Use of IFN-lambda mRNA to treat viral infections

Abstract

The present invention relates to a pharmaceutical composition comprising mRNA encoding an IFN-λ polypeptide for use in treating a virus-induced disorder, preferably a virus-induced respiratory disorder, such as COVID-19.

Description

[Technical Field]

[0001] The present invention relates to a pharmaceutical composition comprising mRNA encoding an IFN-λ polypeptide for use in treating virus-induced disorders, preferably virus-induced respiratory disorders, such as influenza or COVID-19. [Background technology]

[0002] Interferons are a group of proteins currently classified into three distinct families: type I interferons, type II interferons, and type III interferons.

[0003] Type I interferons are a family of closely related glycoproteins, including 13 IFN-α subtypes, as well as IFN-β, IFN-κ, IFN-ε, and IFN-ω. In humans, the IFNα gene family consists of 12 different subtypes encoded by 14 genes (including one pseudogene and two genes encoding the same protein) (Diaz et al., Genomics 22 (1994), 540-552), namely IFN-α1, IFN-α2, IFN-α8, IFN-α14, IFN-α17, IFN-α4, IFN-α5, IFN-α6, IFN-α7, IFN-α10, IFN-α16, IFN-α21 (da Rocha Matos et al., Emerg Microbes Infect. 8, (2019), 1763-1776).

[0004] Regarding IFN-α subtypes, they have been found to exhibit a spectrum of antiviral, antiproliferative, and immunomodulatory responses. Type I interferons play an important role in the innate immune response to respiratory virus infections. As its mechanism, interferon-β is first released, which then stimulates the further release of interferon-β and interferon-αs in a cascade mediated via the type I interferon receptor.

[0005] There is one type II interferon, namely, IFN-gamma, which binds to a different receptor from the type I interferons and has functions that are quite different from those of type I IFNs.

[0006] Type III interferons are the most recently discovered family of interferons. They are also known as interferon-lambdas (IFNλs). These IFNλs are three closely related proteins discovered in 2003. Interferon λ-1 is also known as IL-29, and interferons λ-2 and λ-3 are also known as IL-28A and IL-28B, respectively. These interferons bind to a third receptor distinct from the receptors of type I and type II interferons. These interferons have been shown to possess antiviral activity. Interferon λ has been found to be important in a wide variety of viral infections, including, for example, HCV, HBV, influenza virus, rhinovirus, respiratory syncytial virus (RSV), lymphocytic choriomeningitis virus (LCMV), rotavirus, reovirus, norovirus, and West Nile virus (WNV). Experimental in vivo approaches using IFNλ receptor knockout mice have highlighted the importance of IFNλ signaling in controlling levels of influenza A virus (IAV), SARS coronavirus, RSV, and human metapneumonia virus in the lungs, as well as levels of norovirus, reovirus, and rotavirus in the gastrointestinal tract. In vivo studies have shown that IFNλ reduces the ISG response compared to IFNα / β, indicating that it is far less inflammatory in vivo than IFNα / β. Interestingly, IFNλ retains many antiviral properties despite exhibiting less inflammatory response compared to type I IFNs. This has facilitated the development of IFNλ for clinical use as an alternative treatment to IFNα for HCV infections (Muir et al., J. Hepatol. 61 (2014), 1238-1246). More recent developments have also shown that treatment with IFNλ may be used to control respiratory viral infections.IFNλ2 and 3 have been shown to control IAV pulmonary titers, similar to treatment with IFNα or IFNβ (Davidson et al., EMBO Mol. Med. 8 (2016), 1099-1112; Kim et al, Am. J. Respir. Cell. Mol. Biol. 56 (2017), 202-212). Importantly, treatment with IFNλ avoided the excessive pulmonary inflammation associated with treatment with IFNα (Kim et al., Am. J. Respir. Cell. Mol. Biol. 56 (2017), 202-212). Therapeutic application of IFNλ has thus far focused on administering recombinantly produced proteins. However, using recombinantly produced proteins requires repeated administration of relatively high doses of the protein. This is because the protein is removed from the body relatively quickly and thus can only act for a short period of time. For example, Dinnon III et al. (Nature https: / / doi.org / 10.1038 / s41586-020-2708-8 (2020)) administered 2 μg of peg-IFNλ1 subcutaneously to mice. Similarly, Davidson et al. (EMBO Mol. Med. 8 (2016), 1099-1112) describe administering 2.6 μg / 50μl of IFNλ3 to B6.A2G-Mx mice to treat or prevent influenza infection. In Galani et al. (Immunity 46(2017), 875-890), it was reported that mice were treated with 5 μg or 10 μg of recombinant murine pegylated IFNλ2.

[0007] Therefore, there is a need for means and methods to provide an efficient method for delivering IFNλ to target tissue in vivo (i.e., a method that ensures that IFNλ remains active over a long period and exerts its effects over a long period). This would make it possible to reduce the amount of IFNλ administered to a patient within a given period, and also reduce the number of administrations to the patient. [Overview of the project] [Problems that the invention aims to solve]

[0008] This invention addresses this need by providing embodiments enumerated in the claims.

[0009] Accordingly, the present invention relates to a pharmaceutical composition comprising mRNA encoding an IFN-λ polypeptide for use in treating and / or preventing virus-induced disorders. [Means for solving the problem]

[0010] This invention is based on the finding that when mRNA encoding IFNλ is transfected into cells that serve as a model for alveolar epithelial cells, it enables highly efficient and long-lasting activation of downstream targets important for the antiviral activity of IFN-λ. In particular, in an in vitro model using A-549 cells (a model of type II-like lung cells / alveolar epithelial cells), even extremely low doses of mRNA activate the downstream targets IFIT3, ISG15, IFIT1, and OAS3 (which are indicators of the antiviral activity of IFNλ) at high levels and for a long period (over 120 hours). These results were confirmed in in vivo studies in mice.

[0011] Furthermore, surprisingly, in A-549 cells that had been stably transfected beforehand to express the ACE2 receptor, the induction of downstream targets was as high as in A-549 cells that did not express the ACE2 receptor when mRNA encoding IFN-λ polypeptide was used. On the other hand, when recombinant IFNλ protein was administered, the induction of downstream targets was much lower in A-549 cells expressing ACE2 compared to A-549 cells that did not express the ACE2 receptor. This indicates that administration of recombinant IFNλ polypeptide does not result in efficient activation of downstream targets in cells expressing the ACE2 receptor, while administration of mRNA encoding IFNλ enables efficient activation. Therefore, the use of mRNA encoding IFNλ is particularly advantageous when viral infection targets ACE2-expressing cells, i.e., when the virus enters the cell via the ACE2 receptor.

[0012] Furthermore, in air-liquid interface (ALI) cultures of various cell types, mRNA encoding IFNλ was shown to be effective in activating downstream targets when added to the apical side of cells (facing air), rather than the expected location of the corresponding receptor on the basolateral side of the cell (facing the liquid culture medium). These results were confirmed by in vivo studies in mice to which IFNλ-encoding mRNA was directly administered to the lungs. Airway epithelium forms a mechanical barrier that isolates the external environment from the internal environment, and the structural polarity of the epithelium is important for the integrity of the barrier, and is known to be controlled by complex cell-cell adhesion complexes including adhesion and tight junctions (see, for example, Humlicek et al., J. Immunol. 178 (2007), 6395-6403). Furthermore, since the corresponding receptor is clearly located only on the basolateral side of the cell, it is known that there is a polarity in the functionality of certain cytokines, meaning that only the basolateral position relative to the airway epithelium exerts its effect. Consequently, the airway epithelial response to certain cytokines could only be observed after administration into the airway lumen when the epithelial barrier function had been physically or pharmacologically disrupted beforehand (Humlicek et al., op. cit.). Therefore, it is surprising that the downstream targets of IFNλ are efficiently activated (this is an indicator of antiviral effect) by administering IFNλ mRNA to the apical side of epithelial cells cultured as ALI cultures, or by directly administering IFNλ mRNA to the lungs of mice without disrupting the barrier function of the epithelial cells.

[0013] In principle, mRNA encoding an IFNλ polypeptide can be used in connection with the present invention to treat and / or prevent any possible virus-induced disorders. IFNλ has been shown to exhibit antiviral activity in vitro against many viruses. In vivo, the antiviral activity of IFNλ has been observed particularly against viruses that infect the epithelial cells of the respiratory tract, gastrointestinal tract, and urogenital tract, as well as the liver (see, for example, Lazear et al., Immunity 43 (2015), 15-28; Table 1). Virus-induced diseases that can be treated or prevented by the present invention include diseases caused by viruses belonging to the families of pneumoniae, orthomyxoviridae, adenoviridae, arenaviridae, paramyxoviridae, flaviviridae, retroviridae, caliciviridae, picornaviridae, coronavirusidae, parvoviridae, reoviridae, herpesviridae, or hepadnaviridae.

[0014] Human metapneumonia virus is an example of a virus belonging to the pneumonia virus family.

[0015] Influenza virus is an example of a virus belonging to the Orthomyxoviridae family.

[0016] Adenoviruses are an example of viruses belonging to the Adenoviridae family.

[0017] One example of a virus belonging to the Arenaviridae family is lymphocytic choriomeningitis virus.

[0018] Respiratory syncytial viruses are an example of viruses belonging to the Paramyxoviridae family.

[0019] Viruses belonging to the Flaviviridae family include dengue virus, hepatitis C virus, Zika virus, and West Nile virus.

[0020] Human immunodeficiency virus (HVM) is an example of a virus belonging to the retroviridae family.

[0021] Norovirus is an example of a virus belonging to the Caliciviridae family.

[0022] Rhinoviruses are an example of viruses belonging to the Picornaviridae family.

[0023] Viruses belonging to the Coronaviridae family include SARS-CoV, SARS-CoV2, MERS, and HCoV-NL63, -OC43, -229E, and HKU1.

[0024] Bocavirus is an example of a virus belonging to the Parvoviridae family.

[0025] Viruses belonging to the Reoviridae family include reoviruses and rotaviruses.

[0026] Viruses belonging to the Herpesviridae family include cytomegalovirus and herpes simplex virus (e.g., herpes simplex virus 1 and 2).

[0027] Hepatitis B virus is an example of a virus belonging to the Hepadnaviridae family.

[0028] In a preferred embodiment, the virus-induced disorder is a virus-induced respiratory disorder. With this in mind, the virus that induces the respiratory disorder is preferably selected from the group consisting of rhinovirus, influenza virus, parainfluenza virus, metapneumonia virus, respiratory syncytial virus, adenovirus, and coronavirus.

[0029] In a particularly preferred embodiment, the virus is one that enters cells via the ACE2 receptor. ACE2 (angiotensin-converting enzyme 2) is an enzyme that binds to the cell membranes of cells in the lungs, arteries, heart, kidneys, and small intestine. It lowers blood pressure by catalyzing the hydrolysis of angiotensin II to angiotensin. ACE2 also functions as an entry point into cells for several coronaviruses, such as SARS-CoV, SARS-CoV-2, and HCoV-NL63.

[0030] Therefore, in a particularly preferred embodiment, the virus is a coronavirus, and most preferably a virus selected from the group consisting of SARS-CoV, SARS-CoV-2, and HCoV-NL63.

[0031] Therefore, in a particularly preferred embodiment, the virus-induced diseases are SARS (caused by SARS-CoV), COVID-19 (caused by SARS-CoV-2), as well as mild to moderate upper respiratory tract infections, severe lower respiratory tract infections, croup, and bronchiolitis (caused by HCoV-NL63).

[0032] The IFNλ protein encoded by the mRNA contained in the pharmaceutical composition may be any possible IFNλ protein, particularly interferon λ-1 (also known as IL-29), interferon λ-2 (also known as IL-28A), or interferon λ-3 (IL-28B), or any combination thereof. In a preferred embodiment, the IFNλ protein is a human protein.

[0033] In one embodiment, the IFNλ protein encoded by the mRNA contained in the pharmaceutical composition is IFNλ-1, preferably IFNλ-1 comprising the amino acid sequence shown in SEQ ID NO: 2. In a more preferred embodiment, the mRNA encoding IFNλ-1 includes the coding region shown in SEQ ID NO: 1.

[0034] In one embodiment, the IFNλ protein encoded by the mRNA contained in the pharmaceutical composition is IFNλ-2, preferably IFNλ-2 comprising the amino acid sequence shown in SEQ ID NO: 4. In a more preferred embodiment, the mRNA encoding IFNλ-2 includes a coding region shown in SEQ ID NO: 3.

[0035] In one embodiment, the IFNλ protein encoded by the mRNA contained in the pharmaceutical composition is IFNλ-3, preferably IFNλ-3 comprising the amino acid sequence shown in SEQ ID NO: 6. In a more preferred embodiment, the mRNA encoding IFNλ-3 includes a coding region shown in SEQ ID NO: 5.

