Oligomer compounds for dystrophin rescue by exon 51 skipping in DMD patients

Abstract

Disclosed is an oligomeric compound comprising 10 to 50 monomer subunits, at least a portion of whose sequence is complementary to the following sequence: AAGGAAACUGCCAUCUCCAA (SEQ ID NO: 1 in the attached sequence listing). Also disclosed are pharmaceutical compositions comprising said oligomeric compound and uses for treating Duchenne muscular dystrophy.

Description

[Technical Field]

[0001] The present invention belongs to the general art of therapeutic nucleic acid molecules, particularly therapeutic nucleic acid molecules that help restore dystrophin activity in patients with Duchenne muscular dystrophy (DMD) using splice switching technology.

[0002] More specifically, the present invention provides a novel oligomeric compound that may comprise one or more tricyclodeoxyribonucleic acid (tc-DNA) nucleosides targeting exon 51 of the human dystrophin gene, and one or more lipid moieties directly or covalently bonded to the oligomeric compound via a spacer.

[0003] These oligomeric compounds, and specifically the compound hereafter referred to as SQY51, meet the therapeutic needs of more than 10% of DMD patients with large deletions, are systemically deliverable, reach the entire muscular system including cardiomyopathy and smooth muscle, cross the blood-brain barrier, and exhibit minimal bioaccumulation. [Background technology]

[0004] Antisense technology is an effective means of reducing the expression of specific gene products and therefore can be useful for therapeutic, diagnostic, and research purposes. Generally, the principle behind antisense technology is that antisense compounds (sequences of nucleotides or their analogues) hybridize to target nucleic acids and regulate gene expression activity and function, such as transcription and / or translation. Regardless of the specific mechanism, the specificity of the sequence makes antisense compounds attractive not only as therapeutics that selectively regulate the expression of genes involved in the pathogenesis of disease, but also as tools for target validation and gene functionalization. [Prior art documents] [Patent Documents]

[0005] [Patent Document 1] U.S. Patent No. 5,034,506 [Patent Document 2] Strength Patent No. 5,166,315 [Patent Document 3] U.S. Patent No. 5,185,444 [Patent Document 4] U.S. Patent No. 5,214,134 [Patent Document 5] U.S. Patent No. 5,216,141 [Patent Document 6] U.S. Patent No. 5,235,033 [Patent Document 7] U.S. Patent No. 5,264,562 [Patent Document 8] U.S. Patent No. 5,264,564 [Patent Document 9] U.S. Patent No. 5,405,938 [Patent Document 10] U.S. Patent No. 5,434,257 [Patent Document 11] U.S. Patent No. 5,466,677 [Patent Document 12] U.S. Patent No. 5,470,967 [Patent Document 13] U.S. Patent No. 5,489,677 [Patent Document 14] U.S. Patent No. 5,541,307 [Patent Document 15] U.S. Patent No. 5,561,225 [Patent Document 16] U.S. Patent No. 5,596,086 [Patent Document 17] U.S. Patent No. 5,602,240 [Patent Document 18] U.S. Patent No. 5,608,046 [Patent Document 19] U.S. Patent No. 5,610,289 [Patent Document 20] U.S. Patent No. 5,618,704 [Patent Document 21] U.S. Patent No. 5,623,070 [Patent Document 22] U.S. Patent No. 5,663,312 [Patent Document 23] U.S. Patent No. 5,633,360 [Patent Document 24] U.S. Patent No. 5,677,437 [Patent Document 25] U.S. Patent No. 5,677,439 [Patent Document 26] U.S. Patent No. 5,646,269 [Patent Document 27] U.S. Patent No. 5,792,608 [Patent Document 28] International Publication No. 2011 / 150408 [Patent Document 29] U.S. Patent Application Publication No. 2012 / 0065169 [Patent Document 30] U.S. Patent No. 3,687,808 [Patent Document 31] U.S. Patent No. 4,845,205 [Patent Document 32] U.S. Patent No. 5,130,302 [Patent Document 33] U.S. Patent No. 5,134,066 [Patent Document 34] U.S. Patent No. 5,175,273 [Patent Document 35] U.S. Patent No. 5,367,066 [Patent Document 36] U.S. Patent No. 5,432,272 [Patent Document 37] U.S. Patent No. 5,457,187 [Patent Document 38] U.S. Patent No. 5,459,255 [Patent Document 39] U.S. Patent No. 5,484,908 [Patent Document 40] U.S. Patent No. 5,502,177 [Patent Document 41] U.S. Patent No. 5,525,711 [Patent Document 42] U.S. Patent No. 5,552,540 [Patent Document 43] U.S. Patent No. 5,587,469 [Patent Document 44] U.S. Patent No. 5,594,121 [Patent Document 45] U.S. Patent No. 5,596,091 [Patent Document 46] U.S. Patent No. 5,614,617 [Patent Document 47] U.S. Patent No. 5,645,985 [Patent Document 48] U.S. Patent No. 5,750,692 [Patent Document 49] U.S. Patent No. 5,830,653 [Patent Document 50] U.S. Patent No. 5,763,588 [Patent Document 51] U.S. Patent No. 6,005,096 [Patent Document 52] U.S. Patent No. 5,681,941 [Patent Document 53] International Publication No. 2010 / 115993 [Patent Document 54] International Publication No. 2013 / 053928 [Patent Document 55] International Publication No. 2018 / 193428 [Patent Document 56] U.S. Patent Application Publication No. 2015 / 0141637 [Patent Document 57] U.S. Patent Application Publication No. 2016 / 0002280 [Patent Document 58] U.S. Patent Application Publication No. 2014 / 0296323 [Patent Document 59] U.S. Patent No. 4,981,957 [Patent Document 60] U.S. Patent No. 5,118,800 [Patent Document 61] U.S. Patent No. 5,319,080 [Patent Document 62] U.S. Patent No. 5,359,044 [Patent Document 63] U.S. Patent No. 5,393,878 [Patent Document 64] U.S. Patent No. 5,446,137 [Patent Document 65] U.S. Patent No. 5,466,786 [Patent 66] U.S. Patent No. 5,514,785 [Patent Document 67] U.S. Patent No. 5,519,134 [Patent Document 68] U.S. Patent No. 5,567,811 [Patent Document 69] U.S. Patent No. 5,576,427 [Patent Document 70] U.S. Patent No. 5,591,722 [Patent Document 71] U.S. Patent No. 5,597,909 [Patent Document 72] U.S. Patent No. 5,610,300 [Patent Document 73] U.S. Patent No. 5,627,053 [Patent Document 74] U.S. Patent No. 5,639,873 [Patent Document 75] U.S. Patent No. 5,646,265 [Patent Document 76] U.S. Patent No. 5,670,633 [Patent Document 77] U.S. Patent No. 5,700,920 [Patent Document 78] U.S. Patent No. 5,792,847 [Patent Document 79] U.S. Patent No. 6,600,032 [Patent Document 80] U.S. Patent No. 5,573,906 [Patent Document 81] U.S. Patent No. 4,469,863 [Patent Document 82] U.S. Patent No. 4,476,301 [Patent Document 83] U.S. Patent No. 5,023,243 [Patent Document 84] U.S. Patent No. 5,177,196 [Patent Document 85] U.S. Patent No. 5,188,897 [Patent Document 86] U.S. Patent No. 5,264,423 [Patent Document 87] U.S. Patent No. 5,276,019 [Patent Document 88] U.S. Patent No. 5,278,302 [Patent Document 89] U.S. Patent No. 5,286,717 [Patent Document 90] U.S. Patent No. 5,321,131 [Patent Document 91] U.S. Patent No. 5,399,676 [Patent Document 92] U.S. Patent No. 5,405,939 [Patent Document 93] U.S. Patent No. 5,453,496 [Patent Document 94] U.S. Patent No. 5,455,233 [Patent Document 95] U.S. Patent No. 5,476,925 [Patent Document 96] U.S. Patent No. 5,519,126 [Patent Document 97] U.S. Patent No. 5,536,821 [Patent Document 98] U.S. Patent No. 5,541,306 [Patent Document 99] U.S. Patent No. 5,550,111 [Patent Document 100] U.S. Patent No. 5,563,253 [Patent Document 101] U.S. Patent No. 5,571,799 [Patent Document 102] U.S. Patent No. 5,587,361 [Patent Document 103] U.S. Patent No. 5,194,599 [Patent Document 104] U.S. Patent No. 5,565,555 [Patent Document 105] U.S. Patent No. 5,527,899 [Patent Document 106] U.S. Patent No. 5,721,218 [Patent Document 107] U.S. Patent No. 5,672,697 [Patent Document 108] U.S. Patent No. 5,625,050 [Non-patent literature]

[0006] [Non-Patent Document 1] SP Parker, Ed., McRaw-Hiff Dictionary of Chemical Terms (1984), McGraw-Hill Book Company, New York. [Non-Patent Document 2] Eliel, E. and Wilen, S., “Stereochemistry of Organic Compounds”, John Wiley&Sons, Inc., New York, 1994. [Non-Patent Document 3] Protecting Groups in Organic Synthesis,TWGreene and PGMWuts,3rd edition,John Wiley&Sons,New York 1999 [Non-Patent Document 4] Greene's Protective Groups in Organic Synthesis, PGMWuts, 5th edition, John Wiley&Sons, 2014 [Non-Patent Document 5] Current Protocols in Nucleic Acid Chemistry, edited by SLBeaucage et al. 06 / 2012, especially Chapter 2. [Non-Patent Document 6] Sharma VKet al,Med.Chem.Commun.,2014,5,1454-1471 [Non-Patent Document 7] Swayze et al., The Medicinal Chemistry of Oligonucleotides, in Antisense a Drug Technology, Chapter 6, pp. 143-182 (Crooke, ST, ed., 2008) [Non-Patent Document 8] The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley&Sons, 1990, pp.858-859 [Non-Patent Document 9] Englisch et al.,Angewandte Chemie,International Edition,1991,Vol.30(6),pp.613-623 [Non-Patent Document 10] Sanghvi,YS,Antisense Research and Applications,Crooke,ST and Lebleu,B.,Eds.,CRC Press,1993,pp.273-302

Non-licensed Document 11

Non-licensed Document 12

Non-licensed Document 13

Non-licensed Document 14

Non-licensed Document 15

Non-licensed Document 16

Non-licensed Document 17

Non-licensed Document 18

Non-licensed Document 19

Non-licensed Document 20

Non-licensed Document 21

[0007] In one embodiment, the present invention relates to an oligomeric compound comprising 10 to 50 monomer subunits, wherein at least a portion of its sequence is complementary to the following sequence: AAGGAAACUGCCAUCUCCAA (SEQ ID NO: 1 in the attached sequence listing). In some embodiments, at least a portion of the sequence of the oligomeric compound is complementary to a sequence corresponding to region +48+62 of SEQ ID NO: 2 in the attached sequence listing. In some embodiments, the oligomeric compound comprises or comprises an antisense oligonucleotide. In some embodiments, the oligomeric compound comprises at least one nucleotide sequence having at least 70% identity with the following tc-DNA nucleotide sequence: GGAGATGGCAGTTTC (SEQ ID NO: 3 in the attached sequence listing). In some embodiments, the oligomeric compound comprises or comprises a tricycloDNA antisense oligonucleotide. In some embodiments, the oligomeric compound comprises or comprises a tricyclophosphorothioate DNA antisense oligonucleotide. In some embodiments, the oligomer compound comprises one or more tricyclodeoxyribonucleic acid (tc-DNA) nucleosides and at least one modified ribonucleic acid nucleoside. In some embodiments, the modified ribonucleic acid nucleoside is a 2'-O-methylRNA nucleoside. In some embodiments, the monomer subunits of the oligomer compound are linked by phosphate diester nucleoside bonds. In some embodiments, the oligomer compound has the following nucleotide sequence: - 5'-GGAGATgGCAGTTTC-3' (SEQ ID NO: 4 in the attached sequence listing), - 5'-GGAGATGgCAGTTTC-3' (SEQ ID NO: 5 in the attached sequence listing), - 5'-GGAGATGGcAGTTTC-3' (SEQ ID NO: 6 in the attached sequence listing), and - 5'-GGAGATGGCaGTTTC-3' (SEQ ID NO: 7 in the attached sequence listing) The oligomeric compound comprises or consists of a nucleotide sequence corresponding to one of the above, where tc-DNA nucleotides are indicated by uppercase letters and modified ribonucleic acid nucleosides by lowercase letters. In some embodiments, the oligomeric compound is bound to one or more lipid moieties. In some embodiments, the oligomeric compound comprises the group consisting of: - Palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATgGCAGTTTC-3' (SEQ ID NO: 4 in the attached sequence listing), - Palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATGgCAGTTTC-3' (SEQ ID NO: 5 in the attached sequence listing), - Palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATGGcAGTTTC-3' (SEQ ID NO: 6 in the attached sequence listing), and - Palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATGGCaGTTTC-3' (SEQ ID NO: 7 in the attached sequence listing) Selected from.

[0008] In another aspect, the present invention relates to a pharmaceutical composition comprising an oligomeric compound of the present disclosure as an active ingredient and a pharmaceutically acceptable excipient.

[0009] In another aspect, the present invention relates to oligomeric compounds or pharmaceutical compositions disclosed herein for use in the treatment of Duchenne muscular dystrophy in patients in need.

[0010] In another embodiment, the present invention relates to a method for treating Duchenne muscular dystrophy in patients in need. In some embodiments, the method includes administering to a patient a therapeutically effective amount of the oligomeric compound or pharmaceutical composition disclosed herein.

[0011] The present invention includes therapeutic nucleic acid molecules useful for splice switching techniques in DMD patients. More specifically, the present invention includes therapeutic nucleic acid molecules that do not exhibit the drawbacks of molecules known in the art, such as toxicity, and that can be used to restore semi-functional dystrophin.

[0012] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art in the field to which this invention pertains. Headings used herein are for convenience only and should not be construed as limiting the disclosure of any aspect or embodiment of this invention.

[0013] The terms “oligomeric compound” and “oligonucleotide” refer to synthetic compounds containing 10 to 50 monomer subunits linked by nucleoside-linking groups. The length of an oligonucleotide may be indicated by concatenating or attaching the term “-mer” to the number of monomer subunits. For example, an oligonucleotide containing 10 monomer subunits is a 10-mer (or decamer), and an oligonucleotide containing 25 monomer subunits is a 25-mer. The oligonucleotides and oligomeric compounds of the present invention are described from left to right in order from the 5' end to the 3' end. In some embodiments, at least two of the 10 to 50 monomer subunits are tricyclodeoxyribonucleic acid (tc-DNA) nucleosides. In some embodiments, these are independently selected from natural nucleosides, modified nucleosides, or nucleoside mimics. The oligomeric compound may be single-stranded or double-stranded. In one embodiment, the oligomeric compound is double-stranded (i.e., double-stranded). In some embodiments, the oligomeric compound is single-chain.

[0014] As used herein, the term "monomer subunit" refers to monomer subunits, such as α-D-ribonucleoside, β-D-ribonucleoside, α-D-2'-deoxyribonucleoside, β-D-2'-deoxyribonucleoside, natural nucleoside, modified nucleoside, and thereby tricyclodeoxyribonucleic acid (tc-DNA) nucleoside, 2'-modified ribonucleic acid (2'-modified RNA) nucleoside, locked nucleic acid (LNA) nucleoside, peptide nucleic acid (PNA) nucleoside, and 2'-deoxyribonucleoside. This means including, and usually referring to, all kinds of monomer units suitable for oligomer synthesis, including, 2'-fluoroarabino nucleosides, hexitol nucleic acid (HNA) nucleosides, and phosphorodiamidate morpholino (PMO) nucleosides, nucleoside mimics, native nucleotides, modified nucleotides, and thereby particularly tricyclo-deoxyribonucleic acid (tc-DNA) nucleotides and 2'-modified ribonucleic acid (2'-modified RNA) nucleotides, and nucleotide mimics. Advantageously, the term “monomer subunit” as used herein includes natural nucleosides and modified nucleosides, and thereby particularly ribonucleosides, deoxyribonucleosides, tricyclodeoxyribonucleic acid (tc-DNA) nucleosides, 2'-modified ribonucleic acid (2'-modified RNA) nucleosides, locked nucleic acid (LNA) nucleosides, peptide nucleic acid (PNA) nucleosides, 2'-deoxy-2'-fluoroarabinonucleosides, hexitol nucleic acid (HNA) nucleosides, and phosphorodiamidate morpholinonucleosides. PMO) nucleosides, as well as natural and modified nucleotides, and thereby particularly ribonucleotides, deoxyribonucleotides, tricyclodeoxyribonucleic acid (tc-DNA) nucleotides, 2'-modified ribonucleic acid (2'-modified RNA) nucleotides, locked nucleic acid (LNA) nucleotides, peptide nucleic acid (PNA) nucleotides, 2'-deoxy-2'-fluoro-arabinonucleotides, hexitol nucleic acid (HNA) nucleotides, and phosphorodiamidate morpholino (PMO) nucleotides.More specifically, as used herein, the term “monomer subunit” refers to modified nucleotides, and thereby, in particular, tricyclodeoxyribonucleic acid (tc-DNA) nucleotides, as well as 2'-modified ribonucleic acid (2'-modified RNA) nucleotides.

[0015] The term "base analog", also called "modified nucleic acid base", refers to a chemical modification of a DNA base or RNA base that has a molecular structure mimicking a natural DNA or RNA base. Base analogs include, but are not limited to, 5-methylcytosine, 5-bromouracil, inosine, 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. Base analogs also include alkyl derivatives of adenine and guanine such as 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl adenine and 6-methyl guanine, alkyl derivatives of adenine and guanine such as 2-propyl adenine and 2-propyl guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil and 5-halocytosine, 5-propynyluracil and 5-propynylcytosine (and alkynyl derivatives of other pyrimidine bases), 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-substituted adenines and guanines such as 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 5-substituted uracils and cytosines such as 5-halo, and particularly 5-bromo, 5-trifluoromethyl, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-aminoadenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, 3-deazaguanine and 3-deazaadenine, universal bases, tricyclic pyrimidines such as phenoxazine cytidine (1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as substituted phenoxazine cytidine (e.g., 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), and pyridoindole cytidine (2H-pyrido[3’,2’:4,5]pyrrolo[2,3-d]pyrimidin-2-one), but are not limited thereto.The base analogues may include those in which the purine or pyrimidine base is substituted with other heterocycles, such as 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. The preparation of modified nucleic acid bases is known in the art.

[0016] As used herein, the term “complementary” refers to a nucleic acid sequence that can form hydrogen bonds with another nucleic acid sequence via either conventional Watson-Crick base pairing or other unconventional pairing (e.g., Hougsteen or inverse Hougsteen hydrogen bonds) between complementary nucleosides or complementary nucleotides. “Complementary” (or “specifically hybridizable”) is a term that refers to a degree of complementarity or precise pairing sufficient to result in stable, specific binding between an oligomeric compound and a pre-mRNA or mRNA target.

[0017] In this field, it is understood that nucleic acid molecules do not need to be 100% complementary to the target nucleic acid sequence to be complementary. In other words, two nucleic acid molecules do not need to be perfectly complementary. Complementarity is indicated by the percentage of adjacent residues in the nucleic acid molecule that can form hydrogen bonds with the second nucleic acid molecule. For example, if the first nucleic acid molecule has 10 nucleotides and the second nucleic acid molecule has 10 nucleotides, then the base pairs of 5, 6, 7, 8, 9, or 10 nucleotides in the first and second nucleic acid molecules represent 50%, 60%, 70%, 80%, 90%, and 100% complementarity, respectively. "Perfectly" complementary nucleic acid molecules mean that all adjacent residues in the first nucleic acid molecule form hydrogen bonds with the same number of adjacent residues in the second nucleic acid molecule, and both nucleic acid molecules either have the same number of nucleotides (i.e., the same length) or the two molecules have different lengths.

[0018] The term "antisense oligonucleotide" refers to a single strand of DNA or RNA, or an oligomeric compound, that is complementary to the target sequence. Antisense oligonucleotides can hybridize to pre-mRNA or mRNA having complementary coding or non-coding nucleotide sequences. In this example, the target nucleotide sequence corresponds to sequence 1 in the attached sequence listing, and typically corresponds to the sequence in region 2 + 48 + 62 in the attached sequence listing.

[0019] Within the scope of this disclosure, the "identity percentage" between two nucleotide sequences (or two amino acid sequences) means the percentage of identical nucleotide (or amino acid) residues between the two sequences being compared, which is obtained after performing best alignment between both sequences. Various techniques for obtaining such an identity percentage, including homology algorithms or computer programs such as the BLAST program, are known to those skilled in the art.

[0020] The term "tricycloDNA" (tc-DNA) refers to a class of constrained oligodeoxyribonucleotide analogs in which each nucleotide is modified by introducing a cyclopropane ring to limit the structural flexibility of the skeleton and optimize the shape of the skeleton with a twist angle Y. More specifically, tc-DNA differs structurally from DNA in that it adds an ethylene bridge between the central C(3') and C(5') of the nucleoside and fuses a cyclopropane unit to it to further increase structural rigidity.

[0021] As used herein, the term "nucleoside-interconnecting group" refers to any known connecting group in the art that can, preferably, connect a tricyclodeoxyribonucleic acid (tc-DNA) nucleoside to any further tc-DNA nucleoside, a nucleoside other than a tc-DNA nucleoside, a non-nucleoside including a peptide, or a protein. Representative patents teaching such possible connecting groups include, without limitation, Patent Documents 1 to 27. Therefore, the term "nucleoside-interconnecting group" includes phosphorus-binding groups and non-phosphorus-binding groups. Nonphosphorus bonding groups do not contain a phosphorus atom, and examples of nonphosphorus bonding groups include, independently and optionally, cyano, nitro, halogen-substituted alkyl, aryl, preferably phenyl, benzyl, or benzoyl, cycloalkyl, alkylenearyl, alkylenediaryl, alkoxy, alkoxyalkylene, alkylsulfonyl, alkyne, ether; carboxyl, amide, amine, amino, imine, thiol, sulfide, sulfoxide, sulfone, sulfamate, sulfonate, sulfonamide, siloxane, or mixtures thereof, which are usually these and preferably selected from these. Usually and preferably, the internucleoside bonding group is a phosphorus bonding group, and the phosphorus bonding group is P III or P VThis refers to a portion containing a phosphorus atom in a valence state. More preferably, the internucleoside bond is a phosphorus bond. Even more preferably, the internucleoside bond is selected from a phosphate diester bond, a phosphate triester bond, a phosphorothioate bond, a phosphorodithioate bond, a phosphonate bond, preferably an H-phosphonate bond or a methylphosphonate bond; a phosphonothioate bond, preferably an H-phosphonothioate bond or a methylphosphonothioate bond; a phosphinate bond, a phosphorothioamidate bond, a phosphoramidate bond or a phosphite bond. In some embodiments, the internucleoside bond is selected from a phosphate diester bond, a phosphate triester bond, a phosphorothioate bond, or a phosphonate bond, and the phosphonate is preferably an H-phosphonate bond or a methylphosphonate bond.

[0022] As used herein, the term “nucleoside” refers to a compound comprising a nucleic acid base and a sugar covalently bonded to the nucleic acid base. Furthermore, the term “nucleoside” means all kinds of natural or modified nucleosides or nucleoside mimics that can be incorporated into oligomers using natural or chemical oligomer synthesis. Typically and preferably, as used herein, the term “nucleoside” refers to natural nucleosides, modified nucleosides, or nucleoside mimics. The term “modified nucleoside” is intended to include modifications to the sugar and / or nucleic acid base of nucleosides that are known to those skilled in the art and described herein. The term “nucleoside mimic” is intended to include their structures used to replace sugars and nucleic acid bases. Examples of nucleoside mimics include nucleosides in which the nucleic acid base is substituted with a phenoxazine moiety (e.g., a 9-(2-aminoethoxy)-1,3-diazaphenoxadin-2-one group) and the sugar moiety is substituted with a cyclohexenyl or bicyclo[3.1.0]hexyl moiety. The term “nucleoside” also includes combinations of modifications, such as two or more nucleic acid base modifications, two or more sugar modifications, or modifications of at least one nucleic acid base and at least one sugar.

