RNA-containing composition for transdermal administration, and method for administering said composition

JPWO2023145755A5Pending Publication Date: 2025-12-05
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2023576938
Authority / Receiving Office
JP · JP
Patent Type
Applications
Priority Date
2023-01-25
Filing Date
2023-01-25
Publication Date
2025-12-05

AI Technical Summary

Technical Problem

Current vaccine delivery methods, such as intramuscular injection of mRNA vaccines and intradermal administration of DNA vaccines, have limitations in efficacy and stability, with mRNA vaccines requiring refrigeration and DNA vaccines showing variable effectiveness in human clinical trials.

Method used

A composition containing naked RNA, preferably mRNA, is administered transdermally by spraying onto the skin, allowing for uptake by antigen-presenting cells and induction of antigen-specific immunity, using a method that forms a bulge on the skin and employs a gas-generating agent for pressurization to facilitate penetration.

Benefits of technology

This method achieves antigen-specific immunity comparable to commercially available mRNA vaccines, with high expression levels and immune response induction, while avoiding the toxicity and storage challenges associated with lipid nanoparticles.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention provides a composition for transdermal administration, which contains a nucleic acid. More specifically, the present invention provides a composition for transdermal administration, the composition containing a nucleic acid, in which the nucleic acid comprises RNA. The composition is administered by an administration method comprising spraying the composition onto the surface of a target tissue, in which the spraying of the composition is performed by applying a pressure to the composition so that the composition is sprayed toward the target tissue and penetrates through the surface of the target tissue.
Need to check novelty before this filing date? Find Prior Art

Description

Composition containing RNA for transdermal administration and method of administering said composition

[0001] The present invention relates to compositions comprising RNA for transdermal administration and methods for administering said compositions.

[0002] Needle-free transdermal administration devices that function using explosive charges have been proposed (Patent Documents 1 to 7 and Non-Patent Documents 1 to 3). These devices are disclosed to administer proteins or DNA transdermally to a subject.

[0003] An mRNA vaccine has been developed and is showing remarkable effectiveness against coronavirus infections. The mRNA vaccine is administered intramuscularly to a subject in a form in which pseudouridine-containing mRNA is encapsulated in lipid nanoparticles (Patent Documents 8 and 9).

[0004] DNA vaccines are expected to be used as vaccines because they can be synthesized inexpensively and are highly stable. For example, unlike RNA, DNA vaccines have excellent long-term stability, such as the ability to be stored for more than five years and at -20°C. Furthermore, DNA can be produced much more inexpensively than RNA. Therefore, a technology has been developed in which a vector encoding an antigen operably linked to a promoter is administered to DNA using a needleless syringe (Patent Document 10). However, since the efficacy of Patent Document 3 was not confirmed in human clinical trials, it has been reported that a switch to higher dose testing will be made (Non-Patent Document 4). As described above, with regard to previous vaccine preparations, the method of intramuscularly injecting mRNA vaccines encapsulated in lipid nanoparticles has been highly effective, while the efficacy of intradermal administration of DNA vaccines has not been confirmed.

[0005] WO2001 / 078810 JP 2012-061269 JP 2012-065920 JP 2012-065922 JP 2014-147841 JP 2014-176759 JP 2016-221411 US 8,058,069 B US 9,469,664 B WO2021 / 200800A

[0006] Pharmaceuticals, Drug Delivery and Pharmaceutical Technology, Vol. 108 (7), 2415-2420, 2019AAPS PharmSciTech volume 21, Article number: 19 (2020) https: / / doi. org / 10.1101 / 2021.01.13.426436 "Novel Coronavirus DNA Vaccine: Results of Phase 1 / 2 and Phase 2 / 3 Clinical Trials," press release issued by Anges, Inc., November 5, 2021 (https: / / www.anges.co.jp / pdf_news / public / YuBbtiRGK5R9o88o4TbmUsKKHAkZmLXC.pdf)

[0007] The present invention provides compositions comprising nucleic acids for transdermal administration and methods of administering the compositions. In particular, the nucleic acids according to the present invention comprise RNA, and preferably the RNA may be naked mRNA.

[0008] The present inventors have demonstrated that transdermal administration of the above-mentioned composition to skin tissue by spraying it onto the skin can deliver RNA intradermally (particularly into the dermis), thereby inducing lymph nodes (lymph follicles) containing CD11-positive dendritic cells in the subcutaneous tissue, and that during this process, the RNA is taken up by antigen-presenting cells in the epidermis and dermis, which likely gather in the subcutaneous tissue to form lymph nodes. The present inventors have also demonstrated that RNA can be delivered into these dendritic cells, enabling the induction of antigen-specific immunity (antibody and T-cell immunity) in a subject. The present inventors have also demonstrated that the antigen-specific T-cell immunity induced by administering mRNA encoding a model antigen in combination with an adjuvant using the administration method of the present invention is at a level equivalent to that of commercially available mRNA vaccines.

[0009] According to the present invention, the following invention can be provided: A composition, (1) comprising nucleic acid, wherein the nucleic acid comprises RNA (preferably naked RNA or free RNA), wherein the composition is administered by an administration method (preferably transdermal administration), which administration method (preferably transdermal administration) comprises spraying the composition onto the surface of a target tissue, thereby penetrating the surface of the target tissue and delivering the composition into the target tissue (preferably the cytoplasm of cells in the target tissue). (2) The spraying is performed at a rate of 70 mm. 2 (3) The composition according to (1) above, wherein the injection is carried out so as to introduce mRNA into an area of ​​200 mm or more (for example, so as to form a swelling of 5 mm or more in diameter in the skin immediately after administration). 2(1) The composition according to (1) above, wherein the injection is performed so as to introduce mRNA into an area of ​​1 mm or more or more (for example, so as to form a swelling of 8 mm or more in diameter on the skin immediately after administration). (4) The composition according to any of (1) to (3) above, wherein the injection is performed by applying pressure to the composition. (5) The composition according to (4) above, wherein the pressurization is caused by the generation of gas from a gas generating agent. (6) The composition according to any of (1) to (5) above, wherein the nucleic acid comprises naked mRNA (preferably free mRNA) (wherein the mRNA may contain pseudouridine). (7) The composition according to any of (1) to (6) above, wherein the composition further comprises an adjuvant. (8) The composition according to (7) above, wherein the adjuvant comprises a RIG-I ligand (e.g., double-stranded RNA) or a STING activator (e.g., cGAMP). (9) The composition according to any one of (1) to (8) above, wherein at least a part or all of the nucleic acid is contained in a lipid nanoparticle (e.g., a vesicle) or a polyion complex (e.g., a micelle or a polymersome). (10) The composition according to any one of (1) to (9) above, for use in (i) delivering a nucleic acid to the epidermis or dermis of a subject, (ii) expressing a nucleic acid in the epidermis or dermis of a subject, (iii) inducing lymphoid follicle formation in the subcutaneous tissue of a subject, and / or (iv) inducing specific immunity (which may be systemic) against a translation product of the nucleic acid in a subject. (11) (iv-1) The composition according to any one of (1) to (10) above, for use in inducing an antibody against a translation product of the nucleic acid in a subject. (12) (iv-2) The composition according to any one of (1) to (11) above, for use in inducing T cell immunity (which may be systemic) against a translation product of the nucleic acid in a subject. (13) A method for administering a nucleic acid to a subject in need thereof, wherein the nucleic acid comprises RNA, the method comprising spraying a composition comprising the nucleic acid against the surface of a target tissue of the subject, whereby the composition is sprayed toward the target tissue and the nucleic acid in the composition penetrates the surface of the target tissue and is delivered into the target tissue.(14) A method for inducing antigen-specific immunity in a subject in need thereof, wherein the nucleic acid comprises mRNA encoding the antigen, the method comprising spraying a composition comprising the nucleic acid against the surface of a target tissue of the subject, whereby the composition is sprayed toward the target tissue and the nucleic acid in the composition penetrates the surface of the target tissue and is delivered into the target tissue.