[0036] In some embodiments of the present invention, the polyribonucleotides used in accordance with the present invention may include unmodified nucleotides and modified nucleotides. As used in this application, “unmodified nucleotide” refers to A, C, G, and U nucleotides. As used in this application, “modified nucleotide” refers to any natural or unnatural isomer of A, C, G, and U nucleotides, and any natural or natural analogs thereof, e.g., alternative or modified nucleotides or isomers having chemically modified or substituted residues. Modified nucleotides may have base modifications and / or sugar modifications. Modified nucleotides may also have phosphate modifications, for example, with respect to the 5'-prime cap of the mRNA molecule. Modified nucleotides may also include nucleotides synthesized after transcription by covalent modification of nucleotides. Furthermore, any suitable mixture of unmodified and modified nucleotides is possible. A non-limiting number of examples of modified nucleotides can be found in the literature (e.g., Cantara et al., Nucleic Acids Res, 2011, 39(Issue suppl_1):D195-D201; Helm and Alfonzo, Chem Biol, 2014, 21(2):174-185; Carell et al., Angew Chem Int Ed Engl, 2012, 51(29):7110-31), and some preferred modified nucleotides are exemplified below based on their respective nucleoside residues: 1-Methyladenosine, 2-Methylthio-N6-hydroxynorvalylcarbamoyladenosine, 2-Methyladenosine, 2'-O-Ribosylphosphate adenosine, N6-Methyl-N6-Threonylcarbamoyladenosine, N6-Acetyladenosine, N6-Glycinylcarbamoyladenosine, N6-Isopentenyladenosine, N6-Methyladenosine, N6-Threonylcarbamoyladenosine, N6,N6-Dimethyladenosine, N6-(Cis-Hydroxyisopentenyl)adenosine, N6 -Hydroxynorvalylcarbamoyladenosine, 1,2'-O-dimethyladenosine, N6,2'-O-dimethyladenosine, 2'-O-methyladenosine, N6,N6,2'-O-trimethyladenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-methyladenosine, 2-methylthio-N6-isopentenyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6-2-methylthio-N6-threonylcarbamoyl Luadenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, 7-methyladenosine, 2-methylthio-adenosine, 2-methoxy-adenosine, 2'-amino-2'-deoxyadenosine, 2'-azido-2'-deoxyadenosine, 2'-fluoro-2'-deoxyadenosine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenosine, 7-deaza-8-aza-adenosine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7 -Deaza-2,6-diaminopurine, 7-Deaza-8-aza-2,6-diaminopurine; 2-thiocytidine, 3-methylcytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-methylcytidine, 5-hydroxymethylcytidine, 5-hydroxycytidine, lysidine, N4-acetyl-2'-O-methylcytidine, 5-formyl-2'-O-methylcytidine, 5,2'-O-dimethylcytidine, 2-O-methylcytidine, N4,2'-O-dimethylcytidine, N4,N4,2'-O-trimethylcytidine, isocytidine, pseudocytidine, pseudoisocytidine, 2-thiocytidine, 2'-methyl-2'-deoxycytidine, 2'-amino-2'-deoxycytidine, 2'-fluoro-2'-deoxycytidine, 5-iodocytidine, 5-bromocytidine, 2'-azido-2'-deoxycytidine, 2'-amino-2'-deoxycytidine, 2'-fluoro- 2'-Deoxycytidine, 5-Azacytidine, 3-Methylcytidine, 1-Methyl-Pseudoisocytidine, Pyrrolocytidine, Pyrrolo-Pseudoisocytidine, 2-Thio-5-Methylcytidine, 4-Thio-Pseudoisocytidine, 4-Thio-L-Methyl-Pseudoisocytidine, 4-Thio-L-Methyl-1-Deaza-Pseudoisocytidine, 1-Methyl-L-Deaza-Pseudoisocytidine, 2-Methoxycytidine Zin, 2-methoxy-5-methylcytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-l-methyl-pseudoisocytidine, zebralin, 5-aza-zebralin, 5-methyl-zebralin, 5-aza-2-thio-zebralin, 2-thio-zebralin; 1-methylguanosine, N2,7-dimethylguanosine, N2-methylguanosine, 2'-O-ribosyl phosphate guanosine, 7-methylguanosine, hydroxywibutosine, 7-aminomethyl-7-deazaguanosine, 7-cyano-7-deazaguanosine, N2,N2-dimethylguanosine, N2,7,2'-O-trimethylguanosine, N2,2'-O-dimethylguanosine, 1,2'-O-dimethylguanosine, 2'-O-methylguanosine, N2,N2,2'-O-trimethylguanosine, N2,N2J-trimethylguanosine, isoguanosine, 4-demethylwyosine, epoxyqueosine, undermodified hydroxywybutosine, methylated undermodified hydroxywybutosine, isowyosine, peroxywybutosine, galactosyl-queusin, mannosyl-queusin, queusin, archaeosin, queusin, methylwyosin, queusin, 7-aminocarboxypropyldemethylwyosine, 7-aminocarboxypropylwyosine, 7-aminocarboxypropylwyosine methyl ester, 7-deaza-guanosine, 7-deaza-8-aza -Guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, N1-methyl-guanosine Anosine, 2'-amino-3'-deoxyguanosine, 2'-azido-2'-deoxyguanosine, 2'-fluoro-2'-deoxyguanosine, 2-thiouridine, 3-(3-amino-3-carboxypropyl)uridine, 3-methyluridine, 4-thiouridine, 5-methyl-2-thiouridine, 5-methylaminomethyluridine, 5-carboxymethyluridine, 5-carboxymethylaminomethyluridine, 5-hydroxyuridine, 5-methyluridine, 5-tau Linomethyluridine, 5-Carbamoylmethyluridine, 5-(carboxyhydroxymethyl)uridine methyl ester, Dihydrouridine, 5-Methyldihydrouridine, 5-Methylaminomethyl-2-thiouridine, 5-(carboxyhydroxymethyl)uridine, 5-(carboxyhydroxymethyl)-2'-O-methyluridine methyl ester, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thiouridine, 3,2'-O-dimethyluridine, 5-carboxymethylaminomethyl-2'-O-methyluridine, 5-carbamoylhydroxymethyluridine, 5-carbamoylmethyl-2'-O-methyluridine, 5-carbamoylmethyl-2-thiouridine, 5-methoxycarbonylmethyl-2'-O-methyluridine, 5-(isopentenylaminomethyl)-2'-O-methyluridine, 5,2'-O-dimethyluridine, 2'-O-methyluridine, 2'-O-methyl-2-thiorudine, 2-thio-2'-O-methyluridine, uridine 5-oxyacetic acid, 5-methoxycarbonylmethyluridine, uridine 5-oxyacetic acid methyl ester, 5-methoxyuridine, 5-aminomethyl-2 - Thiouridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-methylaminomethyl-2-selenouridine, 5-methoxycarbonylmethyl-2-thiouridine, 5-taurinomethyl-2-thiouridine, pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl) pseudouridine, 1-methyl pseudouridine, 3-methyl pseudouridine, 2'-O-methyl pseudouridine, 5-formyluridine, 5-aminomethyl-2-geranyluridine, 5-taurinomethyluridine, 5-iodouridine, 5-bromouridine, 2'-methyl-2'-deoxyuridine, 2'-amino-2'-deoxyuridine, 2'-azido-2'-deoxyuridine, 2'-fluoro-2'-deoxyuridine, inosine, 1-methylinosine, 1,2'-O-dimethylinosine, 2'-O-methylinosine, 5-azauridine, 2-thio-5-azauridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thiouridine, 1-taurinomethyl-4-thiouridine, 5-methyluridine, 1-methyl-pseudouridine, 4-thio-l-methyl-pseudouridine , 2-thio-l-methyl-pseudouridine, 1-methyl-l-deaza-pseudouridine, 2-thio-1-methyl-l-deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thiouridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 1,2'-O-dimethyladenosine, 1,2'-O-dimethylguanosine, 1,2'-O-dimethylinosine, 2,8-dimethyladenosine, 2-methylthiomethylenethio-N6-isopentenyl-adenosine, 2-geranylthiouridine, 2-lysidine, 2-methylthiocyclic N6-threonylcarbamoyladenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, 2-selenouridine, 2-thio-2'-O-methyluridine, 2'-O-methyladenosine n, 2'-O-methylcytidine, 2'-O-methylguanosine, 2'-O-methylinosine, 2'-O-methylpseudridine, 2'-O-methyluridine, 2'-O-methyluridine 5-oxyacetate methyl ester, 2'-O-ribosyladenosine phosphate, 2'-O-ribosylguanosine phosphate, 3,2'-O-dimethyluridine, 3-(3-amino-3-carboxypropyl)-5,6-dihydrouridine, 3-(3-amino-3-carboxypropyl)pseudridine, 5,2'-O-dimethylcytidine, 5,2'-O-dimethyluridine, 5-(carboxyhydroxymethyl)-2'-O-methyluridine methyl ester, 55-(isopentenylaminomethyl)-2'-O-methyluridine, 5-aminomethyl-2-geranylthiouridine, 5-aminomethyl-2-selenouridine, 5-aminomethyluridine, 5-carbamoylmethyl-2'-O-methyluridine, 5-carboxyhydroxymethyluridine, 5-carboxymethyl-2-thiouridine, 5-carboxymethylaminomethyl- 2-Geranylthiouridine, 5-Carboxymethylaminomethyl-2-Selenouridine, 5-Carboxymethylaminomethyl-2'-O-Methyluridine, 5-Cyanomethyluridine, 5-Formyl-2'-O-Methylcytidine, 5-Methoxycarbonylmethyl-2'-O-Methyluridine, 5-Methylaminomethyl-2-Geranylthiouridine, 7-Aminocarboxypropyl-Demethylwyosin, 7-Methylguanosine, 8-Methyladenosine, N2,2'-O-Dimethylguanosine, N2 ,7,2'-O-trimethylguanosine, N2,7-dimethylguanosine, N2,N2,2'-O-trimethylguanosine, N2,N2,7-trimethylguanosine, N2,N2,7-trimethylguanosine, N4,2'-O-dimethylcytidine, N4,N4,2'-O-trimethylcytidine, N4,N4-dimethylcytidine, N4-acetyl-2'-O-methylcytidine, N6,2'-O-dimethyladenosine, N6,N6,2'-O-trimethyladenosine, N6-formyladenosine, N6 -Hydroxymethyladenosine, agmatidine, 2-methylthiocyclic N6-threonylcarbamoyladenosine, glutamyl-queuosine, guanosine attached to any nucleotide, guanylated 5' terminus, hydroxy-N6-threonylcarbamoyladenosine; most preferably pseudo-uridine, N1-methyl-pseudo-uridine, 2'-fluoro-2'-deoxycytidine, 5-iodocytidine, 5-methylcytidine, 2-thiouridine, 5-iodouridine and / or 5-methyluridine.

[0037] Furthermore, the term "modified nucleotide" includes nucleotides containing isotopes such as deuterium. The term "isotope" refers to elements that have the same number of protons but different numbers of neutrons, resulting in different mass numbers. Therefore, for example, isotopes of hydrogen are not limited to deuterium but also include tritium. Moreover, polyribonucleotides may also contain isotopes of other elements, such as carbon, oxygen, nitrogen, and phosphorus. Modified nucleotides may be deuterated or contain other isotopes of hydrogen or oxygen, carbon, nitrogen, or phosphorus.

[0038] The total number of modified nucleotide types in the polyribonucleotide may be 0, 1, 2, 3, or 4. Therefore, in some embodiments, at least one nucleotide of one nucleotide type, for example, at least one U nucleotide, may be a modified nucleotide. In some embodiments, at least one nucleotide of a total of two nucleotide types, for example, at least one U nucleotide and at least one C nucleotide, may be modified nucleotides. In some embodiments, at least one nucleotide of a total of three nucleotide types, for example, at least one G nucleotide, at least one U nucleotide, and at least one C nucleotide, may be modified nucleotides. In some embodiments, at least one nucleotide of all four nucleotide types may be a modified nucleotide. In all of these embodiments, one or more nucleotides per nucleotide type may be modified, the percentage of such modified nucleotides per nucleotide type being 0%, 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%.

[0039] In some embodiments, the total percentage of modified nucleotides in the mRNA molecule to be purified is 0%, 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%.

[0040] In a preferred embodiment, the mRNA is mRNA containing a combination of modified and unmodified nucleotides. Preferably, it is mRNA containing a combination of modified and unmodified nucleotides as described in WO2011 / 012316. The mRNA described therein has been reported to exhibit increased stability and decreased immunogenicity. In a preferred embodiment, in such modified mRNA, 5% to 50% of the cytidine nucleotides and 5% to 50% of the uridine nucleotides are modified. The adenosine and guanosine-containing nucleotides may not be modified. The adenosine and guanosine nucleotides may be unmodified, partially modified, and preferably exist in an unmodified form. Preferably, 10% to 35% of the cytidine and uridine nucleotides are modified, and particularly preferably, the content of modified cytidine nucleotides is in the range of 7.5% to 25%, and the content of modified uridine nucleotides is in the range of 7.5% to 25%. In fact, it has been found that the desired properties can be achieved with relatively low content of modified cytidine nucleotides and modified uridine nucleotides, for example, as little as 10% each. It is particularly preferable that the modified cytidine nucleotide is a 5-methylcytidine residue and the modified uridine nucleotide is a 2-thiouridine residue. Most preferably, the content of modified cytidine nucleotides and modified uridine nucleotides is 25% each.

[0041] In any particular embodiment described above, the proportion of a given nucleotide analog refers to the input proportion (e.g., the proportion of the analog in an initiation reaction, such as an initiation in vitro transcription reaction). In any particular embodiment described above, the proportion of a given nucleotide analog refers to the output proportion (e.g., the proportion in the synthesized or transcribed compound). Both options are equally intended.

[0042] The aforementioned mRNA can be recombinantly produced in an in vivo system by methods known to those skilled in the art.

[0043] Alternatively, the modified RNA, preferably the mRNA molecule of the present invention, may be produced in an in vitro system, for example, using an in vitro transcription system known to those skilled in the art. An in vitro transcription system capable of producing RNA, preferably mRNA, requires an input mixture of modified nucleoside triphosphates and unmodified nucleoside triphosphates to produce modified mRNA.

[0044] Furthermore, the modified RNA, preferably mRNA molecules, may be chemically synthesized, for example, by conventional chemical synthesis using a solid-phase support and standard techniques in an automated nucleotide sequence synthesizer, or by chemical synthesis of each DNA sequence followed by in vitro or in vivo transcription.

[0045] The coding region of the mRNA that encodes the IFNλ protein may be a partially or completely codon-optimized sequence. Codon optimization is a technique applied to maximize protein expression by increasing the translation efficiency of each polyribonucleotide, such that for a given amino acid, there are codons that a certain species preferentially uses. Examples of codon-optimized coding regions are shown in sequence numbers (SEQ ID NO): 1, 3, and 5.

[0046] Furthermore, the polyribonucleotide may include further modifications to regulate and / or extend the duration of action. The polyribonucleotide may also include an m7GpppG cap, an internal ribosome entry site (IRES), and / or a polyA tail at the 3' end, and / or further sequences to promote translation.

[0047] Furthermore, the polyribonucleotides used in accordance with the present invention may also include additional functional regions and / or 3' or 5' non-coding regions. The 3' and / or 5' non-coding regions may be sequences naturally adjacent to the encoded protein or artificial sequences that contribute to the stabilization and / or regulation of the polyribonucleotide. Suitable sequences may be identified and investigated by conventional experiments. Furthermore, the polyribonucleotides may also have additional functional regions and may be combined with regulatory elements and target sequences of micro-RNAs to spatially and temporally control the activity of a desired polyribonucleotide, for example, a protein-coding sequence, i.e., with respect to a specific cell or cell type and / or developmental stage or a specific time frame.

[0048] In one embodiment, the mRNA also includes a 5-' and / or 3'-UTR. In a particularly preferred embodiment, the UTR sequence is the 5'-UTR sequence described in WO 2017 / 167910. More preferably, the mRNA includes a 5'-UTR sequence immediately upstream of the start codon of its coding region, and exhibits the following sequence: gggagaCGCCACC (SEQ ID NO: 7).

[0049] In a more preferred embodiment, the mRNA also includes a 3'-UTR, preferably a 3'-UTR of the sequence 5'-TTCG-3'.

[0050] In another preferred embodiment, mRNA is transcribed from a DNA molecule as described in WO 2017 / 167910. More preferably, such a DNA molecule comprises a single strand having the following elements: (a) a coding region encoding an IFNλ polypeptide, including a start codon at its 5' end; and, (b) A promoter having gggagaCGCCACC (SEQ ID NO: 7) immediately upstream of the coding sequence, and upstream of this sequence, a promoter recognized by DNA-dependent RNA polymerase, preferably the sequence TaaTacgacTcacTaTa (SEQ ID NO: 8) recognized by T7 DNA-dependent RNA polymerase.

[0051] Therefore, in such an embodiment, the sequence upstream of the start codon of the coding region is TaaTacgacTcacTaTa gggagaCGCCACC (SEQ ID NO: 9).

[0052] In a particularly preferred embodiment, the mRNA is transcribed from a DNA molecule as shown in any one of sequence numbers (SEQ ID NO): 10 to 12. Sequence number (SEQ ID NO): 10 indicates a DNA molecule for transcription of an mRNA molecule encoding IFNλ-1. Sequence number (SEQ ID NO): 11 indicates a DNA molecule for transcription of an mRNA molecule encoding IFNλ-2. Sequence number (SEQ ID NO): 12 indicates a DNA molecule for transcription of an mRNA molecule encoding IFNλ-3.

[0053] The mRNA encoding IFNλ may be combined with mRNA encoding another type of interferon (preferably a type I interferon or a type II interferon). In a preferred embodiment, the type I interferon is selected from the group consisting of IFN-β, IFN-α1, IFN-α2, IFN-α8, IFN-α14, IFN-α17, IFN-α4, IFN-α5, IFN-α6, IFN-α7, IFN-α10, IFN-α16, and IFN-α21 or any combination thereof. In a particularly preferred embodiment, the type I interferon is IFN-α16 or IFN-β. In another preferred embodiment, the other type of interferon is a type II interferon, particularly IFNγ. The same applies to such mRNA encoding another interferon in relation to the preferred embodiments described above for the mRNA encoding IFNλ (e.g., possible modifications, promoter sequences, UTR, etc.).

[0054] An exemplary RNA sequence encoding IFN-α16 is shown as sequence number (SEQ ID NO): 16. The encoded protein is shown as sequence number (SEQ ID NO): 17.

[0055] An exemplary RNA sequence encoding IFN-β is shown as sequence number (SEQ ID NO): 18. The encoded protein is shown as sequence number (SEQ ID NO): 19.

[0056] An exemplary RNA sequence encoding IFNγ is shown in Sequence ID No. 20. The encoded protein is shown in Sequence ID No. 21.

[0057] An example DNA sequence that can be transcribed into mRNA encoding IFN-α16 is shown in Sequence ID No. 22.

[0058] An example DNA sequence that can be transcribed into mRNA encoding IFN-β is shown in Sequence ID No. 23.

[0059] An example DNA sequence that can be transcribed into mRNA encoding IFNγ is shown in Sequence ID No. 24.

[0060] An exemplary mRNA sequence encoding IFN-α16 is shown in sequence number (SEQ ID NO): 25.

