) and female hormones (estrogen) act on the proliferation of epidermal cells in the skin, but their secretion decreases with age. This decline in epidermal cell metabolic function due to aging slows down the rate of skin turnover, causing rough skin and skin aging. In addition, the accumulation of keratinocytes that peel off from the surface of the stratum corneum hinders the smooth excretion of melanin within the epidermis, causing hyperpigmentation and dullness of the skin. Furthermore, it is known that wound healing in the epidermis is slowed. In order to prevent or improve the progression of these phenomena, there has been much research into ingredients that promote the proliferation of epidermal cells and proposals for topical skin preparations.

[0016] Furthermore, the skin is located in the outermost layer of the body and is an organ that is easily subjected to the generation of reactive oxygen species due to the effects of ultraviolet rays and other factors, and is constantly exposed to this oxidative stress. On the other hand, reactive oxygen species scavenging enzymes exist within skin cells, and as long as the amount of reactive oxygen species generated does not exceed their capacity, they protect skin cells from damage caused by reactive oxygen species. However, it is known that the activity of reactive oxygen species scavenging enzymes within skin cells decreases with age, and when damage caused by reactive oxygen species exceeds this defense response, the skin is oxidized, cellular function deteriorates, and aging progresses. In addition, it is thought that in organs other than the skin, when exposed to reactive oxygen species that exceed their scavenging capacity, functional decline occurs, leading to aging, or the development of various lifestyle-related diseases such as cancer and myocardial infarction. Therefore, reactive oxygen species scavenging agents and antioxidants have been investigated for the purpose of protecting against damage caused by reactive oxygen species, and foods, cosmetics, quasi-drugs, and pharmaceuticals containing reactive oxygen species scavenging enzymes such as SOD and catalase, SOD-like active substances, and other reactive oxygen species scavenging agents and antioxidants have been developed (Patent Documents 8 and 9).

[0017] Melilotus officinalis is a perennial plant belonging to the genus Melilotus in the legume family. Known properties of melilotus include its skin-whitening effect (Patent Document 10) and its collagen production-promoting effect (Patent Document 11).

[0018] On the other hand, methods for enhancing the medicinal effects of plants through cultivation methods, such as specifically increasing functional substances like vitamins, polyphenols, and rutin within plants, have already been reported in patent documents. Patent document 12 discloses a method for increasing the amount of vitamin A and vitamin E contained in soybean sprouts by irradiating them with artificial light in the near-ultraviolet to blue wavelength range, Patent document 13 discloses a cultivation method for increasing the functional substances α-tocopherol and vitamin C in komatsuna by irradiating it with artificial ultraviolet light for 5 minutes a day, and Patent document 14 discloses a method for increasing vitamin C and vitamin A in komatsuna and lettuce by adjusting the intensity of blue light, red light, and far-red light. [Prior art documents] [Patent Documents]

[0019]

Patent Document 1

Patent Document 2

Patent Document 3

Patent Document 4

Patent Document 5

Patent Document 6

Patent Document 7

Patent Document 8

Patent Document 9

Patent Document 10

Patent Document 11

Patent Document 12

Patent Document 13

Patent Document 14

Non-Patent Document

[0020]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

[0021] The present invention aims to provide a novel topical or oral skin preparation that is safe and highly stable, exhibiting excellent effects such as melanin production inhibition, collagen production promotion, MMP inhibition, hyaluronic acid production promotion, cell proliferation promotion, and antioxidant effects. [Means for solving the problem]

[0022] In order to solve this problem, the inventors conducted extensive research and discovered that an extract of sweet clover cultivated under irradiation with one or two types of artificial light having a specific wavelength range exhibits excellent melanin production inhibitory effects, collagen production promoting effects, MMP inhibitory effects, hyaluronic acid production promoting effects, cell proliferation promoting effects, and antioxidant effects, leading to the completion of the present invention.

