Ammonia oxidation Nitrosomonas eutropha strain D23

Optimized Nitrosomonas eutropha strains, such as D23, enhance nitrite generation and ammonium oxidation, addressing the need for beneficial bacteria to inhibit pathogenic growth and treat associated diseases.

JP7851633B2Active Publication Date: 2026-04-27AOBIOME LLC
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
AOBIOME LLC
Filing Date
2024-07-18
Publication Date
2026-04-27

AI Technical Summary

Technical Problem

There is a need for improved, beneficial bacteria that can inhibit the growth of pathogenic bacteria.

Method used

Optimized strains of Nitrosomonas eutropha (N. eutropha) designated as D23, D23-100, or AOB D23-100, which possess enhanced abilities to generate nitric oxide (NO) and nitrite (NO2-) and exhibit optimized growth rates, NH4+ oxidation rates, and ammonium ion resistance, thereby inhibiting pathogenic bacteria.

Benefits of technology

The optimized N. eutropha strains effectively inhibit pathogenic bacteria growth, offering potential treatments for diseases associated with low nitrite levels and skin disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007851633000405
    Figure 0007851633000405
  • Figure 0007851633000406
    Figure 0007851633000406
  • Figure 0007851633000407
    Figure 0007851633000407
Patent Text Reader

Abstract

To provide improved beneficial bacteria that can suppress the growth of pathogens.SOLUTION: The present disclosure provides, inter alia, an optimized strain of Nitrosomonas eutropha (N. eutropha) designated D23, D23-100, or AOB D23-100. N. eutropha bacteria disclosed in the present application have desirable properties, e.g., optimized properties, such as the ability to suppress growth of pathogenic bacteria, and an enhanced ability to produce nitric oxide and nitric oxide precursors. The N. eutropha herein may be used, for instance, to treat diseases associated with low nitrite levels, skin diseases, and diseases caused by pathogenic bacteria.SELECTED DRAWING: Figure 18
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This application claims priority to Greek Patent Application No. 20140100217 filed April 15, 2014, U.S. Provisional Patent Application No. 62 / 002084 filed May 22, 2014, U.S. Provisional Patent Application No. 62 / 012811 filed June 16, 2014, U.S. Provisional Patent Application No. 62 / 053588 filed September 22, 2014, and Greek Patent Application No. 20150100115 filed March 13, 2015, the contents of which are incorporated herein by reference in their entirety.

[0002] Sequence List This application is filed electronically in ASCII format and includes a sequence listing which is incorporated in its entirety herein by reference. A copy of the said ASCII format, prepared on 13 April 2015, is named N2060-7001WO.txt and is 3,590,980 bytes in size. [Background technology]

[0003] Beneficial bacteria can be used to inhibit the growth of pathogenic bacteria. Bacteria and other microorganisms are ubiquitous in the environment. The discovery of pathogenic bacteria and the bacteriology of disease have a significant impact on health and disease states. Bacteria are a normal part of the environment of all living things. In the intestines, these bacteria are nonpathogenic under normal conditions and actually improve health by making normal intestinal contents more inhospitable to disease-causing organisms. Disease prevention is achieved in several ways, including the consumption of nutrients, leaving few nutrients for pathogens; the creation of conditions such as pH and oxygen pressure that are inhospitable to pathogens; the production of compounds toxic to pathogens; the consumption of pathogens as food by these microorganisms; the leaving of little usable physical space for pathogens; and the occupation of specific binding sites, leaving only a few usable binding sites for pathogens. The presence of these desirable bacteria is considered useful in preventing disease states.

[0004] There is a need in this field for improved, beneficial bacteria that can inhibit the growth of pathogenic bacteria. [Overview of the Initiative] [Means for solving the problem]

[0005] This disclosure provides, in particular, optimized strains of Nitrosomonas eutropha (N. eutropha) designated as D23, D23-100, or AOB D23-100, and these terms may be used synonymously throughout this disclosure.

[0006] Ammonia-oxidizing bacteria of the genus Nitrosomonas are ubiquitous, Gram-negative, obligate chemosynthetic autotrophic bacteria that possess the unique ability to generate energy solely from the conversion of ammonia to nitrite.

[0007] The N. eutropha bacteria disclosed in this application have the ability to inhibit the growth of pathogenic bacteria, as well as nitric oxide (NO) and nitric oxide (NO2 - ) possess desirable properties, such as an enhanced ability to generate precursors, e.g., optimized properties. The N. eutropha described herein, e.g., optimized N. eutropha, e.g., purified optimized N. eutropha preparations, can be used to treat, for example, diseases, e.g., diseases associated with low nitrite levels, skin disorders, and diseases caused by pathogens. When N. eutropha is referred to throughout this disclosure, it may refer to an optimized strain of N. eutropha or a purified optimized N. eutropha preparation.

[0008] This disclosure provides, in particular, Nitrosomonas eutropha (N. eutropha) bacteria having at least one characteristic selected from the following, e.g., optimized N. eutropha, e.g., purified optimized N. eutropha preparations: Optimized growth rate, Optimized NH4 + Oxidation rate, and Optimization resistance to ammonium ions (NH4 + ).

[0009] This bacterium is optionally pure.

[0010] In multiple embodiments, the optimized growth rate is a rate that enables continuous culture of N. eutropha at an OD600 (optical density at 600 nm) of about 0.15 - 0.18 and reaching an OD600 of about 0.5 - 0.6 in about 1 - 2 days. In multiple embodiments, the optimized growth rate is a doubling time of about 8 hours when cultured under batch culture conditions. In multiple embodiments, the optimized NH4 + oxidation rate is at least about 125 micromoles / minute to oxidize NH4 + to NO2 - . In multiple embodiments, the optimization resistance to NH4 + is the ability to grow for at least about 48 hours in a medium containing about 200 mM NH4 + .

[0011] In some embodiments, a purified optimized N. eutropha bacterial preparation (optionally pure) has at least two characteristics selected from the optimized growth rate, the optimized NH4 + oxidation rate, and the optimization resistance to NH4 + . In some embodiments, a purified optimized N. eutropha bacterial preparation (optionally pure) has the optimized growth rate, the optimized NH4 + oxidation rate, and the optimization resistance to NH4 + . In some embodiments, a purified optimized N. eutropha bacterial preparation (optionally pure) contains a chromosome that hybridizes to SEQ ID NO: 1 with very high stringency.

[0012] In some embodiments, the purified optimized N. eutropha bacterial preparation (optionally pure) contains AmoA protein identical to SEQ ID NO: 6 or 12, selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; AmoB protein identical to SEQ ID NO: 8 or 14, selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; and SEQ ID NO: 4, 10, or 16, selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical. an amoC gene having, a hydroxylamine oxidoreductase protein having identity with SEQ ID NO: 18, 20, or 22, selected from at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical, a cytochrome c554 protein having identity with SEQ ID NO: 24, 26, or 28, selected from at least approximately 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical, or a cytochrome c having identity with SEQ ID NO: 30 or 32, selected from at least approximately 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical M Contains 552 proteins.

[0013] In some embodiments, the purified, optimized N. eutropha bacterial preparation (optionally pure) contains sequence characteristics 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, or all of those listed in Table 2. For example, in some embodiments, the bacterium or preparation contains an AmoA1 or AmoA2 protein (or the gene encoding it) having a mutation at position 1 of N. eutropha strain C91, e.g., at position 1, for V. In some embodiments, the bacterium or preparation contains an AmoA1 or AmoA2 protein (or the gene encoding it) having a mutation at position 160 of N. eutropha strain C91, e.g., at position 160, for L. In some embodiments, the bacterium or preparation contains an AmoA1 or AmoA2 protein (or the gene encoding it) having a mutation at position 167 of N. eutropha strain C91, e.g., at position 167, for A. In some embodiments, the bacterium or preparation contains an AmoB1 or AmoB2 protein (or the gene encoding it) having a mutation at position 33 of N. eutropha strain C91, for example, at position 33 for V. In some embodiments, the bacterium or preparation contains an AmoB1 or AmoB2 protein (or the gene encoding it) having a mutation at position 165 of N. eutropha strain C91, for example, at position 165 for I. In some embodiments, the bacterium or preparation contains an AmoC3 protein (or the gene encoding it) having a mutation at position 79 of N. eutropha strain C91, for example, at position 79 for A. In some embodiments, the bacterium or preparation contains an AmoC3 protein (or the gene encoding it) having a mutation at position 271 of N. eutropha strain C91, for example, at position 271 for V. In some embodiments, the bacterium or preparation contains the Hao1, Hao2, or Hao3 protein (or the gene encoding it) having a mutation at position 85 of N. eutropha strain C91, for example, at position 85 S.In some embodiments, the bacterium or preparation contains the Hao1, Hao2, or Hao3 protein (or the gene encoding it) having a mutation at position 312 of N. eutropha strain C91, for example, at position 312 (E). In some embodiments, the bacterium or preparation contains the Hao1 protein (or the gene encoding it) having a mutation at position 163 of N. eutropha strain C91, for example, at position 163 (A). In some embodiments, the bacterium or preparation contains the c554 CycA1, c554 CycA2, or c554 CycA3 protein (or the gene encoding it) having a mutation at position 65 of N. eutropha strain C91, for example, at position 65 (T). In some embodiments, the bacterium or preparation contains the c554 CycA1 protein (or the gene encoding it) having a mutation at position 186 of N. eutropha strain C91, for example, at position 186 (T). In some embodiments, the bacterium or preparation has a mutation at position 63 of N. eutropha strain C91, for example, a mutation at position 63 for V. M 552 CycB1 or c M 552 Contains the CycB2 protein (or the gene encoding it). In some embodiments, the bacterium or preparation has a mutation at position 189 of N. eutropha strain C91, for example, a mutation for P at position 189. M 552 CycB1 or c M 552 Contains the CycB2 protein (or the gene encoding it). In some embodiments, the bacterium or preparation has a mutation at position 206 of N. eutropha strain C91, for example, a mutation for insE at position 206. M 552 CycB1 or c M 552 Contains the CycB2 protein (or the gene encoding it). In some embodiments, the bacterium or preparation has a mutation at position 207 of N. eutropha strain C91, for example, a mutation for insE at position 207. M 552 CycB1 or c M552 Contains the CycB2 protein (or the gene encoding it). In some embodiments, the bacterium or preparation has a mutation at position 195 of N. eutropha strain C91, for example, a mutation for insD at position 195. M 552 Contains the CycB1 protein (or the gene encoding it). In some embodiments, the bacterium or preparation has a mutation at position 196 of N. eutropha strain C91, for example, a mutation for insD at position 196. M 552 Contains the CycB1 protein (or the gene encoding it). In some embodiments, the bacterium or preparation has a mutation at position 197 of N. eutropha strain C91, for example, a mutation for insD at position 197. M Contains 552 CycB1 protein (or the gene that codes for it).

[0014] Table 2 also describes combinations of two or more sequence characteristics. These two or more sequence characteristics may be present in the same gene or in different genes. These two or more sequence characteristics may be present in the same protein or in different proteins. For example, in some embodiments, the bacterium or preparation includes an AmoA1 or AmoA2 protein (or the gene encoding it) having a mutation at position 1 of N. eutropha strain C91, for example, a mutation at position 1 for V, and a mutation at position 160 of N. eutropha strain C91, for example, a mutation at position 160 for L. In some embodiments, the bacterium or preparation includes an AmoA1 or AmoA2 protein (or the gene encoding it) having a mutation at position 1 of N. eutropha strain C91, for example, a mutation at position 1 for V, and a mutation at position 167 of N. eutropha strain C91, for example, a mutation at position 167 for A. In some embodiments, the bacterium or preparation comprises an AmoA1 or AmoA2 protein (or the gene encoding it) having a mutation at position 160 of N. eutropha strain C91, for example, a mutation at position 160 L, and a mutation at position 167 of N. eutropha strain C91, for example, a mutation at position 167 A.

[0015] In some embodiments, the bacterium or preparation comprises an AmoB1 or AmoB2 protein (or the gene encoding it) having a mutation at position 33 of N. eutropha strain C91, for example, a mutation at position 33 V, and a mutation at position 165 of N. eutropha strain C91, for example, a mutation at position 165 I.

[0016] In some embodiments, the bacterium or preparation comprises an AmoC3 protein (or the gene encoding it) having a mutation at position 79 of N. eutropha strain C91, for example, a mutation at position 79 (A), and a mutation at position 271 of N. eutropha strain C91, for example, a mutation at position 271 (V).

[0017] In some embodiments, the bacterium or preparation comprises a Hao1, Hao2, or Hao3 protein (or the gene encoding it) having a mutation at position 85 of N. eutropha strain C91, for example, to S at position 85, and a mutation at position 312 of N. eutropha strain C91, for example, to E at position 312. In some embodiments, the bacterium or preparation comprises a Hao1 protein (or the gene encoding it) having a mutation at position 85 of N. eutropha strain C91, for example, to S at position 85, and a mutation at position 163 of N. eutropha strain C91, for example, to A at position 163. In some embodiments, the bacterium or preparation comprises a Hao1 protein (or the gene encoding it) having a mutation at position 312 of N. eutropha strain C91, for example, to E at position 312, and a mutation at position 163 of N. eutropha strain C91, for example, to A at position 163.

[0018] In some embodiments, the bacterium or preparation comprises a c554 CycA1 protein (or the gene encoding it) having a mutation at position 65 of N. eutropha strain C91, for example, a mutation at position 65 (T), and a mutation at position 186 of N. eutropha strain C91, for example, a mutation at position 186 (T).

[0019] In some embodiments, the bacterium or preparation has mutations at any two or more of the following amino acid positions: 63, 189, 194, 195, 196, 197, 206, and 207. M 552 Contains the CycB1 protein (or the gene encoding it). For example, two or more of these amino acid positions are 63 and 189, 63 and 194, 63 and 195, 63 and 196, 63 and 197, 63 and 206, 63 and 207, 189 and 194, 189 and 195, 189 and 196, 189 and 194, 189 and 195, 189 and 196, 189 and 197, 189 and 206, 1 The bacterium or preparation may contain 89 and 207, 194 and 195, 194 and 196, 194 and 197, 194 and 206, 194 and 207, 195 and 196, 195 and 197, 195 and 206, 195 and 207, 196 and 197, 196 and 206, 196 and 207, 197 and 206, 197 and 207, or 206 and 207. In some embodiments, the bacterium or preparation may have two or more mutations selected from the group consisting of I63V, S189P, D194G, 195insD, 196insD, 197insD, 206insE, and 207insE. M552 Contains the CycB1 protein (or the gene encoding it). For example, two or more of these mutations include I63V and S189P, I63V and D194G, I63V and 195insD, I63V and 196insD, I63V and 197insD, I63V and 206insE, I63V and 207insE, S189P and D194G, S189P and 195insD, S189P and 196insD, S189P and 197insD, S189P and 206insE, S189P and 207insE, D194G and 195insD, D194G and 196insD, The group can be selected from the following: D194G and 197insD, D194G and 206insE, D194G and 207insE, 195insD and 196insD, 195insD and 197insD, 195insD and 206insE, 195insD and 207insE, 196insD and 197insD, 196insD and 206insE, 196insD and 207insE, 197insD and 206insE, 197insD and 207insE, and 206insE and 207insE.

[0020] In some embodiments, the bacterium or preparation has mutations at two or more of the following amino acid positions: 63, 189, 206, and 207. M 552 Contains the CycB2 protein (or the gene encoding it). For example, these two or more amino acid positions may include 63 and 189, 63 and 206, 63 and 207, 189 and 206, 189 and 207, or 206 and 207. In some embodiments, the bacterium or preparation has two or more mutations selected from the group consisting of I63V, S189P, 206insE, and 207insE. M 552 The mutations include the CycB2 protein (or the gene encoding it). For example, two or more of these mutations may be selected from the group consisting of I63V and S189P, I63V and 206insE, I63V and 207insE, S189P and 206insE, S189P and 207insE, and 206insE and 207insE.

[0021] Table 2 also describes combinations of three or more sequence characteristics. For example, in some embodiments, the bacterium or preparation contains an AmoA1 or AmoA2 protein (or the gene encoding it) having a mutation at position 1 of N. eutropha strain C91, e.g., a mutation at position 1 V, at position 160 of N. eutropha strain C91, e.g., a mutation at position 160 L, and at position 167 of N. eutropha strain C91, e.g., a mutation at position 167 A.

[0022] In some embodiments, the bacterium or preparation comprises the Hao1 protein (or the gene encoding it) having a mutation at position 85 of N. eutropha strain C91, for example, a mutation at position 85 for S, a mutation at position 312 of N. eutropha strain C91, for example, a mutation at position 312 for E, and a mutation at position 163 of N. eutropha strain C91, for example, a mutation at position 163 for A.

[0023] In some embodiments, the bacterium or preparation has mutations at three or more of the following amino acid positions: 63, 189, 194, 195, 196, 197, 206, and 207 (e.g., four, five, six, seven, or all of them). M 552 contains the CycB1 protein (or the gene encoding it). For example, these three mutations may be at positions 195, 196, and 197. In some embodiments, the bacterium or preparation has three or more (e.g., four, five, six, seven, or all) mutations selected from the group consisting of I63V, S189P, D194G, 195insD, 196insD, 197insD, 206insE, and 207insE. M 552 contains the CycB1 protein (or the gene that codes for it). For example, these three mutations could be 195insD, 196insD, and 197insD.

[0024] In some embodiments, the bacterium or preparation has mutations at three or more (e.g., all) of the following amino acid positions: 63, 189, 206, and 207. M 552 Contains the CycB2 protein (or the gene encoding it). In some embodiments, the bacterium or preparation has three or more (e.g., all) mutations selected from the group consisting of I63V, S189P, 206insE, and 207insE. M Contains 552 CycB2 protein (or the gene that codes for it).

[0025] In some embodiments, the bacterium or preparation contains mutations relative to N. eutropha strain C91 in at least two genes, for example, at least two genes listed in Table 2. These two genes are, for example, AmoA1 and AmoA2, AmoA1 and AmoB1, AmoA1 and AmoB2, AmoA1 and AmoC1, AmoA1 and AmoC2, AmoA1 and AmoC3, AmoA1 and Hao1, AmoA1 and Hao2, AmoA1 and Hao3, AmoA1 and c554 CycA1, AmoA1 and c554 CycA2, AmoA1 and c554 CycA3, AmoA1 and cM552 CycB1, AmoA1 and cM552 CycB2, AmoA2 and AmoB1, AmoA2 and AmoB2, AmoA2 and AmoC1, AmoA2 and AmoC2, AmoA2 and AmoC3, AmoA2 and Hao1, AmoA2 and Hao2, AmoA2 and Hao3, AmoA2 and c554 CycA1, AmoA2 and c554 CycA2, AmoA2 and c554 CycA3, AmoA2 and cM552 CycB1, AmoA2 and cM552 CycB2, AmoB1 and AmoB2, AmoB1 and AmoC1, AmoB1 and AmoC2, AmoB1 and AmoC3, AmoB1 and Hao1, AmoB1 and Hao2, AmoB1 and Hao3, AmoB1 and c554 CycA1, AmoB1 and c554 CycA2, AmoB1 and c554; CycA3, AmoB1 and cM552; CycB1, AmoB1 and cM552; CycB2, AmoB2 and AmoC1, AmoB2 and AmoC2, AmoB2 and AmoC3, AmoB2 and Hao1, AmoB2 and Hao2, AmoB2 and Hao3, AmoB2 and c554; CycA1, AmoB2 and c554; CycA2, AmoB2 and c554; CycA3, AmoB2 and cM552; CycB1, AmoB2 and cM552; CycB2, AmoC1 and AmoC2, AmoC1 and AmoC3, AmoC1 and Hao1, AmoC1 and Hao2, AmoC1 and Hao3, AmoC1 and c554 CycA1, AmoC1 and c554; CycA2, AmoC1 and c554; CycA3, AmoC1 and cM552; CycB1, AmoC1 and cM552CycB2, AmoC2 and AmoC3, AmoC2 and Hao1, AmoC2 and Hao2, AmoC2 and Hao3, AmoC2 and c554 CycA1, AmoC2 and c554 CycA2, AmoC2 and c554 CycA3, AmoC2 and cM552 CycB1, AmoC2 and cM552 CycB2, AmoC3 and Hao1, AmoC3 and Hao2, AmoC3 and Hao3, AmoC3 and c554 CycA1, AmoC3 and c554 CycA2, AmoC3 and c554 CycA3, AmoC3 and cM552 CycB1, AmoC3 and cM552 CycB2, Hao1 and Hao2, Hao1 and Hao3, Hao1 and c554 CycA1, Hao1 and c554 CycA2, Hao1 and c554 CycA3, Hao1 and cM552 CycB1, Hao1 and cM552 CycB2, Hao2 and Hao3, Hao2 and c554 CycA1, Hao2 and c554 CycA2, Hao2 and c554 CycA3, Hao2 and cM552 CycB1, Hao2 and cM552 CycB2, Hao3 and c554 CycA1, Hao3 and c554 CycA2, Hao3 and c554 CycA3, Hao3 and cM552 CycB1, Hao3 and cM552 CycB2, c554 CycA1 and c554 CycA2, c554 CycA1 and c554 CycA3, c554 CycA1 and cM552, CycB1 and c554 CycA1 and cM552 CycB2, c554 CycA2 and c554 CycA3, c554 CycA2 and cM552 CycB1, c554 CycA2 and cM552 CycB2, c554 CycA3 and cM552 CycB1, c554 CycA3 and cM552 CycB2, or cM552 CycB1 and cM552 It could be CycB2.

[0026] In some embodiments, the bacterium or preparation contains mutations relative to N. eutropha strain C91 in at least three genes, for example, at least three of the genes listed in Table 2 (e.g., four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or all of them). These three genes may be, for example, AmoA1 and AmoA2 and AmoA3, AmoC1 and AmoC2 and AmoC3, or Hao1 and Hao2 and Hao3.

[0027] In some embodiments, the bacterium or preparation contains at least one structural difference from a wild-type bacterium such as N. eutropha strain C91, for example, at least one mutation. In some embodiments, the bacterium or preparation contains nucleic acids that can be amplified using a pair of primers described herein, for example, a primer containing the sequence of SEQ ID NO: 64 and a primer containing the sequence of SEQ ID NO: 65. In some embodiments, the bacterium or preparation contains nucleic acids or proteins that are at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, or 100% identical to the gene of Figure 6, 7, or 8 or the protein encoded by the gene of Figure 6, 7, or 8. In some embodiments, the bacterium or preparation contains nucleic acids or proteins that are at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, or 100% identical to any sequence of SEQ ID NOs: 64-66 or the protein encoded by any sequence of SEQ ID NOs: 64-66.

[0028] In some aspects, the disclosure relates, among other things, to the ammonia monooxygenase gene, the hydroxylamine oxidoreductase gene, the cytochrome c554 gene, or cytochrome c mThis invention provides N. eutropha bacteria or a purified preparation thereof containing a mutation in gene 552. This mutation may be in wild-type bacteria such as N. eutropha strain C91. This mutation may occur in one or more of the amoA1, amoA2, amoB1, amoB2, and amoC3 genes. This N. eutropha bacterium or a purified preparation thereof may have the mutation at the locations described herein, for example, at the locations listed in Table 2. This N. eutropha bacterium or a purified preparation thereof may have the mutation, and the mutation is one of the mutations described herein, for example, the mutations listed in Table 2.

[0029] In some embodiments, this mutation may occur in one or more of the hao1, hao2, or hao3 genes. The N. eutropha bacterium or a purified preparation thereof may have mutations at the locations described herein, for example, at the locations listed in Table 2. The N. eutropha bacterium or a purified preparation thereof may have mutations, said mutations being the mutations described herein, for example, the mutations listed in Table 2.

[0030] In some embodiments, this mutation may occur in one or more of the c554 cycA1, c554 cycA2, and c554 cycA3 genes. The N. eutropha bacterium, or a purified preparation thereof, may have mutations at the locations described herein, for example, at the locations listed in Table 2. The N. eutropha bacterium, or a purified preparation thereof, may have mutations, such as those described herein, for example, those listed in Table 2.

[0031] In some embodiments, this mutation is c M 552 cycB1 gene and c MThis may occur in one or more of the 552 cycB2 genes. The N. eutropha bacterium, or a purified preparation thereof, may have mutations at the locations described herein, for example, at the locations listed in Table 2. The N. eutropha bacterium, or a purified preparation thereof, may have mutations, and such mutations may be the mutations described herein, for example, the mutations listed in Table 2.

[0032] In certain embodiments, the N. eutropha bacteria or purified preparations thereof described in the preceding four paragraphs may be based on N. eutropha bacteria having at least one characteristic selected from the following, e.g., optimized N. eutropha, e.g., purified optimized N. eutropha preparation: Optimized growth rate, Optimized NH4 + Oxidation rate, and Ammonium ion (NH4 + ) Resistance to optimization.

[0033] In certain embodiments, the N. eutropha bacteria described in the preceding five paragraphs, or a purified preparation thereof, contains the amoA1 gene, amoA2 gene, amoB1 gene, amoB2 gene, amoC3 gene, hao1 gene, hao2 gene, hao3 gene, c554 cycA1 gene, c554 cycA2 gene, c554 cycA3 gene, c M The 552 cycB1 gene and the c554 cycB2 gene may have mutations at at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 positions.

[0034] In some embodiments, the N. eutropha bacterium has an optimized growth rate, e.g., the optimized growth rate described herein, and structural differences, e.g., mutations (e.g., from wild-type strains such as N. eutropha strain C91), e.g., mutations described herein, e.g., mutations in Table 2. In some embodiments, the N. eutropha bacterium has an optimized NH4 + Oxidation rate, for example, the optimized NH4 described herein. + The oxidation rate and structural differences include, for example, mutations (e.g., from wild-type strains such as N. eutropha strain C91), for example, the mutations described herein, for example, the mutations in Table 2. In some embodiments, the N. eutropha bacterium is NH4 + Optimization resistance to, for example, NH4 as described herein. + It has optimized resistance to and structural differences, such as mutations (for example, from wild-type strains such as N. eutropha strain C91), such as the mutations described herein, such as the mutations in Table 2.

[0035] In some embodiments, the N. eutropha bacterium comprises nucleic acids that can be amplified using a pair of primers described herein, for example, a primer containing the sequence of SEQ ID NO: 64 and a primer containing the sequence of SEQ ID NO: 65.

[0036] In certain embodiments, the present disclosure provides a bacterium N. eutropha (optionally pure) containing a chromosome that is highly stringent and hybridizes to Sequence ID No. 1.

[0037] In several embodiments, this chromosome hybridizes to Sequence ID No. 1 with very high stringency. In several embodiments, the N. eutropha bacterium (optionally pure) contains at least approximately 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical genes to one or more genes in Figures 6–8 (e.g., 10, 20, 30, 40, 50, 100, or all genes in any one of Figures 6, 7, and 8).

[0038] In several embodiments, the N. eutropha bacterium (optionally pure) is used in Stein et al. Whole-genome analysis of the ammonia-oxidizing bacterium, Nitrosomonas As described in *eutropha C91:implications for niche adaptation*, Environmental Microbiology (2007) 9(12), 2993-3007, it lacks any plasmid that is at least approximately 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to Sequence ID No. 2 (pNeut1) or Sequence ID No. 3 (pNeut2). In several embodiments, this N. eutropha (optionally pure) lacks one or more genes present on the plasmid of Sequence ID No. 2 or Sequence ID No. 3. For example, this N. eutropha (optionally pure) may lack at least 2, 3, 4, 5, 10, 15, or 20 genes present on either or both of pNeut1 and pNeut2. pNeut1 contains 55 protein-coding sequences, while pNeutP2 contains 52 protein-coding sequences. In several embodiments, the N. eutropha bacterium (optionally pure) lacks any plasmid.

[0039] In certain embodiments, the Disclosure provides a bacterium *N. eutropha* (optionally pure) containing one or more of the amoA1 gene which is at least about 98.9% identical to SEQ ID NO: 7 and the amoA2 gene which is at least about 98.8% identical to SEQ ID NO: 13.

[0040] In certain embodiments, the Disclosure provides a bacterium *N. eutropha* (optionally pure) comprising one or more of the following: an AmoA1 protein that is at least about 99.0% identical to SEQ ID NO: 6 and an AmoA2 protein that is at least about 99.0% identical to SEQ ID NO: 12.

[0041] In certain embodiments, the Disclosure provides a N. eutropha bacterium (optionally pure) comprising one or more of the amoB1 gene which is at least about 99.2% identical to SEQ ID NO: 9 and the amoB2 gene which is at least about 99.2% identical to SEQ ID NO: 15.

[0042] In some embodiments, the N. eutropha bacterium (optionally pure) further comprises one or more amoA1 or amoA2 genes that are at least about 98.9% identical to SEQ ID NO: 7 or 13.

[0043] In certain embodiments, the Disclosure provides a N. eutropha bacterium (optionally pure) comprising one or more AmoB1 proteins that are at least about 99.6% identical to SEQ ID NO: 8 and at least about 99.6% identical to SEQ ID NO: 14.

[0044] In some embodiments, the N. eutropha bacterium (optionally pure) further comprises one or more of the AmoA1 protein that is at least about 99.0% identical to SEQ ID NO: 6 and the AmoA2 protein that is at least about 99.0% identical to SEQ ID NO: 12.

[0045] In certain embodiments, the Disclosure provides a bacterium *N. eutropha* (optionally pure) comprising one or more of the following: an amoC1 gene that is at least about 99.9% identical to SEQ ID NO: 5, an amoC2 gene that is at least about 99.9% identical to SEQ ID NO: 11, and an amoC3 gene that is at least about 99.0% identical to SEQ ID NO: 17.