[0061] An exemplary mRNA sequence encoding IFN-β is shown in sequence number (SEQ ID NO): 26.

[0062] An exemplary mRNA sequence encoding IFNγ is shown in Sequence ID No. 27.

[0063] The mRNA administered according to the present invention is in the form of a pharmaceutical composition. According to the present invention, the term "pharmaceutical composition" refers to a composition for administration to a subject. Exemplary subjects include mammals, such as dogs, cats, pigs, cattle, sheep, horses, rodents (e.g., rats, mice, and guinea pigs), or primates (e.g., gorillas, chimpanzees, and humans). In the most preferred embodiment, the subject is a human.

[0064] Generally, the RNA is contained in an effective amount in the pharmaceutical composition. The term "effective amount" refers to an amount sufficient to induce a detectable therapeutic response in the subject to which the pharmaceutical composition is administered.

[0065] The aforementioned pharmaceutical composition may contain pharmaceutically acceptable carriers, i.e., compounds, materials, components, and / or compositions. These are suitable for use in contact with human and animal tissues in proportion to a reasonable benefit / risk ratio, without excessive toxicity, irritation, allergic reactions, or other problems or complications, within the bounds of reasonable medical judgment. Accordingly, a pharmaceutically acceptable carrier is an inert substance formulated together with a pharmaceutically active substance to facilitate the handling of the pharmaceutically active substance in terms of dosage, absorption, solubility, or pharmacokinetic considerations. Examples of preferred pharmaceutically acceptable carriers include those known in the art, as well as phosphate-buffered saline solutions, buffers, water, emulsions such as oil / water emulsions, various types of wetting agents, and sterile solutions. In particular, aqueous carriers include water, alcohol / aqueous solutions, emulsions or suspensions, such as saline and buffering media. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and organic esters such as ethyl oleate.Further examples of pharmaceutically acceptable carriers include, but are not limited to, physiological saline, Ringer's solution and dextrose solution, citrates, phosphates and other organic acids; salt-forming counterions, e.g., sodium and potassium; low molecular weight (>10 amino acid residues) polypeptides; proteins, e.g., serum albumin or gelatin; hydrophilic polymers, e.g., polyvinylpyrrolidone; amino acids, e.g., histidine, glutamine, lysine, asparagine, arginine, or glycine; carbohydrates, e.g., glucose, mannose, or dextrin; monosaccharides; disaccharides; other sugars, e.g. For example, sucrose, mannitol, trehalose, or sorbitol; chelating agents, e.g., EDTA; non-ionic surfactants, e.g., polyoxyethylene sorbitan monolaurate (marketed under the trade name Tween), propylene glycol, pluronics, or polyethylene glycol; antioxidants such as methionine, ascorbic acid, and tocopherol; and / or preservatives (e.g., octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or Examples include benzyl alcohol; alkylparabens (e.g., methyl or propylparaben); catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol. Preferred pharmaceutically acceptable carriers and their formulations are described in more detail in Remington's Pharmaceutical Sciences, 17th edition, 1985, Mack Publishing Co. Furthermore, preservatives, stabilizers, and other additives, such as antimicrobials, antioxidants, chelating agents, and inert gases, nanosystems, or liposomes, may also be present.

[0066] The administration of mRNA encoding the IFNλ protein for the treatment and / or prevention of virus-induced disorders may be achieved by means and methods known to those skilled in the art, particularly to ensure that the mRNA reaches the intended target tissue / target cell. Possible routes include, for example, intravenous, intramuscular, intradermal, subcutaneous, and respiratory delivery.

[0067] If the virus-induced injury is a respiratory injury, administration to the respiratory system is preferred. Possible methods of delivery to the respiratory system include intravenous infusion and inhalation. Alternatively, intravenous administration using a formulation targeted to the lungs to deliver the mRNA to the lungs is also possible.

[0068] In a preferred embodiment, a pharmaceutical composition containing mRNA encoding an IFN-λ polypeptide is administered to the patient by inhalation.

[0069] The mRNA may be inhaled in any form suitable for inhalation. In a preferred embodiment, the mRNA is present in the pharmaceutical composition in a form suitable for inhalation in aerosol form. A particularly preferred method for administering the mRNA to the patient's respiratory system is by spraying.

[0070] In a preferred embodiment, the inhalation is a bolus inhalation. This means that during a short period of inhalation, an aerosol containing the active agent is mixed with the inhaled air. When the aerosol containing the active agent is mixed with the air at the start of inhalation, the active agent reaches deeper parts of the lungs along with a first portion of the inhaled air. When the addition of the active agent is stopped at the end of inhalation, the active agent is not deposited in the central part of the lungs, i.e., the airways, at the end of the inhalation. By using bolus inhalation, different regions of the lungs (e.g., the outer or central regions of the lungs) can be better targeted with respect to the deposition of the active agent, depending on the needs of the underlying disease condition.

[0071] The mRNA can be advantageously combined in the pharmaceutical composition with compounds that facilitate the delivery of mRNA to target cells or target tissues and / or compounds that enhance its stability. One possibility in this regard is to form the RNA into nanoparticles together with suitable substances, such as those described in PCT / EP2020 / 053774.

[0072] Examples of preferred agents or reagents for delivering and / or introducing the RNA into target cells or target tissues are, hereby, liposomal transfection reagents (LTRs).

[0073] One particular mode of delivery and / or introduction of the mRNA into target cells or target tissue is transfection. Therefore, it may be assumed that the mRNA used is transfected (into (target) cells or tissue), delivered / administered via transfection, and / or prepared for transfection. Means and methods for transfecting mRNA are known in the art and are described, for example, in Tavernier (op. above), Yamamoto (Eur J Pharm Biopharm. 71(3) (2009), 484-9) and Kormann (Nat Biotechnol. 29(2) (2011), 154-7). Specific modes of transfection include lipofection, magnetic infection, magnetic lipofection, or complex formation with polymers. Therefore, the mRNA used may be prepared for lipofection, prepared to be transfected by lipofection, delivered / introduced via lipofection, and / or administered via lipofection.

[0074] Thus, the pharmaceutical composition may further include at least one lipid or liposome transfection reagent or enhancer (LTR; liposome transfection reagent). The mRNA used may be contained in the LTR, complexed with the LTR, and / or delivered by the LTR. In particular, the mRNA used may be contained in (respective) lipofection complexes comprising the mRNA and the LTR, and / or delivered by. The pharmaceutical composition may further include the lipofection complex.

[0075] LTRs are known in the art and are sold, for example, by OzBiosciences, Marseille, France. For example, such LTRs are lipids or lipidoids, preferably cationic lipids or cationic lipidoids, such as lipidoids as disclosed in PCT / EP2014 / 063756 (e.g., C12-(2-3-2)), lipids as disclosed in EP2285772 (e.g., Dogtor), and lipopolyamines as disclosed in EP1003711 (e.g., DreamFect). TM and DreamFect Gold TM ) and so on. A specific LTR may be selected from the following group. (i) C12-(2-3-2); (ii) DreamFect TM Preferably, DreamFect Gold TM (DF TM / DF-Gold TM ; OzBiosciences, Marseille, France); (iii) Dogtor (OzBiosciences, Marseille, France); and, (iv) Lipofectamines, e.g., Lipofectamine 2000 (Invitrogen, California, USA).

[0076] In principle, Dogtor is preferred, DreamFect TM is more preferred, as well as DF-Gold TM and C12-(2-3-2) are even more preferred LTRs.

[0077] LTRs such as Dogtor are described, for example, in EP2285772. DF TM or DF-Gold TM LTRs such as are described, for example, in EP1003711. In principle, the oligomers, polymers or lipidoids disclosed in PCT / EP2014 / 063756, the specific cationic lipids disclosed in EP2285772, and the specific lipopolyamines disclosed in EP1003711, are preferred LTRs. C12-(2-3-2) and DF-Gold TM LTRs such as are most preferred.

[0078] Non-limiting examples of lipofection complexes are DF-Gold TM / RNA lipoplexes and C12-(2-3-2) / RNA lipoplexes.

[0079] C12-(2-3-2) is a particularly preferred LTR having the structure shown in formula (V) (see Jarzebinska et al., Angew Chem Int Ed Engl., 2016; 55(33):9591-5):

Chemical formula

[0080] C12-(2-3-2) is suitably prepared, for example, as described in WO 2016 / 075154 A1, EP 3013964, and Jarzebinska et al. (Angew Chem Int Ed Engl., 2016;55(33):9591-5). The cationic lipidoid may be prepared by mixing N1-(2-aminoethyl)-N3-(2-((3,4-dimethoxybenzyl)amino)ethyl)propane-1,3-diamine (8.9 g, 1 equivalent, 28.67 mmol) with 1,2-epoxydodecane (42.27 g, 8 equivalents, 229.4 mmol), or by mixing with constant shaking at 80°C for 24 hours, followed by purification to remove the 3,4-dimethoxybenzyl protecting group.

[0081] Various isomers of C12-(2-3-2), such as racemates, S-isomers, and / or R-isomers, may be used. Preferably, C12-(2-3-2) is used as a pure R-isomer, which has the structure shown in formula (VI). To obtain a pure R-isomer of C12-(2-3-2), the R-isomer of 1,2-epxoiddecane can be used in synthesis and prepared as described above for C12-(2-3-2). [ka]

[0082] Accordingly, in a preferred embodiment, the pharmaceutical composition further comprises mRNA encoding IFNλ and a lipidoid having a structure as shown in formula (V), preferably as shown in formula (VI).

[0083] A particularly preferred LTR is a cationic lipidoid having formula (VII), also referred to in this application as "dL_P," which can be synthesized by the reaction of N,N'-bis(2-aminoethyl)-1,3-propanediamine with N-dodecylacrylamide using boric acid as a catalyst. For the reaction, the mixture may be stirred at 100°C under microwave irradiation.

[0084] Accordingly, in a further preferred embodiment, the pharmaceutical composition comprises mRNA encoding IFNλ and further comprises a lipidoid having the structure shown in formula (VII). [ka]

[0085] Furthermore, the pharmaceutical composition comprises a cationic lipidoid having formula (V), (VI), and / or (VII), preferably dL_P and / or C12-(2-3-2), more preferably the R-isomer of dL_P and / or C12-(2-3-2), as contained in the formulation described below. In particular, the agents and reagents described in this application, and the LTRs described in this application, for delivering and / or introducing the RNA into target cells or target tissues, may be combined with one or more (e.g., two, three, or four) further lipids (e.g., cholesterol, DPPC, DOPE, and / or PEG-lipids [e.g., DMPE-PEG, DMG-PEG2000], etc.). These further lipids may support the desired function of the agents / reagents and LTRs (supporting and / or increasing the delivery and / or introduction of RNA into cells or tissues, and improving transfection efficiency, respectively), and may function as “helper lipids.” Specific examples of such “helper lipids” are cholesterol, DPPC, DOPE, and / or PEG-lipids (e.g., DMPE-PEG, DMG-PEG [e.g., DMG-PEG2000]). Further lipids (e.g., “helper lipids”) may also be part of the complexes / particles disclosed in this application. Those skilled in the art will be in a position to easily prepare the complexes / particles according to the present invention. Examples of further lipids (e.g., “helper lipids”) are also known in the art. Those skilled in the art will be in a position to select preferred further lipids (e.g., “helper lipids”), as well as ratios of pharmaceuticals / reagents / LTRs to further lipids (e.g., “helper lipids”). Such ratios may be molar ratios of pharmaceuticals / reagents / LTRs to further lipids(s), such as 1-4:1-5, 3-4:4-6, about 4:about 5, or about 4:about 5.3 (narrower ranges are preferred). For example, the aforementioned drugs / reagents / LTRs may be combined with three further lipids such as DPPC, cholesterol, and DMG-PEG2000 in molar ratios of 8:5.3:4.4:0.9, or more specifically, 8:5.29:4.41:0.88, respectively.

[0086] Preferably, dL_P and / or C12-(2-3-2), more preferably the R-isomer of dL_P and / or C12-(2-3-2), is used together with helper lipids DPPC and cholesterol and PEG-lipid DMG-PEG2000 in a molar ratio of 8:5.29:4.41:0.88 to produce the above-described product and to formulate lipoid particles.

[0087] A composition in which the R-isomer of C12-(2-3-2) (formula VI) is formulated with the lipids DPPC and cholesterol and the PEG-lipid DMG-PEG2000 in a molar ratio of 8:5.29:4.41:0.88 is also referred to as "LF92" in this application. A composition in which the dL_P (formula VII) is formulated with the lipids DPPC and cholesterol and the PEG-lipid DMG-PEG2000 in a molar ratio of 8:5.29:4.41:0.88 is also referred to as "LF111" in this application.

[0088] Furthermore, as described, for example, in WO 2016 / 075154 A1, EP 3013964, and Zhang et al. (TERMIS, 2019, Tissue Engineering: Part A, Vol. 25, Numbers 1 and 2), dL_P and / or C12-(2-3-2) can be used as a non-viral vector to form a stable lipoplex containing the mRNA molecule based on the electrostatic interaction between the positive amino group of the lipidoid and the negative phosphate group of the mRNA molecule (Anderson, Human Gene Therapy 14, 2003, 191-202). To stabilize the lipoplex structure and reduce leakage, dL_P and / or C12-(2-3-2), more preferably the R-isomer of dL_P and / or C12-(2-3-2), may be supplied together with two helper lipids: 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) and cholesterol (Anderson, Drug Delivery 11, 2004, 33-39; Liang, Journal of Colliod and Interface Science 278, 2004, 53-62). Finally, 1,2-dimiristoyl-sn-glycerol, methoxypolyethylene glycol (DMG-PEG) 2kD (DMG-PEG2000) is added to the lipid mixture to obtain PEGylated liposomes. It is already well known that PEGylation improves the physicochemical properties of liposomal formulations by increasing water solubility, protecting against enzymatic degradation, and limiting immunogenic and antigenic reactions (Milla, Current Drug Metabolism 13, 2012, 105-119). The final N / P ratio of the entire ethane lipid mixture is 8:5.29:4.41:0.88, respectively, as the molar ratio of dL_P and / or C12-(2-3-2) amino groups / DPPC / cholesterol / DMG-PEG2000 to one phosphate group of the mRNA molecule.

[0089] Accordingly, in a preferred embodiment, the pharmaceutical composition further comprises mRNA encoding IFNλ and dL_P and / or C12-(2-3-2), preferably an R-isomer of dL_P and / or C12-(2-3-2), formulated together with DPPC, cholesterol, and DMG-PEG2000.

[0090] Furthermore, in a particularly preferred embodiment, the pharmaceutical composition comprises mRNA encoding IFNλ, and further comprises dL_P and / or C12-(2-3-2), preferably an R-isomer of dL_P and / or C12-(2-3-2), formulated with DPPC, cholesterol, and DMG-PEG2000, such that the final N / P ratio of the entire ethane lipid mixture is 8:5.29:4.41:0.88 for one phosphate group of the mRNA molecule, in the molar ratio of dL_P and / or C12-(2-3-2) amino group / DPPC / cholesterol / DMG-PEG2000, respectively.

[0091] As described above, the R-isomer of C12-(2-3-2) formulated with DPPC, cholesterol, and DMG-PEG2000 is also known as the LF92 formulation.

[0092] Therefore, in a particularly preferred embodiment of the pharmaceutical composition containing mRNA encoding IFNλ, the pharmaceutical composition further comprises an LF92 formulation.

[0093] As described above, dL_P, formulated with DPPC, cholesterol, and DMG-PEG2000, is also known as the LF111 formulation.

[0094] Therefore, in another preferred embodiment of the pharmaceutical composition comprising mRNA encoding IFNλ, the pharmaceutical composition further comprises an LF111 formulation.

[0095] When the pharmaceutical composition is administered to a human patient by inhalation, one dose to be inhaled by the patient preferably contains mRNA encoding an IFN-λ polypeptide between 200 μg and 15 mg. Furthermore, as shown in the attached examples, mouse experiments have shown that when administered via inhalation into the lungs, induction of downstream targets of IFNλ (which is an indicator of antiviral activity) can already be achieved with very low levels of IFNλ mRNA. When extrapolating to human patients based on lung weight, the effective amount of IFNλ mRNA is expected to be in the range of 200 μg to 15 mg per dose, preferably between 250 μg and 5 mg per dose, more preferably between 250 μg and 1 mg per dose, and even more preferably between 250 μg and 750 μg per dose.