[0010] (15) The method according to (13) above, wherein the composition is sprayed by applying pressure to the composition. (16) The method according to (14) above, wherein the composition is sprayed by applying pressure to the composition. (17) The method according to any one of (13) to (16) above, wherein the RNA consists of naked mRNA.

[0011] (21) A composition comprising a nucleic acid, wherein the nucleic acid comprises naked RNA (preferably, free RNA), and the composition is administered by transdermal administration, wherein the transdermal administration comprises spraying the composition against the surface of a target tissue, thereby penetrating the surface of the target tissue and delivering it into the target tissue (preferably, the cytoplasm of cells in the target tissue). (22) A composition comprising a nucleic acid, wherein the nucleic acid comprises naked RNA (preferably, free RNA), and the composition is administered by transdermal administration, wherein the transdermal administration comprises spraying the composition against the surface of a target tissue, thereby penetrating the surface of the target tissue and delivering it into the cytoplasm of cells in the target tissue. (23) A composition comprising a nucleic acid, wherein the nucleic acid comprises naked RNA (preferably, free RNA), and the composition is administered by transdermal administration, wherein the transdermal administration comprises spraying the composition against the surface of a target tissue, thereby penetrating the surface of the target tissue and delivering it into the cytoplasm of cells in the target tissue. 2 (24) The composition according to (21) above, wherein the injection is carried out so as to introduce mRNA into an area of ​​200 mm or more (for example, so as to form a swelling of 5 mm or more in diameter in the skin immediately after administration). 2 (25) The composition according to (21) above, wherein the injection is carried out so as to introduce mRNA into an area of ​​70 mm or more (for example, so as to form a swelling of 8 mm or more in diameter in the skin immediately after administration). 2 (26) The composition according to (22) above, wherein the injection is carried out so as to introduce mRNA into an area of ​​200 mm or more (for example, so as to form a swelling of 5 mm or more in diameter in the skin immediately after administration). 2(27) The composition according to any of (21) to (26) above, wherein the RNA is mRNA. (28) An administration device containing an RNA formulation, comprising: (α) an administration device (preferably the administration device described above) equipped with a gas generating unit containing at least a gas generating agent, the gas generating unit having a gas outlet; and (β) an RNA formulation comprising a composition containing RNA and a container storing the composition, the container having a pressurizing port for pressurizing and a spray port for spraying, the pressurizing port of the RNA formulation being connected to the gas outlet of the administration device, and the composition containing RNA can be sprayed from the spray port by the pressure of the gas generated in the gas generating unit. (28-2) An administration device containing an RNA formulation, comprising: (α) an administration device comprising a gas generating unit containing at least a gas generating agent, the gas generating unit having a drive unit for driving a plunger by pressure caused by gas generated from the gas generating agent in the gas generating unit; and (β) an RNA formulation comprising a composition containing RNA and a container storing the composition, the container having a pressurizing port for pressurizing and an ejection port for ejection, wherein a plunger is inserted into the pressurizing port of the RNA formulation in an airtight and liquid-tight manner, and when gas is generated in the gas generating unit, the drive unit drives the plunger, pushing the plunger into the container, thereby ejecting the composition containing RNA from the ejection port.(29) The administration device according to (28) above, wherein the administration device comprises a body having a handle portion and a gas generating unit (actuator) having a container connectable to the body and containing at least a gas generating agent, the gas generating unit (actuator) having a drive unit for pushing the plunger, the RNA formulation comprises a composition containing RNA and a container storing the composition, the container has a pressurization port for pressurization and a spray port for spraying, the plunger is inserted into the pressurization port, and when the plunger is pushed into the container (i.e., pressurized), the composition containing RNA is sprayed from the spray port. (29) The spray is 70 mm. 2 (30) The administration device according to (28) above, wherein the administration is performed so as to introduce mRNA into an area of ​​200 mm or more (for example, so as to form a swelling of 5 mm or more in diameter on the skin immediately after administration). 2 (31) The administration device according to (28) above, wherein the administration is performed so as to introduce mRNA into an area of ​​70 mm or more (for example, so as to form a swelling of 8 mm or more in diameter on the skin immediately after administration). 2 (32) The administration device according to (28-2) above, wherein the administration is performed so as to introduce mRNA into an area of ​​200 mm or more (for example, so as to form a swelling of 5 mm or more in diameter on the skin immediately after administration). 2 The administration device described in (28-2) above is performed so as to introduce mRNA into the above area (for example, so as to form a swelling of 8 mm or more in diameter in the skin immediately after administration).