[0046] In some embodiments, the N. eutropha bacterium (optionally pure) further comprises one or more of the following: an amoA1 gene at least about 98.9% identical to sequence number 7, an amo2 gene at least about 98.9% identical to sequence number 13, an amoB1 gene at least about 99.2% identical to sequence number 9, and an amoB2 gene at least about 99.2% identical to sequence number 15.

[0047] In certain embodiments, the present disclosure provides a bacterium *N. eutropha* (optionally pure) containing an AmoC3 protein that is at least about 99.4% identical to SEQ ID NO: 16.

[0048] In some embodiments, the N. eutropha bacterium (optionally pure) further comprises one or more of the following: AmoA1 protein at least about 99.0% identical to SEQ ID NO: 6, AmoA2 protein at least about 99.0% identical to SEQ ID NO: 12, AmoB1 protein at least about 99.6% identical to SEQ ID NO: 8, and AmoB1 protein at least about 99.6% identical to SEQ ID NO: 14.

[0049] In certain embodiments, the Disclosure provides a bacterium *N. eutropha* (optionally pure) comprising one or more of the following: a hao1 gene that is at least about 99.1% identical to SEQ ID NO: 19, a hao2 gene that is at least about 99.5% identical to SEQ ID NO: 21, and a hao3 gene that is at least about 99.3% identical to SEQ ID NO: 23.

[0050] In some embodiments, the N. eutropha bacterium (optionally pure) further comprises one or more of the following: an amoA1 gene at least about 98.9% identical to SEQ ID NO: 7, an amo2 gene at least about 98.9% identical to SEQ ID NO: 13, an amoB1 gene at least about 99.2% identical to SEQ ID NO: 9, an amoB2 gene at least about 99.2% identical to SEQ ID NO: 15, an amoC1 gene at least about 99.9% identical to SEQ ID NO: 5, an amoC2 gene at least about 99.9% identical to SEQ ID NO: 11, and an amoC3 gene at least about 99.0% identical to SEQ ID NO: 17.

[0051] In certain embodiments, the Disclosure provides a bacterium *N. eutropha* (optionally pure) comprising one or more of the following: a Hao1 protein that is at least about 99.6% identical to SEQ ID NO: 18, a Hao2 protein that is at least about 99.7% identical to SEQ ID NO: 20, and a Hao3 protein that is at least about 99.7% identical to SEQ ID NO: 22.

[0052] In several embodiments, the N. eutropha bacterium (optionally pure) further comprises an AmoA1 protein at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 8, an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 14, or an AmoC3 protein at least about 99.4% identical to SEQ ID NO: 16.

[0053] In certain embodiments, the Disclosure provides a N. eutropha bacterium (optionally pure) comprising one or more of the following: a cycA1 gene that is at least about 98.1% identical to SEQ ID NO: 25, a cycA2 gene that is at least about 98.8% identical to SEQ ID NO: 27, and a cycA3 gene that is at least about 99.4% identical to SEQ ID NO: 28.

[0054] In some embodiments, the N. eutropha bacterium (optionally pure) further comprises one or more of the following genes: amoA1 gene at least about 98.9% identical to SEQ ID NO: 7, amo2 gene at least about 98.9% identical to SEQ ID NO: 13, amoB1 gene at least about 99.2% identical to SEQ ID NO: 9, amoB2 gene at least about 99.2% identical to SEQ ID NO: 15, amoC1 gene at least about 99.9% identical to SEQ ID NO: 5, amoC2 gene at least about 99.9% identical to SEQ ID NO: 11, amoC3 gene at least about 99.0% identical to SEQ ID NO: 17, hao1 gene at least about 99.1% identical to SEQ ID NO: 19, hao2 gene at least about 99.5% identical to SEQ ID NO: 21, and hao3 gene at least about 99.3% identical to SEQ ID NO: 23.

[0055] In certain embodiments, the Disclosure provides a bacterium *N. eutropha* (optionally pure) comprising one or more of the following: a CycA1 protein that is at least about 99.2% identical to SEQ ID NO: 24, a CycA2 protein that is at least about 99.7% identical to SEQ ID NO: 26, and a CycA3 protein that is at least about 99.7% identical to SEQ ID NO: 28.

[0056] In some embodiments, the N. eutropha bacterium (optionally pure) further comprises one or more of the following proteins: AmoA1 protein at least about 99.0% identical to SEQ ID NO: 6, AmoA2 protein at least about 99.0% identical to SEQ ID NO: 12, AmoB1 protein at least about 99.6% identical to SEQ ID NO: 8, AmoB1 protein at least about 99.6% identical to SEQ ID NO: 14, AmoC3 protein at least about 99.4% identical to SEQ ID NO: 16, Hao1 protein at least about 99.6% identical to SEQ ID NO: 18, Hao2 protein at least about 99.7% identical to SEQ ID NO: 20, and Hao3 protein at least about 99.7% identical to SEQ ID NO: 22.

[0057] In certain embodiments, the Disclosure provides a N. eutropha bacterium (optionally pure) comprising one or more of the cycB1 gene that is at least about 96.8% identical to SEQ ID NO: 31 and the cycB2 gene that is at least about 97.2% identical to SEQ ID NO: 33.

[0058] In several embodiments, the N. eutropha bacterium (optionally pure) has at least approximately 98.9% identical amoA1 gene to SEQ ID NO: 7, at least approximately 98.9% identical amo2 gene to SEQ ID NO: 13, at least approximately 99.2% identical amoB1 gene to SEQ ID NO: 9, at least approximately 99.2% identical amoB2 gene to SEQ ID NO: 15, at least approximately 99.9% identical amoC1 gene to SEQ ID NO: 5, at least approximately 99.9% identical amoC2 gene to SEQ ID NO: 11, SEQ ID NO: It further includes one or more of the following: the amoC3 gene which is at least approximately 99.0% identical to sequence number 17; the hao1 gene which is at least approximately 99.1% identical to sequence number 19; the hao2 gene which is at least approximately 99.5% identical to sequence number 21; the hao3 gene which is at least approximately 99.3% identical to sequence number 23; the cycA1 gene which is at least approximately 98.1% identical to sequence number 25; the cycA2 gene which is at least approximately 98.8% identical to sequence number 27; and the cycA3 gene which is at least approximately 99.4% identical to sequence number 28.

[0059] In certain embodiments, the Disclosure provides a bacterium *N. eutropha* (optionally pure) containing one or more CycB1 proteins that are at least about 97.2% identical to SEQ ID NO: 30 or CycB2 proteins that are at least about 98.8% identical to SEQ ID NO: 32.

[0060] In some embodiments, the N. eutropha bacterium (optionally pure) further comprises one or more of the following: AmoA1 protein at least about 99.0% identical to SEQ ID NO: 6, AmoA2 protein at least about 99.0% identical to SEQ ID NO: 12, AmoB1 protein at least about 99.6% identical to SEQ ID NO: 8, AmoB1 protein at least about 99.6% identical to SEQ ID NO: 14, AmoC3 protein at least about 99.4% identical to SEQ ID NO: 16, Hao1 protein at least about 99.6% identical to SEQ ID NO: 18, Hao2 protein at least about 99.7% identical to SEQ ID NO: 20, Hao3 protein at least about 99.7% identical to SEQ ID NO: 22, CycA1 protein at least about 99.2% identical to SEQ ID NO: 24, CycA2 protein at least about 99.7% identical to SEQ ID NO: 26, and CycA3 protein at least about 99.7% identical to SEQ ID NO: 28.

[0061] In certain embodiments, the Disclosure provides a bacterium *N. eutropha* (optionally pure) containing one or more genes represented by Sequence IDs 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33.

[0062] In certain embodiments, the Disclosure provides a bacterium *N. eutropha* (optionally pure) containing one or more proteins as specified by Sequence IDs 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, and 32.

[0063] In certain embodiments, the Disclosure provides N. eutropha bacteria (optionally pure) containing proteins that are mutants of at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, or all of the amino acid positions listed in Table 2 of N. eutropha strain C91.

[0064] In certain embodiments, the Disclosure provides N. eutropha bacteria (optionally pure) containing proteins that are mutants of all the amino acid positions listed in Table 2 of N. eutropha strain C91.

[0065] In a particular aspect, the Disclosure provides strain D23 of the bacterium N. eutropha (optionally pure), and 25 vials of the bacterium designated AOB D23-100 were deposited with the ATCC Patent Depository Office on 8 April 2014 under ATCC accession number PTA-121157.

[0066] In several embodiments, the N. eutropha bacterium (optionally in pure form) is transgenic.

[0067] In several embodiments, the N. eutropha bacterium (optionally pure) is used to optimize growth rate and optimize NH4 + Oxidation rate, and NH4 + It has at least one property selected from its resistance to optimization.

[0068] In several embodiments, the N. eutropha bacterium (optionally pure) is used to optimize growth rate and optimize NH4 + Oxidation rate, and NH4 + It has at least two properties selected from its resistance to optimization.

[0069] In several embodiments, the N. eutropha bacterium (optionally pure) is used to optimize growth rate and optimize NH4 + Oxidation rate, and NH4 + It has resistance to optimization.

[0070] In some embodiments, the N. eutropha bacteria described herein (e.g., strain D23) substantially does not include bacteria, other ammonia-oxidizing bacteria, fungi, viruses, or pathogens (e.g., animal pathogens, e.g., human pathogens), or any combination thereof.

[0071] In certain embodiments, the present disclosure provides compositions comprising the N. eutropha bacterium described herein (e.g., strain D23) and substantially free of other organisms.

[0072] In certain embodiments, the Disclosure provides a composition comprising the N. eutropha bacterium described herein (e.g., strain D23), further comprising a second organism (e.g., a second strain or species), and substantially comprising other organisms (e.g., strains or species). In some embodiments, the second organism is an ammonia-oxidizing bacterium. In some embodiments, the second organism is selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, Lactobacillus, Streptococcus, and Bifidobacter, and combinations thereof.

[0073] This disclosure also provides compositions comprising the N. eutropha bacterium described herein (e.g., strain D23), further comprising second and third organisms (e.g., other strains or species), and substantially free of other organisms (e.g., strains or species). This disclosure also provides compositions comprising the N. eutropha bacterium described herein (e.g., strain D23), further comprising 2, 3, 4, 5, 6, 7, 8, 9, or 10 other organisms (e.g., other strains or species), and substantially free of other organisms (e.g., strains or species).

[0074] In some embodiments, the present disclosure provides compositions comprising a cell suspension of an actively dividing culture of N. eutropha bacteria having an OD600 of at least about 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.6, 0.7, or 0.8, and substantially free of other organisms.

[0075] In some embodiments, the Disclosure provides compositions for topical administration comprising the N. eutropha bacterium described herein (e.g., strain D23) and pharmaceutically or cosmetically acceptable excipients suitable for topical administration. In some embodiments, the compositions are substantially free of other organisms. In some embodiments, the compositions further comprise a second organism (e.g., another strain or species). In some embodiments, the compositions further comprise two, three, four, five, six, seven, eight, nine, or ten other organisms (e.g., other strains or species). The second organism may be, for example, ammonia-oxidizing bacteria. In some embodiments, the second organism is selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, Lactobacillus, Streptococcus, and Bifidobacter, and combinations thereof.

[0076] In several embodiments, the composition is a powder, cosmetic, cream, stick, aerosol, ointment, wipe, or bandage. In several embodiments, the composition further comprises a humectant, deodorant, fragrance, colorant, insecticide, cleansing agent, or UV blocker. In several embodiments, the excipients are anti-adhesive, binder, coating, disintegrant, filler, flavoring, color, lubricant, adsorbent, preservative, or sweetener. In several embodiments, the concentration of N. eutropha in the composition is about 10 11 ~10 13 The concentration is CFU / L. In several embodiments, the concentration of N. eutropha in the composition is about 10 9The concentration is CFU / ml. In several embodiments, the mass ratio of N. eutropha to the pharmaceutically acceptable excipient can range from about 0.1 g / L to about 100 g / L. In some embodiments, the mass ratio of N. eutropha to the pharmaceutically acceptable excipient is 1 g / L.

[0077] In some embodiments, the composition and / or excipients may be in one or more forms of liquid, solid, or gel. For example, liquid suspensions may include, but are not limited to, water, saline, phosphate-buffered saline, or ammonia oxidation storage buffer. Gel formulations may include, but are not limited to, agar, silica, polyacrylic acid (e.g., Carbopol®), carboxymethylcellulose, starch, guar gum, alginate, or chitosan. In some embodiments, the formulation may be supplemented with an ammonia source, but is not limited to, ammonium chloride or ammonium sulfate. In some embodiments, the disclosure may extend, for example, about 10 11 CFU / L, 10 12 CFU / L, 10 13 The present invention provides compositions comprising at least about 10, 20, 50, 100, 200, 500, 1,000, 2,000, or 10,000 L of the N. eutropha bacteria described herein (e.g., strain D23) in CFU / L. In some embodiments, the composition comprises at least about 10 9 CFU / L, 10 10 CFU / L, 10 11 CFU / L, or 10 12 The concentration is CFU / L. In some embodiments, the present disclosure provides a composition containing at least about 1, 2, 5, 10, 20, 50, 100, 200, or 500 g of the N. eutropha bacteria described herein, for example, as a dry formulation such as a powder.

[0078] In some embodiments, the Disclosure provides garments containing N. eutropha (e.g., strain D23) as described herein. In some embodiments, the garments are packaged. In some embodiments, the garments are packaged in a material resistant to gas exchange or a material resistant to water. The garments may be provided in concentrations that provide, for example, one or more of the following: treatment or prevention of skin disorders, treatment or prevention of diseases or conditions associated with low nitrite levels, treatment or prevention of body odor, treatment for supplying nitric oxide, or treatment for inhibiting microbial growth.

[0079] In some embodiments, the present disclosure provides a fabric comprising N. eutropha (e.g., strain D23) as described herein.

[0080] In some embodiments, the present disclosure provides knitting yarns comprising N. eutropha (e.g., strain D23) as described herein.

[0081] In some embodiments, the present disclosure provides sewing threads comprising N. eutropha (e.g., strain D23) as described herein.

[0082] In some aspects, this disclosure relates to the optimization of growth rate and optimization of NH4 + Oxidation rate, or NH4 + A method for obtaining (optionally pure) N. eutropha bacteria with optimized resistance to, for example, (a) Optimized growth rate, optimized NH4 + Oxidation rate, or NH4 + The bacteria are cultured under conditions that allow for the selection of one or more optimized resistances to [the specified substance], thereby generating a culture. (b) Optimized growth rate, optimized NH4 + Oxidation rate, or NH4 + To test the optimized resistance to this, and to test the sample derived from this culture, (c) Optimized growth rate, optimized NH4 + Oxidation rate, or NH4 +The present invention provides a method comprising repeating the culture step and the test step until bacteria with optimized resistance to are obtained.

[0083] In several embodiments, the method includes the step of obtaining N. eutropha bacteria from a source such as soil or individual skin. In several embodiments, the method includes optimizing the growth rate and optimizing NH4. + Oxidation rate, or NH4 + Culturing this bacterium under conditions that select one or more (e.g., two or three) of the optimized resistances to NH4 is performed in a solution of approximately 200 mM NH4 + The method includes culturing the bacterium in N. europaea medium containing NH4. In some embodiments, the method includes a step of preparing a pure culture. In some embodiments, the method includes a step of co-culturing the N. eutropha with at least one other type of ammonia-oxidizing bacterium. In some embodiments, the N. eutropha in step (a) has an optimized growth rate, optimized NH4 + Oxidation rate, and NH4 + It lacks optimization tolerance to NH4. In some embodiments, step (c) is the optimization growth rate, optimization NH4 + Oxidation rate, and NH4 + The process includes repeating the culture step and the testing step until bacteria possessing at least two of the optimized resistances to the substance are obtained.

[0084] In some embodiments, the present disclosure provides a N. eutropha bacterium (e.g., strain D23) described herein that is produced by the method described above.

[0085] In some aspects, the present disclosure relates to a method for testing (optionally pure) N. eutropha preparations, Optimized growth rate, optimized NH4 + Oxidation rate, or NH4 + Assaying N. eutropha for one or more of the optimized resistances to, This N.eutropha optimizes growth rate and optimizes NH4 + Oxidation rate, or NH4+ The present invention provides a method that includes classifying N. eutropha as acceptable if it has one or more of the following optimization resistances:

[0086] In several embodiments, the method further includes the step of testing the preparation for contaminating organisms. In several embodiments, the method further includes the steps of taking a sample from the preparation and testing the sample. In several embodiments, the method further includes testing the culture medium in which the N. eutropha is cultured. In several embodiments, the method further includes packaging the N. eutropha from the preparation into a package. In several embodiments, the method further includes commercializing the N. eutropha from the preparation.

[0087] In some embodiments, the Disclosure provides a method for producing, for example, N. eutropha, comprising contacting N. eutropha with a culture medium and culturing the N. eutropha until an OD600 of at least about 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 is reached. In some embodiments, the Method comprises culturing the N. eutropha until an OD600 of about 0.3–0.4, 0.4–0.5, 0.5–0.6, 0.6–0.7, or 0.7–0.8 is reached.

[0088] In several embodiments, the method further includes assaying N. eutropha and the culture medium for contaminated organisms. In several embodiments, the method includes optimizing the growth rate and optimizing NH4 + Oxidation rate, or NH4 + The method further includes assaying N. eutropha for one or more (e.g., two or three) of the optimized resistances to the specified substance. In some embodiments, the method is performed for, for example, about 10 12Including generating at least about 10, 20, 50, 100, 200, 500, 1,000, 2,000, 5,000, or 10,000 L / day of N. eutropha at CFU / L. In some embodiments, this N. eutropha is about 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 CFU / L in concentration. In some embodiments, this N. eutropha is at least about 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 CFU / L in concentration.

[0089] In some aspects, the present disclosure is a method of generating, e.g., manufacturing N. eutropha, comprising contacting N. eutropha with a culture medium and culturing this N. eutropha until at least about 1,000 L of N. eutropha is generated at about 10 12 CFU / L.

[0090] In multiple embodiments, the method further comprises assaying this N. eutropha for one or more (e.g., two or three) of an optimized growth rate, an optimized NH4 + oxidation rate, or an optimized tolerance to NH4 + .

[0091] In multiple embodiments, the method further comprises testing this N. eutropha or this culture medium for contaminating organisms. In multiple embodiments, the N. eutropha contacting the culture medium is N. eutropha having one or more (e.g., two or three) of an optimized growth rate, an optimized NH_{4} + oxidation rate, or an optimized tolerance to NH4 + .

[0092] In some embodiments, the present disclosure relates to a method for producing, for example, N. eutropha, (a) Contacting N. eutropha with the culture medium, (b) A method is provided which includes culturing the present N. eutropha for 1 to 2 days until the culture reaches an OD600 of approximately 0.5 to 0.6, thereby producing the culture.

[0093] In several embodiments, this method optimizes the growth rate and optimizes NH4 + Oxidation rate, or NH4 + The method further includes the step of assaying the N. eutropha for one or more of the optimized resistances to NH4. In some embodiments, the method further includes the step of testing the culture for contaminating organisms, such as bacteria, viruses, fungi, or pathogens, or combinations thereof. In some embodiments, the N. eutropha in step (a) is assayed for optimized growth rate, optimized NH4. + Oxidation rate, or NH4 + N. eutropha having one or more (e.g., two or three) of the optimization resistances to the following. In some embodiments, the method is approximately 10 12 This includes producing at least approximately 1,000 L / day of N. eutropha at a CFU / L rate.

[0094] In some embodiments, the present disclosure provides N. eutropha bacteria produced by the methods described above.

[0095] In several embodiments, the N. eutropha preparation is prepared by the method described above. In some embodiments, the preparation may contain about 0.1 milligrams to about 100 milligrams (mg) of N. eutropha.

[0096] In some embodiments, a reaction mixture containing N. eutropha with an optical density of about 0.5 to about 0.6 may be provided. In some embodiments, the Disclosure provides a method for producing garments having N. eutropha, comprising contacting a garment with N. eutropha described herein (e.g., strain D23).

[0097] In some embodiments, the method includes creating at least 10, 100, or 1000 garments. In some embodiments, the method includes creating at least 10 garments. 10 This includes contacting the CFU with N. eutropha. In some embodiments, the method further includes packaging the garment.

[0098] In certain embodiments, the present disclosure provides a method for obtaining a formulation of N. eutropha, which combines contact of N. eutropha described herein (e.g., strain D23) with a pharmaceutically or cosmetically acceptable excipient.

[0099] In some embodiments, the method further comprises mixing N. eutropha with an excipient. In some embodiments, the method is carried out under conditions that are substantially free of contaminating organisms, such as bacteria, viruses, fungi, or pathogens.

[0100] In certain embodiments, the Disclosure provides a method for packaging N. eutropha, which includes combining N. eutropha described herein (e.g., strain D23) into a package.

[0101] In several embodiments, the package is resistant to gas exchange or water. In several embodiments, the package is resistant to gas exchange, NH3, NH4 + , or NO2 - It is permeable to it.

[0102] In certain embodiments, the present disclosure provides a method for inhibiting microbial growth on the skin of a subject, comprising topically administering an effective dose of the specified N. eutropha bacterium (e.g., strain D23) to a subject requiring such inhibition.

[0103] In several embodiments, this effective dose is approximately 1 × 10⁻⁶ 9 CFU, 2x10 9 CFU, 5x10 9 CFU, 1x10 10 CFU, 1.5 x 10 10 CFU, 2x10 10 CFU, 5x10 10 CFU, or 1 x 10 11 This is a CFU. In several embodiments, this effective dose is at least about 1 × 10⁻⁶ 9 CFU, 2x10 9 CFU, 5x10 9 CFU, 1x10 10 CFU, 1.5 x 10 10 CFU, 2x10 10 CFU, 5x10 10 CFU, or 1 x 10⁻⁶ 11 This is a CFU. In several embodiments, this effective dose is approximately 1 × 10⁻⁶. 9 CFU ~2 x 10 9 CFU, 2x10 9 CFU ~5x10 9 CFU, 5x10 9 CFU~1x10 10 CFU, 1x10 10 CFU ~1.5 × 10 10 CFU, 1x10 10 CFU ~2 x 10 10 CFU, 1.5 x 10 10 CFU ~2 x 10 10 CFU, 2x10 10 CFU ~5x10 10 CFU, or 5x10 10 CFU~1x10 11 It is a CFU. In several embodiments, this bacterium is approximately 1 × 10⁶ 8 , 2×10 8 , 5×10 8 , 1 x 10 9, 2×10 9 , 5×10 9 , or 1 × 10 10 The bacteria are administered at a concentration of CFU / ml. In several embodiments, the bacteria are present at a concentration of at least approximately 1 × 10⁶. 8 , 2×10 8 , 5×10 8 , 1 x 10 9 , 2×10 9 , 5×10 9 , or 1 × 10 10 It is administered at a concentration of CFU / ml. In several embodiments, the bacterium is approximately 1 × 10⁶ 8 ~2×10 8 , 2×10 8 ~5×10 8 , 5×10 8 ~1 × 10 9 , 1 x 10 9 ~2×10 9 , 2×10 9 ~5×10 9 , or 5×10 9 ~1 × 10 10 It is administered at a concentration of CFU / ml. In several embodiments, administration is performed twice daily. In several embodiments, the subject is human. In several embodiments, the inhibited microbial growth is that of Pseudomonas aeruginosa or Staphylococcus aureus (S. aureus or SA), Streptococcus pyogenes (S. pyogenes or SP), or Acinetobacter baumannii (A. baumannii or AB).

[0104] In certain embodiments, the Disclosure provides a method for supplying nitric oxide to a target, comprising positioning an effective dose of the specified N. eutropha bacteria (e.g., strain D23) in close proximity to the target.

[0105] In certain embodiments, the present disclosure provides a method for reducing body odor, comprising topically administering an effective dose of the specified N. eutropha bacteria (e.g., strain D23) to a subject in need thereof.

[0106] In certain embodiments, the present disclosure provides a method for treating a disease associated with low nitrite levels, comprising topically administering a therapeutically effective dose of the specified N. eutropha bacterium (e.g., strain D23) to a subject in need thereof.

[0107] In several embodiments, the disease is HIV dermatitis, infections in diabetic foot ulcers, atopic dermatitis, acne, e.g., acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, skin infections, vascular diseases, vaginal yeast infections, sexually transmitted diseases, heart diseases, atherosclerosis, baldness, lower leg ulcers following diabetes or bed restraint, angina pectoris, especially chronic stable angina, ischemic diseases, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrous organ degeneration, allergies, autoimmune sensitization, end-stage renal disease, obesity, impotence, or cancer.

[0108] In certain embodiments, the Disclosure provides a method for treating a skin disorder, comprising topically administering a therapeutically effective dose of the N. eutropha bacterium described herein (e.g., strain D23) to a subject in need thereof. In related embodiments, the Disclosure provides the N. eutropha bacterium described herein (e.g., strain D23) for treating disorders such as skin disorders. In related embodiments, the Disclosure provides the N. eutropha bacterium described herein (e.g., strain D23) for manufacturing a drug, for example, a drug for the treatment of skin disorders.

[0109] In several embodiments, the skin disorder is acne, e.g., acne vulgaris, rosacea, eczema, or psoriasis. In some embodiments, the skin disorder is an infection in ulcers, e.g., venous ulcers, e.g., leg ulcers, e.g., venous leg ulcers, e.g., diabetic foot ulcers. In some embodiments, topical administration includes pretreatment of the subject with N. eutropha, e.g., N. eutropha as described herein. In some embodiments, topical administration includes topical administration before the onset of the skin disorder. In some embodiments, topical administration includes topical administration after the onset of the skin disorder.

[0110] In certain embodiments, the Disclosure provides a method for promoting wound healing or closure, comprising administering an effective dose of the N. eutropha bacterium described herein (e.g., strain D23) to a wound. In related embodiments, the Disclosure provides the N. eutropha bacterium described herein (e.g., strain D23) for promoting wound healing. In related embodiments, the Disclosure provides the N. eutropha bacterium described herein (e.g., strain D23) for manufacturing a drug, for example, a drug for promoting wound healing.

[0111] In some embodiments, the wound contains one or more undesirable bacteria, such as pathogenic bacteria. In some embodiments, the wound contains S. aureus, P. aeruginosa, P. aeroginosa, or A. baumannii.

[0112] In several embodiments, N. eutropha is administered to a subject before the wound develops. In several embodiments, administration to a wound includes administration to a subject before the wound develops. In several embodiments, the method further includes administering N. eutropha (e.g., N. eutropha as described herein, e.g., strain D23) to a wound after the wound has developed. In some aspects, the disclosure provides a method for killing or inhibiting the growth of a pathogen, which includes bringing N. eutropha bacteria (e.g., N. eutropha as described herein, e.g., strain D23) into contact with the skin, e.g., applying it thereto.

[0113] In several embodiments, this pathogen contributes to one or more of the following conditions: HIV dermatitis, ulcers, e.g., venous ulcers, e.g., leg ulcers, e.g., venous leg ulcers, e.g., diabetic foot ulcer infections, atopic dermatitis, acne, e.g., acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, urticaria, rosacea, skin infections, vascular diseases, vaginal yeast infections, sexually transmitted diseases, heart diseases, atherosclerosis, baldness, leg ulcers following diabetes or bed restraint, angina pectoris, especially chronic stable angina pectoris, ischemic diseases, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrous organ degeneration, allergies, autoimmune sensitization, end-stage renal disease, obesity, impotence, pneumonia, primary immunodeficiency, epidermolysis bullosa, or cancer.

[0114] In several embodiments, the condition is an infection in an ulcer, e.g., a venous ulcer, e.g., a leg ulcer, e.g., a venous leg ulcer, e.g., a diabetic foot ulcer. In several embodiments, the condition is a venous leg ulcer. In several embodiments, the condition is acne, e.g., acne vulgaris. In several embodiments, the condition is acne vulgaris. In several embodiments, the pathogen is one or more of Propionibacterium acnes, Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pyogenes, or Acinetobacter baumannii. In several embodiments, the method further includes determining whether the subject requires the killing or inhibition of the growth of the pathogen, e.g., determining whether the subject requires the killing or inhibition of the growth of the pathogen. In several embodiments, the method further includes selecting a subject that requires the killing or inhibition of the growth of the pathogen.

[0115] In some embodiments, N. eutropha catalyzes the following reactions.

[0116] At a neutral pH, ammonia generated from ammonium under approximately neutral pH conditions is the initial reaction substrate. The conversion of ammonia to nitrite is carried out in two steps catalyzed by ammonia monooxygenase (Amo) and hydroxylamine oxidoreductase (Hao), respectively, as follows. [ka]

[0117] In some cases, reaction B is reported to produce nitrite (HNO2) at low pH, as follows: [ka]

[0118] In certain embodiments, when grown under batch culture conditions, N. eutropha has a doubling time of less than 4, 5, 6, 7, 8, 9, or 10 hours, for example, about 8 hours, for example, 7-9 hours, or 6-10 hours. In some embodiments, the doubling time is at least 3, 4, 5, or 6 hours under batch culture conditions. In some embodiments, when grown under chemostat (i.e., continuous culture) conditions, N. eutropha has a doubling time of less than 16, 18, 20, 22, 24, or 26 hours, for example, about 20 hours, for example, 19-21 hours, or 18-22 hours. In some embodiments, the doubling time is at least 10, 12, 14, 16, or 18 hours under chemostat conditions.