[0096] The number of doses administered to the target depends on the actual purpose. In the case of acute viral infection, the administration is preferably carried out as follows: - One dose, once (for example, in the case of a mild infection); or, - A dose once every two days for 2, 4, 6, 8, 10, or 14 days; or, - A dose once daily for 2, 3, 4, 5, 6, 7, 8, 9, or 10 days; or, - A dose of twice a day for 2, 3, 4, 5, 6, 7, 8, 9, or 10 days.

[0097] To prevent viral infection, or to prevent virus-induced exacerbation of lung diseases such as asthma or COPD, the above administration should preferably be carried out as follows: - Preferably a dose once per week for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 weeks, preferably 1, 2, 3, 4, 5, 6 or 7 months.

[0098] The present invention also relates to mRNA molecules comprising any one of sequence ID Nos: 13 to 15, 25, 26, or 27.

[0099] Sequence ID Nos: 13 to 15, 25, 26, and 27 each contain a coding region optimized for the codons of IFNλ-1, -2, and -3, IFN α16, IFNβ, and IFNγ, respectively. Furthermore, each of these mRNAs contains the sequence gggagaCGCCACC (Sequence ID No: 7) directly upstream of the start codon, and the sequence 5'-TTCG-3' as the 3'-UTR.

[0100] Preferably, such mRNA further comprises, for example, a poly-A tail of about 200 nucleotides.

[0101] The present invention also relates to DNA molecules containing the sequence shown in any one of SEQ ID NO: 10 to 12 or 22 to 24. SEQ ID NO: 10 indicates a DNA molecule for transcribing an mRNA molecule encoding IFNλ-1. SEQ ID NO: 11 indicates a DNA molecule for transcribing an mRNA molecule encoding IFNλ-2. SEQ ID NO: 12 indicates a DNA molecule for transcribing an mRNA molecule encoding IFNλ-3. SEQ ID NO: 22 indicates a DNA molecule for transcribing an mRNA molecule encoding IFN α16. SEQ ID NO: 23 indicates a DNA molecule for transcribing an mRNA molecule encoding IFNβ. SEQ ID NO: 24 indicates a DNA molecule for transcribing an mRNA molecule encoding IFNγ. [Brief explanation of the drawing]

[0102] [Figure 1]Figure 1 shows the IFNλ1 concentration in the supernatant of cells treated with rec. hIL-29. As shown on the x-axis, supernatants of A-549 cells treated with various doses of rec. hIL-29 were collected and stored at -80°C. On the day of analysis, hIL-29 ELISA was performed according to the kit protocol. TMB was incubated for 15 minutes. For analysis using GraphPad Prism V.8, ΔO.D at 650 nm and 450 nm were used. [Figure 2] Figure 2 shows the concentration of IFNλ1 in the supernatant of cells transfected with IFNλ mRNA. As shown on the x-axis, supernatants of A-549 cells transfected with various doses of hIL-29 encoding mRNA were collected and stored at -80°C. On the day of analysis, hIL-29 ELISA was performed according to the kit protocol. TMB was incubated for 15 minutes. For analysis using GraphPad Prism V.8, ΔO.D at 450 nm and 650 nm was used. [Figure 3] Figure 3 shows target activation at high doses, after treatment or transfection. A549 cells were transfected with 15 ng / well IFN-lambda mRNA and stimulated with 2.9 ng / well human rec. hIL-29. As a control, A549 cells were transfected with 15 ng / well BMP2-Stop encoding mRNA. Cells were collected and lysed at various time points (6, 10, 24, 48, 72, and 120 hours) for real-time PCR analysis. [Figure 4] Figure 4 shows target activation after treatment or transfection at moderate doses. A549 cells were transfected with 4 ng / well IFN-lambda mRNA and stimulated with 0.6 ng / well human rec. hIL-29. As a control, A549 cells were transfected with 4 ng / well BMP2-Stop encoding mRNA. Cells were collected and lysed at various time points (6, 10, 24, 48, 72, and 120 hours) for real-time PCR analysis. [Figure 5]Figure 5 shows target activation at low doses, after treatment or transfection. A549 cells were transfected with 2 ng / well IFN-lambda mRNA and stimulated with 0.3 ng / well human rec. hIL-29. As a control, A549 cells were transfected with 2 ng / well BMP2-Stop encoding mRNA. Cells were collected and lysed at various time points (6, 10, 24, 48, 72, and 120 hours) for real-time PCR analysis. [Figure 6] Figure 6 shows target activation after treatment or transfection at extremely low doses. A549 cells were transfected with 1 ng / well of IFN-lambda mRNA and stimulated with 0.1 ng / well of human rec. hIL-29. As a control, A549 cells were transfected with 1 ng / well of mRNA encoding BMP2-Stop. Cells were collected and lysed at various time points (6, 10, 24, 48, 72, and 120 hours) for real-time PCR analysis. [Figure 7] Figure 7 shows the activation of downstream targets 6 hours after treatment with recombinant IFNλ1 or mRNA encoding IFNλ1, as evaluated by qPCR for IFIT1, IFIT3, OAS3, and ISG15. Downstream target activation is plotted against the measured IFNλ1 level. [Figure 8] Figure 8 shows the following: (a) Downstream signaling of IFNλ1 in A-549 and A-549-ACE2 cells 48 hours after transfection with mRNA at various doses. Similar induction patterns are observed in both cell lines. (b) Downstream signaling of IFNλ1 in A-549 and A-549-ACE2 cells 48 hours after use of recombinant protein. In this case, a higher level of induction is observed in A-549 cells. (c) IFNλ1 expression in A-549-ACE2 cells: When A-549-ACE2 cells were transfected with mRNA encoding IFNλ1, IFNλ1 was produced in a dose-dependent manner after 48 hours. [Figure 9] Figure 9 shows IFNλ1 expression in the supernatant of transfected cells after transfection of immersed cells. Similar expression levels were observed among HEK293, A-549, and FreeStyle 293-F cells. Lower levels were observed in 16HBE14o- cells; untreated wells showed background in ELISA. Peak expression was observed 24 hours post-transfection, and levels remained constant for at least 48 hours post-transfection. In all cell lines except 16HBE14o- cells, transfection doses of less than 4 ng / well were sufficient to reach an effective antiviral IFNλ concentration of 0.3 ng / mL at 6 hours post-transfection. [Figure 10] Figure 10 shows the following: (a) Downstream signaling of IFNλ1 in immersed A-549 cells after transfection with IFN-lambda mRNA. The values ​​shown are normalized to UT (untransfected). Elevations were observed for all target genes, and peak expression occurred 24 hours post-transfection. Very strong target induction was observed even at low mRNA doses. (b) Downstream signaling of IFNλ1 in immersed 16HBE14o- cells after transfection with IFN-lambda mRNA. The values ​​shown are normalized to UT (untransfected). Elevations were observed for all target genes (lower for OAS3), and peak expression occurred 24 hours post-transfection. Overall, weaker target induction was observed compared to A-549 cells. [Figure 11]Figure 11 shows the following: (a) ELISA results for detecting IFNλ1 in ALI cultures after transfection with IFNλ1 mRNA. Values ​​were measured 24 hours after transfection. The total amount of IFNλ1 was measured in the apical and basal outer compartments. IFNλ1 was detected as follows: A-549 > 16HBE14o > Epithelix human primary wt ALI. The maximum basal yield in Epithelix ALI was 500 times lower than that of A-549 ALI. (b) Measurement of downstream target activation in ALI cultures 24 hours after transfection with IFNλ1 mRNA. The highest downstream target activation was observed in A-549 ALI cultures. The values ​​shown are normalized to UT (untransfected). The same activation pattern was observed in all cell lines: ISG15 > IFIT1 ≥ IFIT3 > OAS3. (c) Endogenous levels of downstream targets in untreated 16HBE and Epithelix primary human ALI compared to A-549 ALI. 16HBE14o- and Epithelix primary human ALI have up to 40 times higher baseline endogenous levels of downstream targets than A-549 ALI. [Figure 12]Figure 12 shows the following: (a) Quantification of IFNλ1 mRNA in lung homogenates of treated mice 5 and 24 hours after treatment. IFNλ1 mRNA was detected dose-dependently 5 hours after administration and at very low levels 24 hours after administration. (b) Results of ELISA assays detecting IFNλ1 in lung homogenates and BALF at 5 and 24 hours after administration. IFNλ1 could be measured in lung homogenates and BALF 5 hours after administration. At 24 hours after administration, only low levels of IFNλ1 could be measured. (c) Downstream activation of IFNλ1 in lung homogenates. Demonstrates the functionality of human IFNλ1 mRNA in mice. The values ​​shown are normalized to UT (untreated) mice. The target gene was highly induced 5 hours after administration and still upregulated, although the intensity was more reduced 24 hours after administration. OAS3 is not induced as strongly as other target genes, but induction is higher at 24 hours than at 5 hours. [Figure 13] Figure 13 shows a comparison between hIFNλ1 mRNA transfection and recombinant protein (see also Example 8). [Figure 14] Figure 14 shows the hIFNλ ELISA from the supernatant of transfected A-549 cells: LF92 vs. commercially available transfection reagent (see also Example 9). [Figure 15] Figure 15 shows the induction of target genes by LF92-formulated mRNA (see also Example 10). [Figure 16] Figure 16 shows the in vitro tolerability of the LF92 formulation of the mRNA encoding hIFNλ1 (see also Example 11). [Figure 17] Figure 17 shows the correlation between mRNA translation and the induction of target genes by (a) IFIT1, (b) OAS3, (c) ISG15, and (d) MX1 (see also Example 12). [Figure 18]Figure 18 shows the in vitro inhibition of (a) SARS-CoV-2 and (b) IAV as evaluated by qPCR (see also Example 13). [Figure 19] Figure 19 shows the detection of hIFNλ1 mRNA in lung homogenate (see also Example 14). [Figure 20] Figure 20 shows the detection of the hIFNλ1 protein in lung homogenate (see also Example 15). [Figure 21] Figure 21 shows the activation of target genes (a) IFIT1, (b) IFIT3, (c) ISG15, and (d) OAS3 in lung tissue after administration of hIFNλ1 mRNA (see also Example 16). [Figure 22] Figure 22 shows the detection of chemokines in plasma after a single intranasal administration of hIFNλ1 mRNA (see also Example 17). [Figure 23] Figure 23 shows the activation of target genes (a) IFIT1, (b) IFIT3, (c) ISG15, and (d) OAS3 in lung tissue after treatment with hIFNλ1 mRNA (see also Example 18). [Figure 24] Figure 24 shows the detection of hIFNλ1 mRNA deposited in the lungs after intranasal administration in mice (see also Example 19). [Figure 25] Figure 25 shows body weight during repeated administration of hIFNλ1 mRNA (see also Example 20). [Figure 26] Figure 26 shows the quantification of hIFNλ1 mRNA in ferret lung homogenate (see also Example 21). [Figure 27] Figure 27 shows the activation of the target gene in ferret lung homogenate (see also Example 22). [Figure 28] Figure 28 shows the quantification of IFN mRNA, target gene activation, and cytokine induction in ferret lung homogenate (see also Example 23). [Figure 29]Figure 29 shows that IAV replication is reduced by mRNA encoding IFN (see also Example 24). [Figure 30] Figure 30 shows that the mRNA encoding hIFNλ1 reduces SARS-CoV-2 replication (see also Example 25). [Modes for carrying out the invention]

[0103] Other aspects and advantages of the present invention are described in the following examples (which are provided for illustrative purposes only, not for limitation). Each publication, patent, patent application, or other document referenced herein is incorporated herein by reference in its entirety. [Examples]

[0104] Examples Examples 1 and 2, described below, aimed to evaluate the downstream target activation induced by IFNλ1 treatment in A-549 cells using recombinant protein or mRNA encoding IFNλ1. For this purpose, A549 cells were incubated with recombinant IFNλ1 for 6 hours or transfected with mRNA encoding IFNλ1, and downstream activation of IFIT1, IFIT3, OAS3, and ISG15 was analyzed by qPCR at 6, 10, 24, 48, 72, 120, and 168 hours post-treatment. Furthermore, IFNλ1 levels were measured by hIL-29 ELISA in the cell supernatant at all sample collection times.

[0105] When A-549 cells were treated with recombinant IFNλ1, activation of downstream targets was observed 6 hours after treatment, but rapidly decreased at later points after medium change. IFNλ1-ELISA revealed that approximately 30% of the added protein was recovered in the supernatant 6 hours after treatment. When A-549 cells were transfected with mRNA encoding IFNλ1 and the medium was changed 6 hours after transfection, IFNλ1 could be detected in the supernatant of these cells for up to 168 hours, peaking at 48 hours. Downstream targets were highly induced even with low doses of transfected mRNA and remained upregulated up to 120 hours after mRNA transfection.

[0106] The following abbreviations and definitions are used in the attached examples: [Table 1]

[0107] The following materials and methods were used in the attached embodiment. 1.Material [Table 2]

[0108] [Table 3]

[0109] [Table 4]

[0110] 2. Method 2.1 cell culture A-549 cells were cultured in MEM supplemented with 10% heat-inactivated FBS and 1% P / S at 37°C under a 5% CO2 humidified atmosphere. 24 hours prior to transfection, 20,000 cells / well were seeded into 96-well plates in a total volume of 100 μL.

[0111] 2.2 In vitro transcription To prepare a template for in vitro transcription, the circular plasmid was digested with the restriction enzyme Bsp119I to linearize it, and then purified by chloroform-ethanol precipitation.

[0112] mRNA was produced using a standard in vitro transcription mixture containing T7 RNA polymerase, inorganic pyrophosphatase, and an RNase inhibitor (including the modified triphosphate nucleotides shown). Co-transcription capping was performed by adding an ARCA cap analog. For in vitro transcription of the chemically modified RNA, 25% of cytidine-5'-triphosphate was replaced with 5-methylcytidine-5'-triphosphate, and 25% of uridine-5'-triphosphate was replaced with 2-thiouridine-5'-triphosphate (Jena Biosciences), respectively (see, e.g., Sequence ID No. 1). The remaining template DNA was digested with DNase I. Subsequently, the mRNA was purified by a proprietary tangential flow filtration process (See our Patent).

[0113] The remaining uncapped mRNA was dephosphorylated using phosphatase (Quick CIP), and then purified by a proprietary tangential flow filtration process (See our Patent).

[0114] The mRNA was further polyadenylated using poly(A) polymerase and purified again by a proprietary tangential flow filtration process (see our patent). Finally, the mRNA was filtered using a 0.22 μm membrane. Important quality characteristics such as poly(A) tail length, non-degradation, cap ratio, and modified nucleotide incorporation were measured in subsequent quality control of the mRNA.

[0115] 2.3 Transfection mRNA encoding IFNλ1 (SEQ ID NO: 13) (which was generated as described in section 2.2 above) is treated with lipofectamine. 登録商標 Messenger MAX TM Transfection was performed using a ratio of RNA to lipofectamine of 1:1.5 (w / v). For lipoplex formation, mRNA was diluted with dH2O. 登録商標 Messenger MAX TM The solution was diluted in serum-free medium and mixed by pipetting. After incubation at room temperature for 10 minutes, lipofectamine was added to the RNA solution. 登録商標 Messenger MAX TM The solutions were added, mixed, and incubated at room temperature for a further 5 minutes. Dose titration was performed across a range of mRNA / well from 500 to 0.98 ng. Subsequently, 25 μL of lipoplex solution was added to each well for mRNA / well concentrations of 15.6, 3.9, 1.95, and 0.98 ng.

[0116] 2.4 collect At 6, 10, 24, 48, 72, 120, and 168 hours after transfection, the supernatant was collected and stored in a new 96-well storage plate at -80°C until ELISA. Prior to ELISA, the supernatant was centrifuged at 500 × g for 2 minutes to precipitate cell debris.

[0117] For qPCR, after collecting the supernatant, the cells were washed with 150 μL of D-PBS per well and frozen at -80°C.