[0023] The sugars of nucleosides are, without limitation, monocyclic, bicyclic, or tricyclic systems, preferably tricyclic, bicyclic, or monocyclic ribose or deoxyribose. Sugar modifications include, but are not limited to, modified stereochemical configurations, substitution of at least one group, or deletion of at least one group. Modified sugars are usually, and preferably, modified versions of ribosyl moieties (i.e., furanosyl moieties) naturally present in RNA and DNA, such as bicyclic sugars, tetrahydropyrans, 2'-modified sugars, 3'-modified sugars, 4'-modified sugars, 5'-modified sugars, or 4'-substituted sugars. Suitable examples of glycosylation are known to those skilled in the art, including 2',3' and / or 4' substituted nucleosides (e.g., 4'-S-modified nucleosides); 2'-O-modified RNA nucleotide residues, e.g., 2'-O-alkyl or 2'-O-(substituted)alkyl, e.g., 2'-O-methyl, 2'-O-(2-cyanoethyl), 2'-O-(2-methoxy)ethyl (2'-MOE), 2'-O-(2-thiomethyl)ethyl; 2'-O-(haloalkoxy)methyl, e.g., 2'-O-(2-chloroethoxy)methyl (MCEM), 2'-O-(2,2-dichloroethoxy) C) Methyl (DCEM); 2'-O-alkoxycarbonyl, for example, 2'-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl] (MCE), 2'-O-[2-(N,N-dimethylcarbamoyl)ethyl] (DMCE), especially 2'-O-methyl modification or 2'-O-methoxyethyl (2'-O-MOE); or other modified sugar moieties, for example, morpholino (PMO), cationic morpholino (PMOPlus), or modified morpholino groups, for example, PMO-X, but not limited to these.The term "PMO-X" refers to a modified morpholino group comprising at least one 3' or 5'-terminal modification, e.g., a 3'-fluorescent tag, a 3'-quencher (e.g., 3'-carboxyfluorescein, 3'-Gene Tools Blue, 3'-lysamine, 3'-dabucil), a 3'-affinity tag, and a functional group for chemical bonding (e.g., 3'-biotin, 3'-primary amine, 3'-disulfideamide, 3'-pyridyldithio), a 5'-terminal modification (5'-primary amine, 5'-dabucil), a 3'-azide, a 3'-alkyne, a 5'-azide, a 5'-alkyne, or a modified morpholino group disclosed in Patent Documents 28 and 29.

[0024] The "bicyclic sugar moiety" comprises two interconnected ring systems, such as a bicyclic nucleoside, and the sugar moiety has a 2'-O-CH(alkyl)-4' or 2'-O-CH2-4' group, locked nucleic acid (LNA), xylo-LNA, α-L-LNA, β-D-LNA, cEt(2'-O,4'-C restricted ethyl)LNA, cMOEt(2'-O,4'-C restricted methoxyethyl)LNA, ethylene-bridged nucleic acid (ENA), hexitol nucleic acid (HNA), fluorinated HNA (F-HNA), pyranosyl RNA (pRNA), or 3'-deoxypyranosyl-DNA (p-DNA).

[0025] As used herein, the term “lipid moiety” typically and advantageously refers to moieties derived from hydrocarbons, oils, fats (such as fatty acids and glycerides), sterols, steroids, and derivative forms of these compounds. Preferred lipid moieties include fatty acids and their derivatives, hydrocarbons and their derivatives, and sterols, such as cholesterol. As used herein, the term “lipid moiety” also includes amphiphilic compound moieties that include both lipid and hydrophilic moieties.

[0026] As used herein, the term "hydrocarbon" encompasses compounds consisting solely of covalently bonded hydrogen and carbon atoms. This term includes straight-chain (unbranched) and branched hydrocarbons, saturated hydrocarbons, and open-chain (aliphatic) hydrocarbons, including monounsaturated and polyunsaturated hydrocarbons. The term also includes hydrocarbons containing one or more aromatic rings, but preferably excludes hydrocarbons containing one or more aromatic rings. The terms "straight-chain" and "unbranched" are used interchangeably herein.

[0027] As used herein, the term “fatty acid” refers to a hydrocarbon chain ending in a carboxylic acid group, which is typically, and preferably, an alkyl or alkenyl group with a carbon length of 3 to 32 carbon atoms, and is therefore saturated or unsaturated, and contains one or more, preferably one carboxyl group (-COOH), and one or more, preferably one C 1-32The fatty acid may be optionally substituted with alkyl groups, one or more, preferably one phosphate group (HOP(O)(OH)O-), one or more, preferably one phosphonate group (HOP(O)O-), one or more, preferably one thiophosphate group (HOP(O)(SH)O-), one or more, preferably one dithiophosphate group (HOP(S)(SH)O-), one or more, preferably one diphosphate group (HO-P(O)(OH)-OP(O)(OH)-O-), one or more, preferably one triphosphate group (HO-P(O)(OH)-OP(O)(OH)-OP(O)(OH)-O-), one or more phenyl groups (-C6H5), halogens, preferably one or more phenyl groups substituted with iodine, or carboxyl groups. If the fatty acid has one or more double bonds and is therefore unsaturated, it may be either cis-geometric isomeric or trans-geometric isomeric. As used herein, the term “fatty acid moiety” refers to a moiety derived from a fatty acid as defined herein, wherein one carboxyl group (-COOH) of the fatty acid becomes a -C(O) group of the fatty acid moiety, and the -C(O) group is bonded directly to the oligonucleotide or via a spacer according to the present invention. Preferably, as used herein, the term “fatty acid” refers to a hydrocarbon chain ending in a carboxylic acid group, wherein the hydrocarbon chain is typically, and preferably, an alkyl or alkenyl with a carbon length of typically 3 to 32 carbon atoms, and is therefore saturated or unsaturated, and has one or more, preferably one carboxyl group (-COOH), one or more, preferably one C 1-32Alkyl, one or more, preferably one phosphate group (HOP(O)(OH)O-), one or more, preferably one phosphonate group (HOP(O)O-), one or more, preferably one thiophosphate group (HOP(O)(SH)O-), one or more, preferably one dithiophosphate group (HOP(S)(SH)O-), one or more, preferably one diphosphate group (HO-P(O)(OH)-OP(O)(OH)-O-), one or more, preferably one triphosphate group (HO-P(O)(OH)-OP(O)(OH)-OP(O)(OH)-O-), one or more phenyl groups (-C6H5), halogen, preferably one or more phenyl groups substituted with iodine, or optionally substituted with carboxyl groups. Preferably, the fatty acid has an even number of carbon atoms, and the carbon atoms of the carboxyl group (-COOH) of the fatty acid or the -C(O) group of the fatty acid portion are included in the count of carbon atoms.

[0028] Therefore, fatty acids preferably contain an even or odd, preferably even, number of linear carbon atoms (generally 3 to 32 carbons), can be saturated or unsaturated, and preferably contain one or more, preferably one carboxyl group (-COOH), and one or more, preferably one C 1-32 The alkyl group may contain, or be modified to contain, various substituents, including alkyl groups, one or more preferably one phosphate group (HOP(O)(OH)O-), one or more preferably one phosphonate group (HOP(O)O-), one or more preferably one thiophosphate group (HOP(O)(SH)O-), one or more preferably one dithiophosphate group (HOP(S)(SH)O-), one or more preferably one diphosphate group (HO-P(O)(OH)-OP(O)(OH)-O-), one or more preferably one triphosphate group (HO-P(O)(OH)-OP(O)(OH)-OP(O)(OH)-O-), one or more phenyl groups (-C6H5), halogens, preferably one or more phenyl groups substituted with iodine, or carboxyl groups.

[0029] As used herein, the term "aliphatic diacid" refers to a fatty acid as defined herein which has an additional carboxylic acid group at the ω position. Accordingly, an aliphatic diacid is a dicarboxylic acid. As used herein, the term "aliphatic diacid moiety" refers to a moiety derived from an aliphatic diacid as defined herein, wherein one carboxyl group (-COOH) of said aliphatic diacid becomes a -C(O) group of said aliphatic diacid moiety, and said -C(O) group is attached to the oligonucleotide either directly or via a spacer according to the invention. Preferred embodiments of aliphatic diacids have one or more, preferably one C 1-32 alkyl, one or more, preferably one phosphate group (HOP(O)(OH)O-), one or more, preferably one phosphonate group (HOP(O)O-), one or more, preferably one thiophosphate group (HOP(O)(SH)O-), one or more, preferably one dithiophosphate group (HOP(S)(SH)O-), one or more, preferably one diphosphate group (HO-P(O)(OH)-O-P(O)(OH)-O-), one or more, preferably one triphosphate group (HO-P(O)(OH)-O-P(O)(OH)-O-P(O)(OH)-O-), one or more, preferably one phenyl group (-C6H5), one or more, preferably one phenyl group substituted with halogen, preferably iodine, or a saturated aliphatic diacid optionally substituted with a carboxyl group. Preferred examples include one C 6-24 alkyl, such as glutaric acid optionally substituted with 3-pentadecylglutaric acid (PDG).

[0030] As used herein, the term "alkyl phosphate moiety" refers to C 3-32 alkyl-O-P(O)(OH)-O-, wherein said C 3-32 alkyl is C as defined herein 3-32 alkyl, is independently selected from.

[0031] As used herein, the term "alkyl phosphonate moiety" refers to C 3-32 alkyl-O-P(O)-O-, wherein said C3-32 Alkyl is C as defined herein. 3-32 It is selected independently of alkyl.

[0032] As used herein, the term "alkyl" refers to a linear or branched hydrocarbon chain radical consisting only of carbon and hydrogen atoms, without unsaturation, and having 1 to 32 carbon atoms (e.g., (C 1-32 ) Alkyl or C 1-32 Alkyl refers to a single bond that may or usually be attached to the rest of the molecule. Any numerical ranges such as "1 to 32" as used herein refer to any integer within a given range. For example, "1 to 32 carbon atoms" means that an alkyl group may consist of carbon atoms ranging from 1, 2, 3, etc., up to 32, but unless a numerical range is specifically specified, this definition is also intended to include the generation of the term "alkyl". Typical alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (used synonymously with isopropyl; abbreviated as iPr or Pri herein for the same meaning), n-butyl, isobutyl, sec-butyl, isobutyl, tertiary butyl (used synonymously with 1,1-dimethylethyl or tert-butyl), n-pentyl, isopentyl, neopentyl, hexyl, septyl, octyl, nonyl, and decyl. Unless otherwise specified herein, alkyl groups are independently optionally substituted with one or more substituents which are alkenyl, alkoxy, carboxyl (-COOH), heteroalkyl, heteroalkenyl, hydroxyl, phosphate (-OP(O)(OH)O-), phosphonate (-OP(O)O-), halogen, preferably iodine-substituted phenyl (-C6H4), or carboxyl groups. Preferably, the term “alkyl” as used herein refers to an unsubstituted alkyl group as defined herein.

[0033] As used herein, the term "alkylene" refers to a linear or branched hydrocarbon biradical derived from an alkyl group as defined herein, wherein one hydrogen atom of the alkyl group is cleaved to produce a second radical of the alkylene. Examples of alkylenes include -CH2-, -CH2-CH2-, -CH(CH3)-, -CH2-CH2-CH2-, -CH(CH3)-CH2-, or -CH(CH2CH3)-.

[0034] As used herein, the term "alkenyl" refers to a linear or branched hydrocarbon chain radical group consisting only of carbon and hydrogen atoms, containing at least one double bond, and having 3 to 32 carbon atoms (i.e., (C 3-32 ) Alkenyl or C 3-32 The term "alkenyl" refers to an alkenyl group which may be, or usually is, bonded to the rest of the molecule by a single bond. Any numerical ranges used herein, such as "3 to 32," refer to any integer within a given range; for example, "3 to 32 carbon atoms" means that the alkenyl group may consist of carbon atoms ranging from 3 carbon atoms, 4 carbon atoms, and so on, up to 32 carbon atoms. Typical alkenyl groups include, but are not limited to, ethenyl (i.e., vinyl), prop-1-enyl (i.e., allyl), buta-1-enyl, pento-1-enyl, and penta-1,4-dienyl. Each double bond may be in an (E) configuration or a (Z) configuration. Thus, an alkenyl may, where applicable, contain the double bond in its (E) configuration, its (Z) configuration, or in any ratio of a mixture of these. Unless otherwise specified herein, the alkenyl group is optionally substituted with one or more substituents that are independently alkenyl, alkoxy, carboxyl (-COOH), heteroalkyl, heteroalkenyl, hydroxyl, phosphate (-OP(O)(OH)O-), phosphonate (-OP(O)O-), halogen, preferably iodine-substituted phenyl (-C6H4), or carboxyl. Preferably, the term “alkenyl” as used herein refers to an unsubstituted alkenyl as defined herein.

[0035] As used herein, the term "alkenylene" refers to a linear or branched hydrocarbon chain biradical derived from an alkenyl as defined herein, wherein one hydrogen of the alkenyl is cleaved to generate a second radical of the alkenylene.

[0036] The term "alkynyl" refers to a linear or branched hydrocarbon chain radical group consisting only of carbon and hydrogen atoms, containing at least one triple bond, and having 2 to 10 carbon atoms (i.e., (C 2-32 ) Alkinyl or C 2-32 This refers to an alkynyl group. Numerical ranges such as "2 to 32" as used herein refer to any integer within a given range. For example, "2 to 32 carbon atoms" means that the alkynyl group may consist of carbon atoms ranging from 2 carbon atoms, 3 carbon atoms, etc., up to 32 carbon atoms. Typical alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, pentynyl, and hexynyl. Unless otherwise specified herein, an alkynyl group is independently optionally substituted with one or more substituents that are alkenyl, carboxyl group (-COOH), heteroalkyl, heteroalkenyl, phosphate group (-OP(O)(OH)O-), phosphonate group (-OP(O)O-), halogen, preferably iodine-substituted phenyl group (-C6H4), or carboxyl group. Preferably, the term "alkynyl" as used herein refers to an unsubstituted alkynyl as defined herein.

[0037] As used herein, the term "alkynylene" refers to a linear or branched hydrocarbon biradical derived from an alkynyl as defined herein, wherein one hydrogen of the alkynyl is cleaved to generate a second radical of the alkynylene.

[0038] The term "alkoxy" refers to an O-alkyl group containing 1 to 32 carbon atoms in a linear, branched, or combination thereof configuration, bonded to the parent structure via oxygen. Examples include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, cyclopropyloxy, and cyclohexyloxy. "Lower alkoxy" refers to (C 1-6 ) Alkoxy or OC 1-6 This refers to an alkoxy group containing 1 to 6 carbon atoms, also known as an alkyl group.

[0039] The term "substituted alkoxy" refers to an alkoxy group in which the alkyl component is substituted (i.e., -O-(substituted alkyl)). Unless otherwise specified herein, the alkyl portion of an alkoxy group is independently optionally substituted with one or more substituents which are alkenyl, carboxyl (-COOH), heteroalkyl, heteroalkenyl, phosphate (-OP(O)(OH)O-), phosphonate (-OP(O)O-), halogen, preferably iodine-substituted phenyl (-C6H4), or carboxyl groups.

[0040] The term "acyl" refers to the groups (alkyl)-C(O)-, (aryl)-C(O)-, (heteroaryl)-C(O)-, and (heteroalkyl)-C(O)-, which are bonded to the parent structure via carbonyl functionality. Unless otherwise specified herein, the alkyl, aryl, or heteroaryl portion of the acyl group is independently optionally substituted with one or more substituents which are alkenyl, carboxyl (-COOH), heteroalkyl, heteroalkenyl, phosphate (-OP(O)(OH)O-), phosphonate (-OP(O)O-), halogen, preferably iodine-substituted phenyl (-C6H4), or carboxyl groups.

[0041] The term "amino" or "amine" is -N(R a )2 refers to a radical group, and unless otherwise specified herein, R aEach of these is independently hydrogen, alkyl, fluoroalkyl, carbocykyl, carbocykylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl, or heteroarylalkyl. -N(R a )Two units, in addition to hydrogen, have two R a If it has substituents, R a The substituent can bond with the nitrogen atom to form a 4, 5, 6, or 7-membered ring. For example, -N(R a )2 is intended to include, but is not limited to, 1-pyrrolidinyl and 4-morpholinyl. Unless otherwise specified herein, the amino or amine group is independently optionally substituted with one or more substituents which are alkenyl, carboxyl (-COOH), heteroalkyl, heteroalkenyl, phosphate (-OP(O)(OH)O-), phosphonate (-OP(O)O-), halogen, preferably iodine-substituted phenyl (-C6H4), or carboxyl group.

[0042] The term "aromatic," "aryl," or "Ar" refers to a group of 6-10 ring atoms (e.g., C6-C6). 10 Aromatic or C6-C 10This refers to an aromatic radical having an aryl group, which has at least one ring having a conjugated pi-electron system that is carbocyclic (e.g., phenyl, fluorenyl, and naphthyl). A divalent radical formed from a substituted benzene derivative and having free valence on the ring atom is named a substituted phenylene radical. A divalent radical derived from a monovalent polycyclic hydrocarbon radical whose name ends in "-yl" by removing one hydrogen atom from a carbon atom with free valence is named by adding "-idene" to the name of the corresponding monovalent radical. For example, a naphthyl group with two bonding sites is called naphthylidene. Any numerical ranges such as "6 to 10" described herein refer to any integer within a given range. For example, "6 to 10 ring atoms" means that the aryl group may consist of ring atoms ranging from 6 ring atoms, 7 ring atoms, etc., up to 10 ring atoms. This term includes monocyclic or fused polycyclic (i.e., rings sharing adjacent pairs of ring atoms) groups.

[0043] The terms “aralkyl” or “arylalkyl” refer to an (aryl)alkyl radical, where aryl and alkyl are as disclosed herein, and are optionally substituted with one or more substituents listed as preferred substituents for aryl and alkyl, respectively.

[0044] In this specification, the terms "carboxyl" or "carboxyl group" are used interchangeably to refer to the -(C=O)OH radical.

[0045] The term "cycloalkyl" refers to a monocyclic or polycyclic radical that contains only carbon and hydrogen and may be saturated or partially unsaturated. A cycloalkyl group is a group having 3 to 10 ring atoms (i.e., (C3- 10 )Cycloalkyl or C3- 10This includes cycloalkyl groups. Numerical ranges such as "3 to 10" as described herein refer to any integer within a given range. For example, "3 to 10 carbon atoms" means that the cycloalkyl group may consist of carbon atoms ranging from 3 to 10. Specific examples of cycloalkyl groups include, but are not limited to, the following: cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cyclooctyl, cyclononyl, cyclodecyl, norbornyl, etc.

[0046] The term "fluoroalkyl" refers to an alkyl radical defined above, which is substituted with one or more fluororadicals as defined above, such as trifluoromethyl, difluoromethyl, 2,2,2-trifluoroethyl, or 1-fluoromethyl-2-fluoroethyl. The alkyl portion of the fluoroalkyl radical may be optionally substituted as defined above for alkyl groups.

[0047] As used herein, the term "halogen" refers to fluorine, chlorine, bromine, or iodine, preferably iodine. In some embodiments, the halogen substituent is iodine.

[0048] As used herein, the terms “heteroalkyl” and “heteroalkenyl” refer to optionally substituted alkyl and alkenyl radicals, which are one or more skeletal chain atoms selected from atoms other than carbon, such as oxygen, nitrogen, sulfur, phosphorus, or combinations thereof. A numerical range may be assigned to indicate the total chain length, for example, C1-C4 heteroalkyl, in this example being 4 atoms long.

[0049] The term "heteroaryl," "heteroaromatic," or "HetAr" refers to a 5-18 member aromatic radical (e.g., C5-C5) comprising one or more ring heteroatoms selected from nitrogen, oxygen, and sulfur, which may be monocyclic, dicyclic, tricyclic, or tetracyclic. 13This refers to heteroaryl groups. Numerical ranges such as "5 to 18" described herein all refer to integers within a given range. For example, "5 to 18 ring atoms" means that the heteroaryl group may consist of ring atoms ranging from 5 ring atoms, 6 ring atoms, etc., up to 18 ring atoms. By removing one hydrogen atom from an atom with free valence, a divalent radical derived from a monovalent heteroaryl radical whose name ends in "-yl" is named by adding "-idene" to the name of the corresponding monovalent radical. For example, a pyridyl group with two bond sites is called pyridylidene.

[0050] The term "stereoisomer" refers to compounds that have the same chemical structure but differ in the stereochemical arrangement of their atoms or groups.

[0051] A "diastereomer" refers to a stereoisomer of a compound that has two or more chiral centers and whose compounds are not mirror images of each other. Diastereomers have different physical properties, such as melting point, boiling point, spectral characteristics, chemical reactivity, and biological reactivity. Mixtures of diastereomers can be separated by high-resolution analytical methods such as electrophoresis and chromatography.

[0052] "Enantiomers" refer to two stereoisomers of a compound that are mirror images of each other and cannot be superimposed.

[0053] The stereochemical definitions and conventions used herein generally follow Non-Patent Documents 1 and 2.

[0054] The symbols (*), (#), and (§) in chemical formulas represent i) a bond, ii) a radical, and / or iii) a lone electron.

[0055] As used herein, the term “antisense oligonucleotide (AON)” refers to an oligonucleotide or oligomeric compound that can interact with and / or hybridize to a premRNA or mRNA having a complementary nucleotide sequence, thereby modifying gene expression.

[0056] As used herein, the term “protecting group” is intended to mean a group that selectively blocks one or more reaction sites in a polyfunctional compound so that a chemical reaction can be selectively carried out at another unprotected reaction site, and then the group can be easily removed or deprotected after the selective reaction is complete. Various protecting groups are disclosed, for example, in Non-Patent Document 3.

[0057] In this specification, the terms “amino protecting group,” “amino group protecting group,” or “amino protecting group” are used interchangeably and include those well known in the art and detailed in Non-Patent Documents 3-5. Suitable “amino protecting groups” for the present invention include methyl carbamate, ethyl carbamate, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxantyl)]methyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), and 2-f The materials include phenylethyl carbamate (hZ), 1,1-dimethyl-2,2-dibromoethyl carbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethyl carbamate (TCBOC), benzyl carbamate (Cbz), p-methoxybenzyl carbamate (Moz), and 2,4,6-trimethylbenzyl carbamate, (4-methoxyphenyl)diphenylmethyl (MMTr); as well as formamide, acetamide, and benzamide, which are usually and preferably independently selected from these in each appearance.

[0058] In this specification, the terms “hydroxyl protecting group,” “hydroxyl protecting group,” or “hydroxyl protecting group” are used interchangeably and include those well known in the art and detailed in Non-Patent Documents 3-5. In certain embodiments, the “hydroxyl protecting group” of the present invention includes acetyl, benzoyl, benzyl, β-methoxyethoxymethyl ether (MEM), dimethoxytrityl, [bis(4-methoxyphenyl)phenylmethyl] (DMTr), methoxymethyl ether (MOM), methoxytrityl[(4-methoxyphenyl)diphenylmethyl] (MMT), p-methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl (triphenylmethyl, Tr), silyl ethers, such as t-butyldiphenylsilyl ether (TBDPS), trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), triisopropylsilyloxymethyl (TOM), and triisopropylsilyl (TIPS) ether; methyl ether, ethoxyethyl ether (EE), and is usually, and preferably, independently selected from these in each appearance.