[0119] In certain embodiments, a continuous culture of N. eutropha with an OD600 of approximately 0.15–0.18 can reach an OD600 of approximately 0.5–0.6 in approximately 1–2 days. For example, in some embodiments, a continuous culture of N. eutropha can grow from an OD600 of approximately 0.15 to at least 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 over approximately 1 day, and in multiple embodiments, this culture can reach an OD in the range of 0.4–0.6 or 0.3–0.7 over approximately 1 day. In multiple embodiments, a continuous culture of N. eutropha can grow from an OD600 of approximately 0.15 to at least 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 over approximately 2 days, and in multiple embodiments, this culture can reach an OD in the range of 0.4–0.6 or 0.3–0.7 over approximately 2 days. In some embodiments, the continuous culture conditions are approximately 200 mM NH4 + This includes growth in a bioreactor in N. europaea medium optionally containing [specific compound]. In some embodiments, the continuous culture conditions are those presented in Example 2.

[0120] In certain embodiments, this N. eutropha contains at least about 50, 75, 125, or 150 micromoles of NO2. - / min, for example, approximately 100-150, 75-175, 75-125, 100-125, 125-150, or 125-175 micromoles / min, for example, approximately 125 micromoles NO2 - At a speed of / min, NH4 + (For example, about 200 mM) can be converted to nitrite (for example, reaching a maximum of about 180 mM). In some embodiments, the reaction rate is about 10 over 24 hours. 9 It is measured using approximately 1 L of chemostat culture at CFU / ml.

[0121] In a particular embodiment, N. eutropha contains at least 50 mM, 75 mM, 100 mM, 125 mM, 150 mM, 175 mM, 200 mM, 225 mM, 250 mM, 275 mM, or 300 mM, for example, about 150-200, 175-225, 200-250, 225-275, 250-300 mM, for example, about 200 mM or about 250 mM of NH4 + It can be grown in a medium containing (or NH3). In certain embodiments, the N. eutropha is grown in a bioreactor at these ammonium concentrations. In some embodiments, when the N. eutropha is grown at these ammonium concentrations, the nitrate or nitrite concentration can reach at least 60, 80, 100, 120, 140, 160, or 180 mM, for example, about 140–180, 160–200, or 140–200 mM, for example, about 160 mM or 180 mM.

[0122] In certain embodiments, the Disclosure provides a high-density culture of N. eutropha, for example, N. eutropha strain D23. For example, the high-density culture composition may include a cell suspension of an actively dividing culture of N. eutropha bacteria having an OD600 of at least about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, or 0.7, for example, about 0.2-0.6, 0.3-0.6, 0.4-0.6, 0.5-0.6, or 0.4-0.7, and the composition is substantially free of other organisms.

[0123] In some embodiments, N. eutropha is stable for at least 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months when stored at 4°C. In some embodiments, the storage method involves resuspending the cells in a buffer containing one or more of Na2HPO4 and MgCl2, for example, 50 mM Na2HPO4 and 2 mM MgCl2, for example, the storage buffer described in Example 2. For example, the storage conditions may be those specified in Example 2. In some embodiments, N. eutropha is stored in 200 mM NH4 before being stored at 4°C. +(pH 6 to 8, for example, 7) and cultured continuously. The stability may include one or more of 1) maintaining viability and 2) maintaining related characteristics such as the ability to produce a given level of nitrite.

[0124] In certain embodiments, NH4 + and NH3 may be used synonymously throughout the present disclosure.

[0125] The present disclosure provides, inter alia, a method of altering the composition of a subject's skin microbiome. The method includes administering, e.g., applying, a preparation comprising ammonia-oxidizing bacteria to the surface of the skin, wherein the amount and frequency of the administration, e.g., application, is sufficient to reduce the proportion of pathogenic bacteria on the surface of the skin.

[0126] In some embodiments, the ammonia-oxidizing bacteria are ubiquitous Gram-negative obligate chemolithoautotrophic bacteria having the unique ability to generate energy solely from the conversion of ammonia to nitrite.

[0127] In some embodiments, the method may further include selecting a subject based on a subject who requires a reduction in the proportion of pathogenic bacteria on the surface of the skin.

[0128] In some embodiments, the preparation comprising ammonia-oxidizing bacteria includes at least one of ammonia, ammonium salts, and urea.

[0129] In some embodiments, the preparation comprising ammonia-oxidizing bacteria includes a release control material, e.g., a sustained release material.

[0130] In some embodiments, the ammonia-oxidizing bacteria preparation contains one excipient, such as a pharmaceutically acceptable excipient or a cosmetically acceptable excipient. One excipient, such as a pharmaceutically acceptable excipient and a cosmetically acceptable excipient, may be suitable for one of topical administration, nasal administration, pulmonary administration, and gastrointestinal administration. One excipient, such as a pharmaceutically acceptable excipient and a cosmetically acceptable excipient, may be a surfactant. The surfactant may be selected from the group consisting of cocoamidopropyl betaine (ColaTeric COAB), polyethylene sorbitol ester (e.g., Tween 80), ethoxylated lauryl alcohol (RhodaSurf 6 NAT), sodium lauryl sulfate / sodium lauryl glucoside / cocoamidopropyl betaine (Plantapon 611 L UP), sodium lauryl sulfate (e.g., RhodaPex ESB 70 NAT), alkyl polyglucoside (e.g., Plantaren 2000 N UP), sodium lauryl sulfate (Plantaren 200), Dr. Bronner's Castile soap, lauramine oxide (ColaLux Lo), sodium dodecyl sulfate (SDS), alkyl polyglucoside polysulfonate (PolySufanate 160 P), sodium lauryl sulfate (Stepanol-WA Extra K), and any combination thereof. Dr. Bronner's Castile soap contains water, organic coconut oil, potassium hydroxide, organic olive oil, fair trade organic hemp oil, organic jojoba oil, citric acid, and tocopherol. In some embodiments, the excipient comprises one or more, such as all, of water, organic coconut oil, potassium hydroxide, organic olive oil, fair trade organic hemp oil, organic jojoba oil, citric acid, and tocopherol.

[0131] In some embodiments, the preparation may substantially contain no other organisms.

[0132] In some embodiments, the preparation is placed in a powder, cosmetic, cream, stick, aerosol, ointment, wipe, or bandage. The preparation may be provided as a powder, cosmetic, cream, stick, aerosol, ointment, wipe, or bandage.

[0133] In some embodiments, the preparation may contain a humectant, deodorant, fragrance, colorant, insecticide, cleansing agent, or UV-blocking agent.

[0134] In some embodiments, excipients, such as pharmaceutically acceptable or cosmetically acceptable excipients, may include anti-adhesives, binders, coatings, disintegrants, fillers, flavorings, colors, lubricants, adsorbents, preservatives, or sweeteners.

[0135] In some embodiments, the preparation containing ammonia-oxidizing bacteria is about 10 8 ~about 10 14 It may contain CFU / L. In certain embodiments, this preparation contains about 1 × 10⁻⁶ CFU / L. 9 CFU / L ~ approximately 10 x 10 9 May contain CFU / L

[0136] In some embodiments, the preparation containing ammonia-oxidizing bacteria may contain approximately 50 milligrams (mg) to approximately 1000 mg of ammonia-oxidizing bacteria.

[0137] In some embodiments, the mass ratio of ammonia-oxidizing bacteria to excipients, such as pharmaceutically acceptable excipients or cosmetically acceptable excipients, is in the range of about 0.1 g / L to about 1 g / L.

[0138] In some embodiments, this ammonia-oxidizing bacterial preparation is useful for the treatment or prevention of diseases or conditions associated with low nitrite levels, for the treatment or prevention of body odor, for the treatment of supplying nitric oxide, or for the treatment of microbial growth, such as inhibiting pathogenic bacterial growth.

[0139] In some embodiments, the ammonia-oxidizing bacteria are selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, and combinations thereof. The preparation may further include organisms selected from the group consisting of Lactobacillus, Streptococcus, Bifidobacter, and combinations thereof. In certain embodiments, the preparation is substantially free of organisms other than ammonia-oxidizing bacteria.

[0140] In some embodiments, the preparation containing ammonia-oxidizing bacteria may contain ammonia-oxidizing bacteria in a growth state. In some embodiments, the preparation containing ammonia-oxidizing bacteria may contain ammonia-oxidizing bacteria in a storage state.

[0141] In some embodiments, the methods of the present disclosure can be used to provide cosmetic products. In some embodiments, the methods of the present disclosure can be used to provide therapeutic products. The preparations may be useful in treating at least one of the following: HIV dermatitis, infections in diabetic foot ulcers, atopic dermatitis, acne, e.g., acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, urticaria, rosacea, skin infections, vascular diseases, vaginal yeast infections, sexually transmitted diseases, heart diseases, atherosclerosis, baldness, lower leg ulcers following diabetes or bed restraint, angina pectoris, especially chronic stable angina pectoris, ischemic diseases, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrous organ degeneration, allergies, autoimmune sensitization, end-stage renal disease, obesity, impotence, pneumonia, primary immunodeficiency, epidermolysis bullosa, or cancer.

[0142] In certain embodiments, this preparation may be useful in treating at least one of the following conditions: acne, such as acne vulgaris, eczema, psoriasis, urticaria, rosacea, and skin infections.

[0143] In some embodiments, the preparation may be provided in a container, and the preparation and the container may weigh less than about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 grams.

[0144] In some embodiments, the preparation contains about 0.1% to less than 10% of surfactant. In certain embodiments, the preparation may be substantially free of surfactant.

[0145] In some embodiments, the preparation may contain a chelating agent. In some embodiments, the preparation may be substantially free of a chelating agent.

[0146] In some embodiments, the method may involve applying the preparation about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 times per day. In certain embodiments, the preparation may be applied once per day. In certain other embodiments, the preparation may be applied twice per day.

[0147] In some embodiments, the preparation may be applied for approximately 1–3, 3–5, 5–7, 7–9, 5–10, 10–14, 12–18, 12–21, 21–28, 28–35, 35–42, 42–49, 49–56, 46–63, 63–70, 70–77, 77–84, or 84–91 days. In certain embodiments, the preparation may be applied for approximately 16 days.

[0148] In some embodiments, the method may further include obtaining a sample from the surface of skin. In certain embodiments, the method may further include isolating bacterial DNA from the sample. In certain embodiments, the method may further include sequencing bacterial DNA from the sample.

[0149] In some embodiments, administration of ammonia-oxidizing bacteria provides an increase in the proportion of non-pathogenic bacteria on the surface. In certain embodiments, the non-pathogenic bacteria can be commensal non-pathogenic bacteria. In certain embodiments, the non-pathogenic bacteria are commensal non-pathogenic bacteria of the genus Staphylococcus. In certain embodiments, the non-pathogenic bacteria can be the commensal non-pathogenic bacterium Staphylococcus epidermidis.

[0150] In some embodiments, the proportion of non-pathogenic Staphylococcus increases or is determined to increase after about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks. In certain embodiments, the proportion of the non-pathogenic bacterium Staphylococcus epidermidis increases or is determined to increase after about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks.

[0151] In some embodiments, potentially pathogenic Propionibacteria or Propionibacteria associated with disease decrease or are determined to decrease after about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks.

[0152] In some embodiments, potentially pathogenic Stenotrophomonas or Stenotrophomonas associated with disease decrease or are determined to decrease after about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks.

[0153] In some embodiments, the surface of the skin includes a wound.

[0154] In some embodiments, a method for treating acne, such as acne vulgaris, may be provided by one or more methods of the Disclosure. In some embodiments, a method for treating eczema may be provided by one or more methods of the Disclosure. In some embodiments, a method for treating psoriasis may be provided by one or more methods of the Disclosure. In some embodiments, a method for treating urticaria may be provided by one or more methods of the Disclosure. In some embodiments, a method for treating rosacea may be provided by one or more methods of the Disclosure. In some embodiments, a method for treating skin infections may be provided by one or more methods of the Disclosure. In some embodiments, a method for reducing the amount of undesirable bacteria on a surface of a subject is provided.

[0155] In some embodiments, the methods described herein (for example, a method for administering N. eutropha bacteria, e.g., strain D23, to a subject in need) further include treating the subject with an antibiotic. In some embodiments, the antibiotic is a tetracycline, lincosamide (e.g., clindamycin), macrolide (e.g., erythromycin), aminoglycoside (e.g., gentamicin), β-lactam (e.g., piperacillin), β-lactamase inhibitor (e.g., tazobactam), or any combination thereof (e.g., a combination of a β-lactam (e.g., piperacillin) and a β-lactamase inhibitor (e.g., tazobactam)). In some embodiments, the antibiotic is one to which the bacteria are susceptible. In some embodiments, the antibiotic is administered after the bacteria have achieved the desired therapeutic effect. In some embodiments, the antibiotic is one to which the bacteria are resistant. In some embodiments, the antibiotic is administered before or while the bacteria are producing their therapeutic effect.

[0156] It is understood that the compositions and methods described herein that involve bacteria may also involve multiple bacteria. For example, a method for administering N. eutropha bacteria may also involve administering multiple N. eutropha bacteria.

[0157] In certain embodiments, this disclosure also provides nucleic acids comprising a D23 genome, for example, a sequence of consecutive nucleotides (e.g., 15 to 100 nucleotides) from a gene provided herein, such as the gene sequences listed in Table 1, Figures 6-8, or Supplementary Table 1, or SEQ ID NO: 66, or any of the reverse complements described above. In related embodiments, this disclosure provides nucleic acids comprising a sequence of consecutive nucleotides (e.g., 15 to 100 nucleotides) from SEQ ID NO: 1 or its reverse complement. In related embodiments, this disclosure provides nucleic acids comprising a sequence of consecutive nucleotides (e.g., 15 to 100 nucleotides) from a gene in Table 1 (e.g., the sequences of SEQ ID NOs: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, or 33), or its reverse complement.

[0158] In some embodiments, the nucleic acid has other modifications, such as sequences or labels, that do not exist in nature, or both. In some embodiments, the sequence of consecutive nucleotides is not the sequence found in N. Eutropha strain C91. In some embodiments, the nucleic acid includes a heterologous sequence at the 5' end of a sequence of 15 to 100 consecutive nucleotides, or a heterologous sequence at the 3' end of a sequence of 15 to 100 consecutive nucleotides, or both. In some embodiments, the nucleic acid has nucleotide lengths of 10 to 15, 15 to 20, 20 to 25, 25 to 30, 30 to 24, or 35 to 40. In some embodiments, the nucleic acid is bound to a detectable label, such as a fluorescent label, or covalently bound to it. In some embodiments, the nucleic acid contains 10-15, 15-20, 20-25, 25-30, 30-24, 35-40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100 consecutive nucleotides from the D23 genome. In some embodiments, the nucleic acid contains at least about 10, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 consecutive nucleotides from the D23 genome. In some embodiments, the nucleic acid is DNA.

[0159] In some embodiments, the Disclosure provides compositions or kits comprising a first nucleic acid and a second nucleic acid. In some embodiments, the first nucleic acid comprises a sequence of nucleotides (e.g., 15 to 100 nucleotides) from the gene of SEQ ID NO: 1, SEQ ID NO: 66, Figures 6-8, or the gene of Table 1, or its reverse complement. In some embodiments, the second nucleic acid comprises a sequence of nucleotides (e.g., 15 to 100 nucleotides) from the gene of SEQ ID NO: 1, SEQ ID NO: 66, Figures 6-8, or the gene of Table 1, or its reverse complement. In some embodiments, the nucleic acid has a sequence that does not exist in nature, for example, a sequence not found in N. eutropha strain C91. In some embodiments, the first and second nucleic acids define the amplicons of the gene of Table 1 (e.g., the sequences of SEQ ID NOs: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, or 33), or their reverse complement.

[0160] In some embodiments, the first nucleic acid has a sequence corresponding to the first region of SEQ ID NO: 1, and the reverse complement of the second nucleic acid has a sequence corresponding to the second region of SEQ ID NO: 1, with the first and second regions separated by a distance suitable for PCR. In some embodiments, the reverse complement of the first nucleic acid has a sequence corresponding to the first region of SEQ ID NO: 1, and the second nucleic acid has a sequence corresponding to the second region of SEQ ID NO: 1, with the first and second regions separated by a distance suitable for PCR. In one embodiment, the distance suitable for PCR is 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 or fewer nucleotides of SEQ ID NO: 1. In some embodiments, the first and second nucleic acids describe the amplicon of SEQ ID NO: 1. In some embodiments, the first nucleic acid and the second nucleic acid each have a melting temperature (Tm) suitable for PCR, for example, a Tm of about 55–65°C or about 60–65°C. In some embodiments, the Tm of the first nucleic acid is within 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1°C of the Tm of the second nucleic acid.

[0161] In some embodiments, the first nucleic acid, the second nucleic acid, or each of the first and second nucleic acids further comprises a heterogeneous sequence at the 5' end of a sequence of consecutive nucleotides. Alternatively, or in combination, in some embodiments, the first nucleic acid, the second nucleic acid, or each of the first and second nucleic acids further comprises a heterogeneous sequence at the 3' end of a sequence of consecutive nucleotides from SEQ ID NO: 1 or SEQ ID NO: 66. In some embodiments, the first nucleic acid, the second nucleic acid, or each of the first and second nucleic acids has a nucleotide length of 15-20, 20-25, 25-30, 30-24, or 35-40. In some embodiments, the first nucleic acid, the second nucleic acid, or each of the first and second nucleic acids is bound to a detectable label, e.g., a fluorescent label, e.g., covalently. In some embodiments, the first nucleic acid comprises or consists of the sequence of SEQ ID NO: 64. In some embodiments, the second nucleic acid comprises or consists of the sequence of SEQ ID NO: 65. In some embodiments, the first nucleic acid, the second nucleic acid, or both are DNA.

[0162] In some embodiments, the composition or kit comprises at least two pairs (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 pairs) of primers, each pair recognizing a gene from Table 1 (e.g., sequence numbers 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, or 33) or its reverse complement amplicon. In some embodiments, the first pair of primers recognizes an amplicon of an Amo gene (e.g., AmoA1, AmoA2, AmoB1, AmoB2, AmoC1, AmoC2, or AmoC3), and the second pair of primers recognizes an amplicon of an Amo gene (e.g., AmoA1, AmoA2, AmoB1, AmoB2, AmoC1, AmoC2, or AmoC3). In some embodiments, the first pair of primers recognizes the amplicon of the AmoA gene (e.g., AmoA1 or AmoA2). In some embodiments, the second pair of primers recognizes the amplicon of the AmoB gene (e.g., AmoB1 or AmoB2). In some embodiments, the third pair of primers recognizes the amplicon of the AmoC gene (e.g., AmoC1, AmoC2, or AmoC3).

[0163] In some embodiments, the kit includes a first container containing a first nucleic acid and a second container containing a second nucleic acid. The kit may include, for example, further containers for a third, fourth, fifth, or sixth nucleic acid. In some embodiments, a pair of primers that recognize amplicons are stored in a single container.

[0164] In some aspects, this disclosure also provides nucleic acids comprising or consisting of the sequence of SEQ ID NO: 64. In some aspects, this disclosure also provides nucleic acids comprising or consisting of the sequence of SEQ ID NO: 65. In some aspects, this disclosure also provides molecules comprising the nucleic acids described herein and a detectable label, such as a fluorescent label. The nucleic acid may consist, for example, of the sequence of SEQ ID NO: 64 or SEQ ID NO: 65.

[0165] This disclosure provides compositions comprising a first molecule and a second molecule in some embodiments. In some embodiments, the first molecule comprises a nucleic acid as described herein, for example, a nucleic acid comprising the sequence of SEQ ID NO: 64, and optionally includes a detectable label, for example, a fluorescent label. In some embodiments, the second molecule comprises a nucleic acid as described herein, for example, a nucleic acid comprising the sequence of SEQ ID NO: 65, and optionally includes a detectable label, for example, a fluorescent label.

[0166] In some embodiments, the kit includes a first container in which a first molecule is placed and a second container in which a second molecule is placed.

[0167] In some embodiments, the kit described herein further comprises one or more of a buffer, an enzyme (e.g., a polymerase, such as a thermostable polymerase like Taq), a nucleotide (e.g., dNTP), and optionally a dye-labeled chain termination nucleotide (e.g., dideoxynucleotide), these components may be provided separately or as part of a single composition.

[0168] In certain embodiments, the Disclosure provides a method for detecting the presence of D23 N.eutropha nucleic acid in a sample, comprising: performing a polymerase chain reaction (PCR) on the sample using D23 N.eutropha-specific primers; and determining whether a PCR product was produced, wherein the presence of the PCR product indicates the presence of D23 N.eutropha nucleic acid in the sample. In some embodiments, at least two PCR reactions are performed, for example, PCR reactions 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the PCR reactions are performed in separate reaction volumes. In some embodiments, two or more PCR reactions are performed in multiples.

[0169] In some embodiments, D23 N.eutropha-specific primers are the first and second nucleic acids described herein, for example, the first and second nucleic acids derived from the composition or kit described herein. In some embodiments, the first primer contains or comprises the sequence of SEQ ID NO: 65, and the second primer contains or comprises the sequence of SEQ ID NO: 66.

[0170] In some embodiments, the PCR reaction is either a quantitative PCR reaction or a real-time PCR reaction. In some embodiments, the PCR reaction includes a TaqMan reaction. In some embodiments, the PCR reaction involves cycling the temperature of the reaction mixture between a denaturation temperature (e.g., about 95°C), an annealing temperature (e.g., 45–68°C, 55–65°C, or 60–65°C), and a stretching temperature (e.g., about 68°C) for a number of cycles sufficient to produce a detectable PCR product. In some embodiments, detection of the PCR product involves detecting fluorescence from the PCR product. In some embodiments, a positive control is performed using, for example, a known D23 N. eutropha nucleic acid as a template. In some embodiments, a negative control is used, for example, without a template or using another bacterial nucleic acid as a template.

[0171] In certain embodiments, the Disclosure provides a method for detecting the presence of D23 N.eutropha nucleic acid in a sample, comprising detecting the binding of the nucleic acid described herein to the sample, wherein the presence of binding indicates the presence of D23 N.eutropha nucleic acid in the sample. In some embodiments, binding is detected by primer extension or RNase protection.