[0118] 2.5 IFNλ1 ELISA The IFNλ ELISA protocol was performed as established according to the kit protocol, except that the TMB incubation was shortened to 15 minutes.

[0119] Example 1: Expression of IFNλ1 in the supernatant The presence of IFNλ1 in the supernatant of cells transfected with mRNA or treated with rec. hIL-29 was measured by hIL-29 ELISA. Treatment with recombinant hIL-29 was performed at doses of 2.9, 0.6, 0.3, and 0.1 ng / well. These doses corresponded to 23, 5, 2.5, and 1 ng / mL in the supernatant, respectively. Six hours after treatment, concentrations between 0.3 and 8 ng / mL were quantified in the supernatant by ELISA. 70% of the added protein was consumed or degraded by the cells (see Figure 1).

[0120] In the supernatant of cells transfected with mRNA encoding IFNλ1, it was possible to measure the increase in IFNλ1 concentration for each dose up to 48 hours. From 48 hours to 168 hours, IFNλ1 remained detectable with only a slight decrease (see Figure 2).

[0121] Example 2: Activation of downstream targets The activation of downstream targets after treatment with recombinant IFNλ1 or mRNA encoding IFNλ1 was evaluated by qPCR for IFIT1, IFIT3, OAS3, and ISG15.

[0122] High induction of IFIT1, IFIT3, and ISG15 was observed for all mRNA transfection doses. Depending on the target and dose, induction peaked between 24 and 48 hours. After mRNA transfection, the target genes remained upregulated up to 120 hours (see Figures 3 to 6). For OAS3, induction peaked at 120 hours for all transfection doses.

[0123] Treatment with recombinant protein showed target induction comparable to mRNA transfection within 6 hours post-treatment. After changing the culture medium and removing the protein, downstream activation rapidly decreased at all points after the cells could no longer utilize it (see Figures 3 to 6).

[0124] The activation of downstream targets 6 hours after treatment with recombinant IFNλ1 or IFNλ1-encoding mRNA was evaluated by qPCR for IFIT1, IFIT3, OAS3, and ISG15. Downstream target activation was plotted against measured IFNλ1 levels. Activation of IFIT1, IFIT3, and ISG15 was higher at lower IFNλ1 levels when provided by transfection with IFNλ1 mRNA compared to incubation with recombinant IFNλ1 protein (see Figure 7).

[0125] Summary of Examples 1 and 2 When A-549 cells were transfected with mRNA encoding IFNλ1 and the culture medium was changed 6 hours post-transfection, IFNλ1 peaked in the supernatant of these cells at 48 hours and remained detectable up to 168 hours. Downstream targets were highly induced even with low-dose mRNA transfection and remained upregulated up to 120 hours post-transfection.

[0126] Regarding treatment with recombinant hIL-29, activation of downstream targets was observed 6 hours after treatment and rapidly decreased after medium change.

[0127] The following materials and methods were used in the examples described in the examples: 1 method 1.1 In Vitro 1.1.1 Cell culture 1.1.1.1 Soaked cells HEK293, A-549, and 16HBE14o- cells were cultured in MEM supplemented with 10% heat-inactivated FBS and 1% P / S at 37°C under a 5% CO2 humidified atmosphere. For 16HBE14o- cells, coated flasks were used. FreeStyle 293-F cells were cultured as a suspension in a 125 mL vented Erlenmeyer flask using FreeStyle F17 expression medium. 24 hours prior to transfection, cells were seeded in 96-well plates at the following densities with a total volume of 100 μL: HEK293: 25,000 c / well FreeStyle 293-F: 25,000 c / well 16HBE14o-: 25,000 c / well A-549: 20,000 c / well.

[0128] 1.1.1.2 ALI (Air-Liquid-Interface) culture For ALI cultures of 16HBE14o- and A-549, 6 × 104 Cells were seeded in coated 24-well inserts with immersed cells (80-90% confluency). For 16HBE14o- ALI, the inserts were coated with 50 μg / mL type I collagen diluted in 20 mM acetic acid. Cells were seeded at the apex of 250 μL of 16HBE14o- or A-549 medium. 500 μL of medium was added to the basal side for 16HBE14o-, and 700 μL for A-549. Cells were incubated for 72 hours to adhere to a membrane with medium at both the apical and basal sides. 24 hours before transfection, the basal medium was replaced with fresh medium, and the seeding medium at the apical side was carefully aspirated (air-lift). The cells were maintained as ALI cultures without liquid at the apical side.

[0129] MucilAir TM I purchased the insert from Epithelix and used 700 μL of MucilAir for ALI (Air-Liquid-Interface) culture. TM The cells were cultured in culture medium at 37°C under a 5% CO2 humidified atmosphere. Prior to transfection, the cells were allowed to stand for 2-3 days upon arrival. The culture medium was changed every 2-3 days to maintain the culture.

[0130] 1.1.2 Transfection 1.1.2.1 Immersion culture Lipofectamine (登録商標) Messenger MAX TM mRNA was transfected using a ratio of 1:1.5 (w / v) RNA to lipofectamine. Dose titration was performed in the range of 500 to 0.98 ng mRNA / well. For lipoplex formation, mRNA was diluted in dH2O and lipofectamine was added. (登録商標) Messenger MAX TM The solution was diluted in serum-free medium and mixed by pipetting. After 10 minutes of lipofectamine / MMax incubation at room temperature, the RNA solution was mixed with the lipofectamine solution.(登録商標) Messenger MAX TM The solution was added, mixed, and incubated at room temperature for a further 5 minutes. Then, 25 μL of the desired concentration of Lipoplex solution was added to each well.

[0131] 1.1.2.2 ALI culture Mucus washing was performed before transfection with Epithelix primary human ALI. 200 μL of PBS (w / o Mg / Ca) was added to the apical end and incubated at 27°C for 20 minutes. The total time of apical washing should not exceed 30 minutes. To separate the mucus from the apical surface, 100 μL from the apical liquid was used with a P200 pipette in three in-and-out motions. PBS was removed from the apical surface of the ALI culture by gentle aspiration without damaging the epithelium. To remove trace amounts of PBS, a WFI wash was performed using 200 μL of WFI. 16HBE14o- and A-549 ALI were washed using WFI alone.

[0132] Subsequently, the cells were transfected with mRNA in LNPs at concentrations of 0.1, 0.3, 1, 3, and 6 μg per insert. The preparations were thawed at room temperature and then kept on ice until use. Detailed calculations are shown in Table 1. [Table 5]

[0133] Six hours after transfection, the LNP was aspirated.

[0134] 1.1.3 Recovery 1.1.3.1 Immersion culture At each time point after transfection, the cell supernatant was collected and stored in a new 96-well storage plate at -80°C until ELISA was performed. Prior to ELISA, the supernatant was centrifuged at 500 × g for 2 minutes to precipitate cell debris.

[0135] For qPCR, after collecting the supernatant, the immersed cells were washed with 150 μL of D-PBS per well, and the cell pellet was frozen at -80°C.

[0136] 1.1.3.2 ALI culture Twenty-four hours after transfection, the apical end of the insert was washed with 200 μL of PBS, and the solution was pipetted up and down three times. The washing solution was collected in a 96-well storage plate. Additionally, 200 μL of basal medium was collected in the storage plate. The samples were stored at -80°C until ELISA was performed.

[0137] For qPCR, the culture medium was completely removed from the insert without PBS washing. 175 μL of RLT buffer from the RNease Mini Kit (Qiagen, 74104) was added to the insert, supplemented with DTT (40 μL / mL). The cells were detached from the insert using a mini cell scraper. The RLT buffer was transferred to a QIAshredder column. To ensure all cells were transferred, the insert was washed with another 175 μL of RLT buffer. To complete cell lysis, the column was centrifuged at maximum speed for 2.5 minutes. The cell lysates may be frozen at -80°C or used immediately for RNA isolation.

[0138] 1.1.4 ELISA for IFNλ1 IFNλ ELISA was performed according to the kit instructions (IL-29 Human ELISA Kit, Abcam, ab100568), except that the TMB was incubated for 10 minutes instead of 30 minutes.

[0139] 1.1.5 RNA Isolation 1.1.5.1 Soaked cells For immersed cells, SingleShot TM RNA isolation was performed using a cell lysis kit (BioRad, Art.Nr.: 1725080).

[0140] Single Shot TM The cell lysis buffer was prepared according to Table 2. Preparation was always performed on ice to ensure freshness. The lysis buffer was thoroughly mixed, centrifuged, and used within 2 hours.

[0141] [Table 6]

[0142] 50 μL of lysis buffer for RNA isolation was added to each well of the frozen sample, and incubated at room temperature for 10 minutes without agitation. Samples were processed within 20 minutes. Subsequently, the cell lysates were transferred to PCR plates. Proteins and DNA were digested using the "BioDNA" program under the following conditions (see Table 3): Thermal cycler protocol for cell lysis. [Table 7]

[0143] The cell lysates can be stored on ice for up to 4 hours, at -20°C for up to 2 months, or at -80°C for up to 12 months.

[0144] 1.1.5.2 ALI culture RNA was isolated using the RNeasy mini-kit (Qiagen, 74104) according to the manufacturer's protocol. Elution was performed using 30 μL of RNAse-free solution.

[0145] 1.1.6 cDNA synthesis 1.1.6.1 For soaked cells iScript TM Select cDNA Synthesis Kit (BioRad, Art.Nr.: 1708897) was used. The plate containing the cell lysates was thawed on ice. iScript TMAll kit components except the reverse transcriptase were thawed on ice, thoroughly mixed, and briefly centrifuged. cDNA synthesis was performed using OligodT primers. After adding the components to a 2 mL tube, the iScript reverse transcriptase was added after the other components (see Table 4).

[0146] [Table 8]

[0147] 4 μL of cell lysate was pipetteed into a new PCR plate using a multi-channel pipette, and then 16 μL of master mix was added on top. The plate was sealed with cover foil, gently mixed at 400 rpm, and then briefly spun down. cDNA synthesis was performed using a thermal cycler according to the following protocol ("ISCRIPT2").

[0148] [Table 9]

[0149] cDNA can be stored at -20°C until qPCR is performed.

[0150] 1.1.6.2 ALI culture For cDNA synthesis of ALI cultures, the Transcriptor First Strand cDNA Synthesis Kit (Roche, 4896866001) was used. RNA was converted to cDNA according to the manufacturer's protocol. For a two-step cDNA synthesis, 1 μg of total RNA and 1 μL of oligo(dT) primers were required to prepare the first step, in a total volume of 13 μL. An example of the template-primer mixture preparation is shown in Table 6: [Table 10]

[0151] An optional denaturation step was performed at 65°C for 10 minutes using a thermal block cycler. Then, all reagents except the enzyme, reverse transcriptase, and RNAse inhibitor were thawed on ice and briefly centrifuged. To prepare the master mix, the following components listed in Table 7 were added to a new tube: [Table 11]

[0152] Finally, the enzymes were added to the reagents listed in Table 7. The volume of the master mix was adjusted according to the number of samples. 7 μL of the master mix was added to each tube containing the template-primer mixture, bringing the final volume per tube to 20 μL (see Table 6). The tubes were carefully mixed and centrifuged for a short time. The tubes were returned to the thermal block cycler, and the following program for reverse transcription (here, step 2 of cDNA synthesis) was used: [Table 12]

[0153] cDNA can be stored at -20°C until qPCR is performed.

[0154] 1.1.7 qPCR using TaqMan probes The following components shown in Table 9 were combined and vortexed for a short time. The reaction mix was collected at the bottom of the tube and briefly centrifuged to remove air bubbles. 18 μL of the TaqMan master mix was transferred to an optical 96-well qPCR reaction plate. 2 μL of cDNA template (cDNA and nuclease-free) was added to the optical 96-well qPCR reaction plate as shown in Table 10, until the final volume was 20 μL. The optical 96-well qPCR reaction plate was sealed with optical adhesive film and briefly centrifuged.

[0155] [Table 13]

[0156] [Table 14]

[0157] The TawMan assay was performed using the following parameters: [Table 15]

[0158] [Table 16]

[0159] 1.2 in vivo 1.2.1 Animal Husbandry Mice were housed in individually ventilated cages under a circadian light cycle (light from 7 a.m. to 7 p.m.) and kept under specific pathogen-free conditions (negative facility tests for any pathogens listed in FELASA according to the Annual Health and Hygiene Survey 2017). They had free access to food and water. The animals were acclimatized for at least 7 days after arrival before being tested.

[0160] 1.2.2 Intratracheal administration The animals were anesthetized by inhalation of pure oxygen containing 4% isoflurane (Isothesia, Henry Shine, Germany). Intubation was performed on the unconscious animals using a 20-gauge catheter shortened to 37 mm. A final volume of 50 μL of the test substance was applied as a single drop to the proximal end of the catheter, and then aspirated during the animal's physiological inspiratory movement. Finally, 150 μL of air was added to ensure that no liquid remained in the catheter.

[0161] 1.2.3 Clinical Tests Animals were clinically examined using a clinical mouse scoring system before and 24 hours after administration of the test substance. The clinical examination consisted of four different categories, which were scored separately. The scores for each of the four categories were combined into a total clinical score. If the combined score exceeded 4 points, or if the score in a single category exceeded 1 point, it was considered moderate distress and thus used as the human endpoint.

[0162] 1.2.4 Autopsy Animals were subjected to total anesthesia by intraperitoneal injection of fentanyl / midazolam / medetomidine (0.05 / 5.0 / 0.5 mg / kg body weight). Subsequently, the mice were euthanized by cervical dislocation.

[0163] 1.2.5 Removal of BALF and lung The thoracic and abdominal cavities were opened, and an 18G catheter was placed in the trachea. 0.5 mL of PBS was injected and collected from the lung, then centrifuged at 300 × g for 10 minutes at 4°C. The supernatant was collected and stored at -80°C until further processing. The cell pellet was biobanked at -80°C. Next, the lung was explanted and stored at -80°C until further processing.

[0164] 1.2.6 Homogenization of the lungs The sample was homogenized using liquid nitrogen. Therefore, the organ was placed in a mortar and pestle in an icebox. Liquid nitrogen was added to a volume that completely covered the lung. The lung was crushed using a pestle in the mortar. The stapula was immersed in nitrogen and used to divide the organ powder into two halves. Both halves were weighed in empty, tare-filled tubes. The mortar, pestle, and stapula were washed with ethanol after each sample.

[0165] For ELISA, the cells were lysed in 250 μL of Triton X-100 lysis buffer (0.25 M triethanolamine, 0.1% Triton X-100, pH 7.7), and a protease inhibitor was added as a supplement. For qPCR, the cells were lysed in 350 μL of lysis buffer per 30 mg of organ. The lysis buffer RLT was provided in the kit, and 40 μL / mL of DTT was added as a supplement. For qPCR, further homogenization was performed in the lysis tube. Therefore, the procedure was carried out in a tissue homogenizer (MP FastPrep-24 Tissue and Cell Homogenizer) for 3 × 20 seconds with the volumes as described above.

[0166] The samples were incubated on ice for 10 minutes and then centrifuged at maximum speed for 10 minutes at 4°C in a Mikro 22R centrifuge (Hettich Zentrifugen). The supernatant was transferred to a new tube and stored at -80°C until further analysis.

[0167] 1.2.7 Cell lysis and cDNA synthesis for qPCR NucleoSpin (登録商標) RNA isolation was performed using an RNA kit (Macherey & Nagel, 740984.50) according to the manufacturer's protocol.

[0168] cDNA synthesis was performed using the Transcriptor First Strand cDNA Synthesis Kit (Roche, 4896866001). RNA was converted to cDNA according to the manufacturer's protocol. For a two-step cDNA synthesis, 1 μg of total RNA and 1 μL of oligo(dT) primers were required to prepare the first step, totaling 13 μL. An example of preparing the template-primer mixture is shown in Table 11: [Table 17]

[0169] A denaturation step was performed at 65°C for 10 minutes using a thermoblock cycler. Then, all reagents except the enzyme, reverse transcriptase, and RNAse inhibitor were thawed on ice and briefly centrifuged. To prepare the master mix, the following components listed in Table 12 were added to a new tube: [Table 18]

[0170] Finally, the enzymes were added to the reagents listed in Table 12. The volume of the master mix was adjusted according to the number of samples. 7 μL of the master mix was added to each tube containing the template-primer mixture, bringing the final volume per tube to 20 μL. The tubes were carefully mixed and centrifuged for a short time. The tubes were returned to the thermoblock cycler, and the following program for reverse transcription was started: [Table 19]

[0171] cDNA can be stored at -20°C until qPCR is performed.