[0023] That is, the present invention relates to the following (1) ~(3 It consists of ). (1) Cultivation by irradiating with artificial light in which the ratio of photosynthetic photon flux density (PPFD) between wavelengths of 570-730 nm and 400-515 nm is 4:1 to 2:1. By doing so, the hyaluronic acid production-promoting effect was enhanced compared to sweet clover grown in sunlight. Characterized by containing melilot extract. A topical skin preparation for promoting hyaluronic acid production. (2) A topical skin preparation for promoting hyaluronic acid production according to claim 1, wherein the ratio of photosynthetic photon flux density (PPFD) in the wavelength range of 570-730 nm and 400-515 nm is 3:1. (3) Wavelength range 570~730nm and 400~515nm The ratio of photosynthetic photon flux density (PPFD) is 4:1 to 2:1. By cultivating under artificial light, compared to sweet clover cultivated in sunlight, Hyaluronic acid production promoting effect Features that enhance Melilot Cultivation method. [Effects of the Invention]

[0024] The melilot or its extract of the present invention has excellent melanin production inhibitory effects (whitening effect), collagen production promoting effects, MMP inhibitory effects, hyaluronic acid production promoting effects, cell proliferation promoting effects, and antioxidant effects, and can contribute to the fields of pharmaceuticals, quasi-drugs, cosmetics, and food products. [Modes for carrying out the invention]

[0025] The Melilotus officinails used in this invention is also known as Shinagawahagi or Seiyoebirahagi, and is a perennial plant belonging to the genus Melilotus in the family Fabaceae. In this invention, the Melilotus extract refers to an extract of a part of the plant such as its flowers, fruits, seeds, leaves, stems, roots, etc., or the entire plant (whole plant), or a mixture thereof. However, in this invention, the part used as the raw material for extraction is preferably the leaves. Furthermore, the plant may be used as is for extraction, or it may be processed by drying, crushing, or finely chopping.

[0026] Cultivation can be done using soil or hydroponics. When using hydroponics, the seeds can be used after they have rooted. Cultivation is preferably carried out in a facility where temperature, light, and carbon dioxide concentration are controlled. The cultivation temperature is 15-30°C, preferably 20-25°C. The cultivation period varies depending on the irradiation conditions, but harvesting is generally possible in 10-30 days. Cultivation for longer periods is also possible.

[0027] The light source can be a light source used in plant cultivation facilities, with artificial light such as LEDs being the most preferred. Examples of artificial light include light-emitting diodes (LEDs) and laser diodes, but any light source that can selectively emit light within a specific range of wavelengths is acceptable.

[0028] In cultivating sweet clover, the wavelengths of light to be irradiated are preferably blue light in the wavelength range of 400-515 nm and red light in the wavelength range of 570-730 nm, and more preferably light in the wavelength range of 430-460 nm and 630-680 nm. It is most preferable to irradiate with these lights simultaneously. The wavelengths in question refer to the maximum wavelengths (peak wavelengths) of the irradiation spectrum. Any light source having peaks at such wavelengths can be used, whether it is a custom-made or commercially available one. Optical filters may also be used to selectively irradiate with the above wavelengths. In addition to the two types of light mentioned above, light sources such as sunlight and fluorescent lamps can also be used.

[0029] The amount of light irradiated is expressed as photosynthetic photon flux density (PPFD). When two types of light-emitting devices are used for irradiation, it refers to the total amount of light emitted. This amount of light is 10-300 μmol·m² after germination. -2 s -1 Preferably, 50-200 μmol·m -2 s -1 This is even more preferable. If the light intensity is outside this range, growth disorders or poor growth may occur. Irradiation is preferably done from a position 10 to 50 cm above the melilot. The irradiation time can be appropriately changed depending on the characteristics and purpose of the plant, but 6 hours or more is preferable, and 12 to 24 hours is more preferable.

[0030] The ratio of red to blue light intensity refers to the ratio of each PPFD, and can be selected according to the purpose, such as yield or effectiveness.

[0031] In particular, to increase plant yield, a red to blue light intensity ratio of 8:1 to 1:1 is preferable, and among these, a particularly high yield was obtained with a red to blue light intensity ratio of 4:1 to 2:1.