[0059] Preferred examples of the "hydroxyl protecting group" of the present invention include acetyl, t-butyl, t-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl(trityl), 4,4'-dimethoxytrityl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl (TBDMS), t-butyldiphenylsilyl (TBDPS), triphenylsilyl, triisopropylsilyl, benzoylformate, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, 9-fluorenylmethyl carbonate, mesylate, tosylate, triflate, 4-monomethoxytrityl (MMTr), and 4,4'-dimethoxytrityl (DMTr). , and 4,4',4”-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl, 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2,4,6-trimethylphenyl, 2 -(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4',4”-tris(benzoyloxy)trityl, diphenylcarbamoyl, levlinyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthene-9-yl (pixyl), or 9-(p-methoxyphenyl)xanthin-9-yl (MOX), and each appearance is independently selected from these.

[0060] As used herein, the term “nucleic acid base” (Bx) refers to unmodified or naturally occurring nucleic acid bases, as well as modified or naturally occurring nucleic acid bases and their synthetic mimicry. A nucleic acid base is any heterocyclic base that contains one or more atoms or groups of atoms capable of hydrogen bonding to the heterocyclic base of a nucleic acid.

[0061] Typical and preferred examples of nucleic acid bases are purine bases or pyrimidine bases, preferably the purine base being a purine or a substituted purine, and the pyrimidine base being a pyrimidine or a substituted pyrimidine. More preferably the nucleic acid base is (i) adenine (A), (ii) cytosine (C), (iii) 5-methylcytosine (MeC), (iv) guanine (G), (v) uracil (U), or (vi) 5-methyluracil (MeU), or a derivative of (i), (ii), (iii), (iv), (v), or (vi). The terms “derivative of (i), (ii), (iii), (iv), (v), or (vi)” and “nucleic acid base derivative” are used interchangeably herein. Derivatives of (i), (ii), (iii), (iv), (v), or (vi), and nucleic acid base derivatives are known to those skilled in the art, for example, as described in Non-Patent Literature 6, and without limitation include 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, alkyladenine, e.g., 6-methyladenine, 2-propyladenine, alkylguanine, e.g., 6-methylguanine, 2-propylguanine, 2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-halouracil, 5-halocytosine, alkynylpyrimidine bases, e.g., 5-propynyl(-C=C-CH3)uracil, 5-propynyl(-C=C-CH3)cytosine The bases include 6-azouracil, 6-azocytosine, 6-azothimine, pseudouracil, 4-thiouracil; 8-substituted purine bases, e.g., 8-halo-, 8-amino-, 8-thiol-, 8-thioalkyl-, 8-hydroxyl-adenine or guanine; 5-substituted pyrimidine bases, e.g., 5-halo-, in particular, 5-bromo-, 5-trifluoromethyl-uracil or cytosine; 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 8-azaguanine, and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine; hydrophobic bases, indiscriminate bases, size-extended bases, or fluorinated bases.In certain embodiments, the nucleic acid base includes, without limitation, tricyclic pyrimidines, e.g., 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one, or 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). The term “nucleic acid base derivative” also includes those in which the purine or pyrimidine base is substituted with another heterocycle, e.g., 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, or 2-pyridone. Further nucleic acid bases of this disclosure include, without limitation, those known to those skilled in the art (e.g., Patent Document 30, Non-Patent Documents 7-10). The term “nucleic acid base derivative” also includes those in which the purine or pyrimidine base is replaced with a portion corresponding to the spacer of this disclosure to internally bond the one or more lipid portions of the oligomer compound, preferably the oligonucleotide. Specific bonding of the portion corresponding to the spacer is known to those skilled in the art. Preferred nucleic acid base derivatives include methylated adenine, guanine, uracil, and cytosine, and preferably the nucleic acid base derivatives of (i), (ii), (iii), or (iv), where each amino group, preferably an extracyclic amino group, is protected with an acyl protecting group or a dialkylformamidino, preferably dimethylformamidino (DMF), and further include nucleic acid base derivatives such as 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, and pyrimidine analogs such as pseudoisocytosine and pseudouracil. The preparation of modified nucleic acid bases is known in the art and is described in Patent Documents 30 to 52.

[0062] In some embodiments, one or more lipid moieties are independently attached to the oligomer compound at (i) terminal residues of the oligomer compound, (ii) the 5' end of the oligomer compound, (iii) the 3' end of the oligomer compound, or (iv) internal residues of the oligomer compound.

[0063] The term "end" refers to an end or terminus of an oligomer compound, and integers (such as 3' and 5') indicate the carbon atom of the sugar contained in the nucleoside of the oligomer compound. As used herein, the term "5'-terminal group" or "3'-terminal group" refers to a group located at the 5' terminus or 3' terminus, respectively.

[0064] The terms "native" or "naturally occurring", used interchangeably herein, refer to a compound of natural origin.

[0065] The term "exon inclusion" refers to an oligonucleotide-mediated process, such as base pairing between an antisense oligonucleotide and a target pre-mRNA, that results in more efficient recognition of exons by the spliceosome and restoration of exon expression by blocking exon or intron splicing enhancers, blocking corresponding splicing repressors, and / or disrupting undesired secondary structures.

[0066] The term "splicing" is known to those skilled in the art and is used accordingly herein. As used herein, the term "splicing" refers to the post-transcriptional modification of pre-mRNA in which introns are removed and exons are ligated together.

[0067] As used herein, the phrase "exon skipping" refers to a process that results in the removal of an exon that would otherwise remain in the mature mRNA from the fully processed mRNA. Oligonucleotides can block splicing reactions and allow the exclusion of a target exon from fully processed mRNA by blocking access of the spliceosome to one or more splice donor or acceptor sites, or any other site within an exon or intron involved in the definition of splicing. Exon skipping occurs in the nucleus during the maturation process of pre-mRNA. Exon skipping involves masking key sequences involved in splicing of a target exon, and uses antisense oligonucleotides complementary to such key sequences in pre-mRNA. For example, the oligomeric compounds provided herein are suitably used for exon skipping by masking splice sites at intron / exon junctions in dystrophin pre-mRNA, thereby promoting deletion of a mutant exon during processing from pre-mRNA to mature mRNA. In the present invention, the oligomeric compound as defined above is capable of inducing skipping of exon 51 in human DMD pre-mRNA. As used herein and described in detail, the phrase "induces skipping of exon 51 in human DMD pre-mRNA" refers to the exclusion of exon 51 that allows rescue of the DMD mRNA open reading frame (e.g., in cells of a patient bearing the appropriate mutation), which can be translated into a truncated semi-functional protein.

[0068] The phrase "in vitro" refers to an event that occurs outside the body of a subject. In vitro assays include cell-based assays using live or dead cells, and may also include cell-free assays that do not use intact cells. In contrast, the phrase "in vivo" refers to an event that occurs inside the body of a subject.

[0069] The terms “effective dose” or “therapeutic dose” refer to the amount of a compound or combination of compounds described herein that is sufficient to achieve the intended use, including but not limited to the treatment of disease. The therapeutic dose may vary depending on the intended use (in vitro or in vivo), the human subject and condition being treated (e.g., weight, age, and sex of the subject), the severity of the condition, the method of administration, etc., which can be readily determined by those skilled in the art. The term also applies to the dose that elicits a specific response in target cells (e.g., reduced platelet adhesion and / or cell migration). The specific dose will vary depending on the specific compound selected, the administration plan to be followed, whether or not the compound is administered in combination with other compounds, the timing of administration, the tissue to which it is administered, and the physical delivery system carrying the compound.

[0070] The term "patient" refers to any individual with DMD disease who has a large gene deletion in the gene encoding dystrophin that induces a frameshift mutation, which can be restored by removing exon 51 during mRNA splicing.

[0071] In its broadest sense, the term “to treat” or “to cure” refers to reversing, alleviating, or suppressing the progression of a disorder or condition, or one or more symptoms of such disorder or condition, or preventing one or more symptoms of such disorder or condition.

[0072] As used herein, “therapeutic effect” encompasses therapeutic and / or preventive benefits in human subjects. Preventive effects include delaying or eliminating the onset of a disease or condition, delaying or eliminating the onset of symptoms of a disease or condition, slowing, halting, or reversing the progression of a disease or condition, or a combination thereof.

[0073] The term "pharmaceutically acceptable salt" refers to salts derived from various organic and inorganic counterions known in the art. Pharmaceutically acceptable acid addition salts can be formed using inorganic and organic acids. Examples of inorganic acids that can derivate salts include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid. Examples of organic acids that can derivate salts include acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, and salicylic acid. Pharmaceutically acceptable base addition salts can be formed using inorganic and organic bases. Examples of inorganic bases that can derivate salts include sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and aluminum. Organic bases capable of inducing salts include, for example, primary, secondary, and tertiary amines, substituted amines including naturally substituted amines, cyclic amines, and base ion exchange resins. Specific examples include isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, and ethanolamine. In some embodiments, the pharmaceutically acceptable base addition salt is selected from ammonium, potassium, sodium, calcium, and magnesium salts, preferably the pharmaceutically acceptable salt is a sodium salt.

[0074] Typically and preferably, a hydroxyl group (OH) or thiol group (SH) selected from phosphorothioates or phosphorodiesters is typically and preferably bonded to P(III) or P(V), and typically and preferably present in the one or more lipid moieties as part of group B of the one or more lipid moieties, or present in the spacer, or present in the oligomer compound of the present invention, preferably the oligonucleotide, as part of the internucleoside bonding group. In the case of such a hydroxyl group (OH) or thiol group (SH), each can exist independently of the other, as the OH group or in an ionic state such as an O anion and a pharmaceutically acceptable cation, or as the SH group or in an ionic state such as an S anion and a pharmaceutically acceptable cation. Furthermore, any combination of the aforementioned situations and any equilibrium states in the compositions of the present invention are also included, in particular, taking into account further oxygen or sulfur-containing groups on P(III) or P(V), such as (=O), (=S), another OH group, or SH group, as known to those skilled in the art. For the sake of simplification, aspects and embodiments of the present invention typically describe only one of the aforementioned situations. As an example, a preferred spacer of the present invention is referred to herein as #-NH-C 2-12 This is denoted as alkylene-OP(O)(SH)-§. Included herein, without limitation, are spacers where hydrogen is located relative to oxygen, i.e., #-NH-C 2-12 These include alkylene-OP(OH)(S)-§ and all pharmaceutically acceptable salts thereof.

[0075] Accordingly, a pharmaceutically acceptable salt in relation to a hydroxyl group (OH) or thiol group (SH) typically and preferably selected from phosphorothioates or phosphorodiesters, which is typically and preferably bound to P(III) or P(V) and typically and preferably present in the one or more lipid moieties as part of group B of the one or more lipid moieties, or present in the spacer, or present in the oligomer compound of the present invention, preferably the oligonucleotide, as part of the internucleoside binding group, refers to a composition of the present invention in which one or more of the OH groups or SH groups exist independently of each other, either as the OH group or in an ionic state such as an O anion and a pharmaceutically acceptable cation thereof, or as the SH group or in an ionic state such as an S anion and a pharmaceutically acceptable cation, wherein the pharmaceutically acceptable cation is typically and preferably selected from protonated trimethylamine, protonated diethylamine, protonated methylamine, ammonium, sodium, or potassium, and more preferably the pharmaceutically acceptable cation is sodium.

[0076] "Pharmacologically acceptable excipients" means any substance that, in accordance with the present invention, is added to an oligomeric compound according to the present invention to facilitate its transport, avoid substantial degradation of the composition, and / or extend its half-life. Advantageously, such pharmaceutically acceptable excipients refer to molecular entities and compositions that are sterile and nonpyrogenic and, when administered as needed to mammals, particularly humans, do not cause adverse reactions, allergic reactions, or other unfavorable reactions. This is selected, in particular, as a function of the method of administration, depending on the type of application of the pharmaceutical composition of the present invention. Advantageously, pharmaceutically acceptable excipients refer to any kind of non-toxic solid, semi-solid, or liquid filler, diluent, encapsulating material, or formulation aid.

[0077] For example, when a range is used herein to describe a physical or chemical property such as molecular weight or chemical formula, it is intended to include all combinations and partial combinations of the range, and specific embodiments therein. The use of the term “about” when referring to a number or numerical range means that the number or numerical range referred to is an approximation within experimental variation (or statistical experimental error), and therefore the number or numerical range may vary. The variation is typically 0–15%, 0–10%, or 0–5% of the presented number or numerical range.

[0078] Antisense technology, particularly methods based on antisense oligonucleotides (AONs), began about 40 years ago when Zamecnik and Stephenson demonstrated that the expression of specific genes could be downregulated using oligonucleotides. These AONs were initially unmodified synthetic DNA complementary to the target mRNA, but it quickly became clear that chemical modifications to prevent degradation by nucleases were necessary, particularly at the level of internucleotide phosphate diester bonds.

[0079] The phosphorothioate (PS) skeleton is the most commonly used chemical modification to protect AONs from nuclease activity and enhance stability against target RNA. Typical PS differs from phosphate diester (PO) bonds in that the uncrosslinked phosphate oxygen atom is replaced with a sulfur atom, resulting in improved stability and cellular uptake. PS modifications have demonstrated high efficacy due to their improved bioavailability compared to PO modifications, and the majority of drugs currently in clinical development contain PS bonds. However, despite the pharmacokinetic advantages, PS-modified molecules are known to cause toxicity or undesirable effects, primarily due to their ability to bind to plasma proteins. Acute reactions / effects of the PS skeleton may include immune cell activation, complement activation, or transient prolongation of clotting time, which is known to normalize once the oligonucleotide is cleared from the blood, particularly in monkey studies. It should be noted that complement activation, even at low levels, can lead to complement depletion and damage to the vascular system and kidneys if prolonged.

[0080] Other major sites of chemical modification include the 2' position of the sugar moiety, which is widely used in antisense regions (e.g., 2'-O-methyl (2'OMe), 2'-O-methoxyethyl (2'OMOE), 2'-fluorinated (2'F), and 2'-O-aminopropyl analogs). Many other structural modifications of the sugar backbone exist, including phosphorodiamidate morpholino oligomers (PMOs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs), phosphoramidate and methylphosphonate derivatives, and tricycloDNA (tc-DNA). The accumulation of such AONs leads to many therapeutic options, including the manipulation of alternative splicing, where the antisense molecule is the so-called splice-switching oligonucleotide (SSO). In this case, the antisense molecule is used to adjust the ratio of splicing variants or to correct splicing defects by inducing exon inclusion or exon skipping. This technique is suitable for treating many neuromuscular disorders, including Duchenne muscular dystrophy (DMD).

[0081] Duchenne muscular dystrophy (DMD) is an X-linked recessive genetic disorder that affects 1 in 3,500 male births. It is considered a rare disease, with an estimated prevalence of 1 to 9 cases per 100,000 males in France. The disease is caused by mutations in the DMD gene, which encodes dystrophin, a large 427 kDa protein found in various tissues, particularly muscle fibers (i.e., striated and smooth muscle), and neurons in specific areas of the central nervous system. Dystrophin is located near the inner surface of the plasma membrane and, via the membrane dystrophin-associated glycoprotein complex, connects the actin cytoskeleton to the extracellular matrix. A deficiency in dystrophin makes skeletal muscle fibers particularly vulnerable to mechanical stress, leading to repeated recurrent necrosis. As a result, patients exhibit progressive skeletal weakness, and as skeletal muscle is replaced by adipose fibrous tissue over time, walking becomes difficult by age 12, followed by premature death due to respiratory failure and cardiomyopathy. Furthermore, approximately one-third of DMD patients also exhibit cognitive impairment, suggesting significant damage to nerve and brain function.

[0082] Full-length dystrophin, translated from a large mRNA transcript (14kb) consisting of 79 exons, is a regulatory protein that, fortunately, can cope with deletions of numerous exons if the reading frame is preserved. This phenomenon occurs in Becker muscular dystrophy (BMD), a clinically mild disease, where deletions with preserved reading frames result in the synthesis of semi-functional truncated dystrophin. While DMD is caused by various types of mutations occurring throughout the gene, most mutations are large deletions resulting in out-of-frame truncated mRNA that translates into unstable, non-functional truncated dystrophin. Therefore, 20 years ago, it was proposed that inhibiting the splicing process of selected exons using AON to restore semi-functional dystrophin, thereby transforming severe DMD into milder BMD, might be a favorable treatment for DMD.

[0083] Two compounds, a 2'-O-methyl modified ribose oligomer (2'OMe-PS) with a full-length phosphorothioate skeleton and a phosphorodiamidate morpholino oligomer (PMO), were extensively tested for antisense-mediated exon skipping. Both types of antisense molecules have shown dystrophin rescue in skeletal muscle after systemic delivery in animal models of DMD and clinical trials. However, further studies using AONs of 2'OMe-PS and PMO targeting exon 51 in DMD patients did not demonstrate significant clinical benefit, possibly due to insufficient levels of dystrophin rescue (Non-Patent Literature 11).

[0084] Patent document 53 proposes tricycloDNA antisense oligonucleotides (tc-DNA AONs) in which all nucleotides are modified by the introduction of a cyclopropane ring to limit the conformational flexibility of the backbone. These tc-DNA AONs can be designed to skip mutant exon 23 or mutant exon 51 in the dystrophin premRNA. tc-DNA AONs designed to skip mutant exon 51 are tc-DNA AON H51(+68+82), tc-DNA AON H51(+70+84), and tc-DNA AON H51(+73+87), where the numbers refer to exon 51 of the human dystrophin gene (DMD gene). Furthermore, patent document 54 discloses nucleic acid molecules having a sequence of tricyclonucleosides linked by internucleoside phosphorothioate bonds, thus forming tricyclophosphorothioate DNA molecules (tc-DNA-PS). This application describes the use of tc-DNA-PS antisense oligonucleotides for exon 23 skipping of dystrophin premRNA, which has been established by further studies using an mdx mouse model of DMD, showing that tc-DNA AONs with a complete PS backbone induced effective exon 23 skipping to levels 5-6 times higher than achieved with 2'OMe-PS and PMO-compatible AONs (Non-Patent Literature 12). This resulted in a significant rescue of dystrophin protein levels, particularly in the diaphragm and heart, reaching 50% and 40% levels, respectively, compared to wild-type mice after 12 weeks of treatment. However, because oxygen is replaced with sulfur in the phosphate ester backbone, and the in vivo distribution is significantly improved, nonspecific protein binding is also promoted, as well as activation of the innate immune system (e.g., complement activation, coagulation, and elevated inflammatory cytokines), which could lead to acute toxicity in the worst case, or long-term toxicity at best (Non-Patent Literature 13, 14). To address this situation, alternative schemes such as controlling the stereochemistry of phosphorothioates have been proposed (Non-Patent Literature 15), but recent clinical trials in DMD patients have yielded insufficient results.

[0085] Furthermore, Patent Document 55 proposes another approach of combining an oligomeric compound containing one or more tc-DNA nucleosides with one or more lipid moieties covalently bound to this oligomeric compound. Of the various oligomeric compounds bound to at least one lipid moiety, such as those disclosed in this application, compound SY-0487 has shown the best preliminary results in exon 51 skipping tests and is therefore considered to date to be the best tc-DNA-based compound for skipping exon 51 of DMD. Compound SY-0487 is designed herein as SYN51.

[0086] This invention solves the aforementioned technical problems and makes it possible to achieve the set objectives.

[0087] In fact, while we do not wish to be bound by any particular theory, a specific sequence of exon 51 of the premRNA encoded by the DMD gene, or more specifically, the human DMD gene, has been identified, and its reverse complement forms a compound of interest for the treatment of DMD patients.

[0088] As will be apparent to those skilled in the art, in the cell nucleus of eukaryotes, genes are transcribed into pre-messenger RNA (pre-mRNA) that contains both exons and introns. Splicing occurs at specific sequences at the exon-intron boundaries (splice sites), whereby introns are removed and exons are ligated to each other to form mRNA, thus generating mature mRNA that is subsequently translated into protein. Over the past 30 years, from the perspective of DMD treatment, splice switching methods that inhibit this mechanism have been developed. In particular, it has been reported that exon 23 skipping of the mouse DMD gene in mdx mice has been successfully achieved by using various types of antisense oligonucleotides that anneal to the donor splice site at the 3' end of exon 23. For exon 51, numerous compounds have been developed, several of which, selected after screening tests using patient cells, have already been evaluated at the clinical level, and most of them target sequences contained in the region spanning positions +66 to +95 of exon 51 of the pre-mRNA encoded by the human DMD gene.

[0089] In the present invention, the specific sequence selected is located upstream of the region normally targeted by those skilled in the art, which is probably because the region containing the sequence implemented in the present invention did not appear to be particularly prominent in in vitro screening performed by those skilled in the art.

[0090] Surprisingly, it has been found that the oligomeric compounds of the present invention have unexpected binding properties to serum proteins, particularly when covalently bound to a lipid moiety such as palmitoyl. For any species considered, compounds of this class normally bind to apolipoproteins (i.e., the structural protein components of HDL and LDL), whereas the compounds of the present invention preferentially and advantageously bind to serum albumin in blood samples of human and non-human primates. Such properties can significantly improve the bioavailability of the compound as well as its diffusion in skeletal muscle and cardiac tissue. It should be noted that this valuable advantage is unique to the oligomeric compounds of the present invention.

[0091] Accordingly, the present invention includes an oligomeric compound comprising 10 to 50 monomer subunits, the latter of which is complementary to the following sequence: AAGGAAAACUGCCAUCUCCAA (SEQ ID NO: 1 in the attached sequence listing).

[0092] Advantageously, and depending on the monomer subunits they contain, in some embodiments, the oligomeric compounds of the present invention include or consist of oligodeoxyribonucleotides, oligoribonucleotides, morpholino, tricycloDNA oligonucleotides, tricyclophosphorothioate DNA oligonucleotides, and LNA oligonucleotides.

[0093] It should be noted that the monomer subunits contained in the oligomeric compounds according to the present invention include not only the five standard nucleic acid bases, namely adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U), but also base analogues.

[0094] In one embodiment, the sequence AAGGAAAACUGCCAUCUCCAA (SEQ ID NO: 1 in the attached sequence listing), which is partly complementary to the sequence of the oligomeric compound according to the present invention, is a region defined by position +45+64 of exon 51 of the premRNA encoded by the human DMD gene. Exon 51 of the premRNA encoded by the human DMD gene has the following sequence: CUCCUACUCAGACUGUUACUCUGGUGACACAACCUGUGGUUACUAAGGAAACUGCCAUCUCCAAACUAGAAAUGCCAUCUUCCUUGAUGUUGGAGGUACCUGCUCUGGCAGAUUUCAACCGGGCUUGGACAGAACUUACCGACUGGCUUUCUCUGCUUGAUCAAGUUAUAAAAUCACAGAGGGUGAUGGUGGGUGACCUUGAGGAUAUCAACGAGAUGAUCAUCAAGCAGAAG (SEQ ID NO: 2 in the attached sequence listing).

[0095] Advantageously, in some embodiments, at least a portion of the sequence of the oligomeric compound according to the present invention is complementary to the sequence corresponding to region 2+48+62 of SEQ ID NO: attached sequence listing. This region also corresponds to region 1+4+18 of SEQ ID NO: attached sequence listing.

[0096] Therefore, the oligomeric compounds of the present invention and the target nucleotide sequences of pre-mRNA are complementary to each other if a sufficient number of nucleic acid bases that can bind to each other and enable stable association between the oligomeric compounds of the present invention and the target nucleotide sequences of pre-mRNA occupy corresponding positions in each molecule. Those skilled in the art will understand that it is possible to include improper base pairs without precluding the ability of the oligomeric compounds to maintain their association state. Accordingly, described herein are oligomeric compounds of the present invention that may contain up to about 20% of nucleotides that are improper base pairs (i.e., nucleotide bases that are not complementary to the corresponding target nucleotide), and are advantageously antisense oligonucleotides. In particular, the oligomeric compounds of the present invention that are advantageously antisense oligonucleotides contain about 15% or less, more preferably about 10% or less, most preferably 5% or less of improper base pairs, or contain no improper base pairs at all.