[0172] 1.2.8 Real-time PCR using TaqMan probes for downstream targets; see 1.1.7. [Table 20]

[0173] 1.2.9 SNIM (登録商標) qPCR using UPL for RNA quantification qPCR was performed to quantify ETH061T02 SNIM RNA in mouse lung. Therefore, 1 μg of IFNλ1 SNIM RNA was used for cDNA synthesis, which was carried out as described in Section 1.1.6. The IFNλ1 mRNA cDNA was diluted in RNAse-free water to obtain the following dilution: 1:10 1 , 1:10 2 , 1:10 3 , 1:10 4 , 1:10 5 , 1:10 6 Calibration curves were obtained. To avoid inaccuracies during pipetting, it is important to prepare cDNA dilution series in larger volumes (e.g., 20 μL). Mix 0.25 μL of mouse lung sample cDNA or each calibration curve sample with 3.75 μL of RNAse-free solution and use LightCycler (登録商標) The mixture was pipetted into a 480 Multiwell Plate 96. The qPCR master mix was prepared according to Table 13.

[0174] [Table 21]

[0175] The aforementioned master mix is ​​then prepared using a multi-pipette in LightCycler. (登録商標) A 480 Multiwell Plate 96 was prepared by adding 4 μL of diluted cDNA sample or standard to each well. The plate was then processed using LightCycler. (登録商標) It was covered with 480 sealing foil and spun down for a short time. LightCyler (登録商標) qPCR was performed using a program for UniversalProbes on the 96 system.

[0176] Example 3: Efficacy of IFNλ1-encoding mRNA compared to recombinant IFNλ1 in A-549 cells expressing ACE2. The activation of downstream targets 48 hours after treatment of A549 or A549-ACE2 cells with recombinant IFNλ1 (Figure 8a) or IFNλ1-encoding mRNA (Figure 8b) was evaluated by qPCR for IFIT1, IFIT3, OAS3, and ISG15. Transfection with IFNλ1-encoding mRNA similarly induced IFIT1, IFIT3, OAS3, and ISG15, but after treatment with recombinant IFNλ1, the induction of the same downstream targets was reduced in A549-ACE2 cells compared to A459 cells. Transfection of A549-ACE2 cells with IFNλ1-encoding mRNA resulted in dose-dependent production of IFNλ1 (Figure 8c).

[0177] Example 4: mRNA encoding IFNλ1 is translated in various cell types. Transfection with mRNA encoding IFNλ1 results in time-dependent and dose-dependent production of IFNλ1 in HEK293, A549, 16HBE14o-, and FreeStyle 293-F cells, as measured by IFNλ1 ELISA (Figure 9).

[0178] Example 5: Time-dependent and dose-dependent induction of downstream targets in immersion cultured A549 and 16HBE14o- cells after transfection with mRNA encoding IFNλ1. Transfection with mRNA encoding IFNλ1 resulted in time-dependent and dose-dependent induction of IFIT1, IFIT3, OAS3, and ISG15, as evaluated by qPCR (Figures 10a and b).

[0179] Example 6: Dose-dependent production of IFNλ1 and induction of downstream targets in airway liquid interface (ALI) cultures derived from A549, 16HBE14o-, or primary human lung cells (Epithelix). Transfection with mRNA encoding formulated with IFNλ1 in LF92 resulted in dose-dependent production of IFNλ1 (Figure 11a) and induction of IFIT1, IFIT3, OAS3, and ISG15 (Figure 11b), as assessed by qPCR 24 hours post-treatment. Endogenous levels of IFIT1, IFIT3, OAS3, and ISG15 were elevated in ALI cultures derived from 16HBE14o- or primary human lung cells compared to ALI cultures derived from A459- (Figure 11c).

[0180] Example 7: Dose-dependent production of IFNλ1 and induction of downstream targets in the lungs of mice sprayed with mRNA encoding IFNλ1. Transfection with mRNA encoding IFNλ1 formulated in LF92 results in dose-dependent and time-dependent deposition of IFNλ1 mRNA in the lung (Figure 12a), production of IFNλ1 in lung tissue and bronchoalveolar lavage fluid (BALF) (Figure 12b), and induction of IFIT1, IFIT3, OAS3, and ISG15 (Figure 12c), as evaluated by qPCR at 5 and 24 hours post-treatment.

[0181] Example 8: Comparison of hIFNλ1 mRNA transfection with recombinant protein The enhancement of target gene activation after single apical transfection of primary bronchial epithelial gas-liquid interface (ALI) cultures using mRNA encoding hIFNλ1 was compared with apical treatment using recombinant protein. Because the receptor is expressed basolaterally, inhalation (apical) administration of hIFNλ1-encoding mRNA is expected to be more effective in humans than inhalation administration of recombinant protein, as it leads to greater basal secretion of type III IFN than apical secretion.

[0182] Transfection using hIFNλ1 mRNA resulted in a total protein content of 30-40 pg in the apical compartment at 24 hours post-transfection when the transfection mixture was aspirated 6 hours after transfection (Figure 13a). This corresponds to a concentration of 90 ng / mL in airway surface lining fluid (ASL) (the volume of ASL in the ALI culture is 0.33 μL (the surface area of ​​the insert is 0.33 cm²)). 2 (Assuming the ciliary layer height is 0.001 cm). For this reason, activation of the target gene after transfection was compared with treatment with 100 ng / mL of recombinant protein.

[0183] After apical mRNA transfection, target gene expression was four times higher compared to the Stop mRNA control (Figure 13b). In contrast, after administration of recombinant hIFNλ1 protein at a concentration of 100 ng / mL to the apical side, induction of the target gene was lower compared to mRNA transfection and did not exceed twice the induction compared to the Stop mRNA control (Figure 13b). This effect may be due to longer exposure to hIFNλ after mRNA transfection (mRNA translation continues after a 6-hour medium change), and therefore may accumulate compared to treatment with recombinant protein, potentially leading to higher protein levels in the apical and basal compartments. These observations highlight the potential additional PK / PD benefits of mRNA treatment compared to treatment with recombinant protein (Figure 13).

[0184] Example 9: hIFNλ ELISA from the supernatant of transfected A-549 cells: LF92 vs. commercially available transfection reagent At 6 and 24 hours post-transfection, the culture medium was changed in each plate that had not been collected at these points. Therefore, the 24-hour point reflects the translation between 6 and 24 hours, and the 48 and 72-hour points reflect the translation at 24 hours. Post-mRNA transfection translation occurred in a dose-dependent and time-dependent manner, and to a similar extent to that when using commercially available transfection reagents, using LF92-formulated mRNA (Figure 14).

[0185] Example 10: Induction of target gene by LF92 formulation mRNA At 6 and 24 hours post-transfection, the culture medium was changed in each plate that had not been collected at these times. Therefore, the 24-hour time point reflects translation between 6 and 24 hours, and the 48 and 72-hour time points reflect translation at 24 hours post-transfection. Dose-dependent and sustained activation of the hIFNλ1 target gene was observed after single transfection of A549 lung cells with LF92-formulated hIFNλ1-encoding mRNA (Figure 15).

[0186] Example 11: In vitro tolerability of LF92 formulation of mRNA encoding hIFNλ1 At 6 and 24 hours after transfection, the medium was changed for each plate that had not been harvested at these time points. Thus, the 24-hour time point reflects translation between 6 and 24 hours, and the 48- and 72-hour time points reflect translation after 24 hours. Induction of cytokine mRNA expression after single transfection of A549 lung cells with mRNA encoding LF92-formulated hIFNλ1 was observed only at high doses where induction of the target gene reached a plateau (Figure 16).

[0187] Example 12: Correlation between mRNA translation and target gene induction At 6 and 24 hours after transfection, the medium was changed for each plate that had not been harvested at these time points. Thus, the 24-hour time point reflects translation between 6 and 24 hours, and the 48- and 72-hour time points reflect translation after 24 hours. The amount of hIFNλ1 measured in the supernatant correlates with the degree of induction of the target gene (Figure 17).

[0188] Example 13: In vitro virus suppression evaluated by qPCR. Pre-treatment with hIFNλ1 mRNA reduced the amounts of SARS-CoV-2 and IAV viruses, but not with Stop mRNA (Figure 18). A dose-dependent reduction in virus amount by recombinant hIFNλ1 was observed, but the reduction was lower with the recombinant protein compared to mRNA treatment (Figure 18). Treatment was performed 24 hours before infection. Samples were taken 48 hours after infection.

[0189] Example 14: Detection of hIFNλ1 mRNA in lung homogenate Dose-dependent deposition of mRNA encoding human IFNλ1 was observed 5 hours after single intranasal administration in mice (Figure 19). Three animals per group were evaluated.

[0190] Example 15: Detection of hIFNλ1 protein in lung homogenate Quantification of human IFNλ1 in lung homogenates revealed that single intranasal treatment with mRNA encoding the human IFNλ1 protein resulted in dose-dependent and time-dependent protein translation (Figure 20). Three animals were evaluated for each group.

[0191] Example 16: Activation of target gene in lung tissue after administration of hIFNλ1 mRNA. In mice, administration of hIFNλ1 mRNA, at low doses, was well-tolerated after a single intranasal dose and strongly induced the expression of target genes in the lungs (Figure 21).

[0192] The analyzed target genes OAS3, ISG15, IFIT1, and IFIT3 showed dose-dependent activation at all dose levels at 5 hours (Figure 21). Only OAS3 showed dose-dependent activation up to 24 hours post-administration (Figure 21d). Three animals were evaluated for each group.

[0193] Example 17: Detection of chemokines in plasma after a single intranasal administration of hIFNλ1 mRNA. After a single intranasal administration of mRNA or STOP mRNA encoding hIFNλ1, the measured plasma concentrations of the chemokine remained unchanged compared to the medium at all dose levels in mice (Figure 22). Three animals were evaluated for each group.

[0194] Example 18: Activation of target gene in lung tissue after treatment with hIFNλ1 mRNA. LF92-formulated hIFNλ mRNA was well-tolerated at low doses in mice after multiple intranasal administrations and strongly induced the expression of target genes in the lungs (Figure 23).

[0195] Three doses were administered at 48-hour intervals, and samples were collected 24 hours after the last dose. Expression of hIFNλ target genes in lung homogenates increased in a dose-dependent manner (Figure 23). For all target genes analyzed, up to 15-fold activation was observed at the dose level of 1 μg of hIFNλ mRNA (Figure 23). The absence of target gene activation in the STOP and media groups suggests that the observed effect is target-inducible (Figure 23). Six animals were evaluated in each group.

[0196] Example 19: Detection of hIFNλ1 mRNA deposited in the lungs after intranasal administration in mice. Three doses were administered at 48-hour intervals, and samples were collected 24 hours after the last dose. Dose-dependent deposition of mRNA encoding human IFNλ1 was observed (Figure 24). Six animals were evaluated from each group.

[0197] Example 20: Body weight during repeated administration of hIFNλ1 mRNA The drug was administered to mice via nasal infusion in three doses at 48-hour intervals, and body weight was measured daily. Changes in body weight were not recorded (Figure 25). Six animals were evaluated in each group.

[0198] Example 21: Quantification of hIFNλ1 mRNA in ferret lung homogenate hIFNλ1 mRNA was deposited into all lung lobes after a single intranasal administration to ferrets (Figure 26). Three animals were evaluated from each group.

[0199] Example 22: Activation of target gene in ferret lung homogenate hIFNλ1 treatment induces ISG15, MX1, and OAS3 in ferrets after a single intranasal administration (Figure 27). Three animals were evaluated for each group.

[0200] Example 23: Quantification of IFN mRNA, target gene activation, and cytokine induction in ferret lung homogenate. When mRNA encoding hIFNλ1, hIFNβ, or both is administered nasally once, deposition of the mRNA was achieved in all lung lobes (Figure 28). Mx-1 was induced by all three treatments, but none of the cytokines analyzed were induced (Figure 28). Three animals per group were evaluated.

[0201] Example 24: Reduction of IAV replication by mRNA encoding IFNs In the ferret influenza model, intranasal administration of mRNA encoding hIFNλ1 (Figure 29a), hIFNβ (Figure 29b), or both (Figure 29c) was well tolerated and reduced early viral replication and clinical symptoms (Figure 29). Treatments were performed on test days -1, 1, and 3, and infection was performed on day 0. Ten animals per group were evaluated.

[0202] Example 25: Reduction of SARS-CoV-2 replication by mRNA encoding hIFNλ1 Intranasal administration of mRNA encoding hIFNλ1 was well tolerated in hACE2-TG mice challenged with SARS-CoV-2 alpha and reduced viral replication and weight loss compared to mice treated with vehicle (Figure 30). Genomic viral RNA was measured by RT-qPCR (60% decrease compared to vehicle) (Figure 30a), and infectious virus particles were measured using the 50 TCID method (97% decrease compared to vehicle) (Figure 30b) to evaluate viral replication. Body weight was shown as the percent weight change on day 3 after virus inoculation (Figure 30c). Two to five animals per group were evaluated. The following controls were used: mock-treated mice, mice treated with hIFNλ1 mRNA instead of virus, and mice treated with vehicle instead of virus.

[0203] [[ID=十七]] In Examples 8 to 25, the following materials were used.

[0204] 2.1 Materials [Table 22-1] [Table 22-2]

[0205] [Table 23]

[0206] 2.2 Method 2.2.1 Cell culture 2.2.1.1 ALI culture MucilAir TM I purchased the insert from Epithelix and used 700 μL of MucilAir for air-liquid-interface (ALI) culture. TM Cells were cultured in culture medium at 37°C under a 5% CO2 humidified atmosphere. Prior to transfection, the cells were allowed to stand for 2-3 days upon arrival. The culture medium was changed every 2-3 days to maintain the culture.

[0207] 2.2.1.2 A-549 cell culture A-549 cells were cultured as described in 2.1 above.

[0208] 2.2.1.3 A549-ACE2 cell culture A549-ACE2 cells were cultured in DMEM supplemented with 10% FBS, 100 μg / mL streptomycin, and 100 IU / mL penicillin. 10,000 cells were seeded into 96-well plates to a total volume of 100 μL for 24 hours, followed by treatment.

[0209] 2.2.2 Transfection / Treatment Mucus washing was performed before transfection. Therefore, 200 μL of PBS (w / o Mg / Ca) was added to the apical end and incubated at 37°C for 20 minutes. The total time of apical washing should not exceed 30 minutes. To separate the mucus from the apical surface, 100 μL from the apical liquid was used with a P200 pipette in three in-and-out motions. The PBS from the apical surface of the ALI culture was gently aspirated and removed without damaging the epithelium. To remove trace amounts of PBS, a WFI wash was performed using 200 μL of WFI.

[0210] Subsequently, the cells were transfected / treated with the desired dose. The preparation was thawed at room temperature and kept on ice until further use. The recombinant protein was diluted in the culture medium.

[0211] Six hours after transfection, mRNA and recombinant protein were removed from the apical end. For the recombinant protein, the basal medium was also replaced. Twenty-four hours after transfection, the apical end of the insert was washed with 200 μL of PBS and pipetted three times up and down. The washing solution was collected in a 96-well storage plate for ELISA analysis. Additionally, 200 μL of basal medium was collected in the storage plate. The samples were stored at -80°C until ELISA.

[0212] For qPCR, 175 μL of RLT buffer from the RNeasy Mini Kit was added to the insert, supplemented with DTT (40 μL / mL). The cells were detached from the insert using a mini cell scraper. The RLT buffer was transferred to a QIAshredder column. To ensure all cells were transferred, the insert was washed with another 175 μL of RLT buffer. To complete cell lysis, the column was centrifuged at maximum speed for 2.5 minutes. The column was removed, and the cell lysates in the tube may be frozen at -80°C or used immediately to isolate RNA.