[0032] In terms of inhibiting melanin production, a ratio of red to blue light intensity of 8:1 to 1:1 is preferable in terms of effectiveness. Among these, a ratio of red to blue light intensity of 3:1 is the most preferable.

[0033] In promoting type I collagen (COL1A) mRNA expression, a red to blue light intensity ratio of 4:1 to 1:1 is preferable in terms of effectiveness. Of these, a red to blue light intensity ratio of 3:1 is the most preferable.

[0034] In terms of suppressing MMP1 mRNA expression, a red to blue light intensity ratio of 8:1 to 1:1 is preferable. Of these, a red to blue light intensity ratio of 3:1 is the most preferable.

[0035] In terms of suppressing MMP2 mRNA expression, a red to blue light intensity ratio of 8:1 to 1:1 is preferable. Of these, a red to blue light intensity ratio of 3:1 is the most preferable.

[0036] In promoting hyaluronic acid synthase 2 (HAS2) mRNA expression, a red to blue light intensity ratio of 8:1 to 1:1 is preferable in terms of effectiveness. Among these, a red to blue light intensity ratio of 3:1 is the most preferable.

[0037] In terms of cell proliferation promotion, a ratio of red to blue light intensity of 8:1 to 1:1 is preferable. Of these, a ratio of red to blue light intensity of 3:1 is the most preferable.

[0038] In terms of reactive oxygen species scavenging (free radical scavenging and removal), a ratio of red to blue light intensity of 8:1 to 1:1 is preferable in terms of effectiveness. Among these, a ratio of red to blue light intensity of 3:1 is the most preferable.

[0039] In summary, a red to blue light intensity ratio of 8:1 to 1:1 is preferable, 4:1 to 2:1 is more preferable, and 3:1 is most preferable.

[0040] Furthermore, the present invention provides novel MMP inhibitors and hyaluronic acid production promoters by cultivating using natural light such as sunlight instead of the artificial light mentioned above. Well-known cultivation methods can be used in this case.

[0041] The extraction method is not particularly limited, but can be carried out by using water or hot water, or a mixed solvent of water and an organic solvent, and by stirring or column extraction. Examples of extraction solvents include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). Preferably, polar solvents such as water, lower alcohols, and liquid polyhydric alcohols are used, and particularly preferably, water, ethanol, 1,3-butylene glycol, and propylene glycol are used. These solvents may be used individually or in mixtures of two or more. Particularly preferred extraction solvents include water, a mixed polar solvent of water and ethanol, or a mixed polar solvent of water and 1,3-butylene glycol. There are no particular limitations on the amount of solvent used; for example, it should be 10 times or more, preferably 20 times or more, relative to the dry weight of the Melilot leaves. However, for convenience in operations such as concentration or isolation after extraction, it is preferable to use 100 times or less. The extraction temperature and time can be appropriately selected depending on the type of solvent used and the pressure during extraction.

[0042] The above extract may be used as is, but if necessary, it may be used after treatment such as concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon, deodorization, ethanol precipitation, etc., to the extent that the effects of the present invention are achieved. Furthermore, the extracted solution may be treated by concentration to dryness, spray drying, freeze-drying, etc., and used as a dried product.

[0043] The present invention may use the above extract as is, or it may contain ingredients used in cosmetics, quasi-drugs, pharmaceuticals, or foods, such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, humectants, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, film-forming agents, sweeteners, and acidulants, to the extent that the effects of the extract are not impaired.

[0044] The present invention can be used in cosmetics, quasi-drugs, pharmaceuticals, and foods, and its dosage forms include, for example, lotions, creams, emulsions, gels, aerosols, essences, packs, cleansers, bath products, foundations, powders, lipsticks, ointments, poultices, tablets, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, suppositories, and injectable solutions.

[0045] For external use, the content of the above extract used in this invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight, when converted to solid matter. Furthermore, 0.01 to 5% by weight is most preferable. Below 0.0001% by weight, sufficient effect is unlikely to be expected. Above 10% by weight, enhancement of effect is unlikely to be observed, and it is uneconomical.