[0097] Typically, the oligomeric compounds according to the present invention include or consist of antisense oligonucleotides.

[0098] Furthermore, in the present invention, the antisense oligonucleotide (AON) sequence is selected to be specific, that is, the AON is perfectly complementary only to the sequence of the target premRNA and not to other nucleic acid sequences. The AON used in the implementation of the present invention may be any suitable type (e.g., oligodeoxyribonucleotides, oligoribonucleotides, morpholino, tricycloDNA, tricyclophosphorothioate DNA, LNA, U7 or U1 modified AON, or their conjugated products, e.g., peptide bonded or nanoparticle complex AONs), which are known to those skilled in the art (Non-Patent Literature 16). The oligomeric compounds and in particular the AONs according to the present invention are generally about 10 to about 50 nucleotides long, particularly about 11 to about 40 nucleotides long, about 12 to about 30 nucleotides long, or about 13 to about 20 nucleotides long, for example, about 10, or about 15, or about 20 to about 30 nucleotides long, or longer. Typically, morpholino AONs are about 25-30 nucleotides long, PPMO AONs are about 20-25 nucleotides long, and tricyclo AONs are about 10-20 nucleotides long. U7 and U1 modified AONs can have long antisense sequences of about 50 nucleotides. The phrase "about X nucleotides" means X nucleotides ± 2 nucleotides.

[0099] In certain embodiments, the oligomeric compound according to the present invention comprises at least one nucleotide sequence having at least 70% identity with the reverse complement of SEQ ID NO:1.

[0100] Therefore, the oligomeric compound according to the present invention comprises at least one nucleotide sequence having at least 70% identity with the reverse complement of SEQ ID NO:1, and may exhibit at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with it.

[0101] Furthermore, in certain embodiments, the oligomeric compound according to the present invention comprises at least one nucleotide sequence having at least 70% identity with the following tc-DNA nucleotide sequence: GGAGATGGCAGTTTC (SEQ ID NO: 3 in the attached sequence listing).

[0102] Therefore, the oligomeric compound according to the present invention comprises at least one nucleotide sequence having at least 70% identity with the tc-DNA nucleotide sequence SEQ ID NO:3, and may exhibit at least 73%, at least 75%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, or at least 99% identity with it.

[0103] The identity percentage is statistical, and the differences between the two sequences are randomly distributed along these sequences. The differences between the two sequences may consist of differences in the type of sequence modification, such as deletions, substitutions, or additions of nucleotide (or amino acid) residues.

[0104] In certain embodiments, the oligomeric compound according to the present invention comprises at least one nucleotide sequence that is identical to the tc-DNA nucleotide sequence SEQ ID NO:3.

[0105] For in vivo use, the oligomeric compounds and, in particular, AONs according to the present invention may be stabilized. A “stabilized” oligomeric compound or AON refers to an oligomeric compound or AON that is relatively resistant to in vivo degradation (e.g., by exonucleases or endonucleases). Stabilization may be functional in terms of length or secondary structure. Alternatively, stabilization of the oligomeric compound or AON can be achieved by phosphate skeleton modification.

[0106] The preferred stabilized oligomer compounds or AONs of the present invention have a modified skeleton, for example, a phosphorothioate bond that provides maximum activity and protects the oligomer compound or AON from degradation by intracellular exonucleases and endonucleases. Other possible stabilizing modifications include phosphate diester modifications, combinations of phosphate diester and phosphorothioate modifications, methylphosphonates, methylphosphorothioates, phosphorodithioates, p-ethoxy, and combinations thereof. Chemically stable modified versions of the oligomer compounds or AONs include "morpholino" (phosphodiamide morpholino oligomer, PMO), 2'-O-Met oligomers, tricycloDNA (tc-DNA) oligomers (Patent Document 53), tricyclophosphorothioate DNA oligomers (Patent Document 54), LNA, and others, all of which are known to those skilled in the art (Non-Patent Document 16).

[0107] In certain embodiments of the present invention, the oligomeric compound mainly comprises a tricyclodeoxyribonucleic acid (tc-DNA) nucleoside. Therefore, the oligomeric compound of the present invention comprises or comprises a tricycloDNA antisense oligonucleotide. In this embodiment, the tricycloDNA antisense oligonucleotide according to the present invention comprises or comprises a nucleotide sequence corresponding to nucleotide sequence SEQ ID NO:3.

[0108] In this embodiment, various tc-DNA nucleosides may be linked by phosphate diester bonds. Alternatively, at least two adjacent tc-DNA nucleosides may be linked by phosphorothioate (PS) bonds. The terms "phosphorothioate bond" or "phosphorothioate modification," as used herein interchangeably, refer to the "5'...-OP(S)-O-...3" portion between two adjacent nucleosides in a nucleic acid molecule. Advantageously, all tc-DNA nucleosides in the oligomeric compounds according to the present invention are linked by PS bonds. Therefore, the oligomeric compounds of the present invention comprise or consist of tricyclophosphorothioate DNA antisense oligonucleotides. If other modifications are present in the oligomeric compounds of this disclosure, the latter include phosphate diesters, methylphosphonates, methylphosphorothioates, phosphorodithioates, and p-ethoxy modifications, and combinations thereof.

[0109] In one embodiment, the tc-DNA nucleoside of the oligomeric compound includes the compound of formula (1).

[0110] TIFF0007912190000001.tif86158

[0111] In the above formula: Bx is a nucleic acid base; One of T1 and T2 is a nucleoside-bonding group, and the other of T1 and T2 is OR1, OR2, a 5'-terminal group, a 3'-terminal group, or a nucleoside-bonding group, where R1 is H or a hydroxyl protecting group, and R2 is a phosphorus moiety; q1, q2, q3, q4, and q5 are each independently hydrogen (H), halogen, and C. 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, Substitute C 1-6 Alkyl, substituted C 2-6 Alkenyl, substituted C 2-6 Alkinyl and -(CH2) nA selection is made from the group consisting of -C(O)-R6', where n is 0 to 6, and R6' is OH, NH2, or OC. 1-32 Alkyl and NH-C 1-32 Selected from the group consisting of alkyl groups; z1 and z2 are independently H, halogen, and C. 1-6 Alkyl, C 1-6 Alkoxyl, OC 2-6 Alkenyl, OC 2-6 Alkinyl, Substitute C 1-6 Alkyl, substituted C 1-6 Alkoxy, substituted OC 2-6 Alkenyl and substituted OC 2-6 Selected from the group consisting of alkynyl or pharmaceutically acceptable salts thereof.

[0112] In one embodiment, the tc-DNA nucleoside of the oligomer compound comprises the compound of formula (1), where q5 is H.

[0113] In one embodiment, the tc-DNA nucleoside of the oligomer compound comprises the compound of formula (1), and Bx is selected from the group consisting of thymine, adenine, guanine, and cytosine. In one embodiment, the tc-DNA nucleoside of the oligomer compound comprises the compound of formula (1), and Bx is a modified base. In one embodiment, the tc-DNA nucleoside of the oligomer compound of the present invention comprises the compound of formula (1), and Bx is a modified base selected from the group consisting of 5-methylcytosine, 5-bromouracil, inosine, and 2,6-diaminopurine.

[0114] In one embodiment, the tc-DNA nucleoside of the oligomeric compound includes the compound of formula (2).

[0115] TIFF0007912190000002.tif67114

[0116] In the above formula: Bx is a nucleic acid base; One of T1 and T2 is an internucleoside bonding group, and the other of T1 and T2 is OR1, OR2, a 5'-terminal group, a 3'-terminal group, or an internucleoside bonding group, R1 is H or a hydroxyl protecting group, and R2 is a phosphorus moiety.

[0117] In one embodiment, the tc-DNA nucleoside of the oligomer compound comprises the compound of formula (2), and Bx is selected from the group consisting of thymine, adenine, guanine, and cytosine. In one embodiment, the tc-DNA nucleoside of the oligomer compound of the present invention comprises the compound of formula (2), and Bx is a modified base. In one embodiment, the tc-DNA nucleoside of the oligomer compound of the present invention comprises the compound of formula (2), and Bx is a modified base selected from the group consisting of 5-methylcytosine, 5-bromouracil, inosine, and 2,6-diaminopurine.

[0118] In one embodiment, the tc-DNA nucleoside of the oligomeric compound comprises the compound of formula (3) (also known as C(6')-functionalized tc-DNA).

[0119] TIFF0007912190000003.tif70127

[0120] In the above formula: Bx is a nucleic acid base; R6' is OH, NH2, OC 1-32 Alkyl and NH-C 1-32 Selected from the group consisting of alkyl groups; One of T1 and T2 is an internucleoside bonding group, and the other of T1 and T2 is OR1, OR2, a 5'-terminal group, a 3'-terminal group, or an internucleoside bonding group, R1 is H or a hydroxyl protecting group, and R2 is a phosphorus moiety.

[0121] In one embodiment, the tc-DNA nucleoside of the oligomer compound comprises the compound of formula (3), and Bx is selected from the group consisting of thymine, adenine, guanine, and cytosine. In one embodiment, the tc-DNA nucleoside of the oligomer compound of the present invention comprises the compound of formula (3), and Bx is a modified base. In one embodiment, the tc-DNA nucleoside of the oligomer compound of the present invention comprises the compound of formula (3), and Bx is a modified base selected from the group consisting of 5-methylcytosine, 5-bromouracil, inosine, and 2,6-diaminopurine.

[0122] In one embodiment, the tc-DNA nucleoside of the oligomeric compound comprises the compound of formula (4) (also known as 6'-fluoro-tc-DNA).

[0123] TIFF0007912190000004.tif66107

[0124] In the above formula: Bx is a nucleic acid base; One of T1 and T2 is an internucleoside bonding group, and the other of T1 and T2 is OR1, OR2, a 5'-terminal group, a 3'-terminal group, or an internucleoside bonding group, R1 is H or a hydroxyl protecting group, and R2 is a phosphorus moiety.

[0125] In one embodiment, the tc-DNA nucleoside of the oligomer compound comprises the compound of formula (4), and Bx is selected from the group consisting of thymine, adenine, guanine, and cytosine. In one embodiment, the tc-DNA nucleoside of the oligomer compound of the present invention comprises the compound of formula (4), and Bx is a modified base. In one embodiment, the tc-DNA nucleoside of the oligomer compound of the present invention comprises the compound of formula (4), and Bx is a modified base selected from the group consisting of 5-methylcytosine, 5-bromouracil, inosine, and 2,6-diaminopurine.

[0126] In one embodiment, the tc-DNA nucleoside of the oligomeric compound comprises the compound of formula (5) (also known as 2'-fluoro-tc-DNA).

[0127] TIFF0007912190000005.tif55102

[0128] In the above formula: Bx is a nucleic acid base; One of T1 and T2 is an internucleoside bonding group, and the other of T1 and T2 is OR1, OR2, a 5'-terminal group, a 3'-terminal group, or an internucleoside bonding group, R1 is H or a hydroxyl protecting group, and R2 is a phosphorus moiety.

[0129] In one embodiment, the tc-DNA nucleoside of the oligomer compound comprises the compound of formula (5), and Bx is selected from the group consisting of thymine, adenine, guanine, and cytosine. In one embodiment, the tc-DNA nucleoside of the oligomer compound of the present invention comprises the compound of formula (5), and Bx is a modified base. In one embodiment, the tc-DNA nucleoside of the oligomer compound of the present invention comprises the compound of formula (5), and Bx is a modified base selected from the group consisting of 5-methylcytosine, 5-bromouracil, inosine, and 2,6-diaminopurine.

[0130] Therefore, in one embodiment, the one or more tc-DNA nucleosides of the oligomeric compound include the compound of formula (5') (also known as 2'-fluoro-tc-ANA).

[0131] TIFF0007912190000006.tif54101

[0132] In the above formula: Bx is a nucleic acid base; One of T1 and T2 is an internucleoside bonding group, and the other of T1 and T2 is OR1, OR2, a 5'-terminal group, a 3'-terminal group, or an internucleoside bonding group, R1 is H or a hydroxyl protecting group, and R2 is a phosphorus moiety.

[0133] In one embodiment, the tc-DNA nucleoside of the oligomer compound comprises the compound of formula (5'), and Bx is selected from the group consisting of thymine, adenine, guanine, and cytosine. In one embodiment, the tc-DNA nucleoside of the oligomer compound of the present invention comprises the compound of formula (5'), and Bx is a modified base. In one embodiment, the tc-DNA nucleoside of the oligomer compound of the present invention comprises the compound of formula (5'), and Bx is a modified base selected from the group consisting of 5-methylcytosine, 5-bromouracil, inosine, and 2,6-diaminopurine.

[0134] General methods for preparing the compounds of formulas (1) and (2) for use with oligomeric compounds are known in the art, including the methods described in Patent Documents 56-58, the disclosures of which are incorporated herein by reference. Standard phosphoramidate structural units of tc-DNA are described in the art, for example, in Non-Patent Document 17. Methods for preparing the compound of formula (3) are described, for example, in Non-Patent Document 18, the disclosures of which are incorporated herein by reference. Methods for preparing the compound of formula (4) are described, for example, in Non-Patent Document 19, the disclosures of which are incorporated herein by reference. Methods for preparing the compounds of formulas (5) and (5') are described, for example, in Non-Patent Document 20, the disclosures of which are incorporated herein by reference.

[0135] In another specific embodiment of the present invention, the oligomer compound comprises at least one tricyclodeoxyribonucleic acid (tc-DNA) nucleoside and at least one modified ribonucleic acid nucleoside. Any modified RNA nucleoside known to those skilled in the art can be realized in the present invention. The modified RNA nucleosides confer flexibility to the oligomer molecule into which they are introduced. Specifically, the modified RNA nucleoside is a 2'-modified RNA nucleoside, such as 2'-O-methyl, 2'-methoxyethoxy, 2'-fluoro, 2'-allyl, 2'-O-[2-(methylamino)-2-oxoethyl], 2'-amino, and 2'-O-(N-methylcarbamate). More specifically, the modified RNA nucleoside is a 2'-O-methylRNA nucleoside. Furthermore, the monomer subunits of the oligomer compound according to this particular embodiment are typically linked by phosphate diester nucleoside bonds.

[0136] 2' modified RNA nucleosides, and other nucleosides In one embodiment, one or more nucleosides other than the tc-DNA nucleoside of the oligomer compound are, independently of each other, 2'-modified ribonucleic acid (2'-modified RNA) nucleosides.

[0137] In one embodiment, one or more nucleosides other than the tc-DNA nucleoside of the oligomer compound are RNA nucleosides of formula (6).

[0138] TIFF0007912190000007.tif53107

[0139] In the above formula: Bx is a nucleic acid base; One of T1 and T2 is an internucleoside bonding group, and the other of T1 and T2 is OR1, OR2, a 5'-terminal group, a 3'-terminal group, or an internucleoside bonding group, R1 is H or a hydroxyl protecting group, and R2 is a phosphorus moiety.

[0140] In one embodiment, one or more nucleosides other than the tc-DNA nucleoside of the oligomer compound are RNA nucleosides of formula (6), and Bx is selected from the group consisting of cytosine, adenine, guanine, and uracil. In one embodiment, the 2' modified RNA nucleoside of the oligomer compound comprises the compound of formula (6), and Bx is a modified base. In one embodiment, the 2' modified RNA nucleoside of the oligomer compound comprises the compound of formula (6), and Bx is a modified base selected from the group consisting of 5-methylcytosine, 5-methyluracil, 5-bromouracil, inosine, and 2,6-diaminopurine.

[0141] In one embodiment, the 2'-modified RNA nucleoside of the oligomeric compound of the preferred composition of the present invention includes the compound of formula (7) (2'-O-methylRNA nucleoside).

[0142] TIFF0007912190000008.tif56113

[0143] In the above formula: Bx is a nucleic acid base; One of T1 and T2 is an internucleoside bonding group, and the other of T1 and T2 is OR1, OR2, a 5'-terminal group, a 3'-terminal group, or an internucleoside bonding group, R1 is H or a hydroxyl protecting group, and R2 is a phosphorus moiety.

[0144] In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (7), and Bx is selected from the group consisting of cytosine, adenine, guanine, and uracil. In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (7), and Bx is a modifying base. In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (7), and Bx is a modifying base selected from the group consisting of 5-methylcytosine, 5-methyluracil, 5-bromouracil, inosine, and 2,6-diaminopurine.

[0145] In one embodiment, the 2'-modified RNA nucleoside of the oligomeric compound includes the compound of formula (8) (2'-O-propargyl RNA nucleoside).

[0146] TIFF0007912190000009.tif56113

[0147] In the above formula: Bx is a nucleic acid base; One of T1 and T2 is an internucleoside bonding group, and the other of T1 and T2 is OR1, OR2, a 5'-terminal group, a 3'-terminal group, or an internucleoside bonding group, R1 is H or a hydroxyl protecting group, and R2 is a phosphorus moiety.

[0148] In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (8), and Bx is selected from the group consisting of cytosine, adenine, guanine, and uracil. In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (8), and Bx is a modifying base. In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (8), and Bx is a modifying base selected from the group consisting of 5-methylcytosine, 5-methyluracil, 5-bromouracil, inosine, and 2,6-diaminopurine.

[0149] In one embodiment, the 2'-modified RNA nucleoside of the oligomeric compound includes the compound of formula (9) (2'-O-propylaminoRNA nucleoside).

[0150] TIFF0007912190000010.tif70145

[0151] In the above formula: Bx is a nucleic acid base; One of T1 and T2 is an internucleoside bonding group, and the other of T1 and T2 is OR1, OR2, a 5'-terminal group, a 3'-terminal group, or an internucleoside bonding group, R1 is H or a hydroxyl protecting group, and R2 is a phosphorus moiety.

[0152] In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (9), and Bx is selected from the group consisting of cytosine, adenine, guanine, and uracil. In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (9), and Bx is a modifying base. In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (9), and Bx is a modifying base selected from the group consisting of 5-methylcytosine, 5-methyluracil, 5-bromouracil, inosine, and 2,6-diaminopurine.

[0153] In one embodiment, the 2'-modified RNA nucleoside of the oligomeric compound includes the compound of formula (10) (2'-aminoRNA nucleoside).

[0154] TIFF0007912190000011.tif53112

[0155] In the above formula: Bx is a nucleic acid base; One of T1 and T2 is an internucleoside bonding group, and the other of T1 and T2 is OR1, OR2, a 5'-terminal group, a 3'-terminal group, or an internucleoside bonding group, R1 is H or a hydroxyl protecting group, and R2 is a phosphorus moiety.

[0156] In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (10), and Bx is selected from the group consisting of cytosine, adenine, guanine, and uracil. In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (10), and Bx is a modifying base. In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (10), and Bx is a modifying base selected from the group consisting of 5-methylcytosine, 5-methyluracil, 5-bromouracil, inosine, and 2,6-diaminopurine.

[0157] In one embodiment, the 2'-modified RNA nucleoside of the oligomeric compound includes the compound of formula (11) (2'-fluoroRNA nucleoside).

[0158] TIFF0007912190000012.tif55107

[0159] In the above formula: Bx is a nucleic acid base; One of T1 and T2 is an internucleoside bonding group, and the other of T1 and T2 is OR1, OR2, a 5'-terminal group, a 3'-terminal group, or an internucleoside bonding group, R1 is H or a hydroxyl protecting group, and R2 is a phosphorus moiety.

[0160] In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (11), and Bx is selected from the group consisting of cytosine, adenine, guanine, and uracil. In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (11), and Bx is a modified base. In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (11), and Bx is a modified base selected from the group consisting of 5-methylcytosine, 5-methyluracil, 5-bromouracil, inosine, and 2,6-diaminopurine.

[0161] In one embodiment, one or more nucleosides other than the tc-DNA nucleoside of the oligomer compound include the compound of formula (11') (2'-deoxy2'-fluoroarabinonucleoside (2'-FANA)).

[0162] TIFF0007912190000013.tif55109

[0163] In the above formula: Bx is a nucleic acid base; One of T1 and T2 is an internucleoside bonding group, and the other of T1 and T2 is OR1, OR2, a 5'-terminal group, a 3'-terminal group, or an internucleoside bonding group, R1 is H or a hydroxyl protecting group, and R2 is a phosphorus moiety.

[0164] In one embodiment, one or more nucleosides other than the tc-DNA nucleoside of the oligomer compound comprises a compound of formula (11'), and Bx is selected from the group consisting of cytosine, adenine, guanine, and uracil. In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises a compound of formula (11'), and Bx is a modified base. In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises a compound of formula (11'), and Bx is a modified base selected from the group consisting of 5-methylcytosine, 5-methyluracil, 5-bromouracil, inosine, and 2,6-diaminopurine.

[0165] In one embodiment, the 2'-modified RNA nucleoside of the oligomeric compound comprises the compound of formula (12) (2'-O-methoxyethyl RNA, or 2'-MOE, nucleoside).

[0166] TIFF0007912190000014.tif68116

[0167] In the above formula: Bx is a nucleic acid base; One of T1 and T2 is an internucleoside bonding group, and the other of T1 and T2 is OR1, OR2, a 5'-terminal group, a 3'-terminal group, or an internucleoside bonding group, R1 is H or a hydroxyl protecting group, and R2 is a phosphorus moiety.

[0168] In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (12), and Bx is selected from the group consisting of cytosine, adenine, guanine, and uracil. In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (12), and Bx is a modified base. In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (12), and Bx is a modified base selected from the group consisting of 5-methylcytosine, 5-methyluracil, 5-bromouracil, inosine, and 2,6-diaminopurine.

[0169] In one embodiment, one or more nucleosides other than the tc-DNA nucleoside of the oligomer compound include the compound of formula (13) (morpholino nucleoside).

[0170] TIFF0007912190000015.tif68102

[0171] In the above formula: Bx is a nucleic acid base; One of T1 and T2 is an internucleoside bonding group, and the other of T1 and T2 is OR1, OR2, a 5'-terminal group, a 3'-terminal group, or an internucleoside bonding group, R1 is H or a hydroxyl protecting group, and R2 is a phosphorus moiety.

[0172] In one embodiment, one or more nucleosides other than the tc-DNA nucleoside of the oligomer compound comprises a compound of formula (13), and Bx is selected from the group consisting of cytosine, adenine, guanine, and uracil. In one embodiment, the 2' modified RNA nucleoside of the oligomer compound comprises a compound of formula (13), and Bx is a modified base. In one embodiment, the 2' modified RNA nucleoside of the oligomer compound comprises a compound of formula (13), and Bx is a modified base selected from the group consisting of 5-methylcytosine, 5-methyluracil, 5-bromouracil, inosine, and 2,6-diaminopurine.

[0173] In one embodiment, the 2'-modified RNA nucleoside of the oligomeric compound comprises a compound of formula (14) (locked nucleic acid or LNA nucleoside).

[0174] TIFF0007912190000016.tif5588

[0175] In the above formula: Bx is a nucleic acid base; One of T1 and T2 is an internucleoside bonding group, and the other of T1 and T2 is OR1, OR2, a 5'-terminal group, a 3'-terminal group, or an internucleoside bonding group, R1 is H or a hydroxyl protecting group, and R2 is a phosphorus moiety.

[0176] In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (14), and Bx is selected from the group consisting of cytosine, adenine, guanine, and uracil. In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (14), and Bx is a modifying base. In one embodiment, the 2'-modified RNA nucleoside of the oligomer compound comprises the compound of formula (14), and Bx is a modifying base selected from the group consisting of 5-methylcytosine, 5-methyluracil, 5-bromouracil, inosine, and 2,6-diaminopurine.