[0213] 2.2.2.1 Transfection using lipofectamine MMax in Examples 9 to 12 Transfection with lipofectamine MMax was performed as described in 2.3 above, except that dose titration was performed in the range of 0.005 to 100 ng mRNA / well. Subsequently, 25 μL of Lipoplex solution was added to each well, and the medium was replaced with 100 μL of fresh complete medium.

[0214] 2.2.2.2 Transfection using lipofectamine MMax in Example 13 Transfection with lipofectamine MMax was performed as described in 2.3 above, except that dose titration was performed in the range from 15 ng / 25 μL to the desired concentration. The cell medium was replaced with 100 μL of fresh medium.

[0215] Subsequently, 25 μL of Lipoplex solution was added to each well.

[0216] For treatment with recombinant protein, the protein was pre-diluted in culture medium to the desired concentration of 25 μL and added to the cells.

[0217] 2.2.2.3 Transfection using LF92-formulated mRNA LF92-formulated mRNA was diluted to the desired concentration in a medium (10% (w / v) sucrose, 50 mM sodium chloride, and a proprietary excipient). 25 μL of each dilution was added to each well, and the medium was replaced with 100 μL of fresh complete medium.

[0218] 2.2.3 RNA Isolation RNA isolation was performed as described in 1.1.5.2 above.

[0219] 2.2.4 cDNA synthesis cDNA synthesis was carried out as described in 1.1.6 above.

[0220] 2.2.5 qPCR using TaqMan probes qPCR using a TaqMan probe was performed as described in 1.1.7 above. The qPCR results were analyzed using the ΔΔCt method. To do this, first, the ΔCt of each sample was calculated. This was done by subtracting the average Ct value of the housekeeper (RPLP0) from the Ct value of the target sample. Next, ΔΔCt was calculated by subtracting the ΔCt of the reference sample (medium control) from the ΔCt of the target sample. Finally, the multiplicative change was calculated using Equation 2. -ΔΔCt I used this to perform the calculation.

[0221] 2.2.6 hIFNλ1 ELISA (IL-29 ELISA) The hIFNλ1 ELISA was performed as described in 1.1.4 above. Interpolation was performed using the 4PL standard curve. Analysis was performed using GraphPad Prism software and Excel.

[0222] 2.2.7 Recovery Plates were collected at 3, 6, 24, 48, and 72 hours after transfection. The culture medium was changed at 6 and 24 hours after transfection for each plate.

[0223] For ELISA, the supernatant of the cells was collected in a 96-well storage plate and frozen at -80°C. When performing two different ELISAs, the supernatant was divided into two plates so that they could be thawed separately. For qPCR, the cells were placed in 150 μL of PBS. - / - Wash the cells using [a specific method] and freeze them without a solution at -80°C.

[0224] 2.2.8 SingleShot TM RNA isolation using a Cell Lysis Kit Single Shot TMRNA isolation using the Cell Lysis Kit was performed as described in 2.2.5.

[0225] 2.2.9 Preparation of virus stock SARS-CoV-2-MUC-IMB-1, SARS-CoV-2-GFP strain, wild-type influenza A virus (IAV-WT)(SC35M), and IAV(SC35M)NS1-GFP were produced by infecting Vero E6 cells cultured for 2 days in DMEM medium (10% FCS, 100 μg / ml streptomycin, 100 IU / ml penicillin) (MOI 0.01). The virus stocks were collected and centrifuged twice (1000 g / 10 min) before storage at -80°C.

[0226] The titer of the viral stock was determined by plaque assay. For this purpose, a confluent monolayer of Vero E6 cells was infected with a 5-fold series of dilutions of viral supernatant at 37°C for 1 hour. The inoculum was removed and replaced with serum-free MEM containing 0.5% carboxymethylcellulose. On post-infection day 2, formaldehyde was added directly to the culture medium to a final concentration of 5%, and the cells were fixed at room temperature for 20 minutes.

[0227] After thoroughly washing the fixed cells with PBS, they were stained with H2O containing 1% crystal violet and 10% ethanol for 20 minutes. After rinsing with PBS, the number of plaques was counted and the viral titer was calculated.

[0228] 2.2.10 Viral Infection Cells were transfected and then infected with SARS-CoV-2 (MOI 3) or IAV (MOI 0.5) for 24 hours. The viruses were added directly to the cell cultures as 25 μL of medium. SARS-CoV-2-GFP and IAVGFP were used to analyze the infection dynamics under a live imaging system.

[0229] 2.2.11 Cell Monitoring with IncuCyte After infection, plates were placed in the IncuCyte S3 Live-Cell analysis system, and full-well, real-time images of mock (phase channel) and infected (GFP and phase channel) cells were acquired every 4 hours for 48 hours. Cell viability (mock) and viral replication (mock and infected) were evaluated using IncuCyte S3 Software (Essen Bioscience; version 2019B Rev2) as well-well cell confluence (phase region) and well-well normalized integrated GFP intensity (integrated GFP intensity / phase region), respectively.

[0230] 2.2.12 qPCR for SARS-CoV-2 and IAV mRNA PowerUp SYBR Green was used to relatively quantify the transfers. All steps were performed according to the manufacturer's instructions. RPLP0 was used as the housekeeper.

[0231] 2.2.13 Animal housing All animals were cared for as described in 1.2.1 above. All procedures were approved by the local animal welfare authority (Regierung von Oberbayern) as file number Az.2532.Vet_03-17-114 and carried out in accordance with the German Animal Protection Act (Tierschutzgesetz).

[0232] 2.2.14 Nasal administration in Examples 14 to 17 The animals were anesthetized by inhaling pure oxygen supplemented with approximately 4% isoflurane, an anesthetic gas, in an inhalation chamber at a flow rate of 2 L / min. hIFNλ1 mRNA was administered into both nostrils using a laboratory pipette in two 25 μL boluses, so that the animals would actively inhale the liquid through their noses during physiological inspiratory movements. The animals were held in an upright position during this procedure and then placed in a supine position until they recovered from anesthesia.

[0233] 2.2.15 Clinical Tests in Examples 14 to 17 Clinical examinations were performed as described in 1.2.3 above, except that clinical examinations were performed on the animals before the procedure, 5 hours after the procedure, and daily until the day of necropsy. Furthermore, body weight was measured before administration and daily until the end of this experiment.

[0234] 2.2.16 Autopsy Autopsy was scheduled at 5, 24, or 48 hours after administration, respectively. In A01, an additional 72-hour interval was added for necropsy. In A02, in group 2, necropsies were further performed at 72 and 96 hours after administration of hIFNλ1 mRNA. Animals were put under total anesthesia by intraperitoneal injection of fentanyl / midazolam / medetomidine (0.05 / 5.0 / 0.5 mg / kg body weight). Capillary blood was collected from the retrobulbar venous plexus behind the eyeball using an unheparinized 0.8 mm capillary tube and collected in an EDTA tube. The blood samples were centrifuged at 2,000 × g for 5 minutes at 4°C. The mice were then euthanized by cervical dislocation.

[0235] The thoracic and abdominal cavities were opened, the lungs were explanted as a whole without rinsing, rapidly frozen on dry ice, and stored at -80°C until further processing was required.

[0236] 2.2.17 Lung homogenization 2.2.17.1 The sample was homogenized using liquid nitrogen. Therefore, the organ was placed in a mortar placed in an icebox. Liquid nitrogen was added in a volume that completely covered the lung. The lung was crushed using a pestle in the mortar. The organ was kept reliably covered with liquid nitrogen at all times. The stapula was immersed in nitrogen and used to divide the organ powder into three parts. Each part of the organ powder was weighed in an empty, tare-filled Eppendorf tube. Approximately 5 mg of the powder was taken for the bDNA assay, and the remaining powder was divided into two halves (one for ELISA and one for qPCR). The weight of each organ was recorded.

[0237] The mortar, pestle, and stapler were washed with ethanol after each sample.

[0238] 2.2.17.2 For ELISA, lysis was performed in Triton X-100 lysis buffer (0.25 M triethanolamine, 0.1% Triton X-100, pH 7.7). Dissolution was performed on ice for at least 10 minutes. After each sixth sample, the lysate was centrifuged at 14000 rpm for 10 minutes. The supernatant was collected in a new tube and stored at -80°C until further processing.

[0239] 2.2.17.3 For qPCR, 600 μL of lysis buffer was added to the tube containing the organ powder. The lysis buffer RLT was provided with the kit, and 40 μL / mL of DTT was added as a supplement. The solution was then transferred to a Lysing Matrix D tube and homogenized in a tissue homogenizer for 3 × 20 seconds. The lysate was transferred to a new Eppendorf tube. The volume of homogenate corresponding to 10 mg of lung was calculated, transferred to a new Eppendorf tube, and mixed with lysis buffer to a final volume of 350 μL. These samples were used directly to isolate RNA without freezing. The remaining lung homogenate was stored at -80°C.

[0240] 2.2.18 RNA isolation and cDNA synthesis for qPCR in Examples 14 to 17 and 18 to 20 RNA isolation from lung lysates was performed using 10 mg of lysed lung homogenate and the Qiagen RNeasy mini-kit, according to the manufacturer's protocol.

[0241] cDNA synthesis was performed as described in 1.1.6.1 above. For 2-step cDNA synthesis, the first step (referred to here as the template primer mixture) was prepared using 1 μg of total RNA and 1 μL of OligoDT primer in a total volume of 13 μL.

[0242] 2.2.19 Creation of a calibration curve for quantifying hIFNλ1 mRNA A calibration curve is necessary to accurately determine the amount of human IFNλ1 encoding mRNA in the sample. Therefore, 1 μg of hIFNλ1 mRNA was reverse transcribed. Then, serial dilutions of the cDNA were performed in nuclease-free water at the following dilutions: 1:10 1 , 1:10 2 , 1:10 3 , 1:10 4 , 1:10 5 , 1:10 6 , 1:10 7 The dilution was prepared independently. This was, for example, 1:10 2 The diluted solution was used in the assay at a 1:10 ratio. 1 Not from the dilution, but from a separate 1:10 1 The solutions were prepared from dilutions. 2 μL of each dilution was added to 8 μL of the master mix, and qPCR was performed.

[0243] 2.2.20 qPCR using UPL probes To quantify the mRNA encoding human IFNλ1, including calibration curves, probes from the Universal Probe Library (UPL) were used.

[0244] The following components shown in Table 14 were combined and vortexed for a short time. The reaction mixture was collected at the bottom of the tube, and the mixture was centrifuged briefly at 3200 g for 2 minutes to remove air bubbles.

[0245] 8 μL of TaqMan master mix was transferred to an optical 96-well qPCR reaction plate. 2 μL of cDNA template was added to the optical 96-well qPCR reaction plate to a final volume of 10 μL. The optical 96-well qPCR reaction plate was sealed with an optical adhesive film and centrifuged briefly at 3200 g for 2 minutes.

[0246] I selected the execution mode "new experiment based on Roche Template" and then selected "HydrolysisProbes" in LightCycler96.

[0247] [Table 24]

[0248] 2.2.21 Calculation of hIFNλ1 mRNA quantity The amount of mRNA encoding human IFNλ1 in a sample can be determined using the calibration curve. The calibration curve was created by placing log(amount of hIFNλ1 mRNA) on the x-axis and the ct value on the y-axis.

[0249] Exemplary equation from the calibration curve Y = -3,2449X + 9,1445 Next, the amount of IFNλ1 mRNA in the sample (X: log of concentration) was measured (Y: ct value of the sample).

[0250] [Table 25]

[0251] 2.2.22 ELISA for CXCL9 and CXCL10 in plasma The plasma samples for this study were measured according to the manufacturer's instructions. Changes to that protocol are shown in Table 16.

[0252] [Table 26]

[0253] 2.2.23 ELISA for CXCL9 and CXCL11 in lung homogenates Lung homogenates from this study were measured according to the manufacturer's instructions. Changes to the protocol are shown in Table 17.

[0254] [Table 27]

[0255] 2.2.24 Intranasal administration in Examples 18 to 20 The animals were anesthetized by inhaling pure oxygen supplemented with approximately 3% isoflurane, an anesthetic gas, in an inhalation chamber at a flow rate of 2 L / min. One drop of hIFNλ1 mRNA in a volume of 50 μL was placed at the tip of the nose, and then actively inhaled through both nostrils during physiological inspiratory movements. The animals were held in an upright position during this procedure and then placed in a supine position until they recovered from anesthesia. The procedure was performed for a total of three drug administrations, every other day. A necropsy was performed 24 hours after the last administration.

[0256] 2.2.25 Clinical Tests in Examples 18 to 20 Clinical examinations were performed as described in 1.2.3 (above), except that clinical examinations were performed on the animals before the first treatment, 3 hours after the first treatment, and daily thereafter until the day of necropsy. In addition, body weight was measured before administration and daily until the end of this experiment.

[0257] 2.2.26 Autopsy in Examples 18 to 20 Animals were completely anesthetized by intraperitoneal injection of fentanyl / midazolam / medetomidine (0.05 / 5.0 / 0.5 mg / kg body weight). Capillary blood was collected from the retrobulbar venous plexus behind the eyeball using an unheparinized 0.8 mm capillary tube and collected in an EDTA tube. The mice were then euthanized by cervical dislocation. The thoracic and abdominal cavities were opened, and the lungs were explanted as a whole without irrigation.

[0258] The right main bronchus was ligated, the right lung was explanted, rapidly frozen on dry ice, and stored at -80°C until further processing. 0.4 mL of fixative (4% paraformaldehyde solution) was blown into the left lung through the trachea. Subsequently, the left bronchus was ligated, and the left lung, including the trachea from which the fixative was blown, was transferred to the 4% paraformaldehyde solution for diffusion fixation for approximately 24 hours. After the fixation time, the lung sample was transferred to 70% ethanol.

[0259] 2.2.27 Preparation of plasma EDTA-containing blood samples were centrifuged at 2,000 × g for 5 minutes at 4°C. The supernatant was frozen with dry ice and then stored at -80°C until further processing was required.

[0260] 2.2.28 Lung homogenization in Examples 18 to 20 Lung homogenization was performed as described in 2.2.17.3 above.

[0261] 2.2.29 Test system in Examples 21 to 24 Species: Mustela putorius (ferret) Stock: Sable Source: Triple F Farms (Gillett, PA) The ferrets were between 20 and 24 weeks old at the time of administration of LF92-formulated hIFN mRNA. In Example 24, the ferrets were 5 months old at the time of administration of LF92-formulated hIFN mRNA. The weight of the animals on the day before administration (-1 day) ranged from 0.7 kg to 1.1 kg. Each animal was permanently identified by a unique ear tag at NLS after receiving the animals.

[0262] 2.2.30 Test system housing in Examples 21 to 24 The animals were acclimatized for 10 to 12 days prior to the start of the study. During the acclimatization period, the animals' health status was assessed daily by technical staff for clinical manifestations and behavioral characteristics indicating health or disease. Throughout the acclimatization period and the lifespan of the study, the animals were housed in groups of three in stainless steel cages with wire bottoms.

[0263] 2.2.31 Test drug administration in Examples 21 to 23 Animals were administered 1 mL of LF92-formulated hIFN mRNA by nasal drop using a pipette (0.5 mL / nostril). Human IFNλ1 or Stop mRNA formulated with LF92 was administered at an mRNA concentration of 0.07 mg / mL. In Example 23, an mRNA concentration of 1.25 mg / mL was administered, resulting in a total mRNA concentration of 2.5 mg / mL for the combination of human IFNλ1 and human IFNβ.

[0264] 2.2.32 Test drug administration in Example 24 On days 1, 1, and 3 of the experiment, LF92-formulated hIFN mRNA was administered to animals by nasal drop drops using a pipette (0.5 mL / nostril for a 0.125 or 0.25 mg / mL solution). LF92-formulated human IFNλ1-encoding mRNA, human IFNβ-encoding mRNA, or a combination of both was administered at an mRNA concentration of 1.25 mg / mL (for combinations, the total mRNA concentration was 2.5 mg / mL). A control medium was administered.