[0046] When administered internally, the dosage varies depending on age, weight, symptoms, therapeutic effect, administration method, processing time, etc. Generally, the daily intake per adult is preferably 5 mg or more, more preferably 10 mg to 5 g, and most preferably 20 mg to 2 g.

[0047] Next, in order to describe the present invention in detail, examples of the production, experimental, and formulation of the extract used in the present invention will be given as examples, but the present invention is not limited thereto. The percentages shown in the production and formulation examples are weight percentages. [Examples]

[0048] (1) Experimental materials and growth conditions Melilot seeds were sown in moist vermiculite, germinated at 22-25°C in the dark, and then grown as seedlings under fluorescent light at 22-26°C. Afterward, the seedlings were wrapped in sponges and grown using a hydroponic system. Red LEDs (peak wavelength 660nm) and blue LEDs (peak wavelength 450nm) were simultaneously irradiated from 30cm above the plants for 24 hours at a room temperature of 21-25°C, resulting in a total photosynthetic photon flux density of 100 μmol·m³ from the red and blue LEDs. -2 s -1 The ratio of red to blue light intensity is set to achieve the following: 4:1 ~ 2:1 Cultivation was carried out using the following method. The light intensity ratio was not changed during cultivation. Cultivation was also carried out under sunlight. In both cases, after cultivation for 4 weeks, the plants were harvested and dried by hot air drying at approximately 60°C to obtain dried melilot (Table 1).

[0049] [Table 1]

[0050] (2) Example of production of melilot extract The melilot extract was prepared as follows. In preparation examples 1A to 4A, the melilot leaves used as the extraction material were grown under conditions where the ratio of red to blue light intensity was 2:1.

[0051] (Production Example 1A) Preparation of hot water extract of Melilot 10 g of dried melilot was added to 200 mL of water and extracted at 95-100°C for 2 hours. The resulting extract was filtered, the filtrate was concentrated, and freeze-dried to obtain 2.6 g of hot water extract of melilot.

[0052] (Production Example 2A) Preparation of a 50% ethanol extract of Melilot 10 g of dried melilot was immersed in 200 mL of 50% ethanol aqueous solution at room temperature for 7 days to extract the extract. After filtering the resulting extract, it was concentrated to dryness using an evaporator to obtain 2.1 g of 50% ethanol extract of melilot.

[0053] (Production Example 3A) Preparation of ethanol extract of Melilot 10 g of dried melilot was immersed in 200 mL of ethanol at room temperature for 7 days to extract the extract. After filtering the resulting extract, it was concentrated to dryness using an evaporator to obtain 0.55 g of melilot ethanol extract.

[0054] (Preparation Example 4A) Preparation of 1,3-butylene glycol extract of Melilot 10 g of dried Melilotus was immersed in 200 mL of 1,3-butylene glycol at room temperature for 7 days to extract the extract. The resulting extract was filtered to obtain 195 g of Melilotus 1,3-butylene glycol extract.

[0055] Similarly, the total photosynthetic photon flux density of red and blue LEDs is 100 μmol·m. -2 s -1 To achieve this, we used melilots cultivated with varying ratios of red and blue light, and melilots cultivated under sunlight, and extracted them in the same manner as in production examples 1A to 4A above, resulting in production examples 1B to 4B, 1C to 4C, and production examples P to S (Table 2).

[0056] [Table 2] [Examples]

[0057] (Example prescription 1) Lotion 1 Formula Content (%) 1. Hot water extract of Melilot (Production Example 1A) 2.0 2,1,3-Butylene glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40 E.O.) 0.1 10.Fragrance (appropriate amount) 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Components 1-6 and 11 and components 7-10 are uniformly dissolved, mixed together, and filtered to obtain the product.

[0058] (Example prescription 2) Lotion 2 In Formulation Example 1, the hot water extract of sweet clover (Production Example 1A) was replaced with the hot water extract of sweet clover (Production Example P) to create Lotion 2.