[0172] In some embodiments of the methods herein, the sample comprises at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 bacterial strains. In some embodiments, the sample is derived from a subject, e.g., skin of a human subject. In some embodiments, the methods herein include detecting one or more further types of bacteria in the sample, e.g., Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pyogenes, or Acinetobacter baumannii. The present invention provides, for example, the following items. (Item 1) Optimized growth rate, Optimized NH4+ oxidation rate, and A purified, optimized Nitrosomonas eutropha (N. eutropha) bacterial preparation having at least one property selected from optimized resistance to NH4+. (Item 2) The N. eutropha bacterial preparation described in item 1, wherein the optimized growth rate is a rate that allows continuous culture of N. eutropha at an OD600 (optical density 600 nm) of approximately 0.15 to 0.18 to reach an OD600 of approximately 0.5 to 0.6 in approximately 1 to 2 days. (Item 3) The N. eutropha bacterial preparation according to item 1 or 2, wherein the optimized growth rate is a doubling time of approximately 8 hours when cultured under batch culture conditions. (Item 4) The N. eutropha bacterial preparation according to any one of items 1 to 3, wherein the optimized NH4+ oxidation rate is at least about 125 micromoles / min, which oxidizes NH4+ to NO2-. (Item 5) A N. eutropha bacterial preparation according to any one of items 1 to 4, wherein the optimized resistance to NH4+ is the ability to grow for at least about 48 hours in a medium containing about 200 mM NH4+. (Item 6) A N. eutropha bacterial preparation according to any one of items 1 to 5, having at least two properties selected from optimized growth rate, optimized NH4+ oxidation rate, and optimized resistance to NH4+. (Item 7) N. eutropha bacterial preparations as described in items 1-6, having optimized growth rate, optimized NH4+ oxidation rate, and optimized resistance to NH4+. (Item 8) A N. eutropha bacterial preparation described in any of items 1-7, containing a chromosome that hybridizes to Sequence ID No. 1 with very high stringency. (Item 9) AmoA protein having identity with SEQ ID NO: 6 or 12, selected from at least approximately 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; AmoB protein having identity with SEQ ID NO: 8 or 14, selected from at least approximately 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; amoC gene having identity with SEQ ID NO: 4, 10, or 16, selected from at least approximately 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; A N. eutropha bacterial preparation according to any of items 1 to 8, comprising: a hydroxylamine oxidoreductase protein having identity with SEQ ID NO: 18, 20, or 22, selected from and 100% identical; a cytochrome c554 protein having identity with SEQ ID NO: 24, 26, or 28, selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; or a cytochrome cM552 protein having identity with SEQ ID NO: 30 or 32, selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical. (Item 10) A N. eutropha bacterial preparation described in any of items 1-9, comprising sequence characteristics 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, or all of them, from Table 2. (Item 11) A N. eutropha bacterial preparation as described in item 10, comprising the AmoA1 or AmoA2 protein (or the gene encoding it) having a mutation at position 1, for example, V at position 1, of N. eutropha strain C91. (Item 12) A N. eutropha bacterial preparation according to any of items 10 to 11, comprising the AmoA1 or AmoA2 protein (or the gene encoding it) having a mutation at position 160, for example, L at position 160, of N. eutropha strain C91. (Item 13) A N. eutropha bacterial preparation according to any of items 10 to 12, comprising the AmoA1 or AmoA2 protein (or the gene encoding it) having a mutation at position 167 of N. eutropha strain C91, for example, at position 167 (A). (Item 14) A N. eutropha bacterial preparation according to any of items 10 to 13, comprising the AmoB1 or AmoB2 protein (or the gene encoding it) having a mutation at position 33 of N. eutropha strain C91, for example, at position 33, V. (Item 15) A N. eutropha bacterial preparation according to any of items 10-14, comprising the AmoB1 or AmoB2 protein (or the gene encoding it) having a mutation at position 165 of N. eutropha strain C91, for example, at position 165, I. (Item 16) A N. eutropha bacterial preparation as described in any of items 10-15, comprising the AmoC3 protein (or the gene encoding it) having a mutation at position 79, for example, A at position 79, of N. eutropha strain C91. (Item 17) A N. eutropha bacterial preparation as described in any of items 10-16, comprising the AmoC3 protein (or the gene encoding it) having a mutation at position 271 of N. eutropha strain C91, for example, at position 271 (V). (Item 18) A N. eutropha bacterial preparation according to any of items 10 to 17, comprising the Hao1, Hao2, or Hao3 protein (or the gene encoding it) having a mutation at position 85, for example, S at position 85, of N. eutropha strain C91. (Item 19) A N. eutropha bacterial preparation as described in any of items 10 to 18, comprising a Hao1, Hao2, or Hao3 protein (or the gene encoding it) having a mutation at position 312 of N. eutropha strain C91, for example, at position 312, E. (Item 20) A N. eutropha bacterial preparation as described in any of items 10-19, comprising the Hao1 protein (or the gene encoding it) having a mutation at position 163 of N. eutropha strain C91, for example, at position 163, A. (Item 21) A N. eutropha bacterial preparation as described in any of items 10 to 20, comprising a c554 CycA1, c554 CycA2, or c554 CycA3 protein (or the gene encoding it) having a mutation at position 65 of N. eutropha strain C91, for example, at position 65, T. (Item 22) A N. eutropha bacterial preparation as described in any of items 10-21, comprising the c554 CycA1 protein (or the gene encoding it) having a mutation at position 186 of N. eutropha strain C91, for example, a mutation at position 186 (T). (Item 23) A N. eutropha bacterial preparation according to any of items 10 to 22, comprising the cM552 CycB1 or cM552 CycB2 protein (or the gene encoding it) having a mutation at position 63 of N. eutropha strain C91, for example, at position 63, V. (Item 24) A N. eutropha bacterial preparation according to any of items 10 to 23, comprising the cM552 CycB1 or cM552 CycB2 protein (or the gene encoding it) having a mutation at position 189 of N. eutropha strain C91, for example, at position 189 (P). (Item 25) A N. eutropha bacterial preparation according to any of items 10 to 24, comprising the cM552 CycB1 or cM552 CycB2 protein (or the gene encoding it) having a mutation at position 206 of N. eutropha strain C91, for example, for insE at position 206. (Item 26) A N. eutropha bacterial preparation according to any of items 10 to 25, comprising the cM552 CycB1 or cM552 CycB2 protein (or the gene encoding it) having a mutation at position 207 of N. eutropha strain C91, for example, for insE at position 207. (Item 27) A N. eutropha bacterial preparation as described in any of items 10-26, comprising the cM552 CycB1 protein (or the gene encoding it) having a mutation at position 195 of N. eutropha strain C91, for example, for insD at position 195. (Item 28) A N. eutropha bacterial preparation as described in any of items 10-27, comprising the cM552 CycB1 protein (or the gene encoding it) having a mutation at position 196 of N. eutropha strain C91, for example, for insD at position 196. (Item 29) A N. eutropha bacterial preparation as described in any of items 10-28, comprising the cM552 CycB1 protein (or the gene encoding it) having a mutation at position 197 of N. eutropha strain C91, for example, for insD at position 197. (Item 30) An N. eutropha bacterial preparation as described in any of the preceding items, comprising at least one structural difference, e.g., at least one mutation, compared to a wild-type bacterium such as N. eutropha strain C91. (Item 31) A N. eutropha bacterial preparation according to any of the preceding items, comprising a pair of primers described herein, for example, a primer containing the sequence of SEQ ID NO: 64 and a primer containing the sequence of SEQ ID NO: 65, wherein the preparation comprises nucleic acids that can be amplified using such a pair of primers. (Item 32) A N. eutropha bacterial preparation as described in any of the preceding items, comprising nucleic acids or proteins that are at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, or 100% identical to the gene in Figure 6 or the protein encoded by the gene in Figure 6. (Item 33) A N. eutropha bacterial preparation as described in any of the preceding items, comprising nucleic acids or proteins that are at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, or 100% identical to any sequence among sequence numbers 64-66 or the protein encoded by any sequence among sequence numbers 64-66. (Item 34) N. eutropha bacteria, or a purified preparation thereof, containing mutations in the ammonia monooxygenase gene, hydroxylamine oxidoreductase gene, cytochrome c554 gene, or cytochrome cm552 gene that are inconsistent with wild-type bacteria such as N. eutropha strain C91. (Item 35) The N. eutropha bacterium described in item 34, or a purified preparation thereof, wherein the mutation is in the amoA1 gene. (Item 36) The N. eutropha bacterium described in item 34, or a purified preparation thereof, wherein the mutation is in the amoA2 gene. (Item 37) The N. eutropha bacterium described in item 34, or a purified preparation thereof, wherein the mutation is in the amoB1 gene. (Item 38) The N. eutropha bacterium described in item 34, or a purified preparation thereof, wherein the mutation is in the amoB2 gene. (Item 39) The N. eutropha bacterium described in item 34, or a purified preparation thereof, wherein the mutation is in the amoC3 gene. (Item 40) The N. eutropha bacterium described in any of items 34 to 39, or a purified preparation thereof, wherein the mutation is at a location described herein, for example, at a location listed in Table 2. (Item 41) The mutation is one of the mutations described herein, for example, the mutations listed in Table 2, and is a N. eutropha bacterium or a purified preparation thereof as described in any of items 34 to 39. (Item 42) The N. eutropha bacterium described in item 34, or a purified preparation thereof, wherein the mutation is in the hao1 gene. (Item 43) The N. eutropha bacterium described in item 34, or a purified preparation thereof, wherein the mutation is in the hao2 gene. (Item 44) The N. eutropha bacterium described in item 34, or a purified preparation thereof, wherein the mutation is in the hao3 gene. (Item 45) The N. eutropha bacterium described in any of items 42 to 44, or a purified preparation thereof, wherein the mutation is at a location described herein, for example, at a location listed in Table 2. (Item 46) The mutation is one of the mutations described herein, for example, the mutations listed in Table 2, and is a N. eutropha bacterium or a purified preparation thereof as described in any of items 42 to 44. (Item 47) The N. eutropha bacterium described in item 34, or a purified preparation thereof, wherein the mutation is in the c554 cycA1 gene. (Item 48) The N. eutropha bacterium described in item 34, or a purified preparation thereof, wherein the mutation is in the c554 cycA2 gene. (Item 49) The N. eutropha bacterium described in item 34, or a purified preparation thereof, wherein the mutation is in the c554 cycA3 gene. (Item 50) The N. eutropha bacterium described in any of items 47 to 49, or a purified preparation thereof, wherein the mutation is at a location described herein, for example, at a location listed in Table 2. (Item 51) The mutation is one of the mutations described herein, for example, the mutations listed in Table 2, and is a N. eutropha bacterium or a purified preparation thereof as described in any of items 47 to 49. (Item 52) The N. eutropha bacterium described in item 34, or a purified preparation thereof, wherein the mutation is in the cM552 cycB1 gene. (Item 53) The N. eutropha bacterium described in item 34, or a purified preparation thereof, wherein the mutation is in the c554 cycB2 gene. (Item 54) The N. eutropha bacterium described in any of items 52 to 53, or a purified preparation thereof, wherein the mutation is at a location described herein, for example, at a location described in Table 2. (Item 55) The mutation is one of the mutations described herein, for example, the mutations listed in Table 2, and is a N. eutropha bacterium or a purified preparation thereof as described in any of items 52 to 53. (Item 56) A purified, optimized N. eutropha bacterial preparation as described in item 1, containing mutations in the ammonia monooxygenase gene, hydroxylamine oxidoreductase gene, cytochrome c554 gene, or cytochrome cm552 gene. (Item 57) The purified and optimized N. eutropha bacterial preparation described in item 56, wherein the mutation is in the amoA1 gene. (Item 58) The purified and optimized N. eutropha bacterial preparation described in item 56, wherein the mutation is in the amoA2 gene. (Item 59) The purified and optimized N. eutropha bacterial preparation described in item 56, wherein the mutation is in the amoB1 gene. (Item 60) The purified and optimized N. eutropha bacterial preparation described in item 56, wherein the mutation is in the amoB2 gene. (Item 61) The purified and optimized N. eutropha bacterial preparation described in item 56, wherein the mutation is in the amoC3 gene. (Item 62) A purified, optimized N. eutropha bacterial preparation according to any of items 57-61, wherein the mutation is located at the position described herein, for example, at the position listed in Table 2. (Item 63) The purified and optimized N. eutropha bacterial preparation according to any of items 57-61, wherein the mutation is one of the mutations described herein, for example, the mutations listed in Table 2. (Item 64) The purified and optimized N. eutropha bacterial preparation described in item 56, wherein the mutation is in the hao1 gene. (Item 65) The purified and optimized N. eutropha bacterial preparation described in item 56, wherein the mutation is in the hao2 gene. (Item 66) The purified and optimized N. eutropha bacterial preparation described in item 56, wherein the mutation is in the hao3 gene. (Item 67) A purified, optimized N. eutropha bacterial preparation according to any of items 64-66, wherein the mutation is located at the position described herein, for example, at the position listed in Table 2. (Item 68) The purified and optimized N. eutropha bacterial preparation according to any of items 64-66, wherein the mutation is one of the mutations described herein, for example, the mutations listed in Table 2. (Item 69) The purified and optimized N. eutropha bacterial preparation described in item 56, wherein the mutation is in the c554 cycA1 gene. (Item 70) The purified and optimized N. eutropha bacterial preparation described in item 56, wherein the mutation is in the c554 cycA2 gene. (Item 71) The purified and optimized N. eutropha bacterial preparation described in item 56, wherein the mutation is in the c554 cycA3 gene. (Item 72) A purified, optimized N. eutropha bacterial preparation according to any of items 69-71, wherein the mutation is located at the position described herein, for example, at the position listed in Table 2. (Item 73) The purified and optimized N. eutropha bacterial preparation according to any of items 69 to 71, wherein the mutation is one of the mutations described herein, for example, the mutations listed in Table 2. (Item 74) The purified and optimized N. eutropha bacterial preparation described in item 56, wherein the mutation is in the cM552 cycB1 gene. (Item 75) The purified and optimized N. eutropha bacterial preparation described in item 56, wherein the mutation is in the cM552 cycB2 gene. (Item 76) A purified, optimized N. eutropha bacterial preparation according to any one of items 56, 74, and 75, wherein the mutation is located at a position as described herein, for example, at a position as described in Table 2. (Item 77) The purified optimized N. eutropha bacterial preparation according to any of items 56, 74, and 75, wherein the mutation is one of the mutations described herein, for example, the mutations listed in Table 2. (Item 78) N. eutropha bacteria as described in item 34, or a purified preparation thereof, having mutations at at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 positions in one or more of the amoA1, amoA2, amoB1, amoB2, amoB2, amoC3, hao1, hao2, hao3, c554 cycA1, c554 cycA2, c554 cycA3, cM552 cycB1, and c554 cycB2 genes. (Item 79) A purified and optimized N. eutropha bacterial preparation as described in item 56, having mutations at at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 positions in one or more of the amoA1, amoA2, amoB1, amoB2, amoC3, hao1, hao2, hao3, c554 cycA1, c554 cycA2, c554 cycA3, cM552 cycB1, and c554 cycB2 genes. (Item 80) N. eutropha bacteria containing a highly stringent chromosome that hybridizes to Sequence ID No. 1. (Item 81) The N. eutropha bacterium described in item 80, wherein the aforementioned chromosome hybridizes to Sequence ID No. 1 with very high stringency. (Item 82) A N. eutropha bacterium as described in item 80 or 81, containing at least one of the genes shown in Figures 6-8, or a gene having at least 80% identity with them. (Item 83) A N. eutropha bacterium described in item 80 or 81, containing at least one of the genes shown in Figures 6-8. (Item 84) A N. eutropha bacterium described in any of items 80-82, lacking any plasmid that is at least approximately 80% identical to Sequence ID No. 2 or Sequence ID No. 3. (Item 85) N. eutropha bacteria lacking any plasmid, as described in any of items 80-84. (Item 86) N. eutropha bacteria containing one or more of the following genes: the AmoA1 gene which is at least approximately 98.9% identical to SEQ ID NO: 7, and the amoA2 gene which is at least approximately 98.8% identical to SEQ ID NO: 13. (Item 87) N. eutropha bacteria containing one or more of the following: AmoA1 protein which is at least approximately 99.0% identical to SEQ ID NO: 6, and AmoA2 protein which is at least approximately 99.0% identical to SEQ ID NO: 12. (Item 88) N. eutropha bacteria containing one or more of the following: the amoB1 gene which is at least approximately 99.2% identical to sequence number 9; and the amoB2 gene which is at least approximately 99.2% identical to sequence number 15. (Item 89) The N. eutropha bacterium described in item 88 further comprises one or more AmoA1 or amoA2 genes that are at least approximately 98.9% identical to sequence number 7 or 13. (Item 90) N. eutropha bacteria containing one or more AmoB1 proteins that are at least approximately 99.6% identical to SEQ ID NO: 8 or at least approximately 99.6% identical to SEQ ID NO: 14. (Item 91) The N. eutropha bacterium described in item 90 further comprises one or more of the AmoA1 protein, which is at least approximately 99.0% identical to SEQ ID NO: 6, and the AmoA2 protein, which is at least approximately 99.0% identical to SEQ ID NO: 12. (Item 92) N. eutropha bacteria containing one or more of the following genes: the amoC1 gene which is at least approximately 99.9% identical to SEQ ID NO: 5, the amoC2 gene which is at least approximately 99.9% identical to SEQ ID NO: 11, and the amoC3 gene which is at least approximately 99.0% identical to SEQ ID NO: 17. (Item 93) The N. eutropha bacterium described in item 92 further comprises one or more of the following: the amoA1 gene which is at least approximately 98.9% identical to sequence number 7; the amo2 gene which is at least approximately 98.9% identical to sequence number 13; the amoB1 gene which is at least approximately 99.2% identical to sequence number 9; and the amoB2 gene which is at least approximately 99.2% identical to sequence number 15. (Item 94) N. eutropha bacteria containing the AmoC3 protein, which is at least approximately 99.4% identical to that of sequence number 16. (Item 95) The N. eutropha bacterium described in item 94 further comprises one or more of the following: an AmoA1 protein that is at least approximately 99.0% identical to SEQ ID NO: 6, an AmoA2 protein that is at least approximately 99.0% identical to SEQ ID NO: 12, an AmoB1 protein that is at least approximately 99.6% identical to SEQ ID NO: 8, and an AmoB1 protein that is at least approximately 99.6% identical to SEQ ID NO: 14. (Item 96) N. eutropha bacteria containing one or more of the following genes: hao1 gene which is at least approximately 99.1% identical to sequence number 19, hao2 gene which is at least approximately 99.5% identical to sequence number 21, and hao3 gene which is at least approximately 99.3% identical to sequence number 23. (Item 97) The N. eutropha bacterium described in item 96 further comprises one or more of the following: the amoA1 gene which is at least approximately 98.9% identical to SEQ ID NO: 7; the amo2 gene which is at least approximately 98.9% identical to SEQ ID NO: 13; the amoB1 gene which is at least approximately 99.2% identical to SEQ ID NO: 9; the amoB2 gene which is at least approximately 99.2% identical to SEQ ID NO: 15; the amoC1 gene which is at least approximately 99.9% identical to SEQ ID NO: 5; the amoC2 gene which is at least approximately 99.9% identical to SEQ ID NO: 11; and the amoC3 gene which is at least approximately 99.0% identical to SEQ ID NO: 17. (Item 98) N. eutropha bacteria containing one or more of the following proteins: Hao1 protein, which is at least approximately 99.6% identical to SEQ ID NO: 18; Hao2 protein, which is at least approximately 99.7% identical to SEQ ID NO: 20; and Hao3 protein, which is at least approximately 99.7% identical to SEQ ID NO: 22. (Item 99) The N. eutropha bacterium described in item 98 further comprises an AmoA1 protein that is at least approximately 99.0% identical to SEQ ID NO: 6, an AmoA2 protein that is at least approximately 99.0% identical to SEQ ID NO: 12, an AmoB1 protein that is at least approximately 99.6% identical to SEQ ID NO: 8, an AmoB1 protein that is at least approximately 99.6% identical to SEQ ID NO: 14, or an AmoC3 protein that is at least approximately 99.4% identical to SEQ ID NO: 16. (Item 100) N. eutropha bacteria containing one or more of the following genes: a cycA1 gene that is at least approximately 98.1% identical to sequence number 25, a cycA2 gene that is at least approximately 98.8% identical to sequence number 27, and a cycA3 gene that is at least approximately 99.4% identical to sequence number 28. (Item 101) The N. eutropha bacterium described in item 100 further comprises one or more of the following: the amoA1 gene which is at least approximately 98.9% identical to SEQ ID NO: 7; the amo2 gene which is at least approximately 98.9% identical to SEQ ID NO: 13; the amoB1 gene which is at least approximately 99.2% identical to SEQ ID NO: 9; the amoB2 gene which is at least approximately 99.2% identical to SEQ ID NO: 15; the amoC1 gene which is at least approximately 99.9% identical to SEQ ID NO: 5; the amoC2 gene which is at least approximately 99.9% identical to SEQ ID NO: 11; the amoC3 gene which is at least approximately 99.0% identical to SEQ ID NO: 17; the hao1 gene which is at least approximately 99.1% identical to SEQ ID NO: 19; the hao2 gene which is at least approximately 99.5% identical to SEQ ID NO: 21; and the hao3 gene which is at least approximately 99.3% identical to SEQ ID NO: 23. (Item 102) N. eutropha bacteria containing one or more of the following: CycA1 protein at least approximately 99.2% identical to SEQ ID NO: 24, CycA2 protein at least approximately 99.7% identical to SEQ ID NO: 26, and CycA3 protein at least approximately 99.7% identical to SEQ ID NO: 28. (Item 103) The N. eutropha bacterium described in item 102 further comprises one or more of the following: AmoA1 protein at least approximately 99.0% identical to SEQ ID NO: 6, AmoA2 protein at least approximately 99.0% identical to SEQ ID NO: 12, AmoB1 protein at least approximately 99.6% identical to SEQ ID NO: 8, AmoB1 protein at least approximately 99.6% identical to SEQ ID NO: 14, AmoC3 protein at least approximately 99.4% identical to SEQ ID NO: 16, Hao1 protein at least approximately 99.6% identical to SEQ ID NO: 18, Hao2 protein at least approximately 99.7% identical to SEQ ID NO: 20, and Hao3 protein at least approximately 99.7% identical to SEQ ID NO: 22. (Item 104) N. eutropha bacteria containing one or more of the following: a cycB1 gene that is at least approximately 96.8% identical to sequence number 31, and a cycB2 gene that is at least approximately 97.2% identical to sequence number 33. (Item 105) The amoA1 gene is at least approximately 98.9% identical to SEQ ID NO: 7, the amo2 gene is at least approximately 98.9% identical to SEQ ID NO: 13, the amoB1 gene is at least approximately 99.2% identical to SEQ ID NO: 9, the amoB2 gene is at least approximately 99.2% identical to SEQ ID NO: 15, the amoC1 gene is at least approximately 99.9% identical to SEQ ID NO: 5, the amoC2 gene is at least approximately 99.9% identical to SEQ ID NO: 11, the amoC3 gene is at least approximately 99.0% identical to SEQ ID NO: 17, and SEQ ID NO: The N. eutropha bacterium described in item 104 further comprises one or more of the following: the hao1 gene which is at least approximately 99.1% identical to 19; the hao2 gene which is at least approximately 99.5% identical to SEQ ID NO: 21; the hao3 gene which is at least approximately 99.3% identical to SEQ ID NO: 23; the cycA1 gene which is at least approximately 98.1% identical to SEQ ID NO: 25; the cycA2 gene which is at least approximately 98.8% identical to SEQ ID NO: 27; and the cycA3 gene which is at least approximately 99.4% identical to SEQ ID NO: 28. (Item 106) N. eutropha bacteria containing one or more of the following: a CycB1 protein that is at least approximately 97.2% identical to SEQ ID NO: 30, or a CycB2 protein that is at least approximately 98.8% identical to SEQ ID NO: 32. (Item 107) N. eutropha bacteria as described in item 106, further comprising one or more of the following: AmoA1 protein at least approximately 99.0% identical to SEQ ID NO: 6, AmoA2 protein at least approximately 99.0% identical to SEQ ID NO: 12, AmoB1 protein at least approximately 99.6% identical to SEQ ID NO: 8, AmoB1 protein at least approximately 99.6% identical to SEQ ID NO: 14, AmoC3 protein at least approximately 99.4% identical to SEQ ID NO: 16, Hao1 protein at least approximately 99.6% identical to SEQ ID NO: 18, Hao2 protein at least approximately 99.7% identical to SEQ ID NO: 20, Hao3 protein at least approximately 99.7% identical to SEQ ID NO: 22, CycA1 protein at least approximately 99.2% identical to SEQ ID NO: 24, CycA2 protein at least approximately 99.7% identical to SEQ ID NO: 26, and CycA3 protein at least approximately 99.7% identical to SEQ ID NO: 28. (Item 108) N. eutropha bacteria containing one or more genes according to sequence numbers 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33. (Item 109) N. eutropha bacteria containing one or more proteins according to SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, and 32. (Item 110) N. eutropha bacteria containing a protein that is a mutant for at least 1, 2, 3, 4, 5, 10, 15, 20, 25, or 30 of the amino acid positions listed in Table 2 of N. eutropha strain C91, or for all of them. (Item 111) N. eutropha bacteria containing a protein that is a mutant of all the amino acid positions listed in Table 2 of N. eutropha strain C91. (Item 112) A transgenic N. eutropha bacterium described in any one of items 1 through 111. (Item 113) N. eutropha bacteria as described in any one of items 80 to 112, having at least one property selected from optimized growth rate, optimized NH4+ oxidation rate, and optimized resistance to NH4+. (Item 114) N. eutropha bacteria as described in item 113, having at least two characteristics selected from optimized growth rate, optimized NH4+ oxidation rate, and optimized resistance to NH4+. (Item 115) N. eutropha bacteria as described in item 113, having optimized growth rate, optimized NH4+ oxidation rate, and optimized resistance to NH4+. (Item 116) A composition comprising the bacterium N. eutropha as described in any one of items 1 to 115, wherein the composition is substantially free of other organisms. (Item 117) A composition comprising the bacterium N. eutropha described in any one of items 1 to 115, further comprising a second organism, wherein the composition is substantially free of other organisms. (Item 118) The composition according to item 117, wherein the second organism is an ammonia-oxidizing bacterium. (Item 119) The composition according to item 117, wherein the second organism is selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, Lactobacillus, Streptococcus, and Bifidobacter, and combinations thereof. (Item 120) A composition comprising a cell suspension of an actively dividing culture of the bacterium N. eutropha having an OD600 of at least about 0.2, wherein the composition is substantially free of other organisms. (Item 121) A composition for topical administration comprising the N. eutropha bacterium described in any one of items 1 to 115, and a pharmaceutically or cosmetically acceptable excipient suitable for topical administration. (Item 122) The composition described in item 121, which substantially contains no other living organisms. (Item 123) The composition according to item 121, further comprising a second organism. (Item 124) The composition according to item 123, wherein the second organism is an ammonia-oxidizing bacterium. (Item 125) The composition according to item 123, wherein the second organism is selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, Lactobacillus, Streptococcus, and Bifidobacter, and combinations thereof. (Item 126) A composition according to any one of items 121 to 125, provided as a powder, cosmetic, cream, stick, aerosol, ointment, wipe, or bandage, or arranged therein. (Item 127) A composition according to any one of items 121 to 126, further comprising a humectant, deodorant, fragrance, colorant, insect repellent, cleansing agent, or UV blocker. (Item 128) The composition according to any one of items 121 to 127, wherein the excipient comprises an anti-adhesive, binder, coating agent, disintegrant, filler, flavoring agent, colorant, lubricant, adsorbent, preservative, or sweetener. (Item 129) The composition according to any one of items 121 to 128, wherein the concentration of