[0012] (41) An RNA preparation comprising: a composition containing RNA; and a first container storing the composition; wherein the container has a pressure port for pressurizing and an ejection port for ejection, a plunger inserted into the pressure port, and the plunger can be pushed into the first container; when the plunger is pushed into the first container from the pressure port (i.e., pressurized), the composition containing RNA is ejected from the ejection port, thereby allowing at least the RNA to penetrate the tissue surface and penetrate into the tissue. (42) The RNA formulation according to (41) above, further comprising a gas generating unit (actuator), the gas generating unit comprising a second container containing at least a gas generating agent, the gas generating unit (actuator) having a drive unit for pushing the plunger, and the plunger can be pushed into the first container via the drive unit by gas generated from the gas generating agent, and when the plunger is pushed into the first container from the pressure port (i.e., pressurized), a composition containing RNA is sprayed from the spray port, thereby allowing at least the RNA to penetrate the tissue surface and penetrate into the tissue. (43) The RNA formulation according to (42) above, further comprising a body portion of the administration device, wherein the body portion has a handle portion, a switch, a voltage generating unit electrically connected to the switch, and a plug electrically connected to the voltage generating unit, and also has a holder portion to which a gas generating unit (actuator) can be fixed, the gas generating unit is fixed to the holder portion, and the plug of the body is electrically connected to an ignition plug of the gas generating unit (actuator), whereby when the switch is turned on, a voltage is generated from the voltage generating unit, igniting the ignition plug and generating gas from the gas generating agent in the second container of the gas generating unit. (44) An RNA formulation configured such that the spray is 70 mm 2 (45) The RNA formulation according to (41) above, wherein the injection is carried out so as to introduce the mRNA into an area of ​​200 mm or more (for example, so as to form a swelling of 5 mm or more in diameter in the skin immediately after administration). 2(46) The RNA formulation according to (41) above, wherein the injection is carried out so as to introduce the mRNA into an area of ​​70 mm or more (for example, so as to form a swelling of 8 mm or more in diameter on the skin immediately after administration). 2 (47) The RNA formulation according to (42) above, wherein the injection is carried out so as to introduce the mRNA into an area of ​​200 mm or more (for example, so as to form a swelling of 5 mm or more in diameter in the skin immediately after administration). 2 (48) The RNA formulation according to (42) above, wherein the injection is carried out so as to introduce the mRNA into an area of ​​70 mm or more (for example, so as to form a swelling of 8 mm or more in diameter in the skin immediately after administration). 2 (49) The RNA formulation according to (43) above, wherein the injection is carried out so as to introduce the mRNA into an area of ​​200 mm or more (for example, so as to form a swelling of 5 mm or more in diameter in the skin immediately after administration). 2 The RNA formulation according to (43) above, which is administered so as to introduce mRNA into an area of ​​at least 8 mm in diameter (for example, administered so as to form a swelling in the skin with a diameter of at least 8 mm immediately after administration).

[0013] (61) The RNA formulation described above, which does not contain a lipid component. (62) The RNA formulation described above, which does not contain a polyethylene glycol component. (63) The RNA formulation described above, wherein the RNA is naked RNA. (64) The RNA formulation described above, wherein the RNA is RNA containing pseudouridine (e.g., m1Ψ). (65) The RNA formulation described above in (64), wherein all uridines in the RNA are replaced with pseudouridines (e.g., m1Ψ). (66) The RNA formulation described above in (64), wherein the RNA is naked mRNA, and all uridines in the RNA are replaced with pseudouridines (e.g., m1Ψ). (67) The RNA formulation described above in (66), which does not contain a lipid component and / or a polyethylene glycol component.

[0014] Figure 1 shows the results of measuring luciferase chemiluminescence from mice administered with intradermal injection or the transdermal administration method of the present invention to Balb / C mice using IVIS. Figure 2A shows the appearance of the skin after administration. Figure 2B shows the appearance of the skin after administration. Figure 3A shows the results of measuring luciferase chemiluminescence from mice administered with intradermal injection or the transdermal administration method of the present invention to C57BL6J mice using IVIS, and the epidermis of the mice after administration. Figure 3B shows the expression of luciferase in the body of a mouse administered with mRNA via the transdermal administration method of the present invention, and the distribution of luciferase expression in the body of a mouse administered with lipid nanoparticles (LNPs) intradermally. Figure 4 shows the results of IVIS observation of chemiluminescence from the skin of a mouse administered with luciferase-encoding naked mRNA via the transdermal administration method of the present invention. Figure 5 shows the results of immunohistochemical staining of lymphoid follicles formed in the skin tissue of mice administered naked mRNA encoding GFP by the transdermal administration method of the present invention. Figure 6A shows the induction of OVA-specific immunity in mice administered 4.5 μg of m1Ψ-modified mRNA encoding ovalbumin (OVA) into the left and right ventral regions. Figure 6B shows the induction of OVA-specific immunity in mice administered half the dose of N1m1Ψ-modified mRNA encoding ovalbumin (OVA) into the left and right ventral regions. Figure 7 shows the induction of cytotoxic T cells (CTLs) in mice administered 4.5 μg of unmodified mRNA encoding ovalbumin (OVA) into the left and right ventral regions. Figure 8 shows the induction of IgG, IgG1, and IgG2a in mice administered 4.5 μg of unmodified or m1Ψ-modified mRNA encoding ovalbumin (OVA) in the left and right ventral regions in the presence or absence of adjuvant (double-stranded RNA or cGAMP). Figure 9 shows the IgG2a / IgG1 ratio after administration of m1Ψ-modified mRNA, calculated from the results shown in Figure 8. Figure 10 shows the amount of OVA-specific IgG in plasma obtained from mice that were administered 9 μg of m1Ψ-modified mRNA encoding ovalbumin (OVA) in the unilateral ventral region and then, 3 weeks later, administered the same or contralateral ventral region and maintained for 2 weeks.Figure 11 shows the number of OVA-specific INF-γ-positive cells in spleen cells obtained from mice that were administered 4.5 μg of unmodified mRNA encoding SARS-CoV-2 helicase twice in the left and right ventral regions and maintained for one week, as well as the results of an ELISpot assay. Figure 12A shows the induction of cytotoxic T cells (CTLs) in mice that were administered 4.5 μg of unmodified mRNA encoding ovalbumin (OVA) in the left and right ventral regions. Figure 12B shows the results of IVIS observation of luciferase-derived chemiluminescence in mice that received naked mRNA encoding luciferase via the transdermal administration method of the present invention and mice that received the LNP formulation and intramuscular injection. Figure 13 shows the enlargement of the liver and spleen in mice that received LNP. Figure 14A shows the titers and neutralizing ability of S protein-specific antibodies in the plasma of Balb / C mice administered mRNA encoding the spike protein (S protein) of the coronavirus (Wuhan strain) by the transdermal administration method of the present invention, as well as the activation of S protein-specific cellular immunity in the splenocytes of the mice. Figure 14B shows the titers and neutralizing ability of S protein-specific antibodies in the plasma of C57BL6J mice administered mRNA encoding the spike protein (S protein) of the coronavirus (Wuhan strain) by the transdermal administration method of the present invention, as well as the activation of S protein-specific cellular immunity in the splenocytes of the mice. Figure 14C shows the expression of inflammatory cytokines (specifically, interferon β1 and interleukin 6) in the liver and spleen of mice administered mRNA encoding the spike protein (S protein) of the coronavirus (Wuhan strain) by the transdermal administration method of the present invention and a group administered mRNA encapsulated in LNPs subcutaneously. Figure 14D shows the antibody titer and neutralizing ability of S protein-specific antibodies in the plasma of cynomolgus monkeys administered mRNA encoding the spike protein (S protein) of the coronavirus (Wuhan strain) by the transdermal administration method of the present invention. Figure 15 is a schematic diagram of an RNA formulation of the present invention. Figure 16 is a schematic diagram of an RNA formulation of the present invention connected to an administration device. Figure 17 is a schematic diagram of an administration device equipped with a gas generator. Figure 18 is a schematic diagram of the gas generator. Figure 19 shows the body of an administration device equipped with a holder for the gas generator.FIG. 20 is a schematic diagram of the body of the administration device before connection to the gas generating unit. Specific Description of the Invention