[0177] General methods for preparing the compounds of formulas (6) to (14) for use with oligomeric compounds are known in the art, including the methods described in Patent Documents 56 to 79 and Non-Patent Document 21, the disclosures of which are incorporated herein by reference.

[0178] In one embodiment, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, and the one or more nucleosides other than the tc-DNA nucleoside are independent of each other. Ribonucleic acid (RNA) nucleoside; Deoxyribonucleic acid (DNA) nucleoside; 2' modified RNA nucleoside; Preferably, a 2'-ONC crosslinked system (2',4'-BNA NC A bicyclic nucleic acid (2',4'-BNA) nucleoside selected from 2',4'-BNA, stereoisomers of LNA-α-L-LNA, and ethylene nucleic acid (ENA) nucleosides having ); Peptide nucleic acid (PNA) nucleoside; 2'-Deoxy 2'-Fluorarabino (FANA) nucleoside; Hexitol nucleic acid (HNA) nucleoside; and Phosphodiamidate morpholino (PMO) nucleoside Selected from.

[0179] Other nucleosides useful in the present invention are known to those skilled in the art, such as other lipophilic 2'-O-alkylRNAs described in Non-Patent Document 22.

[0180] In one embodiment, the oligomeric compound comprises non-nucleosides, also known in the art as non-nucleoside linkers, non-nucleotide linkers, and non-nucleotidyl linkers, which are, for example, highly flexible substitutions of the sugar carbon of the ribofuranone moiety and can be used to substitute tc-DNA nucleosides and other nucleosides in the oligomeric compound of the present invention. An exemplary non-nucleotide is the 1,3-propanediol group shown in formula (15), which has been shown to bond two exemplary phosphorodiester nucleoside bonds.

[0181] TIFF0007912190000017.tif30128

[0182] The wavy lines in formula (15) represent the repeating nucleosides and internucleoside bond units of the additional oligomers described herein.

[0183] The non-nucleotides of the present invention may be used in conjunction with any of the nucleoside interbonds described herein, including embodiments, wherein the phosphorodiester nucleoside interbond shown in formula (15) is substituted with one or more phosphorothioate nucleoside interbonds.

[0184] In one embodiment, the non-nucleotide is a 1,3-propanediol group. The synthesis of 1,3-propanediol groups and their incorporation into oligomeric compounds are known in the art and are described, for example, in Non-Patent Document 23. In one embodiment, the oligomeric compound comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 1,3-propanediol groups linked by phosphorothioate nucleoside linkages, phosphorodiester nucleoside linkages, or a mixture thereof.

[0185] Alternative non-nucleosides may be used in conjunction with the oligomeric compounds of the present invention, such as ethylene glycol oligomers of various lengths (i.e., 1, 2, 3, or more ethylene glycol units that combine to form a single non-nucleoside). Several suitable ethylene glycol groups are described, for example, in Non-Patent Document 24. The synthesis and use of non-nucleosides are also described, for example, in Patent Document 80, the disclosure of which is incorporated herein by reference.

[0186] In some embodiments, the oligomer compound does not contain nucleosides other than the tc-DNA nucleoside.

[0187] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside.

[0188] In some embodiments, the oligomer compound comprises one or more tc-DNA nucleosides and one or more nucleosides other than tc-DNA nucleosides, wherein 50% or more of the total nucleosides are tc-DNA nucleosides.

[0189] In some embodiments, the oligomer compound comprises one or more tc-DNA nucleosides and one or more nucleosides other than tc-DNA nucleosides, wherein 60% or more of the total nucleosides are tc-DNA nucleosides.

[0190] In some embodiments, the oligomer compound comprises one or more tc-DNA nucleosides and one or more nucleosides other than tc-DNA nucleosides, wherein 70% or more of the total nucleosides are tc-DNA nucleosides.

[0191] In some embodiments, the oligomer compound comprises one or more tc-DNA nucleosides and one or more nucleosides other than tc-DNA nucleosides, wherein 75% or more of the total nucleosides are tc-DNA nucleosides.

[0192] In some embodiments, the oligomer compound comprises one or more tc-DNA nucleosides and one or more nucleosides other than tc-DNA nucleosides, wherein 80% or more of the total nucleosides are tc-DNA nucleosides.

[0193] In some embodiments, the oligomer compound comprises one or more tc-DNA nucleosides and one or more nucleosides other than tc-DNA nucleosides, wherein 85% or more of the total nucleosides are tc-DNA nucleosides.

[0194] In some embodiments, the oligomer compound comprises one or more tc-DNA nucleosides and one or more nucleosides other than tc-DNA nucleosides, wherein 90% or more of the total nucleosides are tc-DNA nucleosides.

[0195] In some embodiments, the oligomer compound comprises one or more tc-DNA nucleosides and one or more nucleosides other than tc-DNA nucleosides, wherein 95% or more of the total nucleosides are tc-DNA nucleosides.

[0196] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, and these one or more nucleosides other than the tc-DNA nucleoside are independent of each other. i. 2'-modified ribonucleic acid (2'-modified RNA) nucleoside; ii. Ribonucleic acid (RNA) nucleoside; iii. Deoxyribonucleic acid (DNA) nucleosides; iv. Locked nucleic acid (LNA) nucleosides; v. Peptide nucleic acid (PNA) nucleoside; vi. 2'-deoxy 2'-fluoroarabino nucleoside; vii. Hexitol nucleic acid (HNA) nucleosides; and viii. Phosphodiamidate morpholino (PMO) nucleoside Selected from.

[0197] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are independently 2'-modified ribonucleic acid (2'-modified RNA) nucleosides.

[0198] In some embodiments, the 2'-modified RNA nucleoside is incorporated at at least two adjacent positions that form a self-complementary Watson-Crick base pair.

[0199] In some embodiments, the 2'-modified RNA nucleoside is incorporated at three or more adjacent positions that form a self-complementary Watson-Crick base pair.

[0200] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are independently ribonucleic acid (RNA) nucleosides.

[0201] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are independently deoxyribonucleic acid (DNA) nucleosides.

[0202] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are independently locked nucleic acid (LNA) nucleosides.

[0203] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are, independently of each other, peptide nucleic acid (PNA) nucleosides.

[0204] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are independently 2'-deoxy2'-fluoroarabinonucleosides.

[0205] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are independently hexitol nucleic acid (HNA) nucleosides.

[0206] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are independently phosphorodiamidate morpholino (PMO) nucleosides.

[0207] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, and these one or more nucleosides other than the tc-DNA nucleoside are independent of each other. i. RNA nucleoside; ii. 2'-O-methyl-RNA nucleoside; iii. 2'-O-propargyl RNA nucleoside; iv. 2'-O-propylaminoRNA nucleoside; v. 2'-O-aminoRNA nucleoside; vi. 2'-FluoroRNA nucleoside; vii. 2'-O-methoxyethyl RNA nucleoside; viii. Morpholino nucleoside; and ix. Locked nucleic acid nucleosides Selected from.

[0208] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are, independently of each other, RNA nucleosides.

[0209] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are independently 2'-O-methylRNA nucleosides.

[0210] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are independently 2'-O-propargyl RNA nucleosides.

[0211] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are independently 2'-O-propylaminoRNA nucleosides.

[0212] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are independently 2'-O-aminoRNA nucleosides.

[0213] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are independently 2'-fluoroRNA nucleosides.

[0214] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are independently 2'-O-methoxyethyl RNA nucleosides.

[0215] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are independently morpholino nucleosides.

[0216] In some embodiments, the oligomer compound further comprises one or more nucleosides other than the tc-DNA nucleoside, wherein the one or more nucleosides other than the tc-DNA nucleoside are independently locked nucleic acid RNA nucleosides.

[0217] Nucleoside internucleoside bond In one embodiment, the internucleoside bonding group of the oligomer compound is independently selected from the group consisting of phosphorothioate bonds, phosphorodithioate bonds, phosphorodiester bonds, phosphate triester bonds, aminoalkyl phosphate triester bonds, methylphosphonate bonds, alkylphosphonate bonds, 5'-alkylenephosphonate bonds, phosphonate bonds, phosphine bonds, phosphoramidate bonds, 3'-aminophosphoramidate bonds, aminoalkylphosphoramidate bonds, thionophosphoramidate bonds, thionoalkylphosphonate bonds, thionoalkyl phosphate triester bonds, selenophosphate bonds, and boranophosphate bonds.

[0218] In some embodiments, the nucleoside bonds of the oligomer compound are independently selected from the group consisting of phosphorothioate bonds and phosphorodiester bonds. In one embodiment, the nucleoside bonds of the oligomer compound consist solely of phosphorodiester bonds.

[0219] An exemplary phosphorothioate bond is shown in formula (16).

[0220] TIFF0007912190000018.tif129139Base: Base

[0221] An exemplary phosphorodiester bond is shown in formula (17).

[0222] TIFF0007912190000019.tif129139Base: Base

[0223] The wavy lines in formulas (16) and (17) represent the repeating nucleosides and internucleoside bonds of the additional oligomers described herein.

[0224] General methods for preparing nucleoside bonds for use with oligomeric compounds are known in the art, including the methods described in Patent Documents 11, 30, 81-108, the disclosures of which are incorporated herein by reference. Phosphothioates may be prepared from phosphate triesters as part of a solid-phase synthesis using, for example, a 3' to 5' extension cycle of four reactions (detritylation, conjugation, sulfidation with PADS, capping, then deprotection, cleavage from support, and purification steps), using the chemical properties of phenylacetyl disulfide (PADS) as described in Non-Patent Document 25.

[0225] The term "phosphorus portion" as used in this specification refers to P III or P V This refers to the portion containing phosphorus atoms in their valence state, and is represented by formula (18).

[0226] TIFF0007912190000020.tif4569

[0227] In the above equation, W represents O, S, or Se, or W represents an electron pair; R3 and R4 are independently H, halogen, OH, OR5, NR6R7, SH, SR8, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, and C1-C6 aminoalkyl; R5 is independently cyano, nitro, halogen, -NHC(O)C1-C3 alkyl, -NHC(O)C1-C3 haloalkyl, C1-C9 alkyl, and C1-C6 alkoxy, each optionally substituted with C1-C3 alkylsulfonyl; independently cyano, nitro, halogen, C1-C4 alkoxy, C1-C4 haloalkyl, C1-C4 haloalkoxy, NHC(O)C1-C3 alkyl, NHC(O)C1-C3 haloalkyl, aryl, C1-C6 alkylenearyl, and C1-C6 alkylenediaryl, each optionally substituted with C1-C3 alkylsulfonyl; acetyl; hydroxyl R6 and R7 are protecting groups; R6 and R7 are independently hydrogen optionally substituted with cyano, nitro, halogen, C2-C6 alkenyl, C3-C6 cycloalkyl, C1-C3 alkoxy, C1-C9 alkyl; aryl optionally substituted with cyano, nitro, halogen, C1-C3 alkyl, C1-C3 alkoxy; amino protecting groups; or they form a heterocycle with the bonded nitrogen atom, preferably the heterocycle is selected from pyrrollidinyl, piperidinyl, morpholinyl, piperazinyl, and homopiperazine, and the heterocycle is optionally substituted with C1-C3 alkyl; and R8 is a thiol protecting group; and the dashed line indicates the bond of the OR2 group to oxygen in any one of formulas (1) to (14), or in a similar manner for nucleosides not explicitly specified in this specification. If W represents O, S, or Se, then the P atom in the phosphorus portion is P V It is in a valence state. When W represents an electron pair, the P atom in the phosphorus portion is P IIIIt is in valence. This part of formula (18) includes any possible stereoisomers. The part represented by formula (18) further includes salts thereof, which are usually and preferably salts formed by treatment with an inorganic base or amine, and which are usually and preferably salts resulting from the reaction with the OH or SH groups that are (independently of each other) R3 and R4. Preferred inorganic bases or amines that result in the formation of the salt together with the OH or SH groups are well known in the art and are usually and preferably trimethylamine, diethylamine, methylamine, or ammonium hydroxide. These phosphorus parts included in the present invention are, where appropriate, "O - HB + It is also abbreviated as ", and the aforementioned HB + This refers to the counter-cation that is formed.

[0228] As used herein, the term “phosphorus moiety” includes moieties derived from phosphonates, triestris phosphites, monophosphates, diphosphates, triphosphates, triestris phosphates, diphosphates, thiophosphates, dithiophosphates, or phosphoramidates, and is typically and preferably independently selected from these in each occurrence. Therefore, in one embodiment, the OR2 group in any one of formulas (1) to (14), or in a similar form for nucleosides not explicitly specified herein, is independently selected in each occurrence from phosphonates, triestris phosphites, monophosphates, diphosphates, triphosphates, triestris phosphates, diphosphates, thiophosphates, dithiophosphates, or phosphoramidates. Other phosphorus moieties usable in the present invention are disclosed in Tetrahedron Report Number 309 (Non-Patent Document 26), the disclosures of which are incorporated herein by reference.

[0229] As used herein, the term "phosphorus portion" is preferably defined in any one of formulas (1) to (14), or in a similar manner for nucleosides not explicitly represented in any of the formulas herein, P III or P VThis refers to the group R2 containing a phosphorus atom in its valence state, which is independently represented by one of the following equations in each occurrence: (19), (20), or (21).

[0230] TIFF0007912190000021.tif34155

[0231] In the above formula, Y is O, S, or Se, preferably O or S, and more preferably Y is O; and R5 and R5' are, in each appearance and independently of each other, hydrogen, C1-C9 alkyl, C1-C6 alkoxy, each independently optionally substituted with cyano, nitro, halogen, -NHC(O)C1-C3 alkyl, -NHC(O)C1-C3 haloalkyl, C1-C3 alkylsulfonyl; aryl, C1-C6 alkylenearyl, C1-C6 alkylenearyl, each independently optionally substituted with cyano, nitro, halogen, C1-C4 alkoxy, C1-C4 haloalkyl, C1-C4 haloalkoxy, -NHC(O)C1-C3 alkyl, NHC(O)C1-C3 haloalkyl, C1-C3 alkylsulfonyl R6 and R7 are independently cyano, nitro, halogen, C2-C6 alkenyl, C3-C6 cycloalkyl, C1-C3 alkoxy-substituted hydrogen, C1-C9 alkyl; cyano, nitro, halogen, C1-C3 alkyl, C1-C3 alkoxy-substituted aryl, preferably phenyl; amino protecting group; or form a heterocycle with the bonded nitrogen atom, preferably the heterocycle is selected from pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, and homopiperazine, and the heterocycle is optionally substituted with C1-C3 alkyl; and R8 is a thiol protecting group; and the dashed line indicates the bond of the OR2 group to oxygen in any one of formulas (1) to (5).

[0232] Advantageously, in certain embodiments, the oligomeric compound may include one or more, preferably several, tricyclodeoxyribonucleic acid (tc-DNA) nucleosides, and at least one modified ribonucleic acid nucleoside, and advantageously, only one modified ribonucleic acid nucleoside. The latter can be present at any location in the sequence of the oligomeric compound according to the present invention.

[0233] In particular, the oligomer compound according to the present invention has the following nucleotide sequence: - 5'-GGAGATgGCAGTTTC-3' (SEQ ID NO: 4 in the attached sequence listing), - 5'-GGAGATGgCAGTTTC-3' (SEQ ID NO: 5 in the attached sequence listing), - 5'-GGAGATGGcAGTTTC-3' (SEQ ID NO: 6 in the attached sequence listing), and - 5'-GGAGATGGCaGTTTC-3' (SEQ ID NO: 7 in the attached sequence listing) The sequence contains or consists of one of the above, where tc-DNA nucleotides are shown in uppercase and the previously defined modified ribonucleic acid nucleosides are shown in lowercase. This notation applies to all the following sequences.

[0234] In particular, the modified RNA nucleosides at positions +7, +8, +9, and +10 of the above sequence are 2'-modified RNA nucleosides, more specifically, 2'-O-methyl RNA nucleosides.

[0235] In this final option, if the oligomeric compound consists of nucleotide sequences corresponding to sequences SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7, the compound is designed as REGONE.7, REGONE.8, REGONE.9, or REGONE.10, respectively.

[0236] Advantageously, in some embodiments, the 15 monomer subunits of the nucleotide sequence corresponding to sequence SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7 in the attached sequence listing are linked by phosphate diester (PO) bonds.

[0237] In some embodiments, the oligomeric compound comprises at least one nucleotide sequence having at least 70%, at least 73%, at least 75%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, or at least 99% identity with SEQ ID NO:4. In some embodiments, the oligomeric compound comprises at least one nucleotide sequence that is identical to SEQ ID NO:4.

[0238] In some embodiments, the oligomeric compound comprises at least one nucleotide sequence having at least 70%, at least 73%, at least 75%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, or at least 99% identity with SEQ ID NO:5. In some embodiments, the oligomeric compound comprises at least one nucleotide sequence that is identical to SEQ ID NO:5.

[0239] In some embodiments, the oligomeric compound comprises at least one nucleotide sequence having at least 70%, at least 73%, at least 75%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, or at least 99% identity with SEQ ID NO:6. In some embodiments, the oligomeric compound comprises at least one nucleotide sequence that is identical to SEQ ID NO:6.

[0240] In some embodiments, the oligomer compound comprises at least one nucleotide sequence having at least 70%, at least 73%, at least 75%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, or at least 99% identity with SEQ ID NO:7. In some embodiments, the oligomer compound comprises at least one nucleotide sequence that is identical to SEQ ID NO:7.

[0241] In certain embodiments, the oligomeric compound according to the present invention can be combined with one or more lipid moieties. In other words, one or more lipid moieties can be covalently bonded to the oligomeric compound directly or indirectly, i.e., via spacers.

[0242] In some embodiments, the oligomeric compound according to the present invention can be combined with one or more lipid moieties, preferably just one lipid moiety, the one or more lipid moieties being covalently bonded to the oligomeric compound directly or via spacers.

[0243] Any lipid portion can be realized with this invention.

[0244] In one embodiment, the one or more lipid portions are independently selected from a fatty acid portion, a fatty acid portion, a glycerolipid portion, a glycerophospholipid portion, a sphingolipid portion, a phospholipid, an alkyl phosphate portion, and an alkylphosphonate portion.

[0245] In one embodiment, the one or more lipid moieties are independently selected from a fatty acid moiety, a fatty acid moiety, a phospholipid, an alkyl phosphate moiety, and an alkyl phosphonate moiety.

[0246] In one preferred embodiment, the one or more lipid portions are independently fatty acid portions. In some embodiments, the one or more lipid portions are independently fatty acid portions. In another embodiment, the one or more lipid portions are independently glycerolipid portions. In another embodiment, the one or more lipid portions are independently glycerophospholipid portions. In another embodiment, the one or more lipid portions are independently sphingolipid portions. In some embodiments, the one or more lipid portions are independently alkylphosphate portions. In some embodiments, the one or more lipid portions are independently alkylphosphonate portions.

[0247] In one embodiment, one or more lipid portions are negatively charged at pH 7.4, and this pH 7.4 typically corresponds to the physiological pH.

[0248] In some embodiments, the one or more lipid moieties are independently selected from a fatty acid moiety, a fatty acid moiety, an alkyl phosphate moiety, and an alkyl phosphonate moiety.

[0249] In some embodiments, the one or more lipid portions are independently fatty acid portions or fatty acid portions.

[0250] In some embodiments, the one or more lipid portions are independently fatty acid portions, and the fatty acid portions are saturated fatty acid portions. In some embodiments, the one or more lipid portions are independently fatty acid portions, and the fatty acid portions are unsaturated fatty acid portions.

[0251] In some embodiments, the one or more lipid portions are independently fatty acid portions, and the fatty acid portions are saturated fatty acid portions. In some embodiments, the one or more lipid portions are independently fatty acid portions, and the fatty acid portion is an unsaturated fatty acid portion.

[0252] In a very preferred embodiment, the one or more lipid portions are independently fatty acid portions, and the fatty acid portions are saturated unbranched fatty acid portions.

[0253] In some embodiments, the one or more lipid portions are independently fatty acid portions, and the fatty acid portions are derived from saturated unbranched fatty acids. In some embodiments, the one or more lipid portions are independently fatty acid portions, and the fatty acid portions are derived from saturated unbranched fatty acids.

[0254] In a very preferred embodiment, the one or more lipid portions are independently a fatty acid portion or a fatty acid portion, the fatty acid portion is a saturated unbranched fatty acid portion, and the fatty acid portion is a saturated unbranched fatty acid portion.

[0255] In some embodiments, the one or more lipid portions are independently of each other, portions of formula (I). AB-* (I) In the above equation, A is C 3-32 Alkyl, C 3-32 Alkenil, C 3-32 Alkinyl, HOOC-C 3-32 Alkilen, HOOC-C 3-32 Alkenylene, or HOOC-C 3-32 The b is an alkynylene, where B is C(O), OP(OH), OP(O)(OH), OP(O)(SH), NH-C(O), NH-P(O)(OH), NH-P(O)(SH), or a pharmaceutically acceptable salt thereof; and the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer.

[0256] In a more preferred embodiment, the one or more lipid moieties are independently selected from any one of formulas (a) to (u). a. C 3-32 Alkyl-C(O)-*, b. C 3-32Alkenyl-C(O)-*, c. C 3-32 Alkynyl-C(O)-*, d. C 3-32 Alkyl-OP(OH)-*, e. C 3-32 Alkenyl-OP(OH)-*, f. C 3-32 Alkynyl-OP(OH)-*, g. C 3-32 Alkyl-OP(O)(OH)-*, h. C 3-32 Alkenyl-OP(O)(OH)-*, i. C 3-32 Alkynyl-OP(O)(OH)-*, j. C 3-32 Alkyl-OP(O)(SH)-*, k. C 3-32 Alkenyl-OP(O)(SH)-*, l. C 3-32 Alkynyl-OP(O)(SH)-*, m. C 3-32 Alkyl-NH-C(O)-*, n. C 3-32 Alkenyl-NH-C(O)-*, o. C 3-32 Alkynyl-NH-C(O)-*, p. C 3-32 Alkyl-NH-P(O)(OH)-*, q. C 3-32 Alkenyl-NH-P(O)(OH)-*, r. C 3-32 Alkynyl-NH-P(O)(OH)-*, s. HOOC-C 3-32 Alkylene-C(O)-*, t. HOOC-C 3-32 Alkenylene-C(O)-*, and u. HOOC-C 3-32 Alkynylene-C(O)-*, The asterisk (*) represents said covalent bonding site with said oligomer compound or said spacer.

[0257] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32 The alkyl-C(O)-* portion is the alkyl-C(O)-* part, where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, and preferably the composition contains only one lipid portion.

[0258] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32 The alkenyl-C(O)-* portion is the part where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, and preferably the composition contains only one lipid portion.

[0259] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32 The alkynyl-C(O)-* portion is the alkynyl-C(O)-* portion, where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, and preferably the composition contains only one lipid portion.

[0260] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32 The alkyl-OP(OH)-* portion is the alkyl-OP(OH)-* portion, where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, and preferably the composition contains only one lipid portion.

[0261] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32 The alkenyl-OP(OH)-* portion is the part where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, and preferably the composition contains only one lipid portion.

[0262] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32which is an alkynyl-OP(OH)-* moiety, wherein the asterisk (*) represents the covalent bonding site to said oligomeric compound or said spacer, and preferably, said composition comprises only one lipid moiety.

[0263] In some embodiments, said one or more lipid moieties are each independently of formula C 3-32 which is an alkyl-OP(O)(OH)-* moiety, wherein the asterisk (*) represents the covalent bonding site to said oligomeric compound or said spacer, and preferably, said composition comprises only one lipid moiety.

[0264] In some embodiments, said one or more lipid moieties are each independently of formula C 3-32 which is an alkenyl-OP(O)(OH)-* moiety, wherein the asterisk (*) represents the covalent bonding site to said oligomeric compound or said spacer, and preferably, said composition comprises only one lipid moiety.