[0265] On day 0 of the experiment, all groups of animals were subjected to a 2 × 10⁶ dose using 1 ml of freshly diluted H1N1 A / California / 04 / 09 virus. 2 TCID 50 The virus was challenged by nasal drops to a titer of up to / ml. This viral titer was further confirmed on the same day (back titration).

[0266] 2.2.33 Autopsy in Examples 21 to 23 All animals were humanely euthanized with a large dose of sedative six hours after administration. Lung tissue samples were taken from the upper, middle, and lower regions of the left upper lobe (left head), right upper lobe (right head), left lower lobe (left tail), and right lower lobe (right tail). The tissue samples were weighed, cut into three pieces, placed in cryovial tubes containing 1 mL of RNAlater, and stored overnight at 4°C to allow RNAlater to permeate the tissue. The RNAlater solution was removed from the tubes, the tissues were rapidly frozen, and stored at -80°C until sent to ethris.

[0267] 2.2.34 Lung homogenization in Examples 21 to 23 600 μL of lysis buffer was added to a Lysing D tube and stored on ice. The lysis buffer RLT was included in the kit, and 40 μL / mL of DTT was added as a supplement. The frozen organs were weighed and transferred to one lysis tube or cut into pieces and transferred to several lysis tubes according to their weight. 300-350 mg in 600 μL of lysis buffer was determined to be the maximum volume of tissue and lysis buffer per lysis tube. The organs in the lysis buffer were stored on ice while processing further samples. Homogenization was performed in a tissue homogenizer for 3 × 20 seconds. The lysate was then centrifuged at maximum speed (14000 rpm) for 3 minutes. The supernatant was transferred to a new Eppendorf tube. A volume of homogenate corresponding to 10 mg of lung was transferred to an additional new Eppendorf tube. To this tube, lysis buffer was added to a final volume of 600 μL. These samples and residual lysates were frozen at -80°C, after which RNA was isolated.

[0268] 2.2.35 Clinical findings in Example 24 Ferrets were observed twice daily, and clinical signs of the disease, including sneezing, nasal discharge, and activity, were scored. A score of 0 or 1 was assigned to the presence or absence of sneezing or nasal discharge. Activity was scored as follows: 0 = normal activity, 1 = decreased activity, and 2 = no activity. A daily score was recorded for each individual ferret showing specific clinical signs on a given day. The score was also recorded as the number of ferrets in the group showing one or more signs of infection on a given day.

[0269] 2.2.36 Body weight and body temperature in Example 24 Body weight was measured upon receipt, before the first administration of LF92-formulated hIFN mRNA, and on the day following each day of the study.

[0270] Body temperature was measured daily using a transponder that had been subcutaneously implanted in the ferret on day -1.

[0271] 2.2.37 Virus titer in nasal irrigation solution Nasal lavage fluid was collected on days 1, 2, 3, 4, 5, and 6 after viral challenge by lavaging the nasal cavity with 2 mL of sterile PBS containing 0.5% bovine serum albumin (BSA), penicillin, streptomycin, and amphotericin B. The lavage fluid on days 1 and 3 was collected before administration of LF92-formulated hIFN mRNA. The collected nasal lavage fluid was dispensed into sterile 1.5-ml Eppendorf tubes, immediately frozen on dry ice, and then frozen in a TCID (Triple Cholesterol Isolation). 50 The samples were stored at -80°C until they were used to determine the virus titer.

[0272] In a TPCK-trypsin-free viral growth medium (DMEM supplemented with 0.3% BSA), 10 -1 from 10 -10 Up to, continuous 1 / 2-log of nasal irrigation solution 10 A dilution was prepared: 25 microliters (25 μl) of 1 / 2-log solution. 10 Each diluted nasal lavage solution was added to MDCK cells in a 96-well microplate (four replicates for each dilution) and incubated at 37°C, 5% CO2 for 60 minutes. After 60 minutes of incubation, 175 microliters (175 μl) of viral growth medium (DMEM supplemented with 0.3% BSA containing 1 μg / ml TPCK-trypsin) was added to each well. The cells were then incubated at 37°C, 5% CO2 for 48 hours. The content of each well was tested for hemagglutination by incubating 50 μl of tissue culture supernatant with 50 μl of 0.5% turkey erythrocytes in 1xPBS for 30 minutes at room temperature. 50This was calculated using the Reed and Muench methods. In short, when the influenza virus is present, red blood cells agglutinate. The number of positive wells (wells with red blood cell agglutination) and negative wells in each dilution was determined. The "cumulative positives," "cumulative negatives," and the percentage of positives were calculated. Next, the "proportional distance" between dilutions showing >50% positivity and dilutions showing <50% positivity was calculated using the following formula: Proportional distance = ((Percentage positive value greater than 50%) 50) / (Percentage positive value greater than 50% - Percentage positive value less than 50%) × 0.5 (Correction factor for 1 / 2 log dilution). Virus TCID for each sample. 50 This was calculated by adding a proportional distance for dilutions showing >50% positivity.

[0273] 2.2.38 Autopsy in Example 24 The animals were humanely euthanized on day 6, and lung tissue was collected from all four lung lobes. Photographs of the lungs were taken and each was weighed. Three portions were collected from each lobe. Two of these portions were placed in pre-weighed tubes containing RNAlater (or equivalent) and weighed, while the third lung portion was placed in 10% buffered formalin.

[0274] 2.2.39 Quantification of viral RNA in the lungs Influenza virus quantification in ferret lung tissue was performed by 1-step RT-qPCR using an Applied Biosystems QuantStudio 6-flex thermal cycler (Applied Biosystems, Foster City, CA, USA). Viral RNA was extracted from lung tissue samples collected from the left upper lobe using the Zymo Research Quick-RNA Miniprep Plus Kit (Santa Ana, CA) to obtain 60 μL of eluted viral RNA, which was divided equally and stored at -80°C until use for quantification. To amplify the sequence in viral gene segment 7 that codes for the viral matrix protein, a 20 μL one-step RT-qPCR reaction mixture was pre-prepared using 5 μL (5 μL) of extracted RNA, containing qScript XLT One-Step RT-qPCR ToughMix plus Rox (QuantBio), 0.2 μM primers M+24 F (5'-AGA TGA GTC TTC TAA CCG AGG TCG-3') and Rev-mod (5'-TGC AAA GAC ACT TTC CAG TCT CTG-3'), and TaqMan probe M+64 (5'6-FAM / TC AGG CCC C / ZEN / C TCA AAG CCG A-3'BkFQ). For reverse transcription, amplification was performed in a 96-well plate in a single cycle of 10 minutes at 50°C, followed by 45 cycles of 3 minutes at 95°C, 10 seconds at 95°C, and 30 seconds at 60°C to amplify the DNA. Influenza A / California / 04 / 2009 pdmH1N1 cell culture stock (8×10 6The amount of viral RNA in each sample was interpolated using a calibration curve generated by amplifying serial dilutions of viral RNA extracted from pfu / mL. The total viral RNA in each sample was normalized to the relative amount of ferret GAPDH RNA per milligram of total RNA. To amplify the GAPDH sequence, 20 μL of a 1-step RT-qPCR reaction mixture was pre-prepared using 3 μL of extracted RNA, containing qScript XLT One-Step RT-qPCR ToughMix plus Rox (QuantBio), 0.2 μM primers Fer_GAPDH FWD (5'-CAA CGG ATT TGG CCG TAT TG-3') and Fer_GAPDH REV (5'-CTG GAA CAT GTA GAC CAT GTA GT-3'), and the TaqMan probe Fer_GAPDH PRB (5Cy5 / AGGGTCATT / TAO / GATGGCGACAATATCCAC / 3IAbRQSp / ). For reverse transcription, a single cycle of 10 minutes at 50°C was performed, followed by 45 cycles of 3 minutes at 95°C, 10 seconds at 95°C, and 30 seconds at 60°C to amplify the DNA. The amount of GAPDH in the sample was interpolated from a calibration curve generated by amplifying serial dilutions of pooled extracted ferret lung RNA (250 ng / μL). The results were analyzed using the 21 CFR Part 11 Software Module for QuantStudio. TM Data processed by systems 6 and 7, as well as data from RT-qPCR analysis, were imported into GraphPad Prism for analysis.

[0275] 2.2.40 Quantification of viral reproduction in Example 25 2.2.40.1 Approval of the test All experiments, including those involving animals, were pre-approved by the Animal Ethics Committee of the Danish Veterinary and Food Administration (Stationsparken 31-33, 2600 Glostrup, Denmark) and were conducted in accordance with the Danish Animal Welfare Act for the Care and Use of Animals for Scientific Purposes.

[0276] 2.2.40.2 Biosafety All aspects of this study were approved by the Danish Working Environment Authority (Landskronagade 33, 2100 Copenhagen O) prior to the commencement of the study. Work involving SARS-CoV-2 was conducted in a biosafety level 2+ laboratory by personnel equipped with powered air-purifying respirators.

[0277] 2.2.40.3 Replication of SARS-CoV-2 B.1.1.7 SARS-CoV-2 (Kent, UK, isolate) was provided by Professor Arvind Patel of the University of Glasgow under a Material Transfer Agreement (MTA). The virus used was a clinical isolate. The B.1.1.7 variant is in the database as MZ314997. This virus was grown in VeroE6 cells expressing human TMPRSS2 (VeroE6-hTMPRSS2) (courtesy of Professor Stefan Pohlmann, University of Gettington) (Hoffmann et al., 2020). Briefly, VeroE6-hTMPRSS2 cells were infected in DMEM (Gibco) + 2% FCS (Sigma-Aldrich) + 1% Pen / Strep (Gibco) + L-Glutamine (Sigma-Aldrich) (hereinafter referred to as complete medium) with a multiplicity of infection (MOI) of 0.05. The supernatant (including new viral progeny) was collected 72 hours after infection and concentrated on a 100 kDa Amicon ultrafiltration column (Merck) by centrifugation at 4000xg for 30 minutes. The viral titer was determined by the TCID50% assay and calculated by the Reed-Muench method. To convert to the average number of plaque-forming units (pfu) / mL, the TCID50 / mL was multiplied by a factor of 0.7 (ATCC-TCID

[50] converted to plaque-forming units (PFU)).

[0278] 2.2.40.4 Animal housing K18-hACE c57BL / 6J mice (Corporate: 2B6.Cg-Tg(K18-ACE2)2Prlmn / J) were obtained from The Jackson Laboratory. Hemizygous offspring were used in the experiment. Male and female mice of the same age were used, and they were fed a standard solid diet and housed in a pathogen-free facility. The weight of the mice was measured at the same time every day until the third day after infection (the animals were euthanized when they lost 20% of their body weight after infection, or when they reached the human endpoint).

[0279] 2.2.40.5 Treatment of mice Mice were intranasally treated with a 15 μL inoculation of formulated human IFNλ1 mRNA (7.5 μg of mRNA, corresponding to 3 μg deposited in the lungs) under isoflurane anesthesia one day before and one day after infection.

[0280] 2.2.40.6 Infection in mice SARS-CoV-2 was administered using the same method as mRNA administration (intranasal administration of 15 μL aliquots under isoflurane inhalation anesthesia).

[0281] 2.2.40.7 RNA Isolation, Real-time qPCR Lungs were homogenized using steel beads (Qiagen) in Tissuelyser(II) (Qiagen) in PBS and immediately used for RNA isolation. RNA was isolated using a High Pure RNA Isolation Kit (Roche), and an equal amount of RNA was used for standard one-step RT-PCR (Applied Biosystems TaqMan RNA to CT One Step Kit). For the SARS-CoV-2 N gene, qPCR primers AAATTTTGGGGACCAGGAAC and TGGCACCTGTGTAGGTCAAC and probe FAM-ATGTCGCGCATTGGCATGGA-BHQ were used. For IFN-β, Mx1, and β-actin, a Taqman gene expression assay was used (Applied Biosystems). The RNA levels of the SARS-CoV-2 N gene, IFNβ, or Mx1 were normalized relative to the mouse housekeeping gene β-actin using the formula 2^(Ct(18S-rRNA)-Ct(Sars-CoV-2 RNA)).

[0282] 2.2.40.8 TCID50 assay A limiting dilution assay was performed to measure the content of infectious virus in the cell culture supernatant or in the generated virus stock. 2 × 10 4Nine VeroE6-TMPRRS2 cells were seeded in 90 μL of DMEM5 into a 96-well plate. The following day, the samples were thawed, diluted 10-fold, and then serially diluted 10-fold using DMEM. 10 μL of each dilution was added to the cells in eight replicates. The cells were incubated in a humidified CO2 incubator at 37°C and 5% CO2 for 72 hours. After fixation with 5% formalin (Sigma-Aldrich) and crystal violet stain (Sigma-Aldrich), cytopathic effect (CPE) was scored using a light microscope (Leica DMi1), and the tissue culture infectious dose 50 (TCID50 / mL) was calculated using the Reed and Muench methods.

Claims

1. A pharmaceutical composition comprising mRNA encoding an IFN-λ polypeptide for use in treating or preventing a virus-induced disorder, wherein the mRNA is administered by delivery to the respiratory system, and wherein the virus-induced disorder is a virus-induced respiratory disorder.

2. The pharmaceutical composition according to claim 1, wherein the virus causing the virus-induced respiratory disorder is selected from the group consisting of rhinovirus, influenza virus, parainfluenza virus, metapneumonia virus, respiratory syncytial virus, adenovirus, and coronavirus.

3. A pharmaceutical composition according to claim 1 or 2, wherein the virus causing the virus-induced respiratory disorder is a virus that enters cells via the ACE2 receptor.

4. The pharmaceutical composition according to claim 3, wherein the virus is SARS-CoV, SARS-CoV-2, or HCoV-NL63.

5. A pharmaceutical composition according to any one of claims 1 to 4, wherein delivery to the respiratory system is by intravenous infusion or inhalation.

6. The pharmaceutical composition according to claim 5, wherein the inhalation is the inhalation of an aerosol containing the mRNA.

7. A pharmaceutical composition according to any one of claims 1 to 6, wherein the mRNA comprises a combination of unmodified nucleotides and modified nucleotides.

8. The pharmaceutical composition according to claim 7, wherein 5% to 50% of the uridine nucleotide and 5% to 50% of the cytidine nucleotide are modified uridine nucleotide and modified cytidine nucleotide, respectively.

9. The pharmaceutical composition according to claim 8, wherein the modified uridine nucleotide is 2-thiouridine, and the modified cytidine nucleotide is 5-methylcytidine.

10. The pharmaceutical composition according to claim 7, wherein the modified nucleotide is selected from the following list based on each nucleoside residue: pseudo-uridine, N1-methyl-pseudo-uridine, 2'-fluoro-2'-deoxycytidine, 5-iodocytidine, 5-methylcytidine, 2-thiouridine, 5-iodouridine and / or 5-methyluridine.

11. A pharmaceutical composition according to any one of claims 1 to 10, wherein the IFN-λ polypeptide is selected from the group consisting of IFNλ1, IFNλ2, and IFNλ3, or a combination thereof.

12. The pharmaceutical composition according to claim 11, wherein the coding region of the mRNA encoding IFNλ1 is as shown in sequence number (SEQ ID NO): 1, wherein the coding region of the mRNA encoding IFNλ2 is as shown in sequence number (SEQ ID NO): 3, or wherein the coding region of the mRNA encoding IFNλ3 is as shown in sequence number (SEQ ID NO):

5.

13. A pharmaceutical composition according to claim 11 or 12, wherein the mRNA encoding IFNλ1 has the sequence shown in SEQ ID NO: 13, wherein the mRNA encoding IFNλ2 has the sequence shown in SEQ ID NO: 14, or wherein the mRNA encoding IFNλ3 has the sequence shown in SEQ ID NO:

15.

14. A pharmaceutical composition according to any one of claims 1 to 13, further comprising mRNA encoding type I interferon and / or mRNA encoding type II interferon.

15. The pharmaceutical composition according to claim 14, wherein the type I interferon is selected from the group consisting of IFN-α and IFN-β, and the type II interferon is IFNγ.

16. The pharmaceutical composition according to claim 15, wherein IFN-α is IFN-α16.

Images