[0015] <Definition of Terms> In this specification, defined terms have the meanings as defined. Undefined terms have the meanings commonly used in the technical field. The singular form does not exclude plural. "Comprise" means that elements other than those specified may be included, and "consist of" means that elements other than those specified are substantially free (for example, only including unavoidable contamination of the elements in the production, or containing only an amount that does not substantially affect the function, or containing only the elements at levels below the detection limit), or are completely free of elements other than those specified.

[0016] As used herein, a "subject" may be an animal or plant. An animal or plant includes animals and plants. An animal may be, for example, a vertebrate, for example, a mammal or a bird. A mammal may be, for example, a primate, such as a human, a rodent, such as a mouse or a rat, or a domestic mammal, such as a cow, a horse, a sheep, a donkey, a sheep, a goat, a llama, or a camel. An example of a bird may be, for example, a chicken.

[0017] As used herein, "target tissue" refers to tissues such as skin (preferably the epidermis and dermis) and various organs. Therefore, the surface of a target tissue includes the surface of the skin, the surface of tissues such as mucous membranes, and the surface of various organs. In the present invention, a composition is administered by penetrating (or passing through) the surface of a target tissue, and administration by penetrating (or passing through) the skin surface is referred to as transdermal administration. As used herein, "skin" refers to the layer covering the outer surface of the body. Skin is composed of the epidermis and dermis. The epidermis is a tissue derived from the ectoderm and is primarily composed of keratinocytes. The epidermis has a basal layer on a basement membrane containing basal cells that divide actively in contact with the dermis. Epidermal cells derived from basal cells migrate outward from the basal side, transforming into spinous cells, granular cells, and keratinocytes. The dermis is a mesodermally derived tissue present in the lower layer of the epidermis. The dermis contains collagen-producing fibroblasts and immune cells such as mast cells, which are involved in immune function and inflammation. The dermis contains sweat glands such as eccrine and apocrine glands.

[0018] As used herein, the term "nucleic acid" includes deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), as well as modified nucleic acids thereof. Examples of nucleic acids include, but are not limited to, nucleic acids containing only DNA, nucleic acids containing only RNA, nucleic acids containing only DNA and RNA, nucleic acids containing DNA and modified nucleic acids, nucleic acids containing RNA and modified nucleic acids, and nucleic acids containing DNA, RNA, and modified nucleic acids.

[0019] As used herein, "messenger RNA" (mRNA) refers to RNA that has a protein-coding region and is capable of producing the protein as a translation product in a cell. mRNA typically has a 5' cap structure, a 5' untranslated region (UTR), a coding region, a 3' UTR, and a polyadenine sequence. The 5' cap structure may be, for example, a cap containing N7-methylguanosine (m7G) (e.g., m7GpppG cap, 3'-O-methyl-m7GpppG cap). The 5' UTR and 3' UTR, for example, facilitate translation of a protein from an mRNA.

[0020] As used herein, a "modified nucleic acid" refers to a derivative of DNA or RNA, and may be DNA or RNA modified for purposes such as enhanced hybridization ability, stability against degradation, or thermal stability. Modified nucleic acids include, but are not limited to, fluorescent dye-modified nucleic acids, biotinylated nucleic acids, and nucleic acids into which a cholesteryl group has been introduced. To enhance the stability of RNA, bases may be modified with 2'-O-methyl, 2'-fluoro, or 2'-methoxyethyl (MOE), and the phosphodiester bond in the nucleic acid backbone may be replaced with a phosphorothioate bond. Modified nucleic acids include crosslinked nucleic acids. Examples of such artificial nucleic acids include locked nucleic acid (LNA), which is a crosslinked DNA in which the oxygen atom at the 2' position and the carbon atom at the 4' position are crosslinked via a methylene; ENA, which is a crosslinked DNA in which the oxygen atom at the 2' position and the carbon atom at the 4' position are crosslinked via an ethylene; and nucleotides in which the oxygen atom at the 2' position and the carbon atom at the 4' position are crosslinked via a -CH. 2 OCH 2 BNACOC bridged via -, the oxygen atom at the 2' position and the carbon atom at the 4' position are -NR-CH 2 -{where R is a methyl or hydrogen atom}, bridged nucleic acids (BNAs) such as BNANCs bridged via -{where R is a methyl or hydrogen atom}, 2 (OCH 3 )-bridged cMOE, the oxygen atom at the 2' position and the carbon atom at the 4' position are -CH 2 (CH 3Examples of modified nucleic acids include cEt bridged via a 2'-aminoethyl glycine (N-(2-aminoethyl)glycine)-, AmNA bridged via an amide at the 2' and 4' carbon atoms, scpBNA bridged via a methylene at the 2' oxygen atom and the 4' carbon atom, forming a cyclopropane at the 6' position, peptide nucleic acids (PNAs) having a polymer backbone in which N-(2-aminoethyl)glycine is amide-linked instead of deoxyribose or ribose, and morpholino oligos in which bases are linked via morpholine rings (e.g., U.S. Pat. No. 9,469,664B, the entirety of which is incorporated herein by reference). Modified nucleic acids may have acidic properties, but are not necessarily acidic. Examples of mRNAs containing modified nucleosides include those described in U.S. Pat. No. 8,278,036B, the entirety of which is incorporated herein by reference. Modified nucleosides include, for example, pseudouridine, which is known as a modified nucleoside for in vivo expression of mRNA. Modified nucleosides can replace unmodified nucleosides. Pseudouridine includes, for example, 1-methyl-3-(amino-5-carboxypropyl)pseudouridine (m 1 acp 3 Examples of such pseudouridines include 1-methylpseudouridine (m1Ψ), 2'-O-methylpseudouridine (Ψm), 5-methyldihydriuridine (m5D), and 3-methylpseudouridine (m3Ψ), which can replace uridine. The modified mRNA preferably contains pseudouridine, and may further preferably contain 5-methylcytidine.