[0265] In some embodiments, said one or more lipid moieties are each independently of formula C 3-32 which is an alkynyl-OP(O)(OH)-* moiety, wherein the asterisk (*) represents the covalent bonding site to said oligomeric compound or said spacer, and preferably, said composition comprises only one lipid moiety.

[0266] In some embodiments, said one or more lipid moieties are each independently of formula C 3-32 which is an alkyl-OP(O)(SH)-* moiety, wherein the asterisk (*) represents the covalent bonding site to said oligomeric compound or said spacer, and preferably, said composition comprises only one lipid moiety.

[0267] In some embodiments, said one or more lipid moieties are each independently of formula C 3-32The alkenyl-OP(O)(SH)-* portion is the part where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, and preferably the composition contains only one lipid portion.

[0268] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32 The alkynyl-OP(O)(SH)-* portion is the alkynyl-OP(O)(SH)-* portion, where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, and preferably the composition contains only one lipid portion.

[0269] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32 The alkyl-NH-C(O)-* portion is the alkyl-NH-C(O)-* portion, where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, and preferably the composition contains only one lipid portion.

[0270] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32 The alkenyl-NH-C(O)-* portion is the part where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, and preferably the composition contains only one lipid portion.

[0271] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32 The alkynyl-NH-C(O)-* portion is the alkynyl-NH-C(O)-* portion, where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, and preferably the composition contains only one lipid portion.

[0272] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32The alkyl-NH-P(O)(OH)-* portion is the alkyl-NH-P(O)(OH)-* portion, where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, and preferably the composition contains only one lipid portion.

[0273] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32 The alkenyl-NH-P(O)(OH)-* portion is the part where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, and preferably the composition contains only one lipid portion.

[0274] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32 The alkynyl-NH-P(O)(OH)-* portion is the alkynyl-NH-P(O)(OH)-* portion, where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, and preferably the composition contains only one lipid portion.

[0275] In some embodiments, the one or more lipid moieties are independently of each other, and the formula is HOOC-C 3-32 The alkylene-C(O)-* portion is the alkylene-C(O)-* portion, where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, and preferably the composition contains only one lipid portion.

[0276] In some embodiments, the one or more lipid moieties are independently of each other, and the formula is HOOC-C 3-32 The alkenylene-C(O)-* portion is the part where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, and preferably the composition contains only one lipid portion.

[0277] In some embodiments, the one or more lipid moieties are independently of each other, and the formula is HOOC-C 3-32The alkynylene-C(O)-* portion is the alkynylene-C(O)-* portion, where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, and preferably the composition contains only one lipid portion.

[0278] In some embodiments, the one or more lipid portions are independently any one of the portions of formulas (a) to (d). a. C 3-32 Alkyl-C(O)-*, b. HOOC-C 3-32 Alkylene-C(O)-*, c. C 3-32 alkyl-OP(O)(OH)-*, d. C 3-32 Alkyl-OP(O)(SH)-*, In the above formula, the asterisk (*) represents the covalent bond point with the oligomer compound or the spacer, preferably the C 3-32 Alkyl is unbranched C 3-32 It is alkyl, and more preferably the C 3-32 Alkyls are unbranched carbon atoms with an odd number of carbon atoms. 3-32 It is alkyl, preferably the C 3-32 Alkilen is unbranched C 3-32 It is an alkylene, and more preferably the C 3-32 Alkylenes are unbranched carbon atoms with an odd number of carbon atoms. 3-32 It is alkylene.

[0279] In a more preferred embodiment, the one or more lipid portions are independent of each other, and the formula C 3-32 The alkyl-C(O)-* portion is where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, preferably the C 3-32 Alkyl is unbranched C 3-32 It is alkyl, and more preferably the C 3-32 Alkyls are unbranched carbon atoms with an odd number of carbon atoms. 3-32 It is alkyl.

[0280] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32 The alkyl-C(O)-* portion, where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, preferably the composition comprises only one lipid portion, and the C 3-32 Alkyl is unbranched C 3-32 It is alkyl.

[0281] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32 The alkyl-C(O)-* portion, where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, preferably the composition comprises only one lipid portion, and the C 3-32 Alkyls are unbranched carbon atoms with an odd number of carbon atoms. 3-32 It is alkyl.

[0282] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32 The alkenyl-C(O)-* portion is where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, preferably the C 3-32 Alkenil is branched C 3-32 It is an alkenyl, and more preferably the C 3-32 Alkenyls are branched carbon atoms with an odd number of carbon atoms. 3-32 It is Alkenil.

[0283] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32 The alkenyl-C(O)-* portion, where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, preferably the composition comprises only one lipid portion, and the C 3-32 Alkenil is branched C 3-32 It is Alkenil.

[0284] In some embodiments, the one or more lipid moieties are independent of each other, and the formula C 3-32 The alkenyl-C(O)-* portion, where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, preferably the composition comprises only one lipid portion, and the C 3-32 Alkenyls are branched carbon atoms with an odd number of carbon atoms. 3-32 It is Alkenil.

[0285] In some embodiments, the one or more lipid moieties are, independently of each other, saturated C 8-26 This is the fatty acid portion, preferably the saturated C 8-26 The fatty acid portion is derived from caprylic acid (C8), capric acid (C10), lauric acid (C12), myristic acid (C14), palmitic acid (C16), stearic acid (C18), arachidic acid (C20), lignoceric acid (C22), or cerotic acid (C24).

[0286] In some embodiments, the one or more lipid portions are independently saturated fatty acid portions, which are derived from caprylic acid (C8), capric acid (C10), lauric acid (C12), myristic acid (C14), palmitic acid (C16), stearic acid (C18), arachidic acid (C20), lignoceric acid (C22), and cerotic acid (C24).

[0287] In some embodiments, the one or more lipid portions are saturated fatty acid portions derived from palmitic acid (C16) or stearic acid (C18), and preferably, the one or more lipid portions are saturated fatty acid portions derived from palmitic acid (C16).

[0288] In some embodiments, the one or more lipid moieties are independently unsaturated C 14-22 This is the fatty acid portion, preferably the unsaturated C 14-22The fatty acid moieties are derived from myristoleic acid, palmitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, linoleic acid, linoleidic acid, alpha-linolenic acid, arachidonic acid, eicosapentaenoic acid, erucic acid, and docosahexaenoic acid. In some embodiments, one or more of the lipid moieties are saturated fatty acid moieties derived from palmitoleic acid.

[0289] In some embodiments, the one or more lipid portions are independently unsaturated fatty acid portions, which are derived from myristoleic acid, palmitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, linoleic acid, linoleidic acid, alpha-linolenic acid, arachidonic acid, eicosapentaenoic acid, erucic acid, and docosahexaenoic acid.

[0290] In some embodiments, the one or more lipid portions are unsaturated fatty acid portions derived from oleic acid.

[0291] In some embodiments, the one or more lipid moieties are independently of each other, formula (HOOC)-C 3-32 This is the alkylene-C(O)-* portion, where the asterisk (*) represents the covalent bond site with the oligomer compound or the spacer, preferably the C 3-32 Alkilen is unbranched C 3-32 It is an alkylene, and more preferably the C 3-32 Alkylenes are unbranched carbon atoms with an odd number of carbon atoms. 3-32 It is alkylene.

[0292] In some embodiments, the one or more lipid moieties are independently of each other, according to the formula (HOOC)-(CH2) r -(CH)(C 5-25 Alkyl)-(CH2) t The -C(O)-* portion is where the asterisk (*) represents the covalent bond point with the oligomer compound or the spacer, r is an integer between 1 and 3, and t is an integer between 1 and 3, independent of each other.

[0293] In some embodiments, the one or more lipid moieties are independently of each other, according to the formula (HOOC)-(CH2) r -(CH)[(CH2) s CH3]-(CH2) t -C(O)-* represents the portion where the asterisk (*) represents the covalent bond point with the oligomer compound or the spacer, r is an integer between 1 and 3, s is an integer between 4 and 24, and t is an integer between 1 and 3, independent of each other.

[0294] In some embodiments, the one or more lipid moieties are independently of each other, according to the formula (HOOC)-(CH2) r -(CH)[(CH2) s CH3]-(CH2) t -C(O)-* represents the portion where the asterisk (*) represents the covalent bond point with the oligomer compound or the spacer, r is an integer of 1 or 2 independently of each other, s is an integer of 5 to 19 independently of each other, and t is an integer of 1 or 2 independently of each other.

[0295] In some embodiments, the one or more lipid moieties are independently of each other, according to the formula (HOOC)-(CH2) r -(CH)[(CH2) s CH3]-(CH2) t The -C(O)-* portion is where the asterisk (*) represents the covalent bond point with the oligomer compound or the spacer, r is 1, s is an integer between 4 and 24, preferably between 5 and 19, and t is 1.

[0296] In some embodiments, the one or more lipid moieties are independently of each other, according to the formula (HOOC)-(CH2) r -(CH)[(CH2) s CH3]-(CH2) tThe -C(O)-* portion is where the asterisk (*) represents the covalent bond point with the oligomer compound or the spacer, r is 1, s is an integer from 5 to 19, preferably from 11 to 17, and t is 1.

[0297] In some embodiments, the one or more lipid moieties are independently of each other, according to the formula (HOOC)-(CH2) r -(CH)[(CH2) s CH3]-(CH2) t This is the -C(O)-* portion, where the asterisk (*) represents the covalent bond point with the oligomer compound or the spacer, r is 1, s is 15, and t is 1.

[0298] Therefore, in some embodiments, the one or more lipid portions are 3-pentadecyl glutaric acid (PDG).

[0299] In some embodiments, the lipid portion is directly bound to the oligomer compound.

[0300] In some embodiments, the one or more lipid portions are bonded to the oligomer compound via spacers.

[0301] In one embodiment, the spacer has 5 to 30 carbon atoms, preferably 5 to 25 carbon atoms, more preferably 5 to 20 carbon atoms, or most preferably 5 to 17 carbon atoms. In an additional embodiment, the spacer has 4 to 20 heteroatoms, preferably 4 to 18 heteroatoms, more preferably 4 to 14 heteroatoms, or most preferably 4 to 12 heteroatoms. Particularly preferred examples of heteroatoms are nitrogen atoms and oxygen atoms. Hydrogen atoms are not heteroatoms.

[0302] In some embodiments, the spacer includes any one of the following formulas, preferably selected independently from any one of the following formulas. #-NH-C 2-12Alkylene-§, #-NH-C 2-12 Alkylene-OP(OH)-§, #-NH-C 2-12 Alkilen-OP(O)(SH)-§, #-NH-C 2-12 Alkylene-OP(O)(OH)-§, #-SH-C 2-12 Alkylene-§, #-NH-C 2-12 Alkylene-NH-C(O)-§, #-NH-C 2-12 Alkylene-NH-P(O)(OH)-§, and #-NH-C 2-12 Alkylene-NH-P(O)(SH)-§, In the above equation, C 2-12 One or more -CH2- portions of the alkylene can optionally be -O-, -S-, -NH-, -C(O)-, -C(O)O-, aryl, heteroaryl, cycloalkyl, heterocycloalkyl, -OP(OH)O-, OP(O)(SH)O-, OP(O)(OH)O-, NHP(O)(OH)O-, NHP(O)(SH)O-, or -(O-CH2-CH2) k -(k is an integer from 1 to 8) is independently substituted, and the above C 2-12 One or more -CH2- portions of the alkylene are independently and optionally substituted with one or more -COOH, -NH2, -OP(O)(OH)2, or -OH (therefore, the C 2-12 (meaning that one or both, preferably one, of the hydrogen atoms of one or more -CH2- moieties of the alkylene are optionally substituted independently of each other with one or more -COOH, -NH2, -OP(O)(OH)2, or -OH), where (#) represents a covalent bond with the lipid moiety and (§) represents a covalent bond with the oligomer compound.

[0303] In a very preferred embodiment, the spacer includes any one of the following formulas, preferably selected independently from any one of the following formulas. a. #-NH-C2-12 Alkylene-§, b. #-NH-C 2-12 Alkylene-OP(OH)-§, c. #-NH-C 2-12 Alkilen-OP(O)(SH)-§, d. #-NH-C 2-12 Alkylene-OP(O)(OH)-§, e. #-NH-C 2-12 Alkylene-NH-C(O)-§, f. #-NH-C 2-12 Alkylene-NH-P(O)(OH)-§, and g. #-NH-C 2-12 Alkylene-NH-P(O)(SH)-§, In the above formula, (#) represents a covalent bond with the lipid portion, and (§) represents a covalent bond with the oligomer compound.

[0304] In a very preferred embodiment, the spacer includes any one of the following formulas, preferably selected independently from any one of the following formulas. a. #-NH-C 2-12 Alkylene-§, b. #-NH-C 2-12 Alkylene-OP(OH)-§, c. #-NH-C 2-12 Alkilen-OP(O)(SH)-§, d. #-NH-C 2-12 Alkylene-OP(O)(OH)-§, e. #-NH-C 2-12 Alkylene-NH-C(O)-§, f. #-NH-C 2-12 Alkylene-NH-P(O)(OH)-§, and g. #-NH-C 2-12 Alkylene-NH-P(O)(SH)-§, In the above equation, C 2-12One or more -CH2- portions of the alkylene can optionally be -O-, -S-, -NH-, -C(O)-, -C(O)O-, aryl, heteroaryl, cycloalkyl, heterocycloalkyl, -OP(OH)O-, OP(O)(SH)O-, OP(O)(OH)O-, NHP(O)(OH)O-, NHP(O)(SH)O-, or -(O-CH2-CH2) k -(k is an integer from 1 to 8) is independently substituted, where (#) represents a covalent bond with the lipid portion and (§) represents a covalent bond with the oligomer compound.

[0305] In a very preferred embodiment, the spacer includes any one of the following formulas, preferably selected independently from any one of the following formulas. a. #-NH-C 2-12 Alkylene-§, b. #-NH-C 2-12 Alkylene-OP(OH)-§, c. #-NH-C 2-12 Alkilen-OP(O)(SH)-§, d. #-NH-C 2-12 Alkylene-OP(O)(OH)-§, e. #-NH-C 2-12 Alkylene-NH-C(O)-§, f. #-NH-C 2-12 Alkylene-NH-P(O)(OH)-§, and g. #-NH-C 2-12 Alkylene-NH-P(O)(SH)-§, In the above equation, C 2-12 One or more -CH2- portions of the alkylene can optionally be -O-, -S-, -NH-, -C(O)-, -C(O)O-, aryl, heteroaryl, cycloalkyl, heterocycloalkyl, -OP(OH)O-, OP(O)(SH)O-, OP(O)(OH)O-, NHP(O)(OH)O-, NHP(O)(SH)O-, or -(O-CH2-CH2) k -(k is an integer from 1 to 8) is independently substituted, and the above C 2-12One or more -CH2- portions of the alkylene are independently and optionally substituted with one or more -COOH, -NH2, -OP(O)(OH)2, or -OH groups, wherein (#) represents a covalent bond with the lipid portion, and (§) represents a covalent bond with the oligomer compound.

[0306] In a very preferred embodiment, the spacer includes any one of the following formulas, preferably selected independently from any one of the following formulas. a. #-NH-C 2-12 Alkylene-§, b. #-NH-C 2-12 Alkylene-OP(OH)-§, c. #-NH-C 2-12 Alkilen-OP(O)(SH)-§, d. #-NH-C 2-12 Alkylene-OP(O)(OH)-§, e. #-NH-C 2-12 Alkylene-NH-C(O)-§, f. #-NH-C 2-12 Alkylene-NH-P(O)(OH)-§, and g. #-NH-C 2-12 Alkylene-NH-P(O)(SH)-§, In the above equation, C 2-12 One or more -CH2- portions of the alkylene may optionally be -O-, -S-, -NH-, -C(O)-, -C(O)O-, phenyl, triazolyl, cyclopentyl, cyclohexyl, succinimidyl, -OP(OH)O-, OP(O)(SH)O-, OP(O)(OH)O-, NHP(O)(OH)O-, NHP(O)(SH)O-, or -(O-CH2-CH2) k -(k is an integer from 1 to 8) is independently substituted, and the above C 2-12 One or more -CH2- portions of the alkylene are independently and optionally substituted with one or more -COOH, -NH2, -OP(O)(OH)2, or -OH groups, wherein (#) represents a covalent bond with the lipid portion, and (§) represents a covalent bond with the oligomer compound.

[0307] In some embodiments, the spacer includes any one of the following formulas, preferably selected independently from any one of the following formulas. a. -NH-(CH2) m -, b. -NH-(CH2) m -X-, c. -NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -, d. -NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -X-, e. -NH-CH(COOH)-(CH2) q -, f. -NH-CH(COOH)-(CH2) q -X-, g. -NH-CH(COOH)-(CH2) q -C(O)-NH-(CH2) m -, h. -NH-CH(COOH)-(CH2) q -C(O)-NH-(CH2) m -X-, i. -NH-CH(COOH)-(CH2) q -C(O)-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -X-, j. -NH-CH(COOH)-(CH2) q -C(O)-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-NH-(CH2) n -(O-CH2-CH2) r -X-, In the above equation, X is mutually independent of OP(OH), OP(O)(SH), or OP(O)(OH), k is mutually independent of an integer between 1 and 8, m is mutually independent of an integer between 2 and 12, n is mutually independent of an integer between 2 and 4, p is mutually independent of an integer between 1 and 5, q is mutually independent of an integer between 1 and 3, preferably 1 or 2, and r is mutually independent of an integer between 1 and 3, preferably 1 or 2.

[0308] In some embodiments, the spacer includes any one of the following formulas, preferably selected independently from any one of the following formulas. a. #-NH-(CH2) m -§, b. #-NH-(CH2) m -X-§, c. #-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -§, d. #-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -X-§, e. #-NH-CH(COOH)-(CH2) q -§, f. #-NH-CH(COOH)-(CH2) q -X-§, g. #-NH-CH(COOH)-(CH2) q -C(O)-NH-(CH2) m -§, h. #-NH-CH(COOH)-(CH2) q -C(O)-NH-(CH2) m -X-§, i. #-NH-CH(COOH)-(CH2) q -C(O)-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -X-§, j. #-NH-CH(COOH)-(CH2) q-C(O)-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-NH-(CH2) n -(O-CH2-CH2) r -X-§, In the above formula, X is independently OP(OH), OP(OH)(S), or OP(O)(OH), k is independently an integer from 1 to 8, m is independently an integer from 2 to 12, n is independently an integer from 2 to 4, p is independently an integer from 1 to 5, q is independently an integer from 1 to 3, preferably 1 or 2, r is independently an integer from 1 to 3, preferably 1 or 2, (#) represents a covalent bond with the lipid portion, and (§) represents a covalent bond with the oligomer compound.

[0309] In some embodiments, the spacer includes any one of the following formulas, preferably selected independently from any one of the following formulas. a. -Z-NH-(CH2) m -X- b. -Z-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -X- c. -Z[-NH-(CH2)] n -(O-CH2-CH2) k -O-(CH2) p -C(O)-]-NH-(CH2) q -X- d. -Z[-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-] r -NH-(CH2) q -(O-CH2-CH2) k -X- In the above formula, -Z- independently represents a combination, or -NH-CH(COOH)-(CH2)2-C(O)-, or -NH-CH[(CH2)2COOH]-C(O)-, X independently represents OP(OH), OP(O)(SH), OP(O)(OH), NHP(O)(OH), NHP(O)(SH), or NH-C(O), k independently is an integer from 1 to 8, m independently is an integer from 2 to 12, n independently is an integer from 2 to 4, p independently is an integer from 1 to 5, q independently is an integer from 1 to 6, preferably 3 or 6, and r independently is an integer from 1 to 3, preferably 1 or 2.

[0310] In some embodiments, the spacer includes any one of the following formulas, preferably selected independently from any one of the following formulas. a. #-Z-NH-(CH2) m -X-§ b. #-Z-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -X-§ c. #-Z[-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-]-NH-(CH2) q -X-§ d. #-Z[-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-] r -NH-(CH2) q -(O-CH2-CH2) k -X-§ In the above formula, -Z- independently represents a bond, or -NH-CH(COOH)-(CH2)2-C(O)-, or -NH-CH[(CH2)2COOH]-C(O)-, X independently represents OP(OH), OP(O)(SH), OP(O)(OH), NHP(O)(OH), NHP(O)(SH), or NH-C(O), k independently is an integer from 1 to 8, m independently is an integer from 2 to 12, n independently is an integer from 2 to 4, p independently is an integer from 1 to 5, q independently is an integer from 1 to 6, preferably 3 or 6, and r independently is an integer from 1 to 3, preferably 1 or 2, the (#) represents a covalent bond with the lipid portion, and the (§) represents a covalent bond with the oligomer compound.

[0311] In some embodiments, the spacer includes any one of the following formulas, preferably selected independently from any one of the following formulas. a. #-Z-NH-(CH2) m -X-§ b. #-Z-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -X-§ c. #-Z[-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-]-NH-(CH2) q -X-§ d. #-Z[-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-] r -NH-(CH2) q -(O-CH2-CH2) k -X-§ In the above formula, -Z- independently represents a bond, or -NH-CH(COOH)-(CH2)2-C(O)-, or -NH-CH[(CH2)2COOH]-C(O)-, X independently represents OP(OH), OP(O)(SH), OP(O)(OH), NHP(O)(OH), NHP(O)(SH), or NH-C(O), k independently is an integer of 1 or 2, m independently is an integer from 4 to 8, n independently is an integer from 2 to 4, p independently is an integer of 1 or 2, q independently is an integer from 1 to 6, and r independently is an integer from 1 to 3, preferably 1 or 2, the (#) represents a covalent bond with the lipid portion, and the (§) represents a covalent bond with the oligomer compound.

[0312] In some embodiments, the spacer includes any one of the following formulas, preferably selected independently from any one of the following formulas. a. #-Z-NH-(CH2) m -X-§ b. #-Z-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -X-§ c. #-Z[-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-]-NH-(CH2) q -X-§ d. #-Z[-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-] r -NH-(CH2) q -(O-CH2-CH2) k -X-§ In the above formula, -Z- independently represents a bond, or -NH-CH(COOH)-(CH2)2-C(O)-, or -NH-CH[(CH2)2COOH]-C(O)-, X independently represents OP(OH), OP(O)(SH), or OP(O)(OH), k independently is an integer of 1 or 2, m independently is an integer from 4 to 8, n is 2, p is 1, q independently is an integer from 1 to 6, r independently is an integer from 1 to 3, preferably 1 or 2, (#) represents a covalent bond with the lipid portion, and (§) represents a covalent bond with the oligomer compound.

[0313] In some embodiments, the spacer includes any one of the following formulas, preferably selected independently from any one of the following formulas. a. #-Z-NH-(CH2) m -X-§ b. #-Z-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -X-§ c. #-Z[-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-]-NH-(CH2) q -X-§ d. #-Z[-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-] r -NH-(CH2) q -(O-CH2-CH2) k -X-§ In the above formula, -Z- independently represents a bond, or -NH-CH(COOH)-(CH2)2-C(O)-, or -NH-CH[(CH2)2COOH]-C(O)-, X independently represents OP(O)(SH) or OP(O)(OH), k independently represents an integer of 1 or 2, m independently represents an integer from 4 to 8, n is 2, p is 1, q independently represents an integer from 1 to 6, r independently represents an integer from 1 to 3, preferably 1 or 2, (#) represents a covalent bond with the lipid portion, and (§) represents a covalent bond with the oligomer compound.