[0059] (Comparative formulation example 1) Conventional lotion In Formulation Example 1, the hot water extract of sweet clover (Production Example 1A) was replaced with purified water to create a conventional lotion.

[0060] (Prescription example 3) Cream 1 Formula Content (%) 1. 50% ethanol extract of Melilot (Production Example 2B) 1.0 2. Squalane 5.5 3. Olive oil 3.0 4. Stearic acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-Butylene glycol 8.5 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-9, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 1 and 11-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring, add component 10 at 45°C, and cool further to 30°C to obtain the product.

[0061] (Prescription example 4) Cream 2 In Formula Example 3, Cream 2 was created by replacing the 50% ethanol extract of sweet clover (Production Example 2B) with the 50% ethanol extract of sweet clover (Production Example Q).

[0062] (Comparative formulation example 2) Conventional cream In Formulation Example 3, the conventional cream was created by replacing the 50% ethanol extract of sweet clover (Manufacturing Example 2B) with purified water.

[0063] (Prescription example 5) Emulsion Formula Content (%) 1. Ethanol extract of Melilot (Production Example 3C) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetanol 1.5 6. Glyceryl monostearate 2.0 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 1-8, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 10-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring. At 45°C, add component 9, and further cool to 30°C to obtain the final product.

[0064] (Prescription example 6) Gel Formula Content (%) 1. 1,3-butylene glycol extract of Melilot (Production Example 4A) 1.0 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60 E.O.) 0.1 5.Fragrance (appropriate amount) 6.1,3-Butylene glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve components 2-5 and components 1 and 6-11 uniformly, then mix them together to obtain the product.

[0065] (Prescription example 7) Pack Formula Content (%) 1. Hot water extract of Melilot (Preparation Example 1C) 1.0 2. 1,3-butylene glycol extract of Melilot (Production Example 4B) 5.0 3. Polyvinyl alcohol 12.0 4. Ethanol 5.0 5.1,3-Butylene glycol 8.0 6. Methyl parahydroxybenzoate 0.2 7. Polyoxyethylene hydrogenated castor oil (20 E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10.Fragrance (appropriate amount) 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve ingredients 1-11 uniformly to form the product.

[0066] (Prescription example 8) Foundation Formula Content (%) 1. 50% ethanol extract of Melilot (Production Example 2C) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20 E.O.) 1.0 4. Polyoxyethylene cetyl ether (20 E.O.) 2.0 5. Cetanol 1.0 6. Liquid lanolin 2.0 7. Liquid paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethylcellulose 0.1 10. Bentonite 0.5 11. Propylene glycol 4.0 12. Triethanolamine 1.1 13. Methyl parahydroxybenzoate 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Bengara 1.0 17. Yellow iron oxide 2.0 18.Fragrance (appropriate amount) 19. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-8, maintain at 80°C to form the oil phase. Swell component 9 thoroughly in component 19, then add components 1 and 10-13 and mix uniformly. Add components 14-17, which have been crushed and mixed in a pulverizer, and stir with a homomixer, maintaining at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase while stirring and emulsify. Then, cool, add component 18 at 45°C, and cool to 30°C while stirring to obtain the product.

[0067] (Prescription example 9) Bath additive Formula Content (%) 1. Ethanol extract of Melilot (Production Example 3A) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to bring the total volume to 100. [Manufacturing Method] Mix ingredients 1-5 uniformly to form the product.

[0068] (Prescription example 10) Ointment Formula Content (%) 1. Hot water extract of Melilot (Production Example 1B) 5.0 2. 1,3-butylene glycol extract of Melilot (Preparation Example 4C) 1.0 3. Polyoxyethylene cetyl ether (30 E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid paraffin 5.0 6. Cetanol 6.0 7. Methyl parahydroxybenzoate 0.1 8. Propylene glycol 10.0 9. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 3-6, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 1, 2 and 7-9, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool to 30°C while stirring to obtain the final product.