[0021] As used herein, "vesicles" refer to particles capable of storing substances inside. As used herein, nanovesicles refer to vesicles having a hydrodynamic diameter of less than 1 μm. Vesicles may be, for example, micelles, which are composed of a single membrane and capable of storing substances inside, or hollow vesicles, which are composed of a double membrane and capable of storing substances inside.

[0022] As used herein, "lipidic nanoparticles" (LNPs) refer to nanoparticles that are nanovesicles composed of lipid molecules (e.g., micelles and liposomes) or complexes (lipoplexes) of lipid molecules and components such as nucleic acids. Lipid nanoparticles include the nucleic acid-lipid particles described in U.S. Pat. No. 8,058,069B, the entire contents of which are incorporated herein by reference. Amphiphilic lipids can form lipidic nanoparticles in aqueous solutions. Those skilled in the art can appropriately select lipids to form lipidic nanoparticles from the lipids.

[0023] As used herein, RNA refers to naked RNA or vesicle-encapsulated RNA. Here, "naked RNA" refers to RNA that exists in a form that is not encapsulated in a vesicle. Among naked RNA, RNA that is not bound to other components is particularly referred to as free RNA.

[0024] As used herein, "isolation" refers to the removal of at least one or more contaminants contained in a system. For example, isolation refers to the removal of a target substance from a cell. As used herein, "purification" refers to the improvement of the purity of a target substance. In compositions to be applied to the human body (e.g., pharmaceutical compositions for humans and vaccines for humans), the components are usually each isolated or purified.

[0025] <Compositions of the Present Invention> The compositions of the present invention comprise nucleic acids. In some embodiments of the present invention, the nucleic acids comprise RNA (particularly isolated RNA). In some embodiments of the present invention, the nucleic acids comprise only RNA. In some embodiments of the present invention, the nucleic acids comprise DNA or modified nucleic acids and RNA. In a preferred embodiment of the present invention, the RNA is single-stranded RNA. In some embodiments of the present invention, the RNA may be RNA encapsulated in a vesicle (e.g., lipid nanoparticle, micelle, or liposome). In some embodiments of the present invention, the RNA may be in the form of a complex with lipid molecules (lipoplex). In some embodiments of the present invention, the RNA may be in a complex with a cationic polymer (polyion complex, e.g., polyion complex micelle or polymersome). In a preferred embodiment of the present invention, the RNA is naked RNA. In a preferred embodiment of the present invention, the nucleic acid may be naked single-stranded RNA (particularly free RNA).

[0026] In a preferred embodiment, the RNA may be messenger RNA (mRNA). In a preferred embodiment, each base of the mRNA consists of an unmodified base. In a preferred embodiment, the mRNA may contain modified nucleic acids. Particularly preferred mRNAs may contain pseudouridine instead of uridine, and in more preferred mRNAs, some or all uridines (particularly all uridines) are changed to pseudouridine. In a particularly preferred embodiment, the pseudouridine is m1Ψ.

[0027] mRNA encodes proteins. Proteins encoded by mRNA include components or parts thereof specific to heterologous organisms, such as pathogens, and components or parts thereof specific to cancer cells. Pathogens include pathogenic viruses, pathogenic microorganisms, and pathogenic parasites. Pathogenic viruses include viruses selected from the group consisting of human immunodeficiency virus (HIV), hepatitis A, hepatitis B, hepatitis C, herpesvirus, adenovirus, influenza virus, flavivirus, echovirus, rhinovirus, coxsackievirus, coronavirus (e.g., severe acute respiratory syndrome-associated coronavirus (SARS-CoV), Middle East respiratory syndrome-associated coronavirus (MERS), SARS-CoV-2), respiratory syncytial virus, mumps virus, rotavirus, measles virus, rubella virus, parvovirus, vaccinia virus, human T-cell leukemia (HTL) virus, dengue virus, papillomavirus, molluscum contagiosum virus, poliovirus, rabies virus, John Cunningham (JC) virus, and arboviral encephalitis virus. Pathogenic microorganisms include pathogenic bacteria, including bacteria selected from the group consisting of chlamydia, rickettsiales, mycobacteria, staphylococci, streptococci, pneumococci, meningococci and gonococci, Klebsiella, Proteus, Serratia, Pseudomonas, Legionella, diphtheria, Salmonella, bacillus, cholera, tetanus, botulism, anthrax, plague, leptospirosis, and Lyme disease bacteria. Pathogenic microorganisms include pathogenic fungi, such as Candida (e.g., albicans, krusei, glabrata, tropicalis), Cryptococcus neoformans, Aspergillus (e.g., fumigatus, niger), Mucorales (e.g., Mucor, Abscisicida, Rhizopus), Sporothrix schenckii, Blastomyces dermatitidis, Paracoccidioides brasiliensis, Coccidioides immitis, and Histoplasma capsulatum.Pathogenic parasites include those selected from the group consisting of Entamoeba histolytica, Balanchine coli, Naegleria fowleri, Acanthamoeba spp., Giardia lamblia, Cryptosporidium spp., Pneumocystis carinii, Plasmodium vivax, Babesia microti, Trypanosoma brucei, Trypanosoma cruzi, Leishmania donovani, Toxoplasma gondii, and Oncus brasiliensis. Thus, in one embodiment of the present invention, the mRNA can encode a component (preferably a surface antigen) of these pathogens or a portion thereof. In particular, among the surface antigens of pathogens, antigens used by pathogens to infect cells, such as the S protein of a betacoronavirus, can be preferably encoded by the mRNA of the present invention. Examples of cancer include bladder cancer, breast cancer, uterine cancer, endometrial cancer, ovarian cancer, colorectal cancer, colon cancer, head and neck cancer, lung cancer, gastric cancer, germ cell cancer, bone cancer, squamous cell carcinoma, skin cancer, central nervous system neoplasms, lymphoma, leukemia, sarcoma, virus-related cancer, small cell lung cancer, non-small cell lung cancer, gastrointestinal cancer, Hodgkin's or non-Hodgkin's lymphoma, pancreatic cancer, glioblastoma, glioma, cervical cancer, ovarian cancer, liver cancer, myeloma, salivary gland cancer, kidney cancer, basal cell carcinoma, melanoma, prostate cancer, vulvar cancer, thyroid cancer, testicular cancer, esophageal cancer, and head and neck cancer. In some embodiments of the present invention, the mRNA may be an antigen specific to these cancers (cancer-specific antigen, preferably a cancer-specific surface antigen) or a portion thereof. The cancer-specific antigen may be, for example, a neoantigen or a portion thereof characteristic of a neoantigen. Cancer-specific antigens also include, for example, cancer-testis antigens (e.g., proteins of the MAGE family, NY-ESO-1), differentiation antigens (e.g., tyrosine kinase in melanoma, Melan-A / MART-1, PSA in prostate cancer), overexpressed cancer antigens (e.g., Her-2 / Neu, survivin, telomerase, and WT-1), cancer-induced mutants of β-catenin, cancer-induced mutants of CDK4, MUC-1, particularly MUC-1 with altered glycosylation patterns, and E6 or E7 of human papillomavirus.With regard to these, a person skilled in the art can select an appropriate antigen depending on the type of infectious disease and cancer with which the subject is suffering and the type of antigen expressed in the cancer, and prepare mRNA suitable for the present invention.