[0314] In some embodiments, the spacer includes any one of the following formulas, preferably selected independently from any one of the following formulas. a. #-Z-NH-(CH2) m -X-§ b. #-Z-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -X-§ c. #-Z[-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-]-NH-(CH2) q -X-§ d. #-Z[-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-] r -NH-(CH2) q -(O-CH2-CH2) k -X-§ In the above formula, -Z- independently represents a bond, or -NH-CH(COOH)-(CH2)2-C(O)-, or -NH-CH[(CH2)2COOH]-C(O)-, X independently represents OP(O)(SH), k independently represents an integer of 1 or 2, m independently represents an integer from 4 to 8, n is 2, p is 1, q independently represents an integer from 1 to 6, r independently represents an integer from 1 to 3, preferably 1 or 2, (#) represents a covalent bond with the lipid portion, and (§) represents a covalent bond with the oligomer compound.

[0315] In some embodiments, the spacer includes any one of the following formulas, preferably selected independently from any one of the following formulas. a. #-Z-NH-(CH2) m -X-§ b. #-Z-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -X-§ c. #-Z[-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-]-NH-(CH2) q -X-§ d. #-Z[-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-] r -NH-(CH2) q -(O-CH2-CH2) k -X-§ In the above formula, -Z- independently represents a bond, or -NH-CH(COOH)-(CH2)2-C(O)-, or -NH-CH[(CH2)2COOH]-C(O)-, X independently represents OP(O)(OH), k independently is an integer of 1 or 2, m independently is an integer from 4 to 8, n is 2, p is 1, q independently is an integer from 1 to 6, r independently is an integer from 1 to 3, preferably 1 or 2, (#) represents a covalent bond with the lipid portion, and (§) represents a covalent bond with the oligomer compound.

[0316] In some embodiments, the spacer includes any one of the following formulas, preferably selected independently from any one of the following formulas. a. #-Z-NH-(CH2) m -X-§ b. #-Z-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -X-§ c. #-Z[-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-]-NH-(CH2) q -X-§ d. #-Z[-NH-(CH2) n -(O-CH2-CH2) k -O-(CH2) p -C(O)-] r -NH-(CH2) q -(O-CH2-CH2) k -X-§ In the above formula, -Z- independently represents a bond, or -NH-CH(COOH)-(CH2)2-C(O)-, or -NH-CH[(CH2)2COOH]-C(O)-, X independently represents OP(O)(SH) or OP(O)(OH), k is 1, m is 6, n is 2, p is 1, q independently is an integer from 1 to 6, r independently is an integer from 1 to 3, preferably 1 or 2, (#) represents a covalent bond with the lipid portion, and (§) represents a covalent bond with the oligomer compound.

[0317] In some embodiments, the spacer is #-Z-NH-(CH2) m The compound comprises -X-§, preferably -Z-, where -Z- represents a bond, X is independently OP(O)(SH) or OP(O)(OH), m is 6, (#) represents a covalent bond with the lipid portion, and (§) represents a covalent bond with the oligomer compound.

[0318] In some embodiments, the spacer is #-Z-NH-(CH2) m The compound comprises -X-§, preferably -Z-, where -Z- represents a bond, X is OP(O)(OH), m is 6, (#) represents a covalent bond with the lipid portion, and (§) represents a covalent bond with the oligomer compound.

[0319] In some embodiments, the spacer is #-Z-NH-(CH2) m The compound includes, preferably, -X-§, where -Z- represents a bond, X is OP(O)(SH), m is 6, (#) represents a covalent bond with the lipid portion, and (§) represents a covalent bond with the oligomer compound.

[0320] In some embodiments, the one or more lipid moieties are covalently bonded to the oligomer compound, either directly or via a spacer, usually and preferably, through -OP(O)(SH)- or -OP(O)(OH)- moieties contained in the one or more lipid moieties or the spacer, wherein the -OP(O)(SH)- or -OP(O)(OH)- moieties are bonded to the 5'-terminal OH group or the 3'-terminal OH group of the oligomer compound.

[0321] In some embodiments, the one or more lipid moieties are independently bonded to the oligomer compound at (i) terminal residues of the oligomer compound, (ii) the 5' end of the oligomer compound, (iii) the 3' end of the oligomer compound, and (iv) internal residues of the oligomer compound.

[0322] In some embodiments, one or more lipid moieties, preferably just one lipid moiety, are independently bound to the oligomer compound at terminal residues of the oligomer compound.

[0323] In some embodiments, one or more lipid moieties, preferably just one lipid moiety, are independently bonded to the oligomer compound at the 5' end of the oligomer compound.

[0324] In some embodiments, one or more lipid moieties, preferably just one lipid moiety, are independently bonded to the oligomer compound at the 3' end of the oligomer compound.

[0325] In some embodiments, one or more lipid moieties, preferably just one lipid moiety, are independently bound to the oligomer compound at internal residues of the oligomer compound.

[0326] In some embodiments, the one or more lipid moieties, preferably just one lipid moiety, is covalently bonded to the oligomer compound, preferably the oligonucleotide, either directly or via a spacer, usually and preferably through the -OP(O)(SH)- or -OP(O)(OH)- or -NHP(O)(OH)- or -NHP(O)(SH)- or -NH-C(O)- moieties contained in the one or more lipid moieties or the spacer, wherein the -OP(O)(SH)- or -OP(O)(OH)- or -NHP(O)(OH)- or -NHP(O)(SH)- or -NH-C(O)- moieties are bonded to the 5'-terminal OH group or the 3'-terminal OH group of the oligomer compound.

[0327] In some embodiments, the one or more lipid moieties, preferably just one lipid moiety, are covalently bonded to the oligomer compound, preferably the oligonucleotide, either directly or via a spacer, through a -OP(O)(SH)- or -OP(O)(OH)- moiety, the -OP(O)(SH)- or -OP(O)(OH)- moiety being bonded to the 5'-terminal OH group or 3'-terminal OH group of the oligomer compound, and typically, and preferably, the -OP(O)(SH)- or -OP(O)(OH)- moiety being included in the one or more lipid moieties or the spacer.

[0328] In some embodiments, the one or more lipid moieties, preferably just one lipid moiety, are covalently bonded to the oligomer compound, preferably the oligonucleotide, either directly or via a spacer, through the -OP(O)(SH)- moiety, the -OP(O)(SH)- moiety being bonded to the 5'-terminal OH group or the 3'-terminal OH group of the oligomer compound, and typically, and preferably, the -OP(O)(SH)- moiety is included in the one or more lipid moieties or the spacer.

[0329] In some embodiments, the one or more lipid moieties, preferably just one lipid moiety, are covalently bonded to the oligomer compound, preferably the oligonucleotide, either directly or via a spacer, through the -OP(O)(SH)- moiety, the -OP(O)(SH)- moiety being bonded to the 5'-terminal OH group of the oligomer compound, and typically, and preferably, the -OP(O)(SH)- moiety is included in the one or more lipid moieties or the spacer.

[0330] In some embodiments, the one or more lipid moieties, preferably just one lipid moiety, are covalently bonded to the oligomer compound, preferably the oligonucleotide, either directly or via a spacer, through the -OP(O)(SH)- moiety, the -OP(O)(SH)- moiety being bonded to the 3'-terminal OH group of the oligomer compound, and typically, and preferably, the -OP(O)(SH)- moiety is included in the one or more lipid moieties or the spacer.

[0331] In some embodiments, the one or more lipid moieties, preferably just one lipid moiety, are covalently bonded to the oligomer compound, preferably the oligonucleotide, either directly or via a spacer, through the -OP(O)(OH)- moiety, the -OP(O)(OH)- moiety being bonded to the 5'-terminal OH group or the 3'-terminal OH group of the oligomer compound, and typically, and preferably, the -OP(O)(OH)- moiety is included in the one or more lipid moieties or the spacer.

[0332] In some embodiments, the one or more lipid moieties, preferably just one lipid moiety, are covalently bonded to the oligomer compound, preferably the oligonucleotide, either directly or via a spacer, through the -OP(O)(OH)- moiety, the -OP(O)(OH)- moiety being bonded to the 5'-terminal OH group of the oligomer compound, and typically, and preferably, the -OP(O)(OH)- moiety is included in the one or more lipid moieties or the spacer.

[0333] In some embodiments, the one or more lipid moieties, preferably just one lipid moiety, are covalently bonded to the oligomer compound, preferably the oligonucleotide, either directly or via a spacer, through the -OP(O)(OH)- moiety, the -OP(O)(OH)- moiety being bonded to the 3'-terminal OH group of the oligomer compound, and typically, and preferably, the -OP(O)(OH)- moiety is included in the one or more lipid moieties or the spacer.

[0334] In certain embodiments, the at least one lipid moiety bound to the oligomer compound is a saturated fatty acid moiety, more specifically, a saturated fatty acid moiety derived from palmitic acid (C16) or stearic acid (C18), and most specifically, a saturated fatty acid moiety derived from palmitic acid (C16). In some embodiments, the at least one lipid moiety includes palmitic acid (C16).

[0335] In the present invention, at least one lipid portion is bound to the oligomer compound at (i) a terminal residue of the oligomer compound, (ii) the 5' end of the oligomer compound, (iii) the 3' end of the oligomer compound, or (iv) an internal residue of the oligomer compound.

[0336] When the bond between the oligomer compound and at least one lipid moiety is direct, the covalent bond includes one atom of the oligomer compound and one atom of at least one lipid moiety.

[0337] A spacer exists when the bond between the oligomer compound and at least one lipid moiety is indirect. One first atom of this spacer is covalently bonded to one atom of the oligomer compound, and at the same time, a second atom of this spacer, different from the first atom, is covalently bonded to at least one atom of the lipid moiety.

[0338] Any spacer disclosed can be realized by the present invention. In a particular embodiment, the spacer realized by the present invention is represented by the following formula (A) or (B). φ-NH-C 2-12 Alkylene-OP(=O)(OH)-§ (A) φ-NH-C 2-12 Alkylene-OP(=S)(OH)-§ (B), In the above equation, (φ) represents a covalent bond with the lipid portion, and (§) represents a covalent bond with the oligomeric compound.

[0339] It should be noted that the spacer in equation (B) is in equilibrium with the spacer in equation (B') below. φ-NH-C 2-12 Alkylene-OP(SH)(=0)-§ (B')

[0340] Therefore, equations (B) and (B') are equivalent and can be used in the same way.

[0341] In a more specific embodiment, the spacer is of formula (B), and advantageously, the alkylene chain of this spacer is 6 carbon atoms long.

[0342] In some embodiments, the oligomeric compounds according to the present invention are selected from the group consisting of the following. - C 8-26 -Saturated fatty acid moiety -NH-C 2-12 Alkylene-OP(=S)(OH)-GGAGATgGCAGTTTC-3' (SEQ ID NO: 4 in the attached sequence list), - C 8-26 -Saturated fatty acid moiety -NH-C 2-12 Alkylene-OP(=S)(OH)-GGAGATGgCAGTTTC-3' (SEQ ID NO: 5 in the attached sequence list), - C 8-26 -Saturated fatty acid moiety -NH-C 2-12 Alkylene-OP(=S)(OH)-GGAGATGGcAGTTTC-3' (SEQ ID NO: 6 in the attached sequence listing), and - C 8-26-Saturated fatty acid moiety -NH-C 2-12 Alkylene-OP(=S)(OH)-GGAGATGGCaGTTTC-3' (SEQ ID NO: 7 in the attached sequence listing).

[0343] In some embodiments, the oligomeric compounds according to the present invention are selected from the group consisting of the following. - Palmitate-NH-C 2-12 Alkylene-OP(=S)(OH)-GGAGATgGCAGTTTC-3' (SEQ ID NO: 4 in the attached sequence list), - Palmitate-NH-C 2-12 Alkylene-OP(=S)(OH)-GGAGATGgCAGTTTC-3' (SEQ ID NO: 5 in the attached sequence list), - Palmitate-NH-C 2-12 Alkylene-OP(=S)(OH)-GGAGATGGcAGTTTC-3' (SEQ ID NO: 6 in the attached sequence listing), and - Palmitate-NH-C 2-12 Alkylene-OP(=S)(OH)-GGAGATGGCaGTTTC-3' (SEQ ID NO: 7 in the attached sequence listing).

[0344] In some embodiments, the oligomeric compounds according to this disclosure are selected from the group consisting of the following: - C 8-26 -Saturated fatty acid portion-NH-C6alkylene-OP(=S)(OH)-GGAGATgGCAGTTTC-3'(SEQ ID NO: 4 in the attached sequence listing), - C 8-26 -Saturated fatty acid portion-NH-C6 alkylene-OP(=S)(OH)-GGAGATGgCAGTTTC-3' (SEQ ID NO: 5 in the attached sequence listing), - C 8-26 -Saturated fatty acid portion-NH-C6alkylene-OP(=S)(OH)-GGAGATGGcAGTTTC-3' (SEQ ID NO: 6 in the attached sequence listing), and - C 8-26-Saturated fatty acid portion-NH-C6alkylene-OP(=S)(OH)-GGAGATGGCaGTTTC-3'(SEQ ID NO: 7 in the attached sequence listing).

[0345] Specific examples of oligomeric compounds according to the present invention include the following: - Palmitate-NH-C6alkylene-OP(=S)(OH)-REGONE.7 - Palmitate-NH-C6alkylene-OP(=S)(OH)-REGONE.8 (hereinafter designed as SKY51), - Palmitate-NH-C6alkylene-OP(=S)(OH)-REGONE.9, and - Palmitate-NH-C6alkylene-OP(=S)(OH)-REGONE.10.

[0346] In other words, the oligomer compound according to the present invention is selected from the group consisting of the following. - Palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATgGCAGTTTC-3' (SEQ ID NO: 4 in the attached sequence listing), - Palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATGgCAGTTTC-3' (SEQ ID NO: 5 in the attached sequence listing), - Palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATGGcAGTTTC-3' (SEQ ID NO: 6 in the attached sequence listing), and - Palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATGGCaGTTTC-3' (SEQ ID NO: 7 in the attached sequence listing).

[0347] In some embodiments, the oligomeric compound is palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATgGCAGTTTC-3' (SEQ ID NO: 4 in the attached sequence listing).

[0348] In some embodiments, the oligomeric compound is palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATGgCAGTTTC-3' (SEQ ID NO: 5 in the attached sequence listing).

[0349] In some embodiments, the oligomeric compound is palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATGGcAGTTTC-3' (SEQ ID NO: 6 in the attached sequence listing).

[0350] In some embodiments, the oligomeric compound is palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATGGCaGTTTC-3' (SEQ ID NO: 7 in the attached sequence listing).

[0351] The present invention relates to oligomeric compounds for use as pharmaceuticals, as defined above. Accordingly, the present invention relates to a pharmaceutical composition comprising the oligomeric compound according to the present invention and a pharmaceutically acceptable excipient as an active ingredient. In some embodiments, the pharmaceutical composition contains a therapeutically effective amount of the oligomeric compound described herein.

[0352] The pharmaceutical compositions according to the present invention can be used systemically; parenterally, for example, intravenously, intraarterially, intraperitoneally, intrathecally, intraventricularly, intrasternally, intracranially, intramuscularly, or subcutaneously; topically; orally; rectally; intranasally; or by inhalation.

[0353] When the oligomer compound according to the present invention is mixed with one or more conventionally used inert diluents and, optionally, other substances such as lubricants, colorants, and coatings, tablets, pills, powders, etc., can be used as a solid composition for oral administration.

[0354] Pharmaceutically acceptable suspensions, solutions, emulsions, and syrups containing conventionally used inert diluents and, optionally, other substances such as wetting products, sweeteners, and thickeners, can be used as liquid compositions for oral or ophthalmic use.

[0355] Sterile compositions for parenteral administration may be aqueous or non-aqueous (oil-based) solutions, suspensions, or emulsions. Water, propylene glycol, vegetable oil, or other suitable organic solvents may be used as solvents or excipients. These compositions may also contain dispensing agents or auxiliary agents such as wetting agents, suspending agents, isotonic agents, or emulsifiers.

[0356] Compositions for topical administration may be, for example, creams, lotions, oral sprays, nasal drops, eye drops, or aerosols.

[0357] Those skilled in the art will understand that the amount of oligomeric compound administered is sufficient to bring about improvement in the undesirable symptoms of the disease. Such an amount may vary depending on factors such as the patient's age, weight, and overall health, and may be determined on an individual basis. The amount may also vary depending on other elements of the treatment protocol (e.g., administration of other medications such as steroids). Those skilled in the art will recognize that such parameters are usually calculated in clinical trials. Furthermore, those skilled in the art will understand that while it is possible for the treatment described herein to completely alleviate the symptoms of the disease, this is not an absolute requirement. Even partial or intermittent relief of symptoms can be of great benefit to the recipient. Moreover, the treatment of a patient is usually not a one-time event. Rather, the oligomeric compound may be administered multiple times, at intervals of several days, several weeks, several months, or even several years, depending on the results obtained.

[0358] The present invention also relates to the previously defined oligomeric compounds or pharmaceutical compositions for use in the treatment of Duchenne muscular dystrophy in patients who require it.

[0359] In another embodiment, the Disclosure includes a method for treating Duchenne muscular dystrophy in patients in need. In some embodiments, the method includes administering to a patient a therapeutically effective dose of the oligomeric compound or pharmaceutical composition disclosed herein.

[0360] It is understood in the art that splice switching techniques can be used to treat patients with DMD disease. In particular, many DMD patients with large deletions involving one or more exons, such as Δ43-50, Δ45-50, Δ47-50, Δ48-50, Δ49-50, Δ50, Δ52, or Δ52-58, may benefit from the present invention aimed at achieving exon 51 skipping; however, the clinical benefit for each patient will vary depending on the quality of the truncated dystrophin resulting from their specific gene deletion.

[0361] Those skilled in the art will recognize that many methods exist for determining or measuring the level of efficacy in treatments such as splice switching. Such methods include, but are not limited to, measuring or detecting the activity of rescued proteins in patient cells or appropriate animal models. Where interspecies homology is possible, it is also possible to measure the efficacy of treatment protocols aimed at altering the exon composition of mRNA using RT-PCR to assess the presence of target exons in patient cells and in normal cells or wild-type animal models.

[0362] Other features and advantages of the present invention will become apparent from the following detailed description with reference to the accompanying drawings. [Brief explanation of the drawing]