[0069] (Prescription example 11) Powder Formula Content (%) 1. Hot water extract of Melilot (Preparation Example 1C) 1.0 2. Dried corn starch 39.0 3. Microcrystalline cellulose 60.0 [Manufacturing method] Mix ingredients 1-3 and prepare as a powder.

[0070] (Prescription example 12) Tablets Formula Content (%) 1. Ethanol extract of Melilot (Production Example 3B) 5.0 2. Dried corn starch 25.0 3. Carboxymethylcellulose calcium 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing Method] Mix ingredients 1-4, then add an aqueous solution of ingredient 5 as a binder and form into granules. Add ingredient 6 to the formed granules and compress into tablets. Each tablet should weigh 0.52g.

[0071] (Prescription example 13) Tablet confectionery Formula Content (%) 1. Ethanol extract of Melilot (Production Example 3A) 2.0 2. Dried corn starch 49.8 3. Erythritol 40.0 4. Citric acid 5.0 5. Sucrose fatty acid ester 3.0 6. Flavor 0.1 7. Purified water 0.1 [Manufacturing method] Mix components 1 - 4 and 7, and granulate. Add components 5 and 6 to the formed granules and tableting. Make each tablet 1.0 g.

[0072] (Formulation Example 14) Beverage Formulation Content (%) 1. Hot water extract of merulot (Production Example 1B) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4. Flavor 0.1 5. Make the total amount 100 with purified water [Manufacturing method] Dissolve components 1 - 3 in a small amount of water. Then, add components 4 and 5 and mix.

[0073] Next, in order to explain the effects of the present invention in detail, experimental examples are given.

Example

[0074] Experimental Example 1 Melanin production inhibition test using B16 mouse melanoma B16 mouse melanoma cells were seeded at 3×10 in a φ60mm dish 4Cells were seeded individually and cultured for 5 days at 37°C under 5% CO2 conditions in MEM culture medium containing 10% FBS, to which each sample was added to final concentrations of 10 and 100 μg / mL. After culturing, the cells were detached and centrifuged to obtain a pellet, which was then dissolved in PBS(-) by sonication. Protein quantification was performed using the Lowry method (J. Biol. Chem., 193, 265-275, 1951). In addition, to measure melanin content, 4N NaOH was added to the remaining cell lysate taken for protein quantification, and after heating at 60°C for 2 hours, the absorbance at 475 nm was measured using a spectrophotometer (Shimadzu Corporation). Melanin content was determined from the calibration curve, and the amount of melanin per 1 mg of protein was calculated. The melanin production inhibition rate was calculated from the ratio of the decrease in melanin content in the sample-added group to the control group (no sample added).

[0075] These experimental results are shown in Table 3. As a result, it was found that the melilot extract of the present invention has excellent melanin production inhibitory effects. In particular, when the ratio of red to blue light intensity was 3:1, a higher effect was observed than that of the extracts from production examples P to R. Furthermore, similar effects were observed with the melilot extracts of the present invention obtained by other extraction methods (production examples 1A to 4C).

[0076] [Table 3]

[0077] Experimental Example 2: Measurement of Type I collagen (COL1A1), MMP1, MMP2, and hyaluronic acid synthase 2 (HAS2) mRNA expression levels. COL1A1, MMP1, MMP2, and HAS2 mRNA expression levels were measured. Human dermal fibroblasts were placed in a 60 mm dish at a rate of 1 × 10⁶. 5Cells were seeded and cultured in DMEM culture medium containing 10% FBS at 37°C and 5% CO2. Once confluent, each sample was cultured for 24 hours in DMEM(-) culture medium to final concentrations of 1 and 10 μg / mL, and then total RNA was extracted. Total RNA was extracted from cells using RNAiso Plus (Takara Bio), and the total RNA amount was determined by the absorbance at 260 nm using a spectrophotometer (Nanodrop). mRNA expression levels were measured using real-time RT-PCR based on the total RNA extracted from cells. High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used for real-time RT-PCR. Specifically, 500 ng of total RNA was reverse transcribed, followed by PCR (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles). Other procedures followed the prescribed method, and the expression levels of COL1A1, MMP1, MMP2, and HAS2 mRNA were determined as a percentage of the expression level of the internal standard, β-actin mRNA. The COL1A1 mRNA expression enhancement rate was calculated as the ratio of the COL1A1 mRNA expression level in the sample-added group to the COL1A1 mRNA expression level in the control (no sample added) group. The MMP1 mRNA expression suppression rate, MMP2 mRNA expression suppression rate, and HAS2 mRNA expression enhancement rate were calculated similarly. The primers used to measure the expression levels of each gene are as follows.