N. eutropha in the composition is about 10¹¹ to 10¹² CFU / L. (Item 130) The composition according to any one of items 121 to 129, wherein the concentration of N. eutropha in the composition is about 10⁹ CFU / ml. (Item 131) A composition according to any one of items 121 to 130, wherein the mass ratio of N. eutropha to the pharmaceutical excipient is in the range of about 0.1 g / L to about 1 g / L. (Item 132) A composition comprising at least about 1,000 L of N. eutropha bacteria as described in any one of items 1 to 115, at a concentration of about 10¹² CFU / L. (Item 133) For example, a composition containing, as a dry preparation such as a powder, at least about 1, 2, 5, 10, 20, 50, 100, 200, or 500 g of N. eutropha bacteria as described in any one of items 1 to 115. (Item 134) For example, clothing containing N. eutropha as described in any one of items 1 to 115, in a concentration that provides one or more of the following: treatment or prevention of skin disorders, treatment or prevention of diseases or conditions associated with low nitrite levels, treatment or prevention of body odor, treatment for supplying nitric oxide, or treatment for inhibiting microbial growth. (Item 135) Clothing items as described in item 134, which are packaged. (Item 136) Clothing items as described in items 134-135, packaged in materials resistant to gas exchange or water. (Item 137) A cloth containing N. eutropha as described in any one of items 1 through 115. (Item 138) Knitting yarn containing N. eutropha as described in any one of items 1 through 115. (Item 139) Sewing thread containing N. eutropha as described in any one of items 1 through 115. (Item 140) A method for producing N. eutropha bacteria having an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized resistance to NH4+, for example, (a) Culturing the bacteria under conditions in which one or more of the following are selected: optimized growth rate, optimized NH4+ oxidation rate, or optimized resistance to NH4+, thereby producing a culture, (b) Test the sample derived from the culture for the optimized growth rate, optimized NH4+ oxidation rate, or optimized resistance to NH4+, (c) The method comprising repeating the culture step and the test step until bacteria having an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized resistance to NH4+ are obtained. (Item 141) The method according to item 140, further comprising the step of obtaining N. eutropha bacteria from a source. (Item 142) The method according to item 141, wherein the source is soil or the skin of an individual. (Item 143) The method according to item 142, comprising culturing the bacteria under conditions in which one or more of the following are selected: optimized growth rate, optimized NH4+ oxidation rate, or optimized resistance to NH4+, in N. europae medium containing approximately 200 mM NH4+. (Item 144) The method according to item 143, comprising the step of preparing a pure culture. (Item 145) The method according to item 143 or 144, comprising the step of co-culturing the aforementioned N. eutropha with at least one other type of ammonia-oxidizing bacteria. (Item 146) The method according to any one of items 140 to 145, wherein the N. eutropha in step (a) lacks an optimized growth rate, an optimized NH4+ oxidation rate, and an optimized resistance to NH4+. (Item 147) The method according to any one of items 140 to 146, wherein step (c) is to repeat the culture step and the test step until a bacterium having at least two of the following is obtained: an optimized growth rate, an optimized NH4+ oxidation rate, and an optimized resistance to NH4+. (Item 148) N. eutropha bacteria produced by any of the methods described in items 140-147. (Item 149) A method for testing N. eutropha preparations, Assaying N. eutropha for one or more of the following: optimized growth rate, optimized NH4+ oxidation rate, or optimized resistance to NH4+, The method comprising classifying N. eutropha as acceptable if it has one or more of the following: an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized resistance to NH4+. (Item 150) The method according to item 149, further comprising the step of testing the preparation for contaminating organisms. (Item 151) The method according to any one of items 149 to 150, further comprising the steps of taking a sample from the preparation and performing a test on the sample. (Item 152) The method according to any one of items 149 to 151, further comprising testing the culture medium in which the N. eutropha is cultured. (Item 153) The method according to any one of items 149 to 152, further comprising packaging N. eutropha from the preparation into a package. (Item 154) The method according to any one of items 149 to 153, further comprising commercializing N. eutropha from the preparation. (Item 155) A method for producing, for example, N. eutropha, comprising: contacting N. eutropha with a culture medium; and culturing the N. eutropha until an OD600 of at least about 0.5 is reached. (Item 156) The method according to item 155, further comprising assaying the contaminating organisms N. eutropha and the culture medium. (Item 157) The method according to any one of items 155 to 156, further comprising assaying the N. eutropha for one or more of the following: optimized growth rate, optimized NH4+ oxidation rate, or optimized resistance to NH4+. (Item 158) The method described in any of items 155-157, which involves producing at least approximately 1,000 L / day of N. eutropha at approximately 10¹² CFU / L. (Item 159) A method for producing N. eutropha, for example, a method for production, comprising: contacting N. eutropha with a culture medium; and culturing the N. eutropha until at least about 1,000 L of N. eutropha is produced at about 10¹² CFU / L. (Item 160) The method according to item 159, further comprising the step of assaying N. eutropha for one or more of the following: optimized growth rate, optimized NH4+ oxidation rate, or optimized resistance to NH4+. (Item 161) The method according to any one of items 159 to 160, further comprising the step of testing the contaminating organism, N. eutropha, or the culture medium. (Item 162) The method according to any one of items 159 to 161, wherein the N. eutropha in contact with the culture medium is an N. eutropha having one or more of the following: an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized resistance to NH4+. (Item 163) A method for producing, for example, N. euifica, (a) Contacting N. eutropha with the culture medium, (b) The method comprising culturing N. eutropha for 1 to 2 days until the culture reaches an OD600 of approximately 0.5 to 0.6, thereby producing the culture. (Item 164) The method according to item 163, further comprising the step of assaying N. eutropha for one or more of the following: optimized growth rate, optimized NH4+ oxidation rate, or optimized resistance to NH4+. (Item 165) The method according to any one of items 163 to 164, further comprising the step of testing the culture for contaminated organisms. (Item 166) The method according to any one of items 163 to 165, wherein the N. eutropha in step (a) is an N. eutropha having one or more of the following: an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized resistance to NH4+. (Item 167) The method according to any of items 163 to 166, which involves producing at least approximately 1,000 L / day of N. eutropha at approximately 10¹² CFU / L. (Item 168) N. eutropha bacteria produced by any of the methods described in items 155-167. (Item 169) A N. eutropha preparation prepared by any of the methods described in items 155-167. (Item 170) The preparation according to item 169, wherein the preparation contains at least about 0.1 to about 100 milligrams (mg) of N. eutropha. (Item 171) A reaction mixture containing N. eutropha with an optical density of approximately 0.5 to 0.6. (Item 172) A method for producing clothing containing N. eutropha, comprising contacting the clothing with N. eutropha as described in any one of items 1 to 115. (Item 173) The method described in item 172, which includes creating at least 10, 100, or 1,000 pieces of clothing. (Item 174) The method according to item 172, comprising bringing the garment into contact with at least 1010 CFU of N. eutropha. (Item 175) The method according to item 172, further comprising packaging the garment. (Item 176) A method for obtaining a formulation of N. eutropha, comprising contacting N. eutropha described in any of items 1 to 115 with a pharmaceutically or cosmetically acceptable excipient. (Item 177) The method according to item 176, further comprising mixing the N. eutropha with the excipient. (Item 178) The method described in item 176, carried out under conditions that substantially do not contain contaminating organisms. (Item 179) A method for packaging N. eutropha, comprising combining N. eutropha described in any of items 1 to 115 into a package. (Item 180) The method according to item 179, wherein the package is resistant to gas exchange or resistant to water. (Item 181) The method according to item 179, wherein the package is permeable to gas exchange, NH3, NH4+, or NO2-. (Item 182) A method for inhibiting microbial growth on the skin of a subject, comprising topically administering an effective dose of N. eutropha bacteria described in any one of items 1 to 115 to a subject requiring such inhibition. (Item 183) The method described in item 182, wherein the effective dose is approximately 1.5 × 10¹⁰ CFU. (Item 184) The method according to any of items 182 to 183, wherein the aforementioned administration is performed twice a day. (Item 185) The method described in any of items 182 to 184, wherein the subject is a human. (Item 186) The method according to any one of items 182-185, wherein the inhibited microbial growth is that of Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pyogenes, or Acinetobacter baumannii. (Item 187) A method for supplying nitric oxide to a target, comprising positioning the N. eutropha bacteria described in any one of the effective dose items 1 to 115 in close proximity to the target. (Item 188) A method for reducing body odor, comprising topically administering an effective dose of N. eutropha bacteria described in any one of items 1 to 115 to a subject in need thereof. (Item 189) A method for treating a disease associated with low nitrite levels, comprising topically administering a therapeutically effective dose of N. eutropha bacteria described in any of items 1 to 115 to a subject in need thereof. (Item 190) The method according to item 189, wherein the disease is HIV dermatitis, infection in diabetic foot ulcers, atopic dermatitis, acne, e.g., acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, skin infections, vascular diseases, vaginal yeast infections, sexually transmitted diseases, heart diseases, atherosclerosis, baldness, lower leg ulcers following diabetes or bed restraint, angina pectoris, especially chronic stable angina pectoris, ischemic disease, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrous organ degeneration, allergies, autoimmune sensitization, end-stage renal disease, obesity, impotence, or cancer. (Item 191) A method for treating a skin disorder, comprising topically administering a therapeutically effective dose of N. eutropha bacteria described in any of items 1 to 115 to a subject in need thereof. (Item 192) The method according to item 191, wherein the skin disorder is acne, for example, acne vulgaris, rosacea, eczema, or psoriasis. (Item 193) The method according to item 191, wherein the skin disorder is an infection in an ulcer, such as a venous ulcer, such as a leg ulcer, such as a diabetic foot ulcer. (Item 194) The method according to any one of items 191 to 193, wherein the local administration includes pre-treating the subject with N. eutropha, for example, N. eutropha as described in any one of items 1 to 115. (Item 195) The method according to any one of items 191 to 194, wherein the local administration includes local administration prior to the onset of the skin disorder. (Item 196) The method according to any one of items 191 to 195, wherein the local administration includes local administration after the onset of the skin disorder. (Item 197) A method for promoting wound healing or closure, comprising administering to a wound an effective dose of N. eutropha bacteria as described in any of items 1 to 115. (Item 198) The method according to item 197, wherein the wound contains one or more undesirable bacteria, such as pathogenic bacteria. (Item 199) The aforementioned wound was caused by Staphylococcus aureus, Pseudomonas The method described in item 197, including aeruginosa or Acinetobacter baumannii. (Item 200) The method according to item 197, wherein N. eutropha is administered to the subject before the onset of the wound. (Item 201) The method according to item 197, wherein administering to the wound includes administering to the subject before the wound develops. (Item 202) The method according to any one of items 197 to 201, further comprising administering N. eutropha to the wound after the onset of the wound. (Item 203) A method for killing or inhibiting the growth of pathogens, comprising bringing N. eutropha bacteria, for example, N. eutropha bacteria as described in any of items 1 to 115, into contact with skin, for example, by applying it thereto. (Item 204) The method according to item 203, wherein the pathogen contributes to one or more of the following conditions: HIV dermatitis, ulcers, e.g., venous ulcers, e.g., leg ulcers, e.g., venous leg ulcers, e.g., infections in diabetic foot ulcers, atopic dermatitis, acne, e.g., acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, urticaria, rosacea, skin infections, vascular diseases, vaginal yeast infections, sexually transmitted diseases, heart diseases, atherosclerosis, baldness, leg ulcers following diabetes or bed restraint, angina pectoris, especially chronic stable angina pectoris, ischemic disease, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrous organ degeneration, allergies, autoimmune sensitization, end-stage renal disease, obesity, impotence, pneumonia, primary immunodeficiency, epidermolysis bullosa, or cancer. (Item 205) The method according to item 204, wherein the condition is an infection in an ulcer, e.g., a venous ulcer, e.g., a leg ulcer, e.g., a venous leg ulcer, e.g., a diabetic foot ulcer. (Item 206) The method according to item 204, wherein the condition is a venous lower leg ulcer. (Item 207) The method according to item 204, wherein the condition is acne, for example, acne vulgaris. (Item 208) The method according to item 204, wherein the condition is acne vulgaris. (Item 209) The method according to any one of items 203 to 208, wherein the pathogen is one or more of Propionibacterium acnes, Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pyogenes, or Acinetobacter baumannii. (Item 210) The method according to any one of items 203 to 209, further comprising determining whether the subject requires the killing or inhibition of the growth of the pathogen, for example, determining that the subject requires the killing or inhibition of the growth of the pathogen. (Item 211) The method according to any one of items 203 to 210, further comprising selecting the subject for which the killing or inhibition of the growth of the pathogen is required. (Item 212) A method for altering the composition of the target skin microbiome, This includes administering a preparation containing ammonia-oxidizing bacteria to the surface of the skin, for example, by applying it topically. The method wherein the amount and frequency of administration, for example, application, is sufficient to reduce the proportion of pathogens on the surface of the skin. (Item 213) The method according to item 212, further comprising selecting the subject based on the subject for which a reduction in the proportion of pathogens on the surface of the skin is required. (Item 214) The method according to any one of items 212 to 213, wherein the preparation comprises at least one of ammonia, an ammonium salt, and urea. (Item 215) The method according to any one of items 212 to 214, wherein the preparation includes a release-controlled material, for example, a sustained-release material. (Item 216) The method according to any one of items 212 to 215, wherein the ammonia-oxidizing bacterial preparation further comprises an excipient, for example, one of a pharmaceutically acceptable excipient or a cosmetically acceptable excipient. (Item 217) The method according to item 216, wherein the excipient, for example, one of the pharmaceutically acceptable excipient and the cosmetically acceptable excipient, is suitable for one of topical administration, intranasal administration, pulmonary administration, and gastrointestinal administration. (Item 218) The method according to any one of items 216 to 217, wherein the excipient, for example, one of the pharmaceutically acceptable excipient and the cosmetically acceptable excipient, is a surfactant. (Item 219) The method according to item 218, wherein the surfactant is selected from the group consisting of cocamidopropyl betaine (ColaTeric COAB), polyethylene sorbitol ester (e.g., Tween 80), ethoxylated lauryl alcohol (RhodaSurf 6 NAT), sodium laureth sulfate / lauryl glucoside / cocamidopropyl betaine (Plantapon 611 L UP), sodium laureth sulfate (e.g., RhodaPex ESB 70 NAT), alkyl polyglucoside (e.g., Plantaren 2000 N UP), sodium laureth sulfate (Plantaren 200), Dr. Bronner's Castile soap, lauramine oxide (ColaLux Lo), sodium dodecyl sulfate (SDS), alkyl polyglucoside polysulfonate (PolySufanate 160 P), sodium lauryl sulfate (Stepanol-WA Extra K), and any combination thereof. (Item 220) The method according to any one of items 212 to 219, wherein the preparation substantially contains no other organisms. (Item 221) The method according to any one of items 212 to 220, wherein the preparation is placed in a powder, cosmetic, cream, stick, aerosol, ointment, wipe, or bandage. (Item 222) The method according to any one of items 212 to 221, wherein the preparation is provided as a powder, cosmetic, cream, stick, aerosol, ointment, wipe, or bandage. (Item 223) The method according to any one of items 212 to 222, wherein the preparation comprises a humectant, deodorant, fragrance, colorant, insecticide, cleansing agent, or UV blocker. (Item 224) The method according to any one of items 216 to 217, wherein the excipient, for example, the pharmaceutically acceptable excipient or the cosmetically acceptable excipient, comprises an anti-adhesive, binder, coating agent, disintegrant, filler, flavoring agent, colorant, lubricant, adsorbent, preservative, or sweetener. (Item 225) The method according to any one of items 212 to 224, wherein the preparation containing the ammonia-oxidizing bacteria contains about 10⁸ to about 10¹⁴ CFU / L. (Item 226) The method according to item 225, wherein the preparation contains approximately 1 × 10⁹ CFU / L to approximately 10 × 10⁹ CFU / L. (Item 227) The method according to any one of items 212 to 226, wherein the preparation containing the ammonia-oxidizing bacteria contains approximately 50 milligrams (mg) to approximately 1000 mg of ammonia-oxidizing bacteria. (Item 228) The method according to any one of items 216 to 227, wherein the mass ratio of ammonia-oxidizing bacteria to the excipient, for example, the pharmaceutically acceptable excipient or the cosmetically acceptable excipient, is in the range of about 0.1 g / L to about 1 g / L. (Item 229) The method according to any one of items 212 to 228, wherein the ammonia-oxidizing bacterial preparation is useful for the treatment or prevention of skin disorders, the treatment or prevention of diseases or conditions associated with low nitrite levels, the treatment or prevention of body odor, the treatment for supplying nitric oxide, or the treatment for inhibiting microbial growth, such as pathogenic bacterial growth. (Item 230) The method according to any one of items 212 to 229, wherein the ammonia-oxidizing bacteria is selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, and combinations thereof. (Item 231) The method according to any one of items 212 to 230, wherein the preparation comprises an organism selected from the group consisting of Lactobacillus, Streptococcus, Bifidobacter, and combinations thereof. (Item 232) The method according to any one of items 212 to 230, wherein the preparation substantially contains no organisms other than ammonia-oxidizing bacteria. (Item 233) The method according to any one of items 212 to 232, wherein the ammonia-oxidizing bacterial preparation contains ammonia-oxidizing bacteria in a grown state. (Item 234) The method according to any one of items 212 to 232, wherein the ammonia-oxidizing bacterial preparation contains ammonia-oxidizing bacteria in storage. (Item 235) The method described in any one of items 212 to 234 for providing cosmetic products. (Item 236) The method described in any one of items 212 to 234 for providing therapeutic drugs. (Item 237) The method according to any one of items 212 to 236, wherein the preparation is useful in treating at least one of the following: HIV dermatitis, infections in diabetic foot ulcers, atopic dermatitis, acne, e.g., acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, urticaria, rosacea, skin infections, vascular diseases, vaginal yeast infections, sexually transmitted diseases, heart diseases, atherosclerosis, baldness, lower leg ulcers following diabetes or bed restraint, angina pectoris, especially chronic stable angina pectoris, ischemic disease, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrous organ degeneration, allergies, autoimmune sensitization, end-stage renal disease, obesity, impotence, pneumonia, primary immunodeficiency, epidermolysis bullosa, or cancer. (Item 238) The method according to item 237, wherein the preparation is useful for treating at least one of acne, such as acne vulgaris, eczema, psoriasis, urticaria, rosacea, and skin infections. (Item 239) The method according to any one of items 212 to 238, wherein the preparation is provided in a container, and the preparation and the container have a weight of less than about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 grams. (Item 240) The method according to any one of items 212 to 239, wherein the preparation contains about 0.1% to less than 10% of a surfactant. (Item 241) The method according to any one of items 212 to 240, wherein the preparation is substantially free of surfactants. (Item 242) The method according to any one of items 212 to 241, wherein the preparation comprises a chelating agent. (Item 243) The method according to any one of items 212 to 242, wherein the preparation is applied approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 times per day. (Item 244) The method according to any one of items 212 to 243, wherein the preparation is applied once daily. (Item 245) The method according to any one of items 212 to 243, wherein the preparation is applied twice daily. (Item 246) The method according to any one of items 212 to 245, wherein the preparation is applied for approximately 1 to 3, 3 to 5, 5 to 7, 7 to 9, 5 to 10, 10 to 14, 12 to 18, 12 to 21, 21 to 28, 28 to 35, 35 to 42, 42 to 49, 49 to 56, 46 to 63, 63 to 70, 70 to 77, 77 to 84, or 84 to 91 days. (Item 247) The method according to any one of items 212 to 246, wherein the preparation is applied for approximately 16 days. (Item 248) The method according to any one of items 212 to 247, further comprising obtaining a sample from the aforementioned surface of the skin. (Item 249) The method according to item 248, further comprising isolating bacterial DNA from the sample. (Item 250) The method according to any one of items 248 to 249, further comprising sequencing the DNA of bacteria in the sample. (Item 251) The method according to any one of items 212 to 250, wherein the administration of the ammonia-oxidizing bacteria provides an increase in the proportion of non-pathogenic bacteria on the surface. (Item 252) The method according to item 251, wherein the non-pathogenic bacterium is a symbiotic non-pathogenic bacterium. (Item 253) The method according to item 252, wherein the non-pathogenic bacterium is a symbiotic non-pathogenic bacterium of the genus Staphylococcus. (Item 254) The method according to item 253, wherein the non-pathogenic bacterium is the symbiotic non-pathogenic bacterium Staphylococcus epidermidis. (Item 255) The method according to any one of items 252 to 254, wherein the non-pathogenic bacteria of the genus Staphylococcus increase after about two weeks, or are identified to increase after about two weeks. (Item 256) The method according to item 255, wherein the non-pathogenic bacterium Staphylococcus epidermidis is increased after approximately two weeks, or is identified as increasing after approximately two weeks. (Item 257) The method described in any one of items 212-256, wherein potentially pathogenic propionibacteria or disease-associated propionibacteria are reduced after approximately two weeks, or identified as being reduced after approximately two weeks. (Item 258) The method according to any one of items 212-257, wherein a potentially pathogenic Stenotrophomonas or disease-associated Stenotrophomonas is reduced after approximately two weeks, or identified as being reduced after approximately two weeks. (Item 259) The method according to any one of items 212 to 258, wherein the aforementioned surface of the skin includes a wound. (Item 260) A method for treating acne, such as acne vulgaris, by the method described in any one of items 212 to 259. (Item 261) A method for treating eczema by any one of the methods described in items 212 to 259. (Item 262) A method for treating psoriasis by any one of the methods described in items 212 to 259. (Item 263) A method for treating urticaria by any one of the methods described in items 212 to 259. (Item 264) A method for treating rosacea by any one of the methods described in items 212 to 259. (Item 265) A method for treating a skin infection by any one of the methods described in items 212-259. (Item 266) A method for reducing the amount of undesirable bacteria on a surface of a subject by means of any one of items 212 to 258. (Item 267) A nucleic acid comprising a sequence of 15 to 100 consecutive nucleotides from sequence number 66 or its reverse complement, provided that the sequence is not naturally occurring, or has other modifications, such as labeling, or both. (Item 268) The nucleic acid described in item 267, wherein the sequence of 15 to 100 consecutive nucleotides is a sequence not found in N. Eutropha strain C91. (Item 269) The nucleic acid according to item 267 or 268, further comprising a heterologous sequence at the 5' end to the sequence of 15 to 100 consecutive nucleotides from sequence number 66. (Item 270) The nucleic acid according to item 267 or 268, further comprising a heterologous sequence at the 3' end to the sequence of 15 to 100 consecutive nucleotides from sequence number 66. (Item 271) The nucleic acid according to item 267 or 268, further comprising a first heterologous sequence at the 5' end to the sequence of 15 to 100 consecutive nucleotides from sequence number 66, and a second heterologous sequence at the 3' end to the sequence of 15 to 100 consecutive nucleotides from sequence number 66. (Item 272) Nucleic acids as described in any of items 267-271, having nucleotide lengths of 15-20, 20-25, 25-30, 30-24, or 25-40. (Item 273) A nucleic acid as described in any of items 267-272, which is bound to a detectable label, e.g., a fluorescent label, e.g., covalently bound. (Item 274) The first nucleic acid, containing 15 to 100 consecutive nucleotides starting from sequence number 66, A second nucleic acid containing 15 to 100 consecutive nucleotides from the reverse complement of sequence number 66, The composition, wherein the first nucleic acid, the second nucleic acid, or both thereof has modifications such as sequences or labels that do not exist in nature, or both thereof. (Item 275) The composition according to item 274, wherein the first nucleic acid, the second nucleic acid, or each of the first and second nucleic acids does not contain a sequence found in N. Eutropha strain C91. (Item 276) The composition according to item 274 or 275, wherein the first nucleic acid, the second nucleic acid, or each of the first and second nucleic acids further comprises a heterogeneous sequence at the 5' end to the sequence of 15 to 100 consecutive nucleotides from sequence number 66. (Item 277) The composition according to any one of items 274 to 276, wherein the first nucleic acid, the second nucleic acid, or each of the first and second nucleic acids further comprises a heterogeneous sequence at the 3' end to the sequence of 15 to 100 consecutive nucleotides from sequence number 66. (Item 278) The composition according to any one of items 274 to 277, wherein the first nucleic acid, the second nucleic acid, or each of the first and second nucleic acids has a nucleotide length of 15 to 20, 20 to 25, 25 to 30, 30 to 24, or 25 to 40. (Item 279) The composition according to any one of items 274 to 278, wherein the first nucleic acid, the second nucleic acid, or each of the first nucleic acid and the second nucleic acid is bound to a detectable label, such as a fluorescent label, for example, by covalent bond. (Item 280) A nucleic acid consisting of the sequence AATCTTGTCTCCACAGGCAGC (sequence number 64). (Item 281) A nucleic acid consisting of the sequence TATACCCACCACCCACGCTA (sequence number 65). (Item 282) A molecule comprising a nucleic acid as described in item 280 or 281, and a detectable label, such as a fluorescent label. (Item 283) A composition comprising a first nucleic acid consisting of the sequence AATCTTGTCTCCACAGGCAGC (SEQ ID NO: 64) and a second nucleic acid consisting of the sequence TATACCCACCACCCACGCTA (SEQ ID NO: 65). (Item 284) (i) a first nucleic acid comprising the sequence AATCTTGTCTCCACAGGCAGC (SEQ ID NO: 64), and (ii) a first molecule optionally comprising a detectable label, such as a fluorescent label. A composition comprising (i) a second nucleic acid having the sequence TATACCCACCACCCACGCTA (SEQ ID NO: 65), and (ii) a second molecule optionally containing a detectable label, such as a fluorescent label. (Item 285) A method for detecting the presence of D23 N.eutropha nucleic acid in a sample, Perform a polymerase chain reaction (PCR) on the sample using a primer specific to N. eutropha D23, The method comprising determining whether a PCR product was generated, wherein the presence of the PCR product indicates that the D23 N.eutropha nucleic acid was present in the sample.