[0028] In some preferred embodiments, the compositions of the present invention are substantially free of or free of lipid nanoparticles and their components. In some embodiments, the compositions of the present invention are substantially free of or free of polyethylene glycol components. In some embodiments, the nucleic acid in the compositions of the present invention comprises RNA, and the RNA consists of naked RNA (preferably mRNA). In some embodiments, the nucleic acid in the compositions of the present invention comprises RNA, and the RNA comprises RNA (preferably mRNA) encapsulated in lipid nanoparticles.

[0029] The composition of the present invention may further comprise an adjuvant. Examples of the adjuvant include, but are not limited to, poly I:C polynucleotide, double-stranded RNA, lipopolysaccharide (LPS), CD40 ligand, a ligand for toll-like receptor TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, or TLR10, or a ligand for TLR13, a ligand for NOD-like receptor, a retinoic acid-inducible gene I (RIG-I) ligand, an immunostimulatory nucleic acid, an immunostimulatory RNA (isRNA), CpG-DNA, a STING activator, e.g., For example, the adjuvant may be selected from the group consisting of cGAMP (e.g., natural cGAMP, or, for example, cyclic GMP-AMP, particularly that produced intracellularly by cyclic GMP-AMP (cGAS), e.g., 2',3'-cGAMP), Freund's incomplete adjuvant, and aluminum-based adjuvants (e.g., alums such as aluminum hydroxide and aluminum phosphate) (see WO2017 / 083963, the entire contents of which are incorporated herein by reference).

[0030] In a preferred embodiment, the double-stranded RNA may hybridize to mRNA using a portion of its base sequence (see WO2018 / 124181, the entire contents of which are incorporated herein by reference). In this embodiment, the RNA may have a blunt 5' end and / or the blunt 5' end may have a triphosphate.

[0031] The compositions of the present invention may further comprise a pharmaceutically acceptable carrier, additive, or excipient. For example, the compositions of the present invention may be an aqueous formulation and may further comprise a pharmaceutically acceptable salt (e.g., a sodium salt), a pH buffer, and / or a metal chelator. The compositions of the present invention are RNAase-free and sterilized (e.g., sterilized by electron beam irradiation, etc.).

[0032] The compositions of the present invention may be, for example, an aqueous solution, a cream, an ointment, an emulsion (e.g., an O / W emulsion), a powder, granules, or a gel, provided that the compositions of the present invention are in a form suitable for delivery by pressurization.

[0033] <Administration method of the composition of the present invention> The composition of the present invention is administered by the administration method of the present invention. Specifically, the administration method of the present invention comprises spraying the composition (e.g., an aqueous solution) onto the surface of the target tissue. The spraying is performed with sufficient or appropriate intensity to penetrate the surface of the target tissue and deliver the composition into the target tissue. Thus, the administration method of the present invention comprises spraying the composition onto the surface of the target tissue with sufficient intensity to penetrate the surface of the target tissue and deliver the composition into the target tissue. Sufficient intensity may be, for example, an intensity that reaches a depth of about 0.2 mm to 3 mm from the surface of the target tissue.

[0034] In a preferred embodiment, the composition can be sprayed by pressurizing it. Pressurization can be achieved by pressurizing the composition with a gas. In a preferred embodiment, the composition is stored in a container, which is equipped with a pressurization port for pressurizing the inside of the container and a nozzle for spraying, and the composition can be sprayed from the nozzle. The inside of the container can be pressurized by generating gas or expanding the gas and spraying the gas into the container containing the composition, and the composition can be sprayed from the nozzle provided in the container by this pressure. The gas used for pressurization can be generated, for example, from a gas generating agent. The gas generating agent can generate gas by combustion. Gas generation from the gas generating agent can be caused directly or through the combustion of an ignition charge. The generated gas reaches the pressurization port and pressurizes the inside of the container. In contrast, the nozzle has a relatively low pressure, and the composition is sprayed from the pressurized container through the nozzle. In a preferred embodiment, the pressurization utilizes explosive force generated by gas generation. The explosive force can be controlled. In a preferred embodiment, as described below, the injection can be performed with RNA formulation 10 described below.

[0035] The ignition charge may be, but is not limited to, any one of the following explosives: zirconium and potassium perchlorate; titanium hydride and potassium perchlorate; titanium and potassium perchlorate; aluminum and potassium perchlorate; aluminum and bismuth oxide; aluminum and molybdenum oxide; aluminum and copper oxide; and aluminum and iron oxide; or a combination of these. For example, a zirconium-potassium perchlorate (ZPP) mixture may be used as the ignition charge. For example, a gas generant may be a powder containing nitrocellulose, diphenylamine, and potassium sulfate. The gas generant may also be any of the various gas generants used in airbag gas generators and seatbelt pretensioner gas generators. The gas generant may preferably be a smokeless powder containing 95 to 99% by weight (e.g., 98%) of nitrocellulose, 0.5 to 1.5% by weight (e.g., 0.8% by weight), and potassium sulfate (0.7 to 2% by weight (e.g., 1.2% by weight)). It is preferable that the ignition charge does not generate gas at a level that would cause substantial fluctuations in pressure during combustion. The gas generant can generate a pressure of 5 to 50 MPa, preferably 20 to 40 MPa, and more preferably 25 to 34 MPa, upon gas generation. Those skilled in the art will be able to appropriately select and use the gas generant and ignition charge. Furthermore, the pressure may reach its maximum, for example, within 10 to 30 milliseconds after gas generation.