[0078] Primer set for COL1A1 AGGACAAGAGGCATGTCTGGTT(Sequence ID 1) TTGCAGTGGTAGGTGATGTTCTG(Sequence ID 2) Primer set for MMP1 GGGAGATCATCGGGACAACTC (Sequence ID 3) TGAGCATCCCCTCCAATACC(Sequence ID 4) Primer set for MMP2 CCGTCGCCCATCATCAA (Sequence ID 5) CTTCTGCATCTTCTTTAGTGTGTCCTT(Sequence No. 6) Primer set for HAS2 TGGATGACCTACGAAGCGATTA(Sequence ID 7) GCTGGATTACTGTGGCAATGAG(Sequence No. 8) Primer set for β-actin CACTCTTCCAGCCTTCCTTCC (Sequence ID 9) GTGTTGGCGTACAGGTCTTTG (Sequence No. 10)

[0079] These experimental results are shown in Tables 4-7. As a result, the melilot extract of the present invention showed excellent MMP1 expression inhibitory effect (MMP1 inhibitory effect), MMP2 expression inhibitory effect (MMP2 inhibitory effect), and HAS2 expression promoting effect (hyaluronic acid production promoting effect). The COL1A1 expression promoting effect (collagen production promoting effect) showed excellent effects in melilot cultivated under irradiation with artificial light having a specific wavelength range. In particular, high effects were observed when the ratio of red to blue light intensity was 8:1 to 1:1 for the COL1A1 expression promoting effect (collagen production promoting effect), MMP1 expression inhibitory effect (MMP1 inhibitory effect), MMP2 expression inhibitory effect (MMP2 inhibitory effect), and HAS2 expression promoting effect (hyaluronic acid production promoting effect). In particular, when the ratio of red to blue light intensity was 3:1, a higher effect was observed than that of the extracts from production examples P-R. Furthermore, similar effects were observed in the melilot extract of the present invention obtained by other extraction methods (production examples 1A-4C).

[0080] [Table 4]

[0081] [Table 5]

[0082] [Table 6]

[0083] [Table 7]

[0084] Experimental Example 3: Cell Proliferation Promotion Test Human keratinocytes were cultured in DMEM culture medium containing 0.1% FBS in a 96-well plate, with 1 × 10⁶ cells per well. 3 Cells were seeded individually, and each sample was added to achieve a final concentration of 0.01 μg / mL. The cells were then cultured at 37°C under 5% CO2 conditions for 5 days. Cell counts were measured by staining. Specifically, after culturing, the culture medium was removed, and the cells were fixed with methanol. Subsequently, 0.1% methylene blue was added, and the cells were stained for 1 hour. After drying, 100 μL of 0.1N HCl was added to each well and thoroughly mixed. The absorbance at 650 nm was measured using a microplate reader. Cell proliferation rate was calculated as the ratio of the number of cells in the sample-added group to the number of cells in the control group (no sample added).

[0085] These experimental results are shown in Table 8. As a result, the melilot extract of the present invention showed excellent cell proliferation promoting activity. In particular, when the ratio of red to blue light intensity was 3:1, a higher effect was observed than that of the extracts from production examples P and Q. Furthermore, similar effects were observed with the melilot extracts of the present invention obtained by other extraction methods (production examples 1A to 4C).