[0173] This disclosure intends to include all combinations of any one or more of the aforementioned aspects and / or embodiments, as well as any combination of any one or more of the embodiments described in the modes and examples for carrying out the invention. [Brief explanation of the drawing]

[0174] [Figure 1]This shows the growth of a mixed culture of bacteria including N. eutropha strain D23. The optical density at a wavelength of 600 nm is plotted against time. [Figure 2-1] Figure 2A: Shows nitrite production in a mixed bacterial culture containing N. eutropha strain D23. Nitrite concentration is plotted against time. Figure 2B-I: Shows the nitrite production rate by N. eutropha D23 in batch culture. Nitrite concentration is plotted against time. Figure 2B-II: Shows the nitrite production rate by N. eutropha D23 in vitro. Nitrite concentration is plotted against time. Figure 2C: Shows the stability of N. eutropha D23 during storage at 4°C. Nitrite concentration is plotted against time. [Figure 2-2] Figure 2A: Shows nitrite production in a mixed bacterial culture containing N. eutropha strain D23. Nitrite concentration is plotted against time. Figure 2B-I: Shows the nitrite production rate by N. eutropha D23 in batch culture. Nitrite concentration is plotted against time. Figure 2B-II: Shows the nitrite production rate by N. eutropha D23 in vitro. Nitrite concentration is plotted against time. Figure 2C: Shows the stability of N. eutropha D23 during storage at 4°C. Nitrite concentration is plotted against time. [Figure 2-3] Figure 2A: Shows nitrite production in a mixed bacterial culture containing N. eutropha strain D23. Nitrite concentration is plotted against time. Figure 2B-I: Shows the nitrite production rate by N. eutropha D23 in batch culture. Nitrite concentration is plotted against time. Figure 2B-II: Shows the nitrite production rate by N. eutropha D23 in vitro. Nitrite concentration is plotted against time. Figure 2C: Shows the stability of N. eutropha D23 during storage at 4°C. Nitrite concentration is plotted against time. [Figure 2-4]Figure 2A: Shows nitrite production in a mixed bacterial culture containing N. eutropha strain D23. Nitrite concentration is plotted against time. Figure 2B-I: Shows the nitrite production rate by N. eutropha D23 in batch culture. Nitrite concentration is plotted against time. Figure 2B-II: Shows the nitrite production rate by N. eutropha D23 in vitro. Nitrite concentration is plotted against time. Figure 2C: Shows the stability of N. eutropha D23 during storage at 4°C. Nitrite concentration is plotted against time. [Figure 3-1] Figure 3A: Shows the ability of N. eutropha D23 to inhibit the growth of P. aeruginosa (left panel) and S. aureus (right panel) in co-culture experiments. The amount of undesirable bacteria (in CFU / ml) for each species is plotted against time. In this figure, "AOB" refers to strain D23. Figure 3B: Shows the ability of N. eutropha D23 to inhibit the growth of Streptococcus pyogenes (left panel) and Acinetobacter baumannii (right panel) in co-culture experiments. The amount of undesirable bacteria (in CFU / ml) for each species is plotted against time. In this figure, "AOB" refers to strain D23. Figure 3C: Shows the ability of N. eutropha D23 to inhibit the growth of Propionibacterium acnes in co-culture experiments. The amount of undesirable bacteria (in CFU / ml) for each species is plotted against time. In this figure, "AOB" refers to strain D23. [Figure 3-2]Figure 3A: Shows the ability of N. eutropha D23 to inhibit the growth of P. aeruginosa (left panel) and S. aureus (right panel) in co-culture experiments. The amount of undesirable bacteria (in CFU / ml) for each species is plotted against time. In this figure, "AOB" refers to strain D23. Figure 3B: Shows the ability of N. eutropha D23 to inhibit the growth of Streptococcus pyogenes (left panel) and Acinetobacter baumannii (right panel) in co-culture experiments. The amount of undesirable bacteria (in CFU / ml) for each species is plotted against time. In this figure, "AOB" refers to strain D23. Figure 3C: Shows the ability of N. eutropha D23 to inhibit the growth of Propionibacterium acnes in co-culture experiments. The amount of undesirable bacteria (in CFU / ml) for each species is plotted against time. In this figure, "AOB" refers to strain D23. [Figure 3-3] Figure 3A: Shows the ability of N. eutropha D23 to inhibit the growth of P. aeruginosa (left panel) and S. aureus (right panel) in co-culture experiments. The amount of undesirable bacteria (in CFU / ml) for each species is plotted against time. In this figure, "AOB" refers to strain D23. Figure 3B: Shows the ability of N. eutropha D23 to inhibit the growth of Streptococcus pyogenes (left panel) and Acinetobacter baumannii (right panel) in co-culture experiments. The amount of undesirable bacteria (in CFU / ml) for each species is plotted against time. In this figure, "AOB" refers to strain D23. Figure 3C: Shows the ability of N. eutropha D23 to inhibit the growth of Propionibacterium acnes in co-culture experiments. The amount of undesirable bacteria (in CFU / ml) for each species is plotted against time. In this figure, "AOB" refers to strain D23. [Figure 4-1]Figure 4A: (Top panel) Plots the NO2- concentration over time in the co-culture experiment. (Bottom panel) Plots the pH over time in the co-culture experiment. Figure 4B: (Top panel) Plots the CFU / ml of the bacteria shown in the co-culture experiment over time. (Center panel) Plots the NO2- concentration over time in the co-culture experiment. (Bottom panel) Plots the pH over time in the co-culture experiment. Figure 4C: Plots the bactericidal activity of D23 against skin pathogens. Figure 4D: Plots the bactericidal activity of D23 against skin pathogens. Figure 4E: Shows an alternative plot of the bactericidal activity of D23 against skin pathogens. [Figure 4-2] Figure 4A: (Top panel) Plots the NO2- concentration over time in the co-culture experiment. (Bottom panel) Plots the pH over time in the co-culture experiment. Figure 4B: (Top panel) Plots the CFU / ml of the bacteria shown in the co-culture experiment over time. (Center panel) Plots the NO2- concentration over time in the co-culture experiment. (Bottom panel) Plots the pH over time in the co-culture experiment. Figure 4C: Plots the bactericidal activity of D23 against skin pathogens. Figure 4D: Plots the bactericidal activity of D23 against skin pathogens. Figure 4E: Shows an alternative plot of the bactericidal activity of D23 against skin pathogens. [Figure 4-3] Figure 4A: (Top panel) Plots the NO2- concentration over time in the co-culture experiment. (Bottom panel) Plots the pH over time in the co-culture experiment. Figure 4B: (Top panel) Plots the CFU / ml of the bacteria shown in the co-culture experiment over time. (Center panel) Plots the NO2- concentration over time in the co-culture experiment. (Bottom panel) Plots the pH over time in the co-culture experiment. Figure 4C: Plots the bactericidal activity of D23 against skin pathogens. Figure 4D: Plots the bactericidal activity of D23 against skin pathogens. Figure 4E: Shows an alternative plot of the bactericidal activity of D23 against skin pathogens. [Figure 4-4]Figure 4A: (Top panel) Plots the NO2- concentration over time in the co-culture experiment. (Bottom panel) Plots the pH over time in the co-culture experiment. Figure 4B: (Top panel) Plots the CFU / ml of the bacteria shown in the co-culture experiment over time. (Center panel) Plots the NO2- concentration over time in the co-culture experiment. (Bottom panel) Plots the pH over time in the co-culture experiment. Figure 4C: Plots the bactericidal activity of D23 against skin pathogens. Figure 4D: Plots the bactericidal activity of D23 against skin pathogens. Figure 4E: Shows an alternative plot of the bactericidal activity of D23 against skin pathogens. [Figure 4-5] Figure 4A: (Top panel) Plots the NO2- concentration over time in the co-culture experiment. (Bottom panel) Plots the pH over time in the co-culture experiment. Figure 4B: (Top panel) Plots the CFU / ml of the bacteria shown in the co-culture experiment over time. (Center panel) Plots the NO2- concentration over time in the co-culture experiment. (Bottom panel) Plots the pH over time in the co-culture experiment. Figure 4C: Plots the bactericidal activity of D23 against skin pathogens. Figure 4D: Plots the bactericidal activity of D23 against skin pathogens. Figure 4E: Shows an alternative plot of the bactericidal activity of D23 against skin pathogens. [Figure 5-1]Figure 5A: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots CT50 for treatment with various D23s. Figure 5C: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots CT50 for treatment with various D23s. Figure 5F: Images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of subjects during the study. Figure 5I: Shows the weight of subjects during the study. Figure 5J: Shows the PCR score of the scalp test of the subjects. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of a human volunteer study evaluating a Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of positive samples for the AOB-specific three gene signatures (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores of a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genera-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. Percentage of total sequence reads representing each of the 12 bacterial genera in baseline samples collected before application (day 0), immediately after one week of application (day 8), or one week after discontinuation of topical application (day 14). The proportions of Acinetobacter, Burkholderia, Enterobacter, Escherichia Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequencing reads representing Nitrosomonas before application (day 0), immediately after one week of application (day 8), or one week after the end of application (day 14) is shown. Figure 5N-B: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The pattern of changes in species abundance was detected by 16S rDNA sequencing of samples collected from AOB users on day 0 versus day 8. Figure 5O: Shows user evaluations of AOB-001. Assessment of the hair and facial beautifying effects of AOB-001 provided by 23 volunteers after one week of application to the scalp and face. Subjects are plotted in order of increasing composite PCT score. (2 = Strongly agree, 0 = No change, -2 = Strongly disagree). [Figure 5-2]Figure 5A: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots CT50 for treatment with various D23s. Figure 5C: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots CT50 for treatment with various D23s. Figure 5F: Images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of subjects during the study. Figure 5I: Shows the weight of subjects during the study. Figure 5J: Shows the PCR score of the scalp test of the subjects. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of a human volunteer study evaluating a Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of positive samples for the AOB-specific three gene signatures (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores of a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genera-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. Percentage of total sequence reads representing each of the 12 bacterial genera in baseline samples collected before application (day 0), immediately after one week of application (day 8), or one week after discontinuation of topical application (day 14). The proportions of Acinetobacter, Burkholderia, Enterobacter, Escherichia Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequencing reads representing Nitrosomonas before application (day 0), immediately after one week of application (day 8), or one week after the end of application (day 14) is shown. Figure 5N-B: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The pattern of changes in species abundance was detected by 16S rDNA sequencing of samples collected from AOB users on day 0 versus day 8. Figure 5O: Shows user evaluations of AOB-001. Assessment of the hair and facial beautifying effects of AOB-001 provided by 23 volunteers after one week of application to the scalp and face. Subjects are plotted in order of increasing composite PCT score. (2 = Strongly agree, 0 = No change, -2 = Strongly disagree). [Figure 5-3]Figure 5A: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots CT50 for treatment with various D23s. Figure 5C: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots CT50 for treatment with various D23s. Figure 5F: Images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of subjects during the study. Figure 5I: Shows the weight of subjects during the study. Figure 5J: Shows the PCR score of the scalp test of the subjects. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of a human volunteer study evaluating a Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of positive samples for the AOB-specific three gene signatures (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores of a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genera-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. Percentage of total sequence reads representing each of the 12 bacterial genera in baseline samples collected before application (day 0), immediately after one week of application (day 8), or one week after discontinuation of topical application (day 14). The proportions of Acinetobacter, Burkholderia, Enterobacter, Escherichia Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequencing reads representing Nitrosomonas before application (day 0), immediately after one week of application (day 8), or one week after the end of application (day 14) is shown. Figure 5N-B: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The pattern of changes in species abundance was detected by 16S rDNA sequencing of samples collected from AOB users on day 0 versus day 8. Figure 5O: Shows user evaluations of AOB-001. Assessment of the hair and facial beautifying effects of AOB-001 provided by 23 volunteers after one week of application to the scalp and face. Subjects are plotted in order of increasing composite PCT score. (2 = Strongly agree, 0 = No change, -2 = Strongly disagree). [Figure 5-4]Figure 5A: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots CT50 for treatment with various D23s. Figure 5C: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots CT50 for treatment with various D23s. Figure 5F: Images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of subjects during the study. Figure 5I: Shows the weight of subjects during the study. Figure 5J: Shows the PCR score of the scalp test of the subjects. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of a human volunteer study evaluating a Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of positive samples for the AOB-specific three gene signatures (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores of a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genera-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. Percentage of total sequence reads representing each of the 12 bacterial genera in baseline samples collected before application (day 0), immediately after one week of application (day 8), or one week after discontinuation of topical application (day 14). The proportions of Acinetobacter, Burkholderia, Enterobacter, Escherichia Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequencing reads representing Nitrosomonas before application (day 0), immediately after one week of application (day 8), or one week after the end of application (day 14) is shown. Figure 5N-B: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The pattern of changes in species abundance was detected by 16S rDNA sequencing of samples collected from AOB users on day 0 versus day 8. Figure 5O: Shows user evaluations of AOB-001. Assessment of the hair and facial beautifying effects of AOB-001 provided by 23 volunteers after one week of application to the scalp and face. Subjects are plotted in order of increasing composite PCT score. (2 = Strongly agree, 0 = No change, -2 = Strongly disagree). [Figure 5-5]Figure 5A: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots CT50 for treatment with various D23s. Figure 5C: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots CT50 for treatment with various D23s. Figure 5F: Images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of subjects during the study. Figure 5I: Shows the weight of subjects during the study. Figure 5J: Shows the PCR score of the scalp test of the subjects. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of a human volunteer study evaluating a Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of positive samples for the AOB-specific three gene signatures (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores of a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genera-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. Percentage of total sequence reads representing each of the 12 bacterial genera in baseline samples collected before application (day 0), immediately after one week of application (day 8), or one week after discontinuation of topical application (day 14). The proportions of Acinetobacter, Burkholderia, Enterobacter, Escherichia Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequencing reads representing Nitrosomonas before application (day 0), immediately after one week of application (day 8), or one week after the end of application (day 14) is shown. Figure 5N-B: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The pattern of changes in species abundance was detected by 16S rDNA sequencing of samples collected from AOB users on day 0 versus day 8. Figure 5O: Shows user evaluations of AOB-001. Assessment of the hair and facial beautifying effects of AOB-001 provided by 23 volunteers after one week of application to the scalp and face. Subjects are plotted in order of increasing composite PCT score. (2 = Strongly agree, 0 = No change, -2 = Strongly disagree). [Figure 5-6]Figure 5A: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots CT50 for treatment with various D23s. Figure 5C: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots CT50 for treatment with various D23s. Figure 5F: Images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of subjects during the study. Figure 5I: Shows the weight of subjects during the study. Figure 5J: Shows the PCR score of the scalp test of the subjects. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of a human volunteer study evaluating a Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of positive samples for the AOB-specific three gene signatures (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores of a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genera-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. Percentage of total sequence reads representing each of the 12 bacterial genera in baseline samples collected before application (day 0), immediately after one week of application (day 8), or one week after discontinuation of topical application (day 14). The proportions of Acinetobacter, Burkholderia, Enterobacter, Escherichia Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequencing reads representing Nitrosomonas before application (day 0), immediately after one week of application (day 8), or one week after the end of application (day 14) is shown. Figure 5N-B: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The pattern of changes in species abundance was detected by 16S rDNA sequencing of samples collected from AOB users on day 0 versus day 8. Figure 5O: Shows user evaluations of AOB-001. Assessment of the hair and facial beautifying effects of AOB-001 provided by 23 volunteers after one week of application to the scalp and face. Subjects are plotted in order of increasing composite PCT score. (2 = Strongly agree, 0 = No change, -2 = Strongly disagree). [Figure 5-7]Figure 5A: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots CT50 for treatment with various D23s. Figure 5C: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots CT50 for treatment with various D23s. Figure 5F: Images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of subjects during the study. Figure 5I: Shows the weight of subjects during the study. Figure 5J: Shows the PCR score of the scalp test of the subjects. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of a human volunteer study evaluating a Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of positive samples for the AOB-specific three gene signatures (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores of a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genera-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. Percentage of total sequence reads representing each of the 12 bacterial genera in baseline samples collected before application (day 0), immediately after one week of application (day 8), or one week after discontinuation of topical application (day 14). The proportions of Acinetobacter, Burkholderia, Enterobacter, Escherichia Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequencing reads representing Nitrosomonas before application (day 0), immediately after one week of application (day 8), or one week after the end of application (day 14) is shown. Figure 5N-B: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The pattern of changes in species abundance was detected by 16S rDNA sequencing of samples collected from AOB users on day 0 versus day 8. Figure 5O: Shows user evaluations of AOB-001. Assessment of the hair and facial beautifying effects of AOB-001 provided by 23 volunteers after one week of application to the scalp and face. Subjects are plotted in order of increasing composite PCT score. (2 = Strongly agree, 0 = No change, -2 = Strongly disagree). [Figure 5-8]Figure 5A: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots CT50 for treatment with various D23s. Figure 5C: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots CT50 for treatment with various D23s. Figure 5F: Images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of subjects during the study. Figure 5I: Shows the weight of subjects during the study. Figure 5J: Shows the PCR score of the scalp test of the subjects. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of a human volunteer study evaluating a Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of positive samples for the AOB-specific three gene signatures (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores of a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genera-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. Percentage of total sequence reads representing each of the 12 bacterial genera in baseline samples collected before application (day 0), immediately after one week of application (day 8), or one week after discontinuation of topical application (day 14). The proportions of Acinetobacter, Burkholderia, Enterobacter, Escherichia Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequencing reads representing Nitrosomonas before application (day 0), immediately after one week of application (day 8), or one week after the end of application (day 14) is shown. Figure 5N-B: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The pattern of changes in species abundance was detected by 16S rDNA sequencing of samples collected from AOB users on day 0 versus day 8. Figure 5O: Shows user evaluations of AOB-001. Assessment of the hair and facial beautifying effects of AOB-001 provided by 23 volunteers after one week of application to the scalp and face. Subjects are plotted in order of increasing composite PCT score. (2 = Strongly agree, 0 = No change, -2 = Strongly disagree). [Figure 5-9]Figure 5A: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots CT50 for treatment with various D23s. Figure 5C: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots CT50 for treatment with various D23s. Figure 5F: Images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of subjects during the study. Figure 5I: Shows the weight of subjects during the study. Figure 5J: Shows the PCR score of the scalp test of the subjects. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of a human volunteer study evaluating a Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of positive samples for the AOB-specific three gene signatures (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores of a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genera-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. Percentage of total sequence reads representing each of the 12 bacterial genera in baseline samples collected before application (day 0), immediately after one week of application (day 8), or one week after discontinuation of topical application (day 14). The proportions of Acinetobacter, Burkholderia, Enterobacter, Escherichia Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequencing reads representing Nitrosomonas before application (day 0), immediately after one week of application (day 8), or one week after the end of application (day 14) is shown. Figure 5N-B: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The pattern of changes in species abundance was detected by 16S rDNA sequencing of samples collected from AOB users on day 0 versus day 8. Figure 5O: Shows user evaluations of AOB-001. Assessment of the hair and facial beautifying effects of AOB-001 provided by 23 volunteers after one week of application to the scalp and face. Subjects are plotted in order of increasing composite PCT score. (2 = Strongly agree, 0 = No change, -2 = Strongly disagree). [Figure 5-10]Figure 5A: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots CT50 for treatment with various D23s. Figure 5C: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots CT50 for treatment with various D23s. Figure 5F: Images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of subjects during the study. Figure 5I: Shows the weight of subjects during the study. Figure 5J: Shows the PCR score of the scalp test of the subjects. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of a human volunteer study evaluating a Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of positive samples for the AOB-specific three gene signatures (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores of a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genera-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. Percentage of total sequence reads representing each of the 12 bacterial genera in baseline samples collected before application (day 0), immediately after one week of application (day 8), or one week after discontinuation of topical application (day 14). The proportions of Acinetobacter, Burkholderia, Enterobacter, Escherichia Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequencing reads representing Nitrosomonas before application (day 0), immediately after one week of application (day 8), or one week after the end of application (day 14) is shown. Figure 5N-B: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The pattern of changes in species abundance was detected by 16S rDNA sequencing of samples collected from AOB users on day 0 versus day 8. Figure 5O: Shows user evaluations of AOB-001. Assessment of the hair and facial beautifying effects of AOB-001 provided by 23 volunteers after one week of application to the scalp and face. Subjects are plotted in order of increasing composite PCT score. (2 = Strongly agree, 0 = No change, -2 = Strongly disagree). [Figure 5-11]Figure 5A: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots CT50 for treatment with various D23s. Figure 5C: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots CT50 for treatment with various D23s. Figure 5F: Images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of subjects during the study. Figure 5I: Shows the weight of subjects during the study. Figure 5J: Shows the PCR score of the scalp test of the subjects. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of a human volunteer study evaluating a Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of positive samples for the AOB-specific three gene signatures (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores of a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genera-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. Percentage of total sequence reads representing each of the 12 bacterial genera in baseline samples collected before application (day 0), immediately after one week of application (day 8), or one week after discontinuation of topical application (day 14). The proportions of Acinetobacter, Burkholderia, Enterobacter, Escherichia Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequencing reads representing Nitrosomonas before application (day 0), immediately after one week of application (day 8), or one week after the end of application (day 14) is shown. Figure 5N-B: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The pattern of changes in species abundance was detected by 16S rDNA sequencing of samples collected from AOB users on day 0 versus day 8. Figure 5O: Shows user evaluations of AOB-001. Assessment of the hair and facial beautifying effects of AOB-001 provided by 23 volunteers after one week of application to the scalp and face. Subjects are plotted in order of increasing composite PCT score. (2 = Strongly agree, 0 = No change, -2 = Strongly disagree). [Figure 5-12]Figure 5A: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots CT50 for treatment with various D23s. Figure 5C: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots CT50 for treatment with various D23s. Figure 5F: Images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of subjects during the study. Figure 5I: Shows the weight of subjects during the study. Figure 5J: Shows the PCR score of the scalp test of the subjects. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of a human volunteer study evaluating a Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of positive samples for the AOB-specific three gene signatures (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores of a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genera-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. Percentage of total sequence reads representing each of the 12 bacterial genera in baseline samples collected before application (day 0), immediately after one week of application (day 8), or one week after discontinuation of topical application (day 14). The proportions of Acinetobacter, Burkholderia, Enterobacter, Escherichia Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequencing reads representing Nitrosomonas before application (day 0), immediately after one week of application (day 8), or one week after the end of application (day 14) is shown. Figure 5N-B: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The pattern of changes in species abundance was detected by 16S rDNA sequencing of samples collected from AOB users on day 0 versus day 8. Figure 5O: Shows user evaluations of AOB-001. Assessment of the hair and facial beautifying effects of AOB-001 provided by 23 volunteers after one week of application to the scalp and face. Subjects are plotted in order of increasing composite PCT score. (2 = Strongly agree, 0 = No change, -2 = Strongly disagree). [Figure 5-13]Figure 5A: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots CT50 for treatment with various D23s. Figure 5C: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots CT50 for treatment with various D23s. Figure 5F: Images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of subjects during the study. Figure 5I: Shows the weight of subjects during the study. Figure 5J: Shows the PCR score of the scalp test of the subjects. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of a human volunteer study evaluating a Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of positive samples for the AOB-specific three gene signatures (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores of a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genera-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. Percentage of total sequence reads representing each of the 12 bacterial genera in baseline samples collected before application (day 0), immediately after one week of application (day 8), or one week after discontinuation of topical application (day 14). The proportions of Acinetobacter, Burkholderia, Enterobacter, Escherichia Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequencing reads representing Nitrosomonas before application (day 0), immediately after one week of application (day 8), or one week after the end of application (day 14) is shown. Figure 5N-B: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The pattern of changes in species abundance was detected by 16S rDNA sequencing of samples collected from AOB users on day 0 versus day 8. Figure 5O: Shows user evaluations of AOB-001. Assessment of the hair and facial beautifying effects of AOB-001 provided by 23 volunteers after one week of application to the scalp and face. Subjects are plotted in order of increasing composite PCT score. (2 = Strongly agree, 0 = No change, -2 = Strongly disagree). [Figure 5-14]Figure 5A: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots CT50 for treatment with various D23s. Figure 5C: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots wound closure percentage over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots CT50 for treatment with various D23s. Figure 5F: Images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of subjects during the study. Figure 5I: Shows the weight of subjects during the study. Figure 5J: Shows the PCR score of the scalp test of the subjects. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of a human volunteer study evaluating a Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of positive samples for the AOB-specific three gene signatures (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores of a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genera-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. Percentage of total sequence reads representing each of the 12 bacterial genera in baseline samples collected before application (day 0), immediately after one week of application (day 8), or one week after discontinuation of topical application (day 14). The proportions of Acinetobacter, Burkholderia, Enterobacter, Escherichia Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequencing reads representing Nitrosomonas before application (day 0), immediately after one week of application (day 8), or one week after the end of application (day 14) is shown. Figure 5N-B: Shows changes in the abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The pattern of changes in species abundance was detected by 16S rDNA sequencing of samples collected from AOB users on day 0 versus day 8. Figure 5O: Shows user evaluations of AOB-001. Assessment of the hair and facial beautifying effects of AOB-001 provided by 23 volunteers after one week of application to the scalp and face. Subjects are plotted in order of increasing composite PCT score. (2 = Strongly agree, 0 = No change, -2 = Strongly disagree). [Figure 6-1] This table shows unique D23 genes that have either the number and function of their assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes with a length exceeding 200 base pairs. The column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates a protein-coding DNA sequence), Start = start location of the gene in the genome sequence of SEQ ID NO: 1, Stop = stop location of the gene in the genome sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-2]This table shows unique D23 genes that have either the number and function of their assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes with a length exceeding 200 base pairs. The column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates a protein-coding DNA sequence), Start = start location of the gene in the genome sequence of SEQ ID NO: 1, Stop = stop location of the gene in the genome sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-3] This table shows unique D23 genes that have either the number and function of their assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes with a length exceeding 200 base pairs. The column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates a protein-coding DNA sequence), Start = start location of the gene in the genome sequence of SEQ ID NO: 1, Stop = stop location of the gene in the genome sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-4] This table shows unique D23 genes that have either the number and function of their assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes with a length exceeding 200 base pairs. The column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates a protein-coding DNA sequence), Start = start location of the gene in the genome sequence of SEQ ID NO: 1, Stop = stop location of the gene in the genome sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-5]This table shows unique D23 genes that have either the number and function of their assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes with a length exceeding 200 base pairs. The column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates a protein-coding DNA sequence), Start = start location of the gene in the genome sequence of SEQ ID NO: 1, Stop = stop location of the gene in the genome sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-6] This table shows unique D23 genes that have either the number and function of their assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes with a length exceeding 200 base pairs. The column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates a protein-coding DNA sequence), Start = start location of the gene in the genome sequence of SEQ ID NO: 1, Stop = stop location of the gene in the genome sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-7] This table shows unique D23 genes that have either the number and function of their assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes with a length exceeding 200 base pairs. The column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates a protein-coding DNA sequence), Start = start location of the gene in the genome sequence of SEQ ID NO: 1, Stop = stop location of the gene in the genome sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-8]This table shows unique D23 genes that have either the number and function of their assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes with a length exceeding 200 base pairs. The column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates a protein-coding DNA sequence), Start = start location of the gene in the genome sequence of SEQ ID NO: 1, Stop = stop location of the gene in the genome sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-9] This table shows unique D23 genes that have either the number and function of their assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes with a length exceeding 200 base pairs. The column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates a protein-coding DNA sequence), Start = start location of the gene in the genome sequence of SEQ ID NO: 1, Stop = stop location of the gene in the genome sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-10] This table shows unique D23 genes that have either the number and function of their assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes with a length exceeding 200 base pairs. The column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates a protein-coding DNA sequence), Start = start location of the gene in the genome sequence of SEQ ID NO: 1, Stop = stop location of the gene in the genome sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-11]This table shows unique D23 genes that have either the number and function of their assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes with a length exceeding 200 base pairs. The column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates a protein-coding DNA sequence), Start = start location of the gene in the genome sequence of SEQ ID NO: 1, Stop = stop location of the gene in the genome sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-12] This table shows unique D23 genes that have either the number and function of their assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes with a length exceeding 200 base pairs. The column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates a protein-coding DNA sequence), Start = start location of the gene in the genome sequence of SEQ ID NO: 1, Stop = stop location of the gene in the genome sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-13] This table shows unique D23 genes that have either the number and function of their assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes with a length exceeding 200 base pairs. The column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates a protein-coding DNA sequence), Start = start location of the gene in the genome sequence of SEQ ID NO: 1, Stop = stop location of the gene in the genome sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-14]This table shows unique D23 genes that have either the number and function of their assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes with a length exceeding 200 base pairs. The column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates a protein-coding DNA sequence), Start = start location of the gene in the genome sequence of SEQ ID NO: 1, Stop = stop location of the gene in the genome sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-15] This table shows unique D23 genes that have either the number and function of their assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes with a length exceeding 200 base pairs. The column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates a protein-coding DNA sequence), Start = start location of the gene in the genome sequence of SEQ ID NO: 1, Stop = stop location of the gene in the genome sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-16] This table shows unique D23 genes that have either the number and function of their assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes with a length exceeding 200 base pairs. The column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates a protein-coding DNA sequence), Start = start location of the gene in the genome sequence of SEQ ID NO: 1, Stop = stop location of the gene in the genome sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 7-1]This table shows unique D23 genes of less than 200 base pairs that have an assigned ORF number. The column headings are as shown in Figure 6. [Figure 7-2] This table shows unique D23 genes of less than 200 base pairs that have an assigned ORF number. The column headings are as shown in Figure 6. [Figure 7-3] This table shows unique D23 genes of less than 200 base pairs that have an assigned ORF number. The column headings are as shown in Figure 6. [Figure 7-4] This table shows unique D23 genes of less than 200 base pairs that have an assigned ORF number. The column headings are as shown in Figure 6. [Figure 7-5] This table shows unique D23 genes of less than 200 base pairs that have an assigned ORF number. The column headings are as shown in Figure 6. [Figure 7-6] This table shows unique D23 genes of less than 200 base pairs that have an assigned ORF number. The column headings are as shown in Figure 6. [Figure 7-7] This table shows unique D23 genes of less than 200 base pairs that have an assigned ORF number. The column headings are as shown in Figure 6. [Figure 7-8] This table shows unique D23 genes of less than 200 base pairs that have an assigned ORF number. The column headings are as shown in Figure 6. [Figure 7-9] This table shows unique D23 genes of less than 200 base pairs that have an assigned ORF number. The column headings are as shown in Figure 6. [Figure 7-10] This table shows unique D23 genes of less than 200 base pairs that have an assigned ORF number. The column headings are as shown in Figure 6. [Figure 7-11] This table shows unique D23 genes of less than 200 base pairs that have an assigned ORF number. The column headings are as shown in Figure 6. [Figure 7-12]This table shows unique D23 genes of less than 200 base pairs that have an assigned ORF number. The column headings are as shown in Figure 6. [Figure 7-13] This table shows unique D23 genes of less than 200 base pairs that have an assigned ORF number. The column headings are as shown in Figure 6. [Figure 8-1] This table shows unique D23 genes that do not have an assigned number of ORFs. The column headings are as shown in Figure 6. [Figure 8-2] This table shows unique D23 genes that do not have an assigned number of ORFs. The column headings are as shown in Figure 6. [Figure 8-3] This table shows unique D23 genes that do not have an assigned number of ORFs. The column headings are as shown in Figure 6. [Figure 8-4] This table shows unique D23 genes that do not have an assigned number of ORFs. The column headings are as shown in Figure 6. [Figure 8-5] This table shows unique D23 genes that do not have an assigned number of ORFs. The column headings are as shown in Figure 6. [Figure 8-6] This table shows unique D23 genes that do not have an assigned number of ORFs. The column headings are as shown in Figure 6. [Figure 8-7] This table shows unique D23 genes that do not have an assigned number of ORFs. The column headings are as shown in Figure 6. [Figure 8-8] This table shows unique D23 genes that do not have an assigned number of ORFs. The column headings are as shown in Figure 6. [Figure 8-9] This table shows unique D23 genes that do not have an assigned number of ORFs. The column headings are as shown in Figure 6. [Figure 8-10] This table shows unique D23 genes that do not have an assigned number of ORFs. The column headings are as shown in Figure 6. [Figure 8-11]This table shows unique D23 genes that do not have an assigned number of ORFs. The column headings are as shown in Figure 6. [Figure 8-12] This table shows unique D23 genes that do not have an assigned number of ORFs. The column headings are as shown in Figure 6. [Figure 8-13] This table shows unique D23 genes that do not have an assigned number of ORFs. The column headings are as shown in Figure 6. [Figure 8-14] This table shows unique D23 genes that do not have an assigned number of ORFs. The column headings are as shown in Figure 6. [Figure 8-15] This table shows unique D23 genes that do not have an assigned number of ORFs. The column headings are as shown in Figure 6. [Figure 8-16] This table shows unique D23 genes that do not have an assigned number of ORFs. The column headings are as shown in Figure 6. [Figure 9] The unique C91 genes that do not have homologs in D23 are listed below. [Figure 10] This shows the sequence alignment between the AmoA1 and AmoA2 proteins of N. eutropha strains D23 and C91. The sequence numbers for each protein are listed in Table 1. Figure 10 discloses sequence numbers 6, 12, 36, and 42, respectively, in order of appearance. [Figure 11] This shows the sequence alignment between the AmoB1 and AmoB2 proteins of N. eutropha strains D23 and C91. The sequence numbers for each protein are listed in Table 1. Figure 11 discloses sequence numbers 8, 14, 38, and 44, respectively, in order of appearance. [Figure 12] This shows the sequence alignment between the AmoC1 and AmoC2 proteins of N. eutropha strains D23 and C91. The sequence numbers for each protein are listed in Table 1. Figure 12 discloses sequence numbers 34, 40, 10, and 4, respectively, in order of appearance. [Figure 13]This is the sequence alignment between the AmoC3 proteins of N. eutropha strains D23 and C91. The sequence numbers of each protein are listed in Table 1. Figure 13 reveals sequence numbers 46 and 16, respectively, in order of appearance. [Figure 14-1] Figures 14A and 14B show the sequence alignments between the Hao1, Hao2, and Hao3 proteins of N. eutropha strains D23 and C91. The sequence numbers for each protein are listed in Table 1. Figure 14 discloses sequence numbers 20, 22, 18, 50, 52, and 48, respectively, in order of appearance. [Figure 14-2] Figures 14A and 14B show the sequence alignments between the Hao1, Hao2, and Hao3 proteins of N. eutropha strains D23 and C91. The sequence numbers for each protein are listed in Table 1. Figure 14 discloses sequence numbers 20, 22, 18, 50, 52, and 48, respectively, in order of appearance. [Figure 15] This shows the sequence alignments between the cycA1, cycA2, and cycA3 genes of N. eutropha strains D23 and C91. The sequence numbers for each protein are listed in Table 1. Figure 15 discloses sequence numbers 26, 28, 24, 58, 56, and 54, respectively, in order of appearance. [Figure 16] This shows the sequence alignment between the cycB1 and cycB2 genes of N. eutropha strains D23 and C91. The sequence numbers for each protein are listed in Table 1. Figure 16 discloses sequence numbers 30, 32, 60, and 62, respectively, in order of appearance. [Figure 17] This bar graph shows the proportion of bacteria by genus relative to the number of days. [Figure 18] The bar graphs show the proportion of bacteria by genus relative to the total bacterial species on days 0, 1, 8, 14, and 16. [Modes for carrying out the invention]

[0175] Supplementary Table 1 shows genomic annotations for 2,777 genes identified in strain D23 using sequence analysis. The column headings are as shown in Figure 6. "C91 Alias" refers to homologs in strain C91. Supplementary Table 1 is attached at the end of the Modes and Examples for Carrying Out the Invention.

[0176] Supplementary Table 2 shows the sequences of selected protein genes identified in strain D23. Supplementary Table 2 is attached at the end of the descriptions of embodiments and examples for carrying out the invention.

[0177] Ammonia-oxidizing bacteria (AOBs) of the genus Nitrosomonas are Gram-negative, obligate autotrophic bacteria with the unique ability to produce nitrite and nitric oxide from ammonia alone as an energy source. They are widely present in both soil and aquatic environments and are essential components of environmental nitrification processes. Due to the role of nitrite and nitric oxide on human skin as important components of several physiological functions such as vasodilation, skin inflammation, and wound healing, these bacteria may have beneficial properties for both healthy and immunopathological skin conditions. These bacteria may be safe for human use because they are slow-growing, cannot grow on organic carbon sources, may be susceptible to soap and antibiotics, and are not associated with any disease or infection in animals or humans.

[0178] 1.Definition Ammonia-oxidizing bacteria refer to bacteria that can oxidize ammonia or ammonium to nitrite at a certain rate, for example, a substantial rate, for example, a predetermined rate, for example, at least the rate shown in any one of Figures 2A, 2B, 2C, 4A, 4B, or 5, or at least 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10% of that rate. In some embodiments, this substantial rate is at least 50, 75, 125, or 150 micromoles of NO2 - / min, for example, approximately 100-150, 75-175, 75-125, 100-125, 125-150, or 125-175 micromoles / min, for example, approximately 125 micromoles NO2 - Ammonium ions (NH4) at a rate of / min + (For example, about 200 mM) nitrite (NO2 - This refers to the conversion to ammonia. Examples of ammonia-oxidizing bacteria include strains D23 and C91 of N. eutropha, as well as other bacteria of the genera Nitrosomonas, Nitrosococcus, Nitrosospira, Nitrosocystis, Nitrosolobus, and Nitrosovibrio. Strain D23 Nitrosomonas eutropha is designated AOB D23-100 and refers to the strain deposited with the American Tissue Culture Collection (ATCC) on April 8, 2014, with accession number PTA-121157. D23 Nitrosomonas eutropha with accession number PTA-121157 has the genome sequence presented in Sequence ID No. 1 herein. The nucleic acid sequence(s) of accession number PTA-121157, e.g., the genome sequence, are incorporated herein by reference in their entirety.

[0179] When the term "optimized Nitrosomonas eutropha (N. eutropha)" is used herein, it refers to optimized growth rate, optimized NH4 + Oxidation rate, or NH4 + This refers to N. eutropha having optimized resistance to [a specific substance]. In one embodiment, this refers to at least one nucleotide, for example, ammonia monooxygenase, hydroxylamine oxidoreductase, cytochrome c554, and cytochrome c MOnly nucleotides in the genes selected from 552 differ from naturally occurring N. eutropha. This difference may arise, for example, from naturally occurring mutations, induced mutations, or targeted genetic engineering selections in N. eutropha. In one embodiment, this differs from naturally occurring N. eutropha in that it has a set of alleles that do not exist together in nature. These differences can provide one or more of the following: treatment or prevention of skin disorders, treatment or prevention of diseases or conditions associated with low nitrite levels, treatment or prevention of body odor, treatment for supplying nitric oxide to a target, and treatment for inhibiting microbial growth.

[0180] As used herein, “pure” means a composition that contains one organism but substantially contains no other organisms. For example, a pure culture of ammonia-oxidizing bacteria is a culture that substantially contains no organisms other than ammonia-oxidizing bacteria. For example, a pure culture of N. eutropha is a culture that substantially contains no organisms other than N. eutropha. In some embodiments, “substantially contained” means undetectable by methods used to detect other organisms (e.g., plating the culture and examining the colony morphology, or PCR for conserved genes such as 16S RNA). A pure composition may contain non-living elements, such as nutrients or excipients. Any embodiment, preparation, composition, or formulation of ammonia-oxidizing bacteria discussed herein may optionally contain, be essentially, or be composed of pure ammonia-oxidizing bacteria.

[0181] Throughout this disclosure, "formulation" may refer to a composition or preparation.

[0182] As used herein, “autotrophic organism,” for example, autotrophic bacteria, is any organism that can self-nourish by using inorganic materials as a nutrient source and photosynthesis or chemosynthesis as an energy source. Autotrophic bacteria can synthesize organic compounds from carbon dioxide, ATP from other sources, oxidation of ammonia to nitrite, oxidation of hydrogen sulfide, and Fe 2+ Fe 3+ This is due to oxidation. The autotrophic bacteria of this disclosure are unable to cause infection.

[0183] As used herein, “combined” administration means that two (or more) different therapeutic agents are delivered to a subject while the subject is suffering from a disorder, for example, these two or more therapeutic agents are delivered after the subject has been diagnosed with the disorder and before the disorder is cured or eliminated. In some embodiments, the delivery of one therapeutic agent occurs in a manner that overlaps with the commencement of the delivery of the other therapeutic agent. This may also be referred to herein as “simultaneous delivery,” “concurrent delivery,” or “parallel delivery.” In other embodiments, the delivery of one therapeutic agent is completed before the commencement of the delivery of the other therapeutic agent. This may also be referred to herein as “sequential delivery” or “sequential delivery.” In any of the embodiments, the therapeutic agent is more effective because it is administered in combination. For example, the second therapeutic agent is more effective, for example, an equivalent effect is seen with the second therapeutic agent but less, or the second therapeutic agent alleviates symptoms to a greater extent than would be seen if the second therapeutic agent were administered in the absence of the first therapeutic agent, or a similar situation is seen with the first therapeutic agent. In some embodiments, the delivery is such that the relief of symptoms or reduction of other parameters related to the disorder exceeds the relief or reduction that would be observed if one therapeutic agent were delivered in the absence of the other. The effects of these two therapeutic agents may be partially additive, fully additive, or more than additive (i.e., synergistic). The delivery may be such that the effect of the delivered first therapeutic agent is still detectable when the second therapeutic agent is delivered.

[0184] Complete N. europaea medium refers to the N. europaea growth medium described in Ensign et al., “In vitro activation of ammonia monooxygenase from Nitrosomonas europaea by copper.” J Bacteriol. 1993 Apr;175(7):1971-80.

[0185] "Culturing" refers to the process of placing a desired quantity of bacteria under conditions that promote their growth, i.e., conditions that promote cell division. These conditions may include a specified culture medium, a set temperature range, and / or agitation rate. Bacteria can be cultured in liquid culture or on plates, for example, on agar plates.

[0186] As used herein, the term “isolated” refers to a substance taken from its original environment or natural environment (e.g., the natural environment in which it naturally exists). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide separated from some or all of its coexisting substances in a natural system by human intervention is isolated. Such polynucleotide may be part of a vector, and / or such polynucleotide or polypeptide may be part of a composition, and such vector or composition may still be isolated because it is not part of the environment in which it is found in nature.