[0036] The injection can be performed multiple times using the same or different pressures. In this case, it may be effective to increase the skin permeability by the first pressure and then penetrate the drug solution into the skin by the second pressure.

[0037] In the present invention, the composition can be widely permeated onto the skin by transdermal administration using jet spray. 2) or greater, an area of ​​skin receives the composition (particularly mRNA, preferably mRNA encoding an immunogen). Thus, transdermal administration by jet propellant can cause a circular bulge of 2 mm or greater in diameter to form on the skin surface. In one embodiment, skin having an area equivalent to a circular area of ​​2 mm or greater, 3 mm or greater, 4 mm or greater, 5 mm or greater, 6 mm or greater, 7 mm or greater, 8 mm or greater, 9 mm or greater, or 10 mm or greater in diameter receives the composition (particularly mRNA, preferably mRNA encoding an immunogen). In one embodiment, 2 More than 10 mm 2 More than 20 mm 2 Above, 30mm 2 Above 40mm 2 Above 50 mm 2 Above, 60mm 2 Above 70 mm 2 Above 80mm 2 Above 90mm 2 Over 100mm 2 Above, 110mm 2 Above 120mm 2 Above 130mm 2 Above 140mm 2 Above, 150mm 2 Above, 160mm 2 Over 170mm 2 Above, 180mm 2 Over 190mm 2 or more, or 200 mm 2 These areas of skin receive the composition (particularly mRNA, preferably mRNA encoding an immunogen). In these embodiments, a bulge may form in the area of ​​skin. In some embodiments, the mRNA encodes a protein whose expression in skin-resident immune cells is beneficial. In some embodiments, the mRNA encodes an immunogen. In some embodiments, the mRNA encodes a viral antigen. In some embodiments, the mRNA encodes a cancer antigen.

[0038] <Medical Uses of the Composition of the Present Invention> The composition of the present invention can be used for medical purposes. For example, the composition of the present invention can deliver nucleic acids, including RNA, to target tissues. If the RNA is functional RNA, it can achieve the desired medical effect. If the RNA encodes a protein, the RNA can express the protein in the target tissue.

[0039] The compositions of the present invention can be used, for example, to deliver nucleic acids to the skin tissue (e.g., epidermis or dermis) of a subject. The compositions of the present invention can be preferably used to deliver nucleic acids to the dermis of the skin tissue of a subject. The compositions of the present invention can be used to express nucleic acids in the dermis of a subject.

[0040] The compositions of the present invention can be used to form lymph nodes (lymph follicles) in the subcutaneous tissue of a subject. The lymph follicles may contain immune cells, such as dendritic cells. The compositions of the present invention can be used to deliver nucleic acids to and / or express nucleic acids in lymph nodes (lymph follicles) in the subcutaneous tissue.

[0041] The compositions of the present invention can also be used, for example, to induce specific immunity in a subject against the translation product of the nucleic acid contained in the composition (i.e., the protein encoded by the nucleic acid, etc.). The specific immunity is preferably systemic. The compositions of the present invention can also preferably be used to induce antibodies in a subject against the translation product of the nucleic acid. The antibodies may be, for example, IgG. The compositions of the present invention can further preferably be used to induce T cell immunity in a subject against the translation product of the nucleic acid. The T cell immunity may be the induction of CD4 single-positive T cells and / or CD8 single-positive T cells.

[0042] Therefore, the composition of the present invention can be used as a vaccine, preferably a vaccine against infectious diseases or cancer. In this aspect, according to the present invention, the composition of the present invention can be a vaccine, preferably a vaccine against infectious diseases or cancer can be provided.

[0043] <Nucleic acid administration method according to the present invention> The present invention provides a method for administering a nucleic acid. The nucleic acid includes RNA. As the nucleic acid, the same nucleic acid as described in the composition of the present invention can be used, so please refer to the description in the section on the composition of the present invention and the description will be omitted here.

[0044] According to the present invention, there is provided a method for administering a nucleic acid to a subject in need thereof, comprising spraying the composition onto the surface of a target tissue of the subject, thereby spraying the composition toward the target tissue, penetrating the surface of the target tissue, and delivering the composition into the target tissue. The target tissue may be an organ, or a tissue such as skin or mucosal tissue. Details of the spraying method are as described in the method for administering the composition of the present invention, so reference is made to this and further description is omitted here.

[0045] The method of administering a nucleic acid of the present invention comprises spraying the composition against the surface of a target tissue, thereby delivering the nucleic acid through the surface of the target tissue and into the target tissue.

[0046] In the method for administering a nucleic acid of the present invention, the injection can be performed using an administration device suitable for this. The administration device can include an enclosure that encloses the composition, a pressurizing unit that pressurizes the composition enclosed in the enclosure, and a flow path that defines a flow path so that the composition pressurized by the pressurizing unit is injected onto the surface of the target tissue. The pressurizing unit can pressurize the composition in the pressurizing unit to penetrate the surface, and the pressure increase in the pressurizing unit serves as the driving force for the injection. The pressure increase in the pressurizing unit is caused by gas release from a gas generating agent.

[0047] <Method for Inducing Immunity According to the Present Invention> The present invention provides a method for inducing antigen-specific immunity in a subject, the method comprising spraying the composition (containing mRNA encoding the antigen) onto the skin surface of the subject, thereby spraying the composition toward the target tissue, penetrating the surface of the target tissue, and delivering the composition into the target tissue. Details of the composition and the administration method are as described above. In one aspect, the antigen-specific immunity can be antigen-specific humoral immunity (antibody production). In one aspect, the antigen-specific immunity can be cellular immunity (T cell immunity, particularly T cell immunity mediated by CD8 single-positive T cells and T cell immunity mediated by CD4 single-positive T cells). In one aspect, the antigen-specific immunity can be both antigen-specific humoral immunity (antibody production) and cellular immunity (T cell immunity, particularly T cell immunity mediated by CD8 single-positive T cells and T cell immunity mediated by CD4 single-positive T cells). In one aspect, the method for inducing antigen-specific immunity involves the induction of lymph nodes (lymph follicles) in the skin. The lymph nodes (lymph follicles) can contain dendritic cells.