[0086] [Table 8]

[0087] Experimental Example 4: Reactive Oxygen Species Scavenging Effect The free radical scavenging and removal activity was evaluated. As a model for free radicals, α,α-diphenyl-β-picrylhydrazyl (hereinafter referred to as DPPH), a stable free radical, was used. It was reacted with the sample at a constant ratio for a certain period of time, and the amount of radicals that decreased was measured from the decrease in absorbance at 517 nm.

[0088] Method for measuring free radical scavenging activity Each sample was added to 2 mL of 1.0 M acetate buffer (pH 5.5) to achieve a final concentration of 10–500 μg / mL. To this solution, 2 mL of ethanol and 1 mL of 0.5 mM DPPH ethanol solution were added to prepare the reaction mixture. For oil-soluble samples, the sample was added to 2 mL of ethanol to prepare the reaction mixture. The mixture was then reacted at 37°C for 30 minutes, and the absorbance at 517 nm (A) was measured using water as a control. A blank absorbance (B) was also measured using purified water instead of the sample. The free radical scavenging and removal rate was calculated using the following formula. Free radical scavenging and removal rate (%) = (1 - A / B) × 100

[0089] From the test results of each sample, the concentration required for 50% free radical scavenging and removal (hereinafter referred to as IC50) was calculated. A lower IC50 value corresponds to a more potent reactive oxygen species scavenger. These test results are shown in Table 9. The melilot extract of the present invention was found to have stable and excellent free radical scavenging activity (antioxidant activity). In particular, a high effect was observed when the red to blue light intensity ratio was 8:1 to 1:1. In particular, when the red to blue light intensity ratio was 4:1 to 2:1, a higher effect was observed than that of the extracts from production examples P to R, and among these, the highest effect was observed when the red to blue light intensity ratio was 3:1. Furthermore, similar effects were observed in the melilot extracts of the present invention obtained by other extraction methods (production examples 1A to 4C).

[0090] [Table 9]

[0091] Experimental Example 5: Usage Test A one-month usage trial was conducted on five individuals (ages 25-66) with wrinkles and sagging skin, using the cream from prescription example 3 and the conventional cream from comparative prescription example 2. After use, the degree of wrinkles and sagging skin was assessed using a questionnaire.

[0092] As a result, the cream containing the extract of the present invention reduced wrinkles and sagging. Furthermore, no skin problems occurred in any participant during the testing period, and there were no safety concerns. There were also no issues with the degradation of the formulation ingredients.

[0093] Furthermore, a similar usage test was conducted using the lotion from Formulation Example 1 and the conventional lotion from Comparative Formulation Example 1. As a result, a reduction in wrinkles and sagging was observed with the lotion containing the extract of the present invention. [Industrial applicability]

[0094] Based on the above, the melilot extract of the present invention possesses excellent melanin production inhibitory effects, collagen production promoting effects, MMP inhibitory effects, hyaluronic acid production promoting effects, cell proliferation promoting effects, and antioxidant effects, and also exhibits excellent stability. Therefore, the melilot extract of the present invention can be used not only in the field of beauty, such as for skin aging, but also in the field of medicine, such as for suppressing functional decline due to aging, and for cancer prevention and treatment, and is expected to be applied to cosmetics, foods, quasi-drugs, and pharmaceuticals.

Claims

1. A topical skin preparation for promoting hyaluronic acid production, characterized by containing an extract of sweet clover that has been cultivated by irradiating it with artificial light having a photosynthetic photon flux density (PPFD) ratio of 4:1 to 2:1 between wavelengths of 570-730 nm and 400-515 nm, thereby enhancing its hyaluronic acid production-promoting effect compared to sweet clover cultivated in sunlight.

2. The topical skin preparation for promoting hyaluronic acid production according to Claim 1, wherein the ratio of photosynthetic photon flux density (PPFD) in the wavelength range of 570-730 nm and 400-515 nm is 3:

1.

3. A method for cultivating sweet clover characterized by enhancing the hyaluronic acid production-promoting effect compared to sweet clover cultivated in sunlight, by irradiating the plants with artificial light having a photosynthetic photon flux density (PPFD) ratio of 4:1 to 2:1 between wavelengths of 570-730 nm and 400-515 nm.

Images