[0187] The terms "nucleic acid," "nucleic acid sequence," "nucleotide sequence," or "polynucleotide sequence," and "polynucleotide" are used synonymously. They refer to polymeric forms of nucleotides of any length, such as deoxyribonucleotides or ribonucleotides, or analogs thereof. This polynucleotide can be single-stranded or double-stranded, and if single-stranded, it can be a coding strand or a non-coding (antisense) strand. Polynucleotides may contain modified nucleotides such as methylated nucleotides and nucleotide analogs. This nucleotide sequence can be interrupted by non-nucleotide components. Polynucleotides can be further modified after polymerization, such as by conjugation with labeling components. Nucleic acids can be recombinant polynucleotides, or polynucleotides of genomic, cDNA, semi-synthetic, or synthetic origin, none of which exist naturally or are conjugated to other polynucleotides in unnatural configurations.

[0188] As used herein, the term “optimized growth rate” refers to one or more of the following: doubling times of less than approximately 4, 5, 6, 7, 8, 9, or 10 hours when cultured under batch conditions as described in Example 2 herein; doubling times of less than approximately 16, 18, 20, 22, 24, or 26 hours when grown under chemostat conditions as described in Example 2 herein; or growth from approximately 0.15 OD600 to at least approximately 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 OD600 over approximately 1 or 2 days. In one embodiment, the optimized growth rate is a rate having a doubling time at least 10, 20, 30, 40, or 50% shorter than the doubling time of naturally occurring N. eutropha.

[0189] When used herein, "Optimized NH4" + "Oxidation rate" refers to NH3 or NH4 + NO2 - This refers to a rate of at least approximately 50, 75, 125, or 150 micromoles / min, which converts to NH4. + (For example, about 200 mM) NO2 -This can be converted to at least about 50, 75, 125, or 150 micromoles / min. In one embodiment, optimized NH4 + The oxidation rate is NH3 or NH4 + However, NO2 develops at a rate at least 10, 20, 30, 40, or 50% faster than that seen in naturally occurring N. eutropha. - This is the speed at which it is converted.

[0190] The amino acid sequence identity percentage (%) for an amino acid sequence (e.g., a protein expressed by N. eutropha D23) as used herein is defined as the percentage of amino acid residues in a candidate sequence that is identical to an amino acid residue in a reference sequence, which may be a naturally occurring N. eutropha sequence or an N. eutropha D23 sequence, after the sequences have been aligned and gaps introduced as necessary to achieve the maximum sequence identity percentage, with no conservative substitutions considered as part of the sequence identity. Alignment for determining the amino acid sequence identity percentage can be achieved in various ways within the scope of means of those skilled in the art, for example, using publicly available computer software such as BLAST, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring the alignment, including any algorithm necessary to achieve the maximum alignment over the entire length of the sequences being compared. For example, amino acid sequence identity can be determined using the WU-BLAST-2 software (Altschul et al, Methods in Enzymology 266, 460-480 (1996), http: / / blast.wustl / edu / blast / README.html). WU-BLAST-2 uses several search parameters, many of which are set to their initial values. These adjustable parameters are set to the following values: overlap span = l, overlap fraction = 0.125, and overall threshold (T) = I1. The HSP score (S) and HSP S2 parameters are dynamic values ​​established by the program itself depending on the composition of a particular sequence, although the minimum values ​​can be adjusted as needed.

[0191] Amino acid substitutions can result from replacing one amino acid with another amino acid having similar structural and / or chemical properties (e.g., leucine with serine, i.e., conserved amino acid substitutions). Typical but non-restrictive conserved substitutions include substitutions between aliphatic amino acids Ala, Val, Leu, and Ile; exchanges of hydroxyl-containing Ser and Thr; exchanges of acidic residues Asp and Glu; exchanges between amide-containing residues Asn and Gln; exchanges of basic residues Lys and Arg; exchanges of aromatic residues Phe and Tyr; and exchanges of small amino acids Ala, Ser, Thr, Met, and Gly. Further conserved substitutions include replacing one amino acid with another amino acid having similar spatial or stereoconfiguration, e.g., Asn and Asp, or Gln and Glu. Amino acid substitutions can also result from replacing one amino acid with another amino acid having different structural and / or chemical properties (i.e., non-conserved amino acid substitutions). Insertions or deletions may optionally be in the range of 1 to 5 amino acids. Acceptable variants can be determined by systematically introducing amino acid insertions, deletions, or substitutions into the sequence and testing the resulting variants for activity in in vivo or in vitro assays, for example, for the metabolism of urea or ammonia.

[0192] The sequence identity percentage (%) for nucleic acid sequences (e.g., the N. eutropha D23 genome and its portions) as used herein is defined as the percentage of nucleotides in a candidate sequence identical to nucleotides in a reference sequence, which may be a naturally occurring N. eutropha sequence or an N. eutropha D23 sequence, after the sequences have been aligned and gaps introduced as necessary to achieve the maximum sequence identity percentage. Alignment for determining the nucleotide sequence identity percentage can be achieved in various ways within the scope of means of those skilled in the art, for example, using publicly available computer software such as BLAST. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithm necessary to achieve maximum alignment over the entire length of the sequences being compared.

[0193] The terms “polypeptide,” “peptide,” and “protein” (in the case of a single chain) are used herein synonymously to refer to amino acid polymers. These polymers may be linear or branched, may contain modified amino acids, and may be interrupted by non-amino acid groups. These terms also encompass modified amino acid polymers (e.g., any other operations such as disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or conjugation with labeling components). These polypeptides may be isolated from natural sources, produced from eukaryotic or prokaryotic hosts by recombinant techniques, or be products of synthetic methods.

[0194] When used herein, "NH4 + "Optimization tolerance to" refers to NH3 or NH4 exceeding 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, or 300 mM. + This refers to the ability to grow for at least about 24 hours or 48 hours under certain conditions. In one embodiment, NH4 + Optimal resistance to NH3 or NH4 at selected concentrations +This refers to the ability to grow at least 10, 20, 30, 40, or 50% faster, or at least 10, 20, 30, 40, or 50% longer, than is possible in naturally occurring N. eutropha, in the presence of [unspecified element].

[0195] As used herein in relation to comparisons between nucleic acids or protein sequences, “similar” means having homology. Similar genes or proteins may include, for example, substitutions (conservative or non-conservative substitutions, etc.), insertions (e.g., insertions of at least 1, 2, 3, 4, 5, 10, 15, 20, 25, or 30 amino acids, and, for example, insertions of up to 2, 3, 4, 5, 10, 15, 20, 25, 30, or 50 amino acids, or any positive combination thereof, or insertions of the number of nucleotides required to code for such amino acids), or deletions (e.g., deletions of at least 1, 2, 3, 4, 5, 10, 15, 20, 25, or 30 amino acids, and, for example, deletions of up to 2, 3, 4, 5, 10, 15, 20, 25, 30, or 50 amino acids, or any positive combination thereof, or deletions of the number of nucleotides required to code for such amino acids), or any combination thereof. Each of substitutions, insertions, and deletions can be located at the N-terminus, C-terminus, or central region of a protein or gene. In some embodiments, a conservative substitution is one that does not alter the charge and / or polarity and / or approximate size and / or geometry of the substituted site.

[0196] As used herein, “transgenic” means containing one or more exogenous DNA segments. These exogenous DNA segments are derived from another organism, such as another bacterium, bacteriophage, animal, or plant.

[0197] As used herein, treatment of a disease or condition means a reduction in the severity or frequency of at least one symptom of that disease or condition compared to a similar patient who is not receiving treatment. Treatment may also mean the cessation, delay, or reversal of the progression of the disease or condition compared to a similar patient who is not receiving treatment. Treatment may include addressing the underlying cause of the disease and / or one or more symptoms.

[0198] As used herein, a therapeutically effective dose means a dose sufficient to prevent the progression of a disease or condition, or to induce its regression, or to alleviate the symptoms of a disease or condition, or to achieve a desired outcome. A therapeutically effective dose may be, for example, the number of bacteria or the number of viable bacteria (e.g., in CFU units), or the mass of bacteria (e.g., in milligrams, grams, or kilograms), or the volume of bacteria (e.g., mm³). 3 It can be measured in units.

[0199] As used herein, the term “viability” refers to the ability of autotrophic bacteria, such as ammonia-oxidizing bacteria, to oxidize ammonia, ammonium, or urea to nitrite at a predetermined rate. In some embodiments, this rate is at least 50, 75, 125, or 150 micromoles of NO2 - / min, for example, approximately 100-150, 75-175, 75-125, 100-125, 125-150, or 125-175 micromoles / min, for example, approximately 125 micromoles NO2 - Ammonium ions (NH4) at a rate of / min + (For example, about 200 mM) nitrite (NO2 - This refers to the conversion to ).

[0200] The terms “growth medium” or “AOB medium” as used herein include the components listed in Table 3 or Table 4 below.

[0201] In some embodiments, the optimal state for this disclosure is a growth state, e.g., a maximum growth state, characterized by a pH of at least about 7.6, ammonia, trace minerals, oxygen, and carbon dioxide. Another state may be characterized by a pH of about 7.4 or less and the absence of carbon dioxide. Under low carbon dioxide conditions, ammonia-oxidizing bacteria, e.g., Nitrosomonas, continue to oxidize ammonia to nitrite to produce ATP, but lack sufficient carbon dioxide to fix and produce proteins, e.g., instead produce polyphosphates, which are used as energy storage media. This may allow ammonia-oxidizing bacteria to remain in a “storage state” for a certain period, e.g., a predetermined period, e.g., at least 1, 2, 3, 4, 5, 6, 7 days, 1, 2, 3, 4 weeks, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months, or 1, 2, 3, 4, or 5 years. In some embodiments, ammonia-oxidizing bacteria may remain in the storage state for at least about 6 months to about 1 year.

[0202] As used herein, “growth state” refers to a state or environment that may have a pH of at least about 7.6, for example, a culture medium, for example, a growth medium, in which autotrophic bacteria, for example, ammonia-oxidizing bacteria are present. The level of at least one of ammonia, ammonium ions, and urea may be about 1 micromol to 1000 millimoles. The level of trace substances is about 0.01 micromoles of iron to 200 micromoles of iron. The level of oxygen is about 5% to 100% oxygen saturation (of the medium). The level of carbon dioxide is about 20 ppm to 10% saturation (of the medium). In certain embodiments, the level of at least one of ammonia, ammonium ions, and urea may be about 10 micromoles to 100 millimoles. The level of trace substances is about 0.1 micromoles of iron to 20 micromoles of iron. The level of oxygen is about 5% to 100% oxygen saturation. The carbon dioxide level is approximately 200 ppm (for example, in the culture medium) with a 5% saturation level.

[0203] As used herein, “polyphosphate-loaded state” refers to a state or environment that may have a pH of about 7.4 or less, e.g., in a culture medium, e.g., a growth medium, e.g., in which autotrophic bacteria, e.g., ammonia-oxidizing bacteria are present. The level of at least one of ammonia, ammonium ions, and urea is about 1 micromol to 2000 millimoles. The level of trace substances is 0.01 micromoles of iron to 200 micromoles of iron. The level of oxygen is about 0% to 100% O2 saturation (e.g., in the medium). The level of carbon dioxide is 0 to less than 400 ppm, and the level of phosphate is greater than about 1 micromol. In certain embodiments, the level of at least one of ammonia, ammonium ions, and urea is about 10 micromoles to 200 millimoles. The level of trace substances is 0.1 micromoles of iron to 20 micromoles of iron. The level of oxygen is about 5% to 100% O2 saturation. Carbon dioxide levels are approximately 0-200 ppm or less, and phosphate levels are approximately 10 micromoles or more.

[0204] A polyphosphate loading state can be induced for a certain period, for example, a predetermined period. This predetermined period may be a period that allows for sufficient polyphosphate accumulation in ammonia-oxidizing bacteria. This predetermined period is suitable for providing a sufficient polyphosphate loading to allow for long-term storage of ammonia-oxidizing bacteria. This predetermined period may be at least partially based on a period of about 0.2 to 10 times, 0.3 to 5 times, 0.5 to 3 times, 0.5 to 1.5 times, or 0.5 to 1 time the doubling time of ammonia-oxidizing bacteria. This predetermined period may be at least partially based on a period of about 1 time the doubling time of ammonia-oxidizing bacteria. In some embodiments, this predetermined period is about 8 to 12 hours. In some embodiments, this predetermined period is about 10 hours. In some embodiments, this predetermined period is about 24 hours.

[0205] The purpose of a polyphosphate-loaded state may be to provide AOB with sufficient ammonia, ammonium ions, and / or urea, as well as O2, so that ATP can be produced, but without providing them with CO2 and carbonates so that they cannot use their ATP to fix CO2, and instead use their ATP to generate polyphosphates that can be stored by the bacteria.

[0206] As used herein, the term “storage conditions” refers to a state or environment having a pH of about 7.4 or less (in some embodiments, the pH may be 7.6 or less), e.g., a culture medium, e.g., a growth medium, e.g., an autotrophic bacterium, e.g., ammonia-oxidizing bacterium, e.g., in a culture medium, e.g., a growth medium. The level of at least one of ammonia, ammonium ions, and urea is about 1 to 1000 micromoles. The level of trace substances is about 0.1 to 100 micromoles. The level of oxygen is about 0 to 100% saturation (of the medium, e.g.). The level of carbon dioxide is about 0 to 800 ppm. In certain embodiments, the level of at least one of ammonia, ammonium ions, and urea is about 10 to 100 micromoles. The level of trace substances is about 1 to 10 micromoles. The level of oxygen is about 0 to 100% saturation (of the medium, e.g.). The level of carbon dioxide is about 0 to 400 ppm.

[0207] AOB is produced in some embodiments of the present disclosure by generating AOB biomass during the growth state, then exposing the AOB to a polyphosphate loading state, then removing the culture medium, and resuspending the AOB in a buffer, such as a storage buffer (i.e., in the storage state).

[0208] These ammonia-oxidizing bacteria can remain in a “storage state” for a certain period, for example, a predetermined period, for example, at least 1, 2, 3, 4, 5, 6, 7 days, 1, 2, 3, 4 weeks, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months, or 1, 2, 3, 4, or 5 years. In some embodiments, the ammonia-oxidizing bacteria can remain in a storage state for at least about 6 months to about 1 year. Upon regeneration, the viability of the ammonia-oxidizing bacteria is at least about 50%, 60%, 70%, 80%, 90%, or 100% of the viability of the ammonia-oxidizing bacteria before storage (e.g., in a growing state). In some embodiments, the ammonia-oxidizing bacterial preparation is stored under selected conditions and contains NH4 + It can be prepared such that only 10%, 20%, 30%, 40%, 50%, 60%, or 70% or less of its oxidizing ability is lost.

[0209] The time required to regenerate ammonia-oxidizing bacteria from storage (or polyphosphate-loaded) conditions may be a predetermined period. For example, this predetermined period may be less than approximately 75 hours or less than approximately 72 hours. This predetermined period may be at least partially based on periods of approximately 0.2 to 10 times, 0.3 to 5 times, 0.5 to 3 times, 0.5 to 1.5 times, or 0.5 to 1 times the doubling time of ammonia-oxidizing bacteria. This predetermined period may be at least partially based on the period of approximately 1 doubling time of ammonia-oxidizing bacteria. This predetermined period may be approximately 8 to 12 hours. This predetermined period may be approximately 10 hours. This predetermined time may be approximately 75 hours, 72 hours, 70 hours, 68 hours, 65 hours, 60 hours, 55 hours, 50 hours, 45 hours, 40 hours, 35 hours, 30 hours, 25 hours, 20 hours, 15 hours, 10 hours, 5 hours, 4 hours, 3 hours, 2 hours, or less than 1 hour. This predetermined period can range from approximately 5 minutes to 5 hours. This predetermined period can range from approximately 5 to 10 minutes, 10 to 15 minutes, 15 to 20 minutes, 20 to 25 minutes, 25 to 30 minutes, 30 to 45 minutes, 45 to 60 minutes, 60 minutes to 1.5 hours, 1.5 hours to 2 hours, 2 hours to 2.5 hours, 2.5 hours to 3 hours, 3 hours to 3.5 hours, 3.5 hours to 4 hours, 4 hours to 4.5 hours, or 4.5 hours to 5 hours. In some embodiments, this predetermined period can be approximately 2 hours. This predetermined period could be, for example, the time required to achieve regeneration of ammonia-oxidizing bacteria, for example, the time required to achieve a viability of ammonia-oxidizing bacteria of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99%, or 100% compared to the viability of bacteria before storage (e.g., in a growing state).

[0210] 2. Ammonia-oxidizing bacteria (AOB), N. eutropha strain D23, and similar bacteria Autotrophic ammonia-oxidizing bacteria (which may be referred to herein as multiple AOBs or simply AOB) are obligate autotrophic bacteria mentioned by Alan B. Hooper and A. Krummel et al. (Alan B. Hooper, Biochemical) Basis of Obligate Autotrophy in Nitrosomonas europaea, Journal of Bacteriology, Feb 1969, pp. 776-779. Antje Krummel et al., Effect of Organic Matter on Growth and Cell Yield of Ammonia-Oxidizing Bacteria, Arch Microbiol (1982) 133:50-54. These bacteria obtain all their metabolic energy solely from the oxidation of ammonia to nitrite in their respiratory chain with nitric oxide (NO) as an intermediate product, and virtually all their carbon by fixing carbon dioxide. They are unable to utilize carbon sources other than a few simple molecules.

[0211] Ammonia-oxidizing bacteria (AOBs) are widely found in the environment and, in the presence of ammonia, fix oxygen and trace metals, carbon dioxide, and proliferate. AOB growth can be slow, and toxic levels of ammonia can kill fish and other organisms before AOBs can proliferate and reduce ammonia to non-toxic levels. The slow growth of AOBs may also delay the health benefits of NO and nitrites produced by AOBs when applied to the skin.

[0212] It is desirable to replenish aquariums, skin, or processes with a sufficient number of viable AOBs that are grown and stored for that purpose. Since AOBs do not form spores, storage in a dry state with high viability is difficult, while storage in a wet state keeps them in a metabolically active state.

[0213] For example, studies have been conducted on the decline in nitrification capacity of AOB (ammonium oxidizing bacteria) during storage for wastewater treatment (Munz G, Lubello C, Oleszkiewicz JA. Modeling the decay of ammonium oxidizing bacteria. Water Res. 2011 Jan;45(2):557-64. Oi:10.1016 / j.watres.2010.09.022).

[0214] The growth, long-term storage, and restoration of activity of Nitrosomonas have been discussed by Cassidy et al. (US Patent No. 5,314,542), who disclose growing Nitrosomonas, removing toxic waste, storing them in sterile water of appropriate salinity for up to one year, and then regenerating them by adding buffer (CaCO3) and 200 ppm ammonium (this regeneration takes 72 hours).

[0215] As an obligate autotroph, AOBs use this energy to fix CO2 and synthesize proteins by reducing the equivalents produced by the oxidation of ammonia to nitrite. Growth requires ammonia, oxygen, minerals, and carbon dioxide.

[0216] Nitrosomonas is known as "Polyphosphate and Orthophosphate Content of Nitrosomonas europaea as a Function of Growth" (KRTerry and ABHooper,Journal of Bacteriology,July According to 1970, pp. 199-206, Vol. 103, No. I), it can exist in several metabolic states.

[0217] In certain embodiments of this disclosure, the ammonia-oxidizing bacteria may be pure. The ammonia-oxidizing bacteria preparation (formulation or composition) may contain, be essentially derived from, or consist of pure ammonia-oxidizing bacteria. The ammonia-oxidizing bacteria may be derived from a genus selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, and combinations thereof.

[0218] This disclosure provides, in particular, a unique strain of ammonia-oxidizing bacteria, e.g., an optimized strain, N. eutropha strain D23, which can increase the production of nitric oxide and nitric oxide precursors on the surface of a subject, e.g., a human subject. This disclosure also provides methods for using this bacteria and articles containing this bacteria.

[0219] In several embodiments, the N. eutropha does not exist in nature. For example, it may have accumulated desirable mutations during the selection period. In other embodiments, desirable mutations may be introduced by the experimenter. In some embodiments, the N. eutropha may be a purified preparation and may be an optimized N. eutropha.

[0220] In preferred embodiments, the N. eutropha strain is autotrophic and therefore cannot cause infection. The preferred strain utilizes urea and ammonia, eliminating the need for hydrolysis of urea in sweat before absorption and utilization by the bacteria. Furthermore, to grow at low pH, this bacterium uses NH4 + It can absorb either ions or urea. This selected strain must also have the ability to survive on a subject, such as the external skin of humans, and must be able to withstand the conditions there.

[0221] Although this disclosure specifically refers to N. eutropha strain D23, preparations, methods, compositions, therapeutic agents, wearable articles, and clothing may be used that contain one or more other strains of N. eutropha, one or more other species of Nitrosomonas, and one or more other ammonia-oxidizing bacteria. Autotrophic AOBs are obligate autotrophic bacteria mentioned by Alan B. Hooper and A. Krummel et al. (Alan B. Hooper, Biochemical Basis of Obligate Autotrophy in Nitrosomonas europaea, Journal) of Bacteriology, Feb 1969, pp. 776-779. Antje Krummel et al., Effect of Organic Matter on Growth and Cell Yield of Ammonia-Oxidizing Bacteria, Arch Microbiol (1982) 133:50-54. These bacteria obtain all their metabolic energy solely from the oxidation of ammonia to nitrite with nitric oxide (NO) as an intermediate product in their respiratory chain, and obtain virtually all their carbon by fixing carbon dioxide. They are unable to utilize carbon sources other than a few simple molecules.

[0222] In a particular embodiment, this N. eutropha is the strain with accession number PTA-121157, which was deposited with the American Tissue Culture Collection (ATCC) on April 8, 2014, and designated AOB D23-100 (25 vials).

[0223] In certain embodiments, the N. eutropha includes a chromosome having a sequence that is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to sequence number 1 (whole genome sequence of strain D23).

[0224] In a particular embodiment, bacteria having the above-described sequence characteristics have (1) an optimized growth rate measured by doubling time, (2) an optimized growth rate measured by OD600, and (3) an optimized NH4 + Oxidation rate, (4) NH4 + Optimization resistance to (4) NO2 - It possesses one or more of the following optimization resistances. Specific subcombinations of these properties are specified in the following paragraphs.

[0225] In some embodiments, the N. eutropha described herein is (1) an optimized growth rate measured in doubling time, (2) an optimized growth rate measured in OD600, and (3) an optimized NH4 + Oxidation rate, (4) NH4+ Optimization resistance to (4) NO2 - It has one or more of the optimization resistances to . For example, this bacterium may have properties (1) and (2); (2) and (3); (3) and (4); or (4) and (5) from the first list of this paragraph. As another example, this bacterium may have properties (1), (2), and (3); (1), (2), and (4); (1), (2), and (5); (1), (3), and (4); (1), (3), and (5); (1), (4), and (5); (2), (3), and (4); (2), (3), and (5); or (3), (4), and (5). As further examples, the bacterium may have characteristics (1), (2), (3), and (4) from the first list of this paragraph; (1), (2), (3), and (5); (1), (2), (4), and (5); (1), (3), (4), and (5); or (2), (3), (4), and (5). In some embodiments, the bacterium has characteristics (1), (2), (3), (4), and (5) from the first list of this paragraph.

[0226] This disclosure relates to (1) the optimized growth rate measured in doubling time, (2) the optimized growth rate measured in OD600, and (3) the optimized NH4 + Oxidation rate, (4) NH4 + Optimization resistance to (4) NO2 -We also provide pure compositions of N. eutropha having one or more of the optimization resistances to . For example, the pure N. eutropha composition may have properties (1) and (2); (2) and (3); (3) and (4); or (4) and (5) from the first list of this paragraph. As another example, the pure N. eutropha composition may have properties (1), (2), and (3); (1), (2), and (4); (1), (2), and (5); (1), (3), and (4); (1), (3), and (5); (1), (4), and (5); (2), (3), and (4); (2), (3), and (5); or (3), (4), and (5). As further examples, the pure N. eutropha composition may have properties (1), (2), (3), and (4) of the first list in this paragraph; (1), (2), (3), and (5); (1), (2), (4), and (5); (1), (3), (4), and (5); or (2), (3), (4), and (5). In some embodiments, the pure N. eutropha composition of the first list in this paragraph has properties (1), (2), (3), (4), and (5).

[0227] N. eutropha strain D23, designated AOB D23-100 and deposited with the ATCC Patent Depository Office on April 8, 2014, under accession number PTA-121157, in the form of 25 vials, comprises a circular genome having SEQ ID NO: 1 or its complement. Thus, in some embodiments, the N. eutropha strains described herein comprise a nucleic acid sequence similar to SEQ ID NO: 1 or its complement, e.g., a genome.

[0228] For example, N. eutropha may contain nucleic acid sequences having a 1,000-base-pair portion that has at least approximately 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity with the 1,000-base-pair portion of SEQ ID NO: 1 or its complement. This 1,000-base-pair portion can range, for example, from nucleotide (n × 1,000) + 1 to (n + 1) × 1,000, where n = 0, 1, 2, 3...2538, for example, nucleotides 1 to 1,000, 1,001 to 2,000, etc., up to the end of SEQ ID NO: 1.

[0229] In several embodiments, N. eutropha includes a nucleic acid sequence having a 2,000 base pair portion that has at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity with the 2,000 base pair portion of SEQ ID NO: 1 or its complement. This 2,000 base pair portion can be, for example, nucleotides (n × 2,000) + 1 to (n + 1) × 2,000, where n = 0, 1, 2, 3...1269, for example, nucleotides 1 to 2,000, 2,001 to 4,000, etc., up to the end of SEQ ID NO: 1.

[0230] In several embodiments, N. eutropha includes a nucleic acid sequence having a 5,000 base pair portion that has at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity with the 5,000 base pair portion of SEQ ID NO: 1 or its complement. This 5,000 base pair portion can be, for example, nucleotides (n × 5,000) + 1 to (n + 1) × 5,000, where n = 0, 1, 2, 3...508, for example, nucleotides 1 to 5,000, 5,001 to 10,000, etc., up to the end of SEQ ID NO: 1.

[0231] In several embodiments, N. eutropha includes a nucleic acid sequence having a 10,000 base pair portion that has at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity with the 10,000 base pair portion of SEQ ID NO: 1 or its complement. This 10,000 base pair portion can be, for example, nucleotides (n × 10,000) + 1 to (n + 1) × 10,000, where n = 0, 1, 2, 3...254, for example, nucleotides 1 to 10,000, 10,001 to 20,000, etc., up to the end of SEQ ID NO: 1.

[0232] In several embodiments, N. eutropha includes a nucleic acid sequence having a 20,000 base pair portion that has at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity with the 20,000 base pair portion of SEQ ID NO: 1 or its complement. This 20,000 base pair portion can be, for example, nucleotides (n × 20,000) + 1 to (n + 1) × 20,000, where n = 0, 1, 2, 3...127, for example, nucleotides 1 to 20,000, 20,001 to 40,000, etc., up to the end of SEQ ID NO: 1.

[0233] In several embodiments, N. eutropha includes a nucleic acid sequence having a 50,000 base pair portion that has at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity with the 50,000 base pair portion of SEQ ID NO: 1 or its complement. This 50,000 base pair portion can be, for example, nucleotides (n × 50,000) + 1 to (n + 1) × 50,000, where n = 0, 1, 2, 3...51, for example, nucleotides 1 to 50,000, 50,001 to 100,000, etc., up to the end of SEQ ID NO: 1.

[0234] In several embodiments, N. eutropha includes a nucleic acid sequence having a 100,000 base pair portion that has at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity with the 100,000 base pair portion of SEQ ID NO: 1 or its complement. This 100,000 base pair portion can be, for example, nucleotides (n × 100,000) + 1 to (n + 1) × 100,000, where n = 0, 1, 2, 3...26, for example, nucleotides 1 to 100,000, 100,001 to 20,000, etc., up to the end of SEQ ID NO: 1.

[0235] In some embodiments, the Disclosure provides compositions of N. eutropha containing chromosomes identical to at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% of SEQ ID NO: 1. In some embodiments, the Disclosure provides pure compositions of N. eutropha containing chromosomes identical to at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% of SEQ ID NO: 1.

[0236] In certain embodiments, the N. eutropha strain includes a nucleic acid sequence, e.g., a genome, that hybridizes to the genome of strain D23, designated as SEQ ID NO: 1 or AOB D23-100, deposited with the ATCC Patent Depository Office on April 8, 2014, in the form of 25 vials under accession number PTA-121157, or to their complement, under low, moderate, high, or very high stringency conditions, or other hybridization conditions described herein. As used herein, the terms “hybridize under low, moderate, high, or very high stringency conditions” describe hybridization and washing conditions. Guidance for performing the hybridization reaction is incorporated by reference to Current Protocols in Molecular Biology, John Wiley & Co. This can be found in Sons, NY (1989), 6.3.1–6.3.6. Both aqueous and non-aqueous methods are described in this reference, and either can be used. The specific hybridization conditions referred to herein are as follows: 1) Low-stringency hybridization conditions in 6x sodium chloride / sodium citrate (SSC) at approximately 45°C, followed by two washes in 0.2x SSC and 0.1% SDS at at least 50°C (for low-stringency conditions, the temperature of these washes can be increased to 55°C); 2) Medium-stringency hybridization in 6x SSC at approximately 45°C. 1) High stringency hybridization conditions: 1) Hybridization conditions, followed by one or more washes at 60°C in 0.2x SSC and 0.1% SDS; 2) High stringency hybridization conditions: 1

[0237] The genome of strain D23 (Sequence ID 1) was compared with the genome of N. eutropha C91. Annotations for the D23 genome are shown in Supplementary Table 1, listing the locations of 2,777 genes in Sequence ID 1 as identified by sequence analysis. In certain embodiments, the N. eutropha described herein includes one or more genes or proteins listed in Supplementary Table 1, or genes or proteins similar to one of the aforementioned genes or proteins.