[0363] [Figure 1A] This figure represents the sequence REGONE (SEQ ID NO:3) and shows the actual shape of the REGONE sequence with a complete tc-DNA-restricted sugar backbone. The 3D model was created using a suitable set of computer tools, structural investigations using NMR and CD spectroscopy, and publicly available experimental data obtained from the crystal structure of tc-DNA. [Figure 1B]This diagram shows the sequence REGONE (SEQ ID NO:3) and its partial pairing with itself. The symbol "|" represents a possible Watson-Crick pairing. If this were an oligomer made of standard DNA, this structure would be unstable (Tm below 15°C). However, 3D modeling of these dimers suggests that such a morphology can exist if a pre-organized constraint skeleton, such as tc-DNA, is present. "G≡C" pairings are shown in black, "A=T" pairings in dark gray, and nucleotides not involved in base pairing are shown in light gray. [Figure 2A] This figure shows the results on the overall shape of REGONE tc-DNA-based oligonucleotides after replacing one nucleotide of tc-DNA with an equivalent nucleotide containing a 2OMe ribose sugar. The figure shows the putative effect of such modification at position 8 on the 3D shape. Subsequent oligomers will be referred to as "REGONE.8" (SEQ ID NO: 5). The 2'OMe nucleotide introduces a bend in the tc-DNA strand, disrupting the entire pre-organized structure and causing it to lose the ability to maintain the dimeric form resulting from incomplete base pairing. [Figure 2B] This figure shows the results on the overall morphology of REGONE tc-DNA-based oligonucleotides after replacing a single nucleotide of tc-DNA with an equivalent nucleotide containing a 2OMe-ribose sugar. It also shows that REGONE.8 is unable to actually form dimers, as demonstrated by gel electrophoresis experiments under non-denaturing conditions. The same sequence consisting only of tc-DNA nucleotides systematically represents the dimerized forms that move differently in the gel (note that the proportion of dimerized forms may be higher). [Figure 3A] This diagram shows the composition of compound SQY51. It indicates the presence of the antisense oligonucleotide REGONE.8 (SEQ ID NO: 5), which is covalently bonded to a palmitoyl residue via a C6 linker at its 5' end. The chemical formula of SQY51 is C215H263N60O93P15S, its exact mass is 5669.35, and its molecular weight is 5672.46. [Figure 3B]This figure shows the composition of compound SQY51 and demonstrates, through gel electrophoresis experiments under non-denaturing conditions, that the addition of palmitoyl residues does not affect the dimerization properties of oligonucleotides. SQY51 still fails to form dimers, while the control compound, which has complete tc-DNA nucleotides, does. [Figure 4] This graph shows the results of complement assays using human serum for SQY51 and the same compound (SQY51-PS) which has a complete phosphorothioate nucleoside bond. Phosphate-buffered saline (PBS) was used as a negative control for complement activation, and zymosan, a glucan with repeating glucose units linked by β-1,3-glycosidic bonds found on the surface of yeast, was used as a positive control. The concentration of the experimental drug used in the in vitro complement activation test was 2 mg / mL, which mimics an in vivo administration regimen of approximately 150 mg / kg, which has a theoretical Cmax of approximately 0.4 mM (this extrapolation considers the amount of blood as plasma, so it could be higher). [Figure 5A] This graph shows the results of coagulation assays using human plasma for SQY51 and the same compound (SQY51-PS) that has a complete phosphorothioate nucleoside bond. Phosphate-buffered saline (PBS) was used as a control. Prothrombin time (PT), a blood test that measures the time it takes for blood to clot in the presence of the experimental drug, is shown. [Figure 5B] This graph shows the results of coagulation assays using human plasma for SQY51 and the same compound (SQY51-PS) that has a complete phosphorothioate nucleoside bond. Phosphate-buffered saline (PBS) was used as a control. Activated partial thromboplastin time (APTT), a blood test that measures the time it takes for blood to clot in the presence of the experimental drug, is shown. [Figure 6A] This figure shows the SDS-PAGE analysis of proteins recovered from human, macaque, and mouse serum using biotinylated SQY51 molecules (the biotin portion was attached via a C3 linker at the 3' end of the oligonucleotide shown in Figure 3 (not shown)). [Figure 6B] This figure shows 3D models of human and mouse albumin interacting with SQY51. Albumin is represented as a "ribbon," palmitoyl-C6 amino acid as the "actual volume," and REGONE.8 as a "baton." [Figure 6C] This figure shows the SDS-PAGE analysis of proteins recovered from human, macaque, and mouse serum using various biotinylated compounds such as SYN51 (palmitoyl-aminoC6-SEQ ID NO:8), M23D (palmitoyl-aminoC6-SEQ ID NO:9), and SQY51 (palmitoyl-aminoC6-SEQ ID NO:5). The biotiny portion was linked to the 3' end of each oligonucleotide via a C3 linker. [Figure 7A] This shows the measurement of hemopharmacological (PK) parameters of SQY51 after intravenous infusion (50 mg / kg dose, 30-minute infusion) in cynomolgus monkeys (Macaca fascicularis). Typically, measuring PK parameters requires collecting numerous blood samples at various time points and estimating the peak plasma concentration (Cmax), half-life (t1 / 2), volume of distribution (VD), and area under the curve (AUC). The graph shows the plasma concentrations of SQY51 over one week after infusion. [Figure 7B] This shows the measurement of hemopharmacological (PK) parameters of SQY51 after intravenous infusion (50 mg / kg dose, 30-minute infusion) in cynomolgus monkeys (Macaca fascicularis). Typically, measuring PK parameters requires taking numerous blood samples at various time points and estimating the peak plasma concentration (Cmax), half-life (t1 / 2), volume of distribution (VD), and area under the curve (AUC). The graph shows the time profile estimated from a two-compartment model (Phoenix WinNonlin 8.1). The plasma concentration (Cp) of SQY51 follows a bi-exponential kinetic model, as previously described for other types of oligonucleotides. The PK parameters for SQY51 are Cmax = 900 ± 120 μg / mL; αt1 / 2 = 2 ± 0.3 h; βt1 / 2 = 90 ± 3 h. [Figure 8A]This shows the results of complement activation in cynomolgus monkeys (Macaca fascicularis) at various time points (pre-test, 10 min, 30 min, 1 h, 2 h, 4 h, 8 h, 24 h, and 48 h) after systemic delivery of SQY51 by intravenous infusion at a dose of 50 mg / kg in phosphate-buffered saline (PBS). PBS alone was used as a negative control, and the corresponding compound with complete phosphorothioate nucleoside binding (SQY51-PS) was used as a positive control. The graph shows the progression of C3a levels, reflecting C3 consumption. [Figure 8B] This shows the results of complement activation in cynomolgus monkeys at various time points (pre-test, 10 min, 30 min, 1 h, 2 h, 4 h, 8 h, 24 h, and 48 h) after systemic delivery of SQY51 by intravenous infusion at a dose of 50 mg / kg in phosphate-buffered saline (PBS). PBS alone was used as a negative control, and the corresponding compound with a complete phosphorothioate nucleoside bond (SQY51-PS) was used as a positive control. The graph shows the progression of Bb, a proteolytic enzyme produced by the cleavage of factor B in the activation of the alternative complement pathway (AP). [Figure 8C] This shows the results of complement activation in cynomolgus monkeys at various time points (before the test, 10 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 8 hours, 24 hours, and 48 hours) after systemic delivery of SQY51 by intravenous infusion at a dose of 50 mg / kg in phosphate-buffered saline (PBS). PBS alone was used as a negative control, and the corresponding compound with complete phosphorothioate nucleoside bonding (SQY51-PS) was used as a positive control. The graph shows the progression of SC5b-9, a soluble complex of S protein and C5b-9 resulting from complement activation in the absence of the lipid bilayer membrane. [Figure 9A]This document presents the results of coagulation assays in blood samples from cynomolgus monkeys (Macaca fascicularis) at various time points (pre-test, 30 minutes, 4 hours, and 24 hours) after systemic delivery of SQY51 by intravenous infusion at a dose of 50 mg / kg in phosphate-buffered saline (PBS). PBS alone was used as a negative control, and the corresponding compound (SQY51-PS) with a complete phosphorothioate nucleoside bond was used as a positive control. The graph shows prothrombin time (PT), a blood test that measures the time it takes for blood to clot in the presence of the experimental drug. [Figure 9B] This shows the results of coagulation assays in cynomolgus monkey blood samples at various time points (pre-test, 30 minutes, 4 hours, and 24 hours) after systemic delivery of SQY51 by intravenous infusion at a dose of 50 mg / kg in phosphate-buffered saline (PBS). PBS alone was used as a negative control, and the corresponding compound with a complete phosphorothioate nucleoside bond (SQY51-PS) was used as a positive control. The graph shows activated partial thromboplastin time (APTT), a blood test that measures the time it takes for blood to clot in the presence of the experimental drug. [Figure 10A] This graph shows cytokine levels in blood samples over 48 hours after a single dose of SQY51 (50 mg / kg, infusion over 30 minutes). The results obtained with SYN51-PS are superimposed to illustrate the compound's ability to induce toxic reactions. The graph also shows the levels of interleukin-1 beta (IL-1β). [Figure 10B] This graph shows cytokine levels in blood samples over 48 hours after a single dose of SQY51 (50 mg / kg, infusion over 30 minutes). The results obtained with SYN51-PS are superimposed to illustrate how the compound can cause toxic reactions. The graph also shows the levels of interleukin-6 (IL-6). [Figure 10C] This graph shows cytokine levels in blood samples over 48 hours after a single dose of SQY51 (50 mg / kg, infusion over 30 minutes). The results obtained with SYN51-PS are superimposed to illustrate how the compound can cause toxic reactions. The graph also shows levels of monocyte chemotactic protein 1 (MCP-1). [Figure 10D]This graph shows cytokine levels in blood samples over 48 hours after a single dose of SQY51 (50 mg / kg, infusion over 30 minutes). The results obtained with SYN51-PS are superimposed to illustrate how the compound can cause toxic reactions. The graph also shows the level of tumor necrosis factor alpha (TNF-α). [Figure 11] This graph shows the in vivo distribution of SQY51 in monkey tissue one or five weeks after the completion of a four-week treatment period using a dose of 50 mg / kg / week. The amount of the compound was measured using the beacon method. The graph overlays the quantitative results of SQY51 one week after the end of treatment (white plot) and four weeks after that (black plot). The percentages indicate the clearance rate after four weeks of washout. [Figure 12A] This figure illustrates the levels of exon 51 skipped dystrophin mRNA in monkey tissues. It shows the detection of exon 51 skipping using nested RT-PCR in the gastrocnemius, quadriceps, deltoid, biceps, diaphragm, heart, cerebellum, spinal cord, skin, stomach, duodenum, and ileum one week after four weeks of administration of SQY51 at a dose of 50 mg / kg / week. Reverse-transcribed mRNA was sequentially amplified by PCR1 (Ex46F / Ex53R) and PCR2 (Ex47Fi / Ex52Ri) to depict the 886 base pair (bp) amplification product resulting from normally spliced ​​dystrophin mRNA and the 653 bp amplification product with exon 51 deletion as a result of the effect of SQY51. [Figure 12B] This chart shows the levels of dystrophin mRNA skipping exon 51 in monkey tissue. The percentage of remaining skipping levels in striated muscle 5 weeks after treatment (black plot) is shown compared to the level 1 week after the last dose (gray background indicates the level reached 1 week post-treatment for each muscle; n=4 monkeys / group). [Figure 13] This graph shows a comparison of the in vivo distribution of SQY51 and SYN51 in monkey tissue one week after the completion of a four-week treatment using a dose of 50 mg / kg / week. The amount of each compound was measured by LC-MS / MS. The graph shows the quantitative results for SQY51 (white plot) and SYN51 (black plot) superimposed. [Modes for carrying out the invention]

[0364] Embodiments included in this specification will now be described with reference to the following examples. These examples are provided for illustrative purposes only, and the disclosures included in this specification should not be construed as being limited to these examples, but rather as encompassing any variations that become apparent as a result of the teachings provided herein. [Examples]

[0365] Compounds for the treatment of Duchenne muscular dystrophy Generally, small antisense oligonucleotides use nucleic acids whose skeletal rigidity is enhanced by a restricting sugar backbone, such as LNA (locked nucleoic acid) or tricycloDNA. Figure 1 shows a REGONE sequence (SEQ ID NO:3) consisting of tricycloDNA nucleotides, where the restriction on the ribose portion gives the oligomer its overall shape, increasing its Tm by 2-3°C per nucleotide. For clarification, the melting temperature (Tm) of an oligonucleotide or oligomeric compound refers to the temperature at which 50% of the oligonucleotide forms a double helix with its complement. In response to this predetermined rigidity, sequences that should not form homodimers still do so, and it has been shown that this can lead to strong in vivo toxicity, especially when the internucleotide bond is of the phosphorothioate (PS) type and the in vivo distribution is improved (Non-patent documents 27, 28).

[0366] The tendency of REGONE to homodimerize was resolved by introducing unconstrained nucleotides into the sequence. As shown in Figure 2, such modifications disrupt the structure of the tricycloDNA oligomer itself, resulting in internal flexibility that prevents incomplete pairing. This is confirmed by (i) 3D modeling of a REGONE variant (referred to as REGONE.8) in which the 8th tc-DNA nucleotide was replaced with an equivalent 2'-O-methylribose RNA, and (ii) gel electrophoresis experiments demonstrating that subsequent compounds were unable to form homodimers. The greatest effect was obtained with modifications at nucleotide numbers 8 and 9, less so at nucleotide numbers 7 and 10, and no effect at all at other positions. Therefore, modifications should be located between nucleotides 7 and 10, i.e., REGONE.7 (SEQ ID NO: 4), REGONE.8 (SEQ ID NO: 5), REGONE.9 (SEQ ID NO: 6), and REGONE.10 (SEQ ID NO: 7). Other modifications at positions 1, 2, 3, 4, 5, 6, 11, 12, 13, 14, or 15 do not significantly affect the overall structure of the pre-organized molecule, thus maintaining its ability to allow dimerization.

[0367] To ensure, or at least not compromise, the safety of REGONE.8 under intravenous infusion conditions, and to satisfy effective biodistribution, it was preferable to link the 15 nucleotides of the oligomer with phosphate diester (PO) bonds rather than phosphorothioate (PS) bonds, as those skilled in the art would argue. Furthermore, since tricycloDNA class oligomers are sufficiently stable in biological fluids, this modification (i.e., PS linkage) is unnecessary and, in fact, could be detrimental if the compound were to cease being biodegradable. Ultimately, REGONE.8 (SEQ ID NO: 5) was covalently linked to a palmitoyl residue via a C6 linker at its 5' end, as shown in Figure 3. This final compound (C 215 H 263 N 60 O 93 P 15 S) will be named SQY51. [Examples]

[0368] In vitro toxicity evaluation in human blood In particular, the experimental drug concentration for such in vitro assays is 2 mg / mL, which is theoretically C max Considering that this mimics an in vivo administration regimen of approximately 150 mg / kg, which results in approximately 0.4 mM (and could be higher in this extrapolation because the blood volume was considered as plasma), advantageously, SQY51 does not activate complement in human serum, but the same compound having a phosphorothioate nucleoside bond (SQY51-PS) does (Figure 4).

[0369] Another concern when intravenously infusing AONs is the potential for interaction with the coagulation system. Several routine tests exist to evaluate the effect of candidate drugs on coagulation, including prothrombin time (PT) and activated partial thromboplastin time (APTT). These two are blood tests that measure the time it takes for blood to coagulate in the presence of the experimental drug. Prolongation of coagulation time (PT and APTT) indicates an anticoagulant effect (risk of heavy bleeding), while shortening of coagulation time indicates a procoagulant effect (risk of blood clot formation (thrombosis)). The experimental drug concentration for coagulation assays is 2 mg / mL, which is theoretically C max This mimics an in vivo administration regimen of approximately 150 mg / kg, which results in a concentration of approximately 0.4 mM (in this extrapolation, the volume of blood was considered as plasma, so the actual amount could be higher). Figure 5 clearly shows that while SQY51 does not significantly alter the coagulation parameters of human plasma, SQY51-PS alters coagulation parameters, particularly by extending the coagulation time of the extrinsic pathway (APTT). [Examples]

[0370] Oligocapture serum Protein A more important question is which experimental model to use to validate technological innovations in the field of AONs. Often, those skilled in the art have simply established the efficacy of novel AONs to suitable cells in tissue culture, and then perhaps in vivo using mouse models. Unfortunately, such methods assume that antisense compounds interact with bodily fluids in the same way regardless of species, an assumption that needs to be verified. For this reason, we investigated which proteins in serum can bind to SQY51. Most of the sequences tested (i.e., those with homogeneous designs) showed very similar capture profiles, but it is noteworthy that SQY51 is unique as it shows significant interspecies differences.

[0371] The SQY51 molecule preferentially retains serum albumin in human and macaque serum, while retaining APO-A1 in mouse serum (Figure 6A).

[0372] Molecular dynamics studies using GROMACS (Non-Patent Literature 29) show that SQY51 interacts with mouse albumin only through the palmitoyl moiety (Figure 6B). 3D analysis, consistent with the experimental data shown in Figure 6A, shows that SQY51 interacts more strongly with human albumin. Here, in addition to the interaction with the palmitoyl residue, the REGONE.8 moiety also interacts with the protein, enhancing its association.

[0373] Figure 6C discloses SDS-PAGE analysis of proteins recovered from human, macaque, and mouse serum using various biotinylated compounds such as SYN51 (palmitoyl-amino C6-SEQ ID NO: 8), M23D (palmitoyl-amino C6-SEQ ID NO: 9), and SQY51 (palmitoyl-amino C6-SEQ ID NO: 5). The biotiny portion was linked to the 3' end of each oligonucleotide via a C3 linker. Sequence SEQ ID NO: 8 in the attached sequence listing corresponds to 5'-AAGAuGGCATTTCTA-3', and sequence SEQ ID NO: 9 in the attached sequence listing corresponds to 5'-CCTCGGCTTACCT-3'. In the above sequences, tc-DNA nucleosides are shown in uppercase and 2'OMe nucleosides in lowercase.

[0374] Note that M23D is a complete tc-DNA oligomer, while both SYN51 and SQY51 contain α within the tc-DNA strand. M23D, like SYN51 in humans and macaques, captures similar protein patterns regardless of the type tested (albumin and apolipoprotein). Only SQY51 exhibits the property of preferentially fixing albumin in primate serum, regardless of whether it is of human or non-human origin.

[0375] As shown in Figure 6, SQY51 preferentially retains serum albumin in human and non-human primate serum, while primarily interacting with apolipoproteins in mouse. 3D modeling of SQY51 using human and mouse albumin confirmed that both proteins were capable of accepting palmitoyl residues. Nevertheless, the REGONE.8 portion of SQY51 appeared to interact with human albumin itself, enhancing its association, which does not occur in mouse albumin. This species-specific capability of SQY51 is unique and clearly unpredictable to those skilled in the art. It is also indicated that the advantages of the compound of the present invention should be further evaluated in suitable animal models such as cynomolgus monkeys (e.g., non-human primates). [Examples]

[0376] Pharmacokinetic and toxicity evaluation of compounds SQY51 (inventive invention) and SYN51 (prior art) in cynomolgus monkeys. First, the pharmacokinetics of SQY51 were compared with SYN51, which also contains a tricycloDNA nucleoside, a 2'-O modified RNA nucleoside (SEQ ID NO:8), and a 15-mer oligomer with a lipid moiety.

[0377] In Figure 7A, it is noteworthy that SQY51 is stable in the blood compartment (for example, as revealed by mass spectrometry, SQY51 remained largely unchanged in plasma samples throughout the kinetic studies (not shown), but it lacked palmitoyl residues and C max (A minor form that reached its peak in approximately 0.1% of cases was detectable 24 hours after injection.)

[0378] Importantly, in contrast to SQY51, the capture of serum proteins by SYN51 showed a parallel set of proteins regardless of species (e.g., serum albumin or apolipoprotein). This difference in affinity for blood proteins was also reflected in the pharmacokinetic profiles. In fact, although the two compounds decayed exponentially after intravenous infusion (50 mg / kg), their secondary PK parameters in the blood differed. In a two-compartment analysis (2C model), the elimination half-life of SYN51 was approximately 20 hours, compared to approximately five times longer for SQY51 (Figure 7).

[0379] Table 1 below shows a comparison of the secondary PK parameters of SQY51 and SYN51 after a single intravenous infusion (50 mg / kg) in cynomolgus monkeys. The amounts of SQY51 and SYN51 in blood samples at various time points were evaluated by LC-MS / MS. Secondary PK parameters were calculated using the 2C model (bi-exponential kinetics).

[0380] TIFF0007912190000022.tif99165

[0381] It is important that SQY51 remained stable throughout the elimination phase. Mass spectrometry across the entire study revealed that SQY51 remained unchanged in the bloodstream and retained its palmitoyl moiety.

[0382] Due to its unique binding properties with primate serum albumin, SQY51 has high persistence in the blood. The main objective was to investigate whether such prolonged presence could cause adverse events such as complement activation (Figure 8), coagulation disorders (Figure 9), and elevated pro-inflammatory cytokines (Figure 10). These potentially harmful phenomena were not observed with SQY51, but they were observed with compounds possessing PS-type nucleotide bonds.

[0383] Regarding the pro-inflammatory cytokines examined in Figure 10, interleukin-1 beta (IL-1β) is produced by activated macrophages and is an important mediator of the innate inflammatory response. The inflammatory cytokine interleukin-6 (IL-6) can be secreted by macrophages in response to molecules called pathogen-associated molecular patterns (PAMPs), which bind to detection molecules of the innate immune system called pattern recognition receptors (PRRs), including Toll-like receptors (TLRs) present on the cell surface and in intracellular compartments. Monocytes / macrophages are the main source of monocyte chemotactic protein 1 (MCP-1), but it can also be produced by other cell types, including endothelial cells and fibroblasts, and is important for peripheral circulation and antiviral immune responses in tissues. Tumor necrosis factor alpha (TNF-α) is a pro-inflammatory cytokine spontaneously produced by activated macrophages and monocytes in response to infection or injury, and mediates hypotension, widespread coagulation, and widespread tissue damage.

[0384] After administering SQY51 at a dose of 50 mg / kg once a week for four weeks, the in vivo distribution in various tissues of the body was analyzed one week and five weeks later (Figure 11). First, as expected, the kidneys and liver were the main organs that accumulated the compound.

[0385] Table 2 below compares exon 51 skipping in the muscles of cynomolgus monkeys one week after four weeks of treatment with either SQY51 or SYN51 (50 mg / kg / week). On average, SQY51 is 10 times more effective than SYN51.

[0386] TIFF0007912190000023.tif99165

[0387] Therefore, the heart appears to be the primary target among striated muscle tissues. Secondly, it should be noted that after only four more weeks of washout, the amount of SQY51 decreased remarkably, particularly in renal tissue. In fact, more than 70% clearance was observed in all tissues four weeks after treatment. [Examples]

[0388] Efficacy of compound SQY51 in cynomolgus monkeys Nested RT-PCR analysis demonstrated the level of exon 51 skipping in monkey tissue after systemic administration of SQY51 (Figure 12), confirming that the antisense portion is widely delivered to myonuclei throughout the entire muscle system, including skeletal muscle, cardiac muscle, and smooth muscle.

[0389] Notably, despite the high clearance rate of SQY51 in muscle (see Figure 11), the level of exon 51 skipping at 5 weeks was relatively similar to the level detected at 1 week, meaning it was largely maintained despite the washout. This suggests that the removed compounds were largely unproductive portions of SQY51, likely left behind in the interstitial fluid or endosomal compartments, where they were removed or destroyed. Furthermore, this sustained effect indicates that the benefits are not significantly lost even if SQY51 treatment is interrupted for more than one or two months, allowing the body time to clear presumably excess tricycloDNA oligomers from at-risk tissues such as the kidneys and liver.

[0390] Finally, the novel compound SQY51 has the following decisive advantages over SYN51, which has been considered the best tc-DNA-based compound for skipping exon 51 of DMD: (i) SQY51 has improved in vivo distribution in monkey muscle after systemic delivery due to its internal properties (e.g., high specific binding to human and NHP serum albumin) (Figure 13), and (ii) the level of exon 51 skipping in subsequent striated muscle is 10-fold higher, indicating that SQY51 has a true therapeutic benefit.

Claims

1. An oligonucleotide comprising 10 to 50 monomer subunits, wherein at least a portion of its sequence is complementary to the following sequence: AAGGAAAAACUGCCCAUCUCCAA (SEQ ID NO: 1), and the oligonucleotide has the following nucleotide sequence: - 5'-GGAGATgGCAGTTTC-3' (SEQ ID NO: 4), - 5'-GGAGATGgCAGTTTC-3' (SEQ ID NO: 5), - 5'-GGAGATGGcAGTTTC-3' (SEQ ID NO: 6), and - 5'-GGAGATGGCaGTTTC-3' (SEQ ID NO: 7), This includes or consists of one of the following: In the above sequence, tc-DNA nucleotides are shown in uppercase letters, and modified ribonucleic acid nucleosides are shown in lowercase letters; these are oligonucleotides.

2. The oligonucleotide according to claim 1, wherein the modified ribonucleic acid nucleoside is a 2'-O-methylRNA nucleoside.

3. The oligonucleotide according to claim 1 or 2, wherein the monomer subunits of the oligonucleotide are linked by phosphate diester nucleoside bonds.

4. The oligonucleotide according to any one of claims 1 to 3, wherein the oligonucleotide is covalently bonded to one or more lipid moieties.

5. The group consisting of the following: - C 8-26 - Saturated fatty acid moiety - NH-C 2-12 alkylene-OP (=S) (OH) -GGAGATgGCAGTTTC-3' (SEQ ID NO: 4), - C 8-26 - Saturated fatty acid moiety - NH-C 2-12 alkylene-OP (=S) (OH) - GGAGATGgCAGTTTC-3' (SEQ ID NO: 5), - C8-26 - saturated fatty acid portion - NH - C2-12 alkylene - OP(=S)(OH) - GGAGATGGcAGTTTC-3' (SEQ ID NO: 6), and - C 8-26 - Saturated fatty acid moiety - NH-C 2-12 Alkylene-OP (=S) (OH) - GGAGATGGCaGTTTC-3' (SEQ ID NO: 7) A compound selected from the above sequence, wherein the tc-DNA nucleotide is shown in uppercase and the modified ribonucleic acid nucleoside is shown in lowercase.

6. The group consisting of the following compounds: - Palmitate-NH-C 2-12 Alkylene-OP(=S)(OH)-GGAGATgGCAGTTTC-3' (SEQ ID NO: 4), - Palmitate-NH-C2-12 Alkylene-OP(=S)(OH)-GGAGATGgCAGTTTTC-3' (SEQ ID NO: 5), - Palmitate-NH-C2-12 Alkylene-OP(=S)(OH)-GGAGATGGcAGTTTC-3' (SEQ ID NO: 6), and - Palmitate-NH-C 2-12 Alkylene-OP(=S)(OH)-GGAGATGGCaGTTTTC-3' (SEQ ID NO: 7) The compound according to claim 5, selected from the above sequence, wherein in the above sequence, tc-DNA nucleotides are indicated by uppercase letters and modified ribonucleic acid nucleosides are indicated by lowercase letters.

7. The group consisting of the following compounds: - C8-26-saturated fatty acid moiety-NH-C6 alkylene-OP(=S)(OH)-GGAGATgGCAGTTTC-3' (SEQ ID NO: 4), - C 8-26 - Saturated fatty acid moiety - NH - C 6 alkylene-OP (=S) (OH) - GGAGATGgCAGTTTC-3' (SEQ ID NO: 5), - C8-26 - saturated fatty acid portion - NH-C6 alkylene - OP(=S)(OH)-GGAGATGGcAGTTTC-3' (SEQ ID NO: 6), and - C 8-26 - Saturated fatty acid moiety - NH-C 6 alkylene-OP (=S) (OH) -GGAGATGGCaGTTTC-3' (SEQ ID NO: 7) The compound according to claim 5, selected from the above sequence, wherein in the above sequence, tc-DNA nucleotides are indicated by uppercase letters and modified ribonucleic acid nucleosides are indicated by lowercase letters.

8. The aforementioned compounds consist of the following groups: - Palmitate-NH-C ６ Alkylene-OP(=S)(OH)-GGAGATgGCAGTTTC-3' (SEQ ID NO: 4), - Palmitate-NH-C ６ Alkylene-OP(=S)(OH)-GGAGATGgCAGTTTTC-3' (SEQ ID NO: 5), - Palmitate-NH-C ６ Alkylene-OP(=S)(OH)-GGAGATGGcAGTTTC-3' (SEQ ID NO: 6), and - Palmitate-NH-C ６ Alkylene-OP(=S)(OH)-GGAGATGGCaGTTTTC-3' (SEQ ID NO: 7), A compound according to any one of claims 5 to 7, selected from the above sequence, wherein in the above sequence, tc-DNA nucleotides are indicated by uppercase letters and modified ribonucleic acid nucleosides are indicated by lowercase letters.

9. A pharmaceutical composition for the treatment of Duchenne muscular dystrophy, comprising, as an active ingredient, an oligonucleotide according to any one of claims 1 to 4 and a pharmaceutically acceptable excipient.

10. A pharmaceutical composition for the treatment of Duchenne muscular dystrophy, comprising, as an active ingredient, a compound according to any one of claims 5 to 8 and a pharmaceutically acceptable excipient.

Images