[0238] Therefore, in some embodiments, N. eutropha includes the genes listed in Supplementary Table 1, or the proteins encoded by said genes. In certain embodiments, N. eutropha includes genes similar to those listed in Supplementary Table 1 (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical), or the proteins encoded by said genes. In some embodiments, N. eutropha includes at least 2, 3, 4, 5, 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 1000, 1500, 2000, 2500, or all of the genes listed in Supplementary Table 1, or genes or proteins that are identical or similar to the proteins encoded by said genes.

[0239] In some embodiments, the N. eutropha described herein (e.g., strain D23) includes one or more genes or proteins that are absent in strain C91, or genes or proteins similar to one of the aforementioned genes or proteins. Examples of these genes are shown in Figures 6-8 and are described in more detail in Example 4 herein.

[0240] Therefore, with respect to Figure 6, in some embodiments, this N. eutropha contains genes that are identical or similar (for example, at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical) to 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, or all of the genes in Figure 6. In some embodiments, the N. eutropha contains one, two, three, four, five, ten, fifteen, two, three, four, sixteen, sixteen, or all of the proteins encoded by the genes listed in Figure 6 that are identical or similar (for example, at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical).

[0241] With respect to Figure 7, in some embodiments, the N. eutropha contains genes that are identical or similar (for example, at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical) to 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, or all of the genes in Figure 7. In some embodiments, the N. eutropha contains one, two, three, four, five, ten, fifteen, two, three, four, fifteen, sixteen, sixteen, or all of the proteins encoded by the genes listed in Figure 7 that are identical or similar (for example, at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical).

[0242] With respect to Figure 8, in some embodiments, this N. eutropha contains genes that are identical or similar (for example, at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical) to 1, 2, 3, 4, 5, 10, 15, 200, or all of the genes in Figure 8. In some embodiments, the N. eutropha contains one, two, three, four, five, ten, fifteen, two, three, four, fifteen

[0243] Collectively with respect to Figures 6-8, in some embodiments, this N. eutropha contains genes that are identical or similar (for example, at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical) to 1, 2, 3, 4, 5, 10, 20, 40, 60, 80, 100, 150, 200, 250, 300, 350, 400, 450, 500, or all of the genes in Figures 6-8. In some embodiments, the N. eutropha contains one, two, three, four, five, ten, two, four, four, five, three, four, four, five, five, four, four, five, five, four, four, five, five, four, five, five, four, four, five, five, five, four, four, five, five, five, four, four, five, five, five, four, four, five, five, five, four, four, five, five, five, five, four, four, five, five, five, five, four, four, five, five, five, five, four, four, five, five, five, five, five, five, four, four, four, five

[0244] In some embodiments, the N. eutropha described herein (e.g., strain D23) lacks one or more genes or proteins specific to strain C91, or genes or proteins similar to one of the aforementioned genes or proteins. Examples of these genes are shown in Figure 9 and described in detail in Example 4 herein. Accordingly, in some embodiments, the N. eutropha described herein lacks at least one, two, three, four, five, ten, 20, 50, 100, 150, 200, 250, or all of the genes in Figure 9. In some embodiments, the N. eutropha described herein lacks up to two, three, four, five, ten, 20, 50, 100, 150, 200, 250, or all of the genes in Figure 9. In several embodiments, the N. eutropha described herein lacks approximately 1–5, 5–10, 10–20, 20–50, 50–100, 100–150, 150–200, 200–250, or 250–all of the genes shown in Figure 9.

[0245] The sequencing of the D23 genome identified genes involved in ammonia metabolism (e.g., ammonia monooxygenase, hydroxylamine oxidoreductase, cytochrome c554, and cytochrome c554).M We identified several potentially interesting genes, including 552). All of these genes are present in multiple copies, and generally, these copies are not identical to one another. One interesting pair of genes is the ammonia monooxygenase synthetic operon amoCAB, which is present in two copies in addition to a third copy of amoC. These operons have homologs in C91, namely Neut_2078 / 7 / 6 and Neut_2319 / 8 / 7. Another interesting pair of genes is hydroxylamine oxidoreductase (hao), which is present in three copies. The homologs of this hao in C91 are designated Neut_1672, 1793, and 2335. A third interesting pair of genes is the cytochrome c554 gene encoded by cycA, which is present in three copies. The corresponding C91 genes are designated Neut_1670, 1791, and 2333. The fourth interesting pair of genes is cytochrome c, encoded by cycB, which is present in both copies. M There are 552 genes. These homologous C91 genes are designated as Neut_1790 and 2332. Each gene group is summarized in Table 1 and will be discussed in more detail below. [Table 1]

[0246] In some embodiments, the N. eutropha described herein includes genes that are identical or similar to those of the genes and proteins in Table 1.

[0247] More specifically, in certain embodiments, the Disclosure provides compositions of N. eutropha, e.g., purified N. eutropha preparations, comprising nucleic acid sequences that are at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the ammonia monooxygenase sequences of Table 1. In certain embodiments, the Disclosure provides compositions of N. eutropha comprising nucleic acid sequences that are at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the hydroxylamine oxidoreductase sequences of Table 1. In certain embodiments, the Disclosure provides compositions of N. eutropha containing nucleic acid sequences that are at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the cytochrome c554 sequences of Table 1. In certain embodiments, the Disclosure provides compositions of N. eutropha containing cytochrome c554 sequences of Table 1. M The present invention provides a composition of N. eutropha containing nucleic acid sequences that are at least approximately 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the 552 sequence.

[0248] In certain embodiments, the Disclosure provides compositions of N. eutropha containing amino acid sequences that are at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.3%, 99.4%, 99.5%, or 99.6% identical to the ammonia monooxygenase sequences of Table 1. In certain embodiments, the Disclosure provides compositions of N. eutropha containing amino acid sequences that are at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.4%, 99.5%, 99.6%, or 99.7% identical to the hydroxylamine oxidoreductase sequences of Table 1. In certain embodiments, the Disclosure provides a composition of N. eutropha containing an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.5%, 99.6%, or 99.7% identical to the cytochrome c554 sequence of Table 1. MThe present invention provides a composition of N. eutropha containing an amino acid sequence that is at least approximately 70%, 80%, 85%, 90%, 95%, 96%, 97%, 97.1%, 97.2%, 97.5%, 98%, 98.5%, 98.6%, 98.7%, 98.8%, 99%, or 99.5% identical to the 552 sequence.

[0249] In some embodiments, N. eutropha is present in a pure composition, for example, in the form of a purified, optimized N. eutropha preparation.

[0250] More specifically, in certain embodiments, the Disclosure provides a pure composition of N. eutropha containing nucleic acid sequences that are at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 98.5%, 98.8%, 98.9%, 99%, 99.2%, 99.3%, 99.4%, 99.5%, or 99.6% identical to the ammonia monooxygenase sequences of Table 1. In certain embodiments, the Disclosure provides a pure composition of N. eutropha containing nucleic acid sequences that are at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the hydroxylamine oxidoreductase sequences of Table 1. In certain embodiments, the Disclosure provides a pure composition of N. eutropha containing nucleic acid sequences that are at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the cytochrome c554 sequences of Table 1. In certain embodiments, the Disclosure provides a pure composition of N. eutropha containing cytochrome c554 sequences of Table 1. M The present invention provides a pure composition of N. eutropha containing nucleic acid sequences that are at least approximately 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the 552 sequence.

[0251] In certain embodiments, the Disclosure provides a pure composition of N. eutropha containing an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 98.5%, 98.8%, 98.9%, 99%, 99.2%, 99.3%, 99.4%, 99.5%, or 99.6% identical to the ammonia monooxygenase sequence of Table 1. In certain embodiments, the Disclosure provides a pure composition of N. eutropha containing an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.4%, 99.5%, 99.6%, or 99.7% identical to the hydroxylamine oxidoreductase sequence of Table 1. In certain embodiments, the Disclosure provides a pure composition of N. eutropha containing an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.5%, 99.6%, or 99.7% identical to the cytochrome c554 sequence of Table 1. M The present invention provides a pure composition of N. eutropha containing amino acid sequences identical to 552 sequences by at least approximately 70%, 80%, 85%, 90%, 95%, 96%, 97%, 97.1%, 97.2%, 97.5%, 98%, 98.5%, 98.6%, 98.7%, 98.8%, 99%, or 99.5%.

[0252] In some embodiments, N. eutropha comprises a gene or protein containing a sequence that is at least approximately 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to any of the strain D23 sequences in Table 1, e.g., SEQ ID NOs. 4-33. Substitutions may be conserved or non-conserved, and insertions and deletions are also intended. In some embodiments, N. eutropha comprises a gene or protein containing any of the sequences in Table 1, e.g., SEQ ID NOs. 4-33. In some embodiments, this protein has N-terminal and / or C-terminal elongations or deletions of up to approximately 1, 2, 3, 4, 5, 6, 8, 10, 15, 20, 25, 50, or 100 amino acids.

[0253] The nucleic acid sequence alignments in Table 1 show the percentage of identity between C91 homologs and D23 homologs. The following paragraphs discuss this percentage of identity and describe various genes that are homologous to the D23 gene in Table 1.

[0254] More specifically, these amoA1 genes are approximately 98.8% identical (i.e., at position 821 / 831). Therefore, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains D23 nucleotides at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains a gene that is at least approximately 98.8%, 98.9%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 amoA1 gene.

[0255] These amoA2 genes are approximately 98.8% identical (i.e., at position 821 / 831). Therefore, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains D23 nucleotides at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains a gene that is at least approximately 98.8%, 98.9%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 amoA2 gene.

[0256] These amoB1 genes are approximately 99.1% identical (i.e., at position 1255 / 1266). Therefore, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains D23 nucleotides at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains a gene that is at least approximately 99.1%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 amoB1 gene.

[0257] These amoB2 genes are approximately 99.1% identical (i.e., at position 1254 / 1266). Therefore, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains D23 nucleotides at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains a gene that is at least approximately 99.1%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 amoB2 gene.

[0258] These amoC1 genes are approximately 99.8% identical (i.e., at positions 814 / 816). Therefore, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least one, two, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains D23 nucleotides at up to one, two, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains a gene that is at least approximately 99.8%, 99.9%, or 100% identical to the D23 amoC1 gene.

[0259] These amoC2 genes are approximately 99.8% identical (i.e., at positions 814 / 816). Therefore, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least one, two, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains D23 nucleotides at up to one, two, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains a gene that is at least approximately 99.8%, 99.9%, or 100% identical to the D23 amoC2 gene.

[0260] These amoC3 genes are approximately 98.9% identical (i.e., at positions 816 / 825). Therefore, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains D23 nucleotides at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains a gene that is at least approximately 98.9%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 amoC3 gene.

[0261] These hao1 genes are approximately 99.0% identical (i.e., at positions 1696 / 1713). Therefore, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or all, of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains D23 nucleotides at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or all, of the positions where this gene differs between strain C91 and strain D23. In several embodiments, the N. eutropha described herein contains a gene that is at least about 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 hao1 gene.

[0262] These hao2 genes are approximately 99.4% identical (i.e., at positions 1702 / 1713). Therefore, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains D23 nucleotides at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains a gene that is at least approximately 99.4%, 99.6%, 99.8%, or 100% identical to the D23 hao2 gene.

[0263] These hao3 genes are approximately 99.2% identical (i.e., at position 1700 / 1713). Therefore, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains D23 nucleotides at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains a gene that is at least approximately 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 hao3 gene.

[0264] These cycA1 genes are approximately 98.0% identical (i.e., at positions 694 / 708). Therefore, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains D23 nucleotides at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or all of the positions where this gene differs between strain C91 and strain D23. In several embodiments, the N. eutropha described herein contains a gene that is at least about 98.0%, 98.2%, 98.4%, 98.6%, 98.8%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 cycA1 gene.

[0265] These cycA2 genes are approximately 98.7% identical (i.e., at positions 699 / 708). Therefore, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains D23 nucleotides at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains a gene that is at least approximately 98.7%, 98.8%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 cycA2 gene.

[0266] These cycA3 genes are approximately 99.3% identical (i.e., at positions 703 / 708). Therefore, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least one, two, three, four, five, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains D23 nucleotides at up to one, two, three, four, five, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains a gene that is at least approximately 99.3%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 cycA3 gene.

[0267] These cycB1 genes are approximately 96.7% identical (i.e., at position 696 / 720). Therefore, in some embodiments, the N. eutropha described herein contain at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or all of the D23 nucleotides at positions where this gene differs between strain C91 and strain D23. In several embodiments, the N. eutropha described herein contains up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or all of the D23 nucleotides at which this gene differs between strain C91 and strain D23. In several embodiments, the N. eutropha described herein contains at least about 96.7%, 96.8%, 97.0%, 97.2%, 97.4%, 97.6%, 97.8%, 98.0%, 98.2%, 98.4%, 98.4%, 98.6%, 98.8%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical genes to the D23 cycB1 gene.

[0268] These cycB2 genes are approximately 97.1% identical (i.e., at positions 702 / 723). Therefore, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains D23 nucleotides at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or all of the positions where this gene differs between strain C91 and strain D23. In several embodiments, the N. eutropha described herein contains at least about 97.1%, 97.2%, 97.4%, 97.6%, 97.8%, 98.0%, 98.2%, 98.4%, 98.4%, 98.6%, 98.8%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical genes to the D23 cycB2 gene.

[0269] The following four paragraphs provide a more detailed explanation of the genes and proteins in Table 1.

[0270] Ammonia monooxygenase reacts [ka] It is an enzyme involved in ammonia oxidation that catalyzes (Ensign et al., 1993). In N. eutropha strain D23, the ammonia monooxygenase operon contains three genes designated as amoA, amoB, and amoC. Strain D23 contains two copies of the entire operon and a third copy of amoC. These genes and corresponding proteins are listed in Table 1 above. In certain embodiments, the N. eutropha described herein contains one or two ammonia monooxygenase subunit A genes and / or proteins from Table 1 (e.g., the D23 sequence in Table 1), or similar genes and / or proteins. In some embodiments, the N. eutropha described herein contains one or two ammonia monooxygenase subunit B genes and / or proteins from Table 1 (e.g., the D23 sequence in Table 1), or similar genes and / or proteins. In certain embodiments, the N. eutropha described herein comprises the ammonia monooxygenase subunit C gene and / or protein of Table 1, 1, 2, or 3 (e.g., the D23 sequence in Table 1), or a similar gene and / or protein. In some embodiments, the N. eutropha described herein comprises at least one or two of the following: (a) the ammonia monooxygenase subunit A gene and / or protein of Table 1 (e.g., the D23 sequence in Table 1), (b) the ammonia monooxygenase subunit B gene and / or protein of Table 1 (e.g., the D23 sequence in Table 1), and (c) the ammonia monooxygenase subunit C gene and / or protein of Table 1 (e.g., the D23 sequence in Table 1). For example, this N. eutropha may comprise all of these ammonia monooxygenase genes and / or proteins of Table 1 (e.g., the D23 sequences in Table 1), or similar genes and / or proteins. More specifically, in some embodiments, this N. eutropha contains all of the D23 ammonia monooxygenase genes listed in Table 1.In some embodiments, this N. eutropha contains all of the D23 ammonia monooxygenase proteins listed in Table 1. Hydroxylamine oxidoreductase is involved in the following common reactions. [ka] They catalyze the following. They typically use heme as a cofactor. N. eutropha strain D23 contains three hydroxylamine oxidoreductases designated hao1, hao2, and hao3. These genes and corresponding proteins are listed in Table 1 above. In some embodiments, the N. eutropha described herein contains hydroxylamine oxidoreductase genes and / or proteins 1, 2, or 3 of Table 1 (e.g., the D23 sequences in Table 1), or similar genes and / or proteins. For example, this N. eutropha may contain all of the hydroxylamine oxidoreductase genes and / or proteins (e.g., the D23 sequences in Table 1), or similar genes and / or proteins. More specifically, in some embodiments, this N. eutropha contains all of the D23 hydroxylamine oxidoreductase genes in Table 1. In some embodiments, this N. eutropha contains all of the D23 hydroxylamine oxidoreductase proteins listed in Table 1.

[0271] The ability of D23 to aerobically catabolize ammonia as its sole energy source and reducer is due to two specialized protein complexes, Amo and Hao, as well as cytochrome c554 and c554, which deliver electrons to the quinone pool. m552 is required. During ammonia oxidation at low oxygen concentrations, the NO reductase activity of c554 is important. N. eutropha strain D23 contains three cytochrome c554 genes designated as cycA1, cycA2, and cycA3. These genes and corresponding proteins are listed in Table 1 above. In some embodiments, the N. eutropha described herein contains cytochrome c554 genes and / or proteins 1, 2, or 3 of Table 1 (e.g., D23 sequences in Table 1), or similar genes and / or proteins. For example, this N. eutropha may contain all of the cytochrome c554 genes and / or proteins of Table 1 (e.g., D23 sequences in Table 1), or similar genes and / or proteins. More specifically, in some embodiments, this N. eutropha contains all of the D23 cytochrome c554 genes of Table 1. In some embodiments, this N. eutropha contains all of the D23 cytochrome c554 proteins listed in Table 1.

[0272] The ability of D23 to aerobically catabolize ammonia as its sole energy source and reducer is due to two specialized protein complexes, Amo and Hao, as well as cytochrome c554 and c554, which deliver electrons to the quinone pool. m Requires 552. Cytochrome c m 552 reduces quinones with electrons of Hao origin. N. eutropha strain D23 has two cytochrome c designated as cycB1 and cycB2. M It contains 552 genes. These genes and their corresponding proteins are listed in Table 1 above. In some embodiments, the N. eutropha described herein contains one or two cytochrome c from Table 1. M It contains 552 genes and / or proteins (e.g., the D23 sequence in Table 1), or similar genes and / or proteins. For example, this N. eutropha contains cytochrome c in Table 1. M552 may include both the gene and / or protein (e.g., the D23 sequence in Table 1), or a similar gene and / or protein. More specifically, in some embodiments, this N. eutropha may include the D23 cytochrome c in Table 1. M It contains both of the 552 genes. In some embodiments, this N. eutropha is D23 cytochrome c as shown in Table 1. M Contains both of the 552 proteins.

[0273] In some embodiments, the N. eutropha described herein comprises a combination of genes and / or proteins selected from Table 1. This combination may, for example, include the genes and / or proteins listed in the preceding four paragraphs. For example, this combination may include two classes of genes and / or proteins from Table 1. Thus, in some embodiments, the N. eutropha comprises one or more ammonia monooxygenase genes and / or proteins and one or more hydroxylamine oxidoreductase genes and / or proteins listed in Table 1 or the preceding four paragraphs. In some embodiments, the N. eutropha comprises one or more ammonia monooxygenase genes and / or proteins and one or more cytochrome c554 genes and / or proteins listed in Table 1 or the preceding four paragraphs. In some embodiments, the N. eutropha comprises one or more ammonia monooxygenase genes and / or proteins and one or more cytochrome c554 genes and / or proteins listed in Table 1 or the preceding four paragraphs. M It includes the 552 gene and / or protein. In some embodiments, this N. eutropha includes one or more hydroxylamine oxidoreductase genes and / or proteins as listed in Table 1 or the preceding four paragraphs, and one or more cytochrome c554 genes and / or proteins. In some embodiments, this N. eutropha includes one or more hydroxylamine oxidoreductase genes and / or proteins as listed in Table 1 or the preceding four paragraphs, and one or more cytochrome c M It contains 552 genes and / or proteins.

[0274] This combination may also include the three classes of genes and / or proteins listed in Table 1. Therefore, in some embodiments, N. eutropha comprises one or more ammonia monooxygenase genes and / or proteins listed in Table 1 or the four paragraphs above, as well as one or more hydroxylamine oxidoreductase genes and / or proteins, and one or more cytochrome c554 genes and / or proteins. In some embodiments, N. eutropha comprises one or more ammonia monooxygenase genes and / or proteins listed in Table 1 or the four paragraphs above, as well as one or more hydroxylamine oxidoreductase genes and / or proteins, and one or more cytochrome c554 genes and / or proteins. M It contains 552 genes and / or proteins. In some embodiments, this N. eutropha contains one or more ammonia monooxygenase genes and / or proteins listed in Table 1 or the four paragraphs above, and one or more cytochrome c554 genes and / or proteins, and / or one or more cytochrome c M Includes 552 genes and / or proteins. In some embodiments, this N. eutropha includes one or more hydroxylamine oxidoreductase genes and / or proteins listed in Table 1 or the preceding paragraph 4, and one or more cytochrome c554 genes and / or proteins, and / or one or more cytochrome c M It contains 552 genes and / or proteins.

[0275] This combination may include genes and / or proteins of all four classes in Table 1. Therefore, in some embodiments, N. eutropha may include one or more ammonia monooxygenase genes and / or proteins as described in Table 1 or the four paragraphs above, as well as one or more hydroxylamine oxidoreductase genes and / or proteins, as well as one or more cytochrome c554 genes and / or proteins, and / or one or more cytochrome c M It contains 552 genes.

[0276] Table 2 (below) lists the sequence differences between the D23 and C91 proteins in Table 1. For example, AmoA1 has an M at position 1 of C91, but a V at position 1 of D23, and this difference is abbreviated as M1V in Table 2. As another example, D23 CycB1 has a DDD insertion between residues 194 and 195 of the C91 protein, with the added residues being residue numbers 195, 196, and 197 of the D23 protein, and this difference is abbreviated as 195insD, 196insD, and 197insD, respectively, in Table 2. The sequence alignments that form the basis of Table 2 are shown in Figures 10-16. [Table 2]

[0277] Accordingly, the N. eutropha described herein may include one or more of the sequence characteristics listed in Table 2. For example, the N. eutropha may include at least one, two, three, four, five, ten, fifteen, twenty, twenty-five, thirty, or all of the sequence characteristics in Table 2. In some embodiments, the N. eutropha may include two, three, four, five, ten, fifteen, twenty, twenty-five, thirty, or all of the sequence characteristics in Table 2. In some embodiments, the N. eutropha may include one to five, five to ten, ten to fifteen, fifteen to twenty, twenty to twenty-five, twenty-five, or thirty, or all of the sequence characteristics in Table 2. The N. eutropha may also include fragments of the protein.

[0278] For individual categories of genes or proteins, in some embodiments, N. eutropha includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the sequence characteristics of the first section (described in Table 2) (ammonia monooxygenase). In some embodiments, N. eutropha includes 1 to 5, 3 to 7, 4 to 8, or 5 to 10 of the sequence characteristics of the first section of Table 2. For example, in some embodiments, N. eutropha includes at least 1, 2, or 3 sequence characteristics of the amoA gene or protein listed in Table 2, and / or 2 or 3 or fewer of these characteristics. N. eutropha may also include at least 1 or 2 sequence characteristics of the amoB gene or protein listed in Table 2. In addition, N. eutropha may include at least 1 or 2 sequence characteristics of the amoC3 gene listed in Table 2. N. eutropha may also include fragments of the aforementioned proteins.

[0279] With respect to the hao gene and protein, N. eutropha may contain at least one, two, three, four, five, six, seven, eight, or all of the sequence characteristics of the second section (described in Table 2, which describes hydroxylamine oxidoreductase). In several embodiments, N. eutropha may contain one to four, two to five, three to six, or four to eight of the sequence characteristics of the second section of Table 2. N. eutropha may also contain at least one, two, or three of the sequence characteristics of Hao1 listed in Table 1, and / or two or three or fewer of these characteristics. N. eutropha may also contain at least one or two sequence characteristics of Hao2 or Hao3 listed in Table 2. N. eutropha may also contain fragments of the aforementioned protein.

[0280] Next, with reference to cytochrome c554, N. eutropha may include at least one, two, three, four, or all of the sequence characteristics of the third segment (describing cytochrome c554) in Table 2. In some embodiments, N. eutropha may include up to two, three, four, or all of the sequence characteristics of the third segment in Table 2. In some embodiments, N. eutropha may include at least one or two sequence characteristics of cytochrome c554 CycA1 listed in Table 2. N. eutropha may also include at least one sequence characteristic of c554 CycA2 or c554 CycA3 listed in Table 2. N. eutropha may also include fragments of the aforementioned protein.

[0281] c M Regarding 552 genes and proteins, this N. eutropha is (cytochrome c) as shown in Table 2. M (Explaining 552) This species may contain at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the sequence characteristics of the fourth segment. In some embodiments, this N. eutropha contains up to 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the sequence characteristics of the fourth segment in Table 2. For example, in some embodiments, this N. eutropha contains sequence characteristics 1-5, 2-7, 3-8, or 5-10 of the fourth segment in Table 2. In some embodiments, c listed in Table 2 M 552 CycB1 has at least one, two, three, four, five, six, or seven sequence characteristics, and / or two, three, four, five, six, or seven of these characteristics. This N. eutropha is listed in Table 2 as c M 552 CycB2 may include at least one, two, or three sequence characteristics, and / or two or three or fewer of these characteristics. This N. eutropha may also include fragments of the aforementioned protein.

[0282] ...

Claims

1. Compared to N. eutropha bacterial strain C91 cultured under similar conditions, Optimized growth rate; Optimized NH 4 + Oxidation rate; and NH 4 + Optimization resistance A Nitrosomonas eutropha (N. eutropha) bacterium having at least two characteristics selected from, The N. eutropha bacterium comprises a genome having a sequence that is at least 90% identical to or complementary to Sequence ID No. 1, and the proteins or genes of Sequence ID Nos. 4 to 33. The aforementioned optimized growth rate is such that continuous cultivation of N. europhala at an OD600 (optical density at 600 nm) of 0.15 to 0.18 allows it to reach an OD600 of 0.5 to 0.6 in 1 to 2 days. The optimized NH₄⁺ oxidation rate is at least 125 micromoles / min, which oxidizes NH₄⁺ to NO₂⁻, and The optimized tolerance to NH4+ is the ability to grow for at least 48 hours in a medium containing 200 mM NH4+. N. eutropha bacteria.

2. The N. europha bacterium according to claim 1, wherein the optimized growth rate is a doubling time of 8 hours when cultured under batch culture conditions.

3. The aforementioned N. eutropha bacteria have an optimized growth rate and optimized NH 4 + Oxidation rate, and NH 4 + The N. europa bacterium according to claim 1 or 2, having optimized resistance to [the specified substance].

4. The N. eutropha bacterium according to any one of claims 1 to 3, wherein the N. eutropha bacterium includes a chromosome that hybridizes to Sequence ID No. 1 under very high stringency.

5. The aforementioned N. eutropha bacteria, a) Nucleic acids that can be amplified using a primer pair comprising a primer containing the sequence of SEQ ID NO: 64 and a primer containing the sequence of SEQ ID NO: 65; or b) The nucleic acid sequence of SEQ ID NO: 66 or the protein encoded by the sequence of SEQ ID NO: 66 N. eutropha bacteria according to any one of claims 1 to 4, including the following.

6. Optimal growth rate, optimized NH 4 + oxidation rate, and NH 4 + A method for obtaining or producing N. eutropha bacteria having at least two characteristics selected from optimal growth rate, optimized NH oxidation rate, and optimization resistance to NH, wherein the N. eutropha bacteria comprises a genome having a sequence at least 90% identical to SEQ ID NO: 1 or its complement, and proteins or genes of SEQ ID NOs: 4 to 33. The aforementioned optimized growth rate is such that continuous cultivation of N. europhala at an OD600 (optical density at 600 nm) of 0.15 to 0.18 allows it to reach an OD600 of 0.5 to 0.6 in 1 to 2 days. The optimized NH₄⁺ oxidation rate is at least 125 micromoles / min, which oxidizes NH₄⁺ to NO₂⁻, and The aforementioned optimized tolerance to NH4+ is the ability to grow for at least 48 hours in a medium containing 200 mM NH4+. The aforementioned method, (a) Optimized growth rate, optimized NH 4 + Oxidation rate, or NH 4 + The bacteria are cultured under conditions in which one or more of the optimized resistances to are selected, thereby producing a culture. (b) Obtain a sample from the culture and optimize the growth rate and optimize the NH 4 + Oxidation rate, or NH 4 + Testing the sample for its resistance to optimization, the testing includes measuring one or more of the OD600, nitrate level, and pH of the sample. (c) Optimized growth rate, optimized NH 4 + Oxidation rate, or NH 4 + The culture step and the test step are repeated until bacteria with optimized resistance to are obtained. Methods that include...

7. A composition comprising the N. europha bacterium according to any one of claims 1 to 5 for use in a method for (a) inhibiting microbial growth on the skin of a subject; (b) treating or preventing body odor associated with the skin of a subject; (c) delaying signs of aging on the skin of a subject; or (d) altering the composition of the skin microbiome of a subject.

8. A composition comprising the bacterium N. eutropha according to any one of claims 1 to 5 for use in a method for treating a disease associated with low nitrite levels, wherein the disease is urticaria, impetigo, HIV dermatitis, infection in diabetic foot ulcers, atopic dermatitis, acne, acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, rosacea, skin infections, vascular diseases, vaginal yeast infections, sexually transmitted diseases, baldness, or lower leg ulcers following diabetes or bed restraint.

9. The composition according to claim 8, wherein the disease is acne, eczema, psoriasis, or rosacea.

10. The composition according to any one of claims 7 to 9, which is formulated as an aerosol or spray.

11. A composition according to any one of claims 7 to 10, formulated for immediate release or sustained release.

Citation Information

Patent Citations

  • Compound containing ammonia-oxidizing bacteria that enhances productivity of nitric oxide and nitric oxide precursors, and method of using the same

    JP2004506028A

  • Compositions containing ammonia-oxidizing bacteria and methods of use thereof

    JP2005515218A