[0048] <Other Inventions> The present invention provides use of the nucleic acid in the production of a composition of the present invention. The present invention also provides use of the nucleic acid in the production of a composition for use in the medical applications of the present invention.

[0049] In one embodiment of the present invention, an RNA formulation 10 may be provided, comprising an RNA-containing composition 13 and a container 14 containing the composition 13, the container 14 having a pressure port 11 for pressurization and an ejection port 12 for ejection. In a preferred embodiment, the container 14 has a cylindrical shape, and a plunger 11a may be inserted into the pressure port 11 in an airtight and liquid-tight manner. That is, pressurization may be achieved by pushing the plunger 11a into the container 14. In this manner, the pressure of the gas generated by the gas generating agent can be transmitted to the container via the plunger, and the composition can be ejected from the ejection port, while preventing contact of the gas generated by the gas generating agent with the composition. For this purpose, the plunger 11a may have a plunger rubber 11b at its tip. The plunger rubber 11b advantageously allows the plunger to be pushed into the container 14 in an airtight and liquid-tight manner. In a preferred embodiment, the container 14 has a cylindrical shape, and the plunger 11a or plunger rubber 11b can move within the cylinder in an airtight and liquid-tight manner, thereby effectively spraying the composition stored in the container 14 from the nozzle 12. The plunger rubber can be made of rubber (e.g., silicone rubber) to ensure airtight and liquid-tight movement. In a preferred embodiment, the nozzle 12 is aseptically sealed. In a preferred embodiment, the nozzle 12 may be a hole with a diameter sufficient for ejection. The diameter of the hole can be appropriately adjusted to ensure the ejection pressure of the composition inside. The nozzle 12 may also be an opening. The RNA formulation may be aseptically contained in a bag. This RNA formulation can be used to administer to a subject via the subject's tissue surface (e.g., the skin surface). The RNA may be naked RNA, for example, free RNA. In a preferred embodiment, the RNA may be mRNA. The internal volume of the container 14 can be determined appropriately. In this specification, the container 14 may be referred to as a first container.

[0050] The above-mentioned RNA preparation can be administered to a subject by applying pressure from the pressure port, causing the composition containing RNA in the container to be ejected from the ejection port.The method of applying pressure and the composition containing RNA are as described above.Therefore, for the method of applying pressure and the composition containing RNA, please refer to the above, and the repeated explanation here will be omitted.

[0051] The RNA formulation is connected to an administration device (see, e.g., FIG. 17 ), and the composition containing RNA can be sprayed from a nozzle by applying pressure from the administration device (see, e.g., FIG. 16 ). The administration device 50 includes a body 31 with a handle 32 and a gas generator (actuator) 20 with a container 21 containing at least a gas generating agent 23, connectable to the body 31. The gas generator (actuator) 20 has a drive unit 25 for pushing the plunger. The drive unit 25 is connected to the plunger 11a, and can push the plunger 11a into the container 14 via the drive unit 25 as gas is generated from the gas generating agent 23. The administration device 50 and the RNA formulation 10 are configured as separate entities (see, e.g., FIGS. 15 and 17 ). For example, they may be sold separately and connected before use, or they may be sold in a connected state (see, e.g., FIG. 16 ). This allows the RNA formulation to be replaced for each administration. In addition, in the administration device, the body 30 with a handle and the gas generator 20 are configured as separate entities (see Figures 18 and 19). For example, they may be sold separately and connected before use, or they may be sold connected together (see, for example, Figure 17). This allows the body to be reused by replacing the gas generator with a cartridge-type one for each administration. The RNA formulation may also be integrated with the gas generator (see Figure 20). Therefore, in this embodiment, an RNA formulation equipped with a gas generator is provided, and in this RNA formulation, the drive unit 25 of the gas generator is configured to push the plunger 11a into the container 14 as gas is generated from the gas generant 23. The gas generator may further include an ignition charge; for example, the gas generant 23 may further include an ignition charge. In this specification, the container 21 may sometimes be referred to as a second container.

[0052] The gas generating unit (actuator) 20 may include an ignition plug 24 for generating gas from the gas generating agent 23. In this manner, gas can be generated by igniting the gas generating agent 23, etc. The body 30 may also include a plug 33 that can be electrically connected to the ignition plug 24. A voltage generating unit 35 is connected to the plug. This connection may be made via a conductive wire 37 or the like. The voltage generating unit 35 is also connected to a switch 34. This connection may be made via a conductive wire 36 or the like. By turning on the switch 34, the voltage generating unit 35 can generate a voltage and transmit the voltage to the plug 33. The ignition plug 24, electrically connected to the plug 33, generates gas from the gas generating agent 23 in response to the voltage from the plug 33, and when the gas is generated, the drive unit 25 is driven to push the plunger 11a into the container 14. The voltage generating unit may be driven by electricity supplied from an external source or an internal power source.

[0053] In one aspect of the present invention, there is provided the above-mentioned RNA formulation, which comprises a gas generating unit containing at least a gas generating agent, and the gas generating unit is used in connection with an administration device having a gas outlet.

[0054] The RNA formulation of the present invention can be administered using an administration device (α) including a gas generating unit containing at least a gas generating agent, the gas generating unit having a gas outlet. The RNA formulation of the present invention can be connected to the gas outlet of the administration device via a pressurizing port.

[0055] In one aspect of the present invention, there is provided an administration device containing an RNA formulation, comprising: (α) an administration device (preferably the administration device described above) comprising a gas generating unit containing at least a gas generating agent, the gas generating unit having a drive unit that is driven in response to gas generation within the gas generating unit; and (β) an RNA formulation comprising a composition containing RNA and a container that stores the composition, the container having a pressurizing port for pressurizing and a spray port for spraying, the pressurizing port of the RNA formulation being connected to the drive unit of the administration device, and the container can be pressurized by the drive unit that is driven in response to generation of gas in the gas generating unit, thereby allowing the composition containing RNA to be sprayed from the spray port. More specifically, as shown in FIG. 16 , an RNA formulation 100 includes a composition 13 containing RNA and a container 14 storing the composition 13, the container 14 having a pressurizing port 11 for pressurizing and an ejection port 12 for ejection, a plunger 11a being inserted into the pressurizing port 11 in an airtight and liquidtight manner, and pressurization is achieved by pushing the plunger 11a into the container 14, whereby the pressure associated with gas generation in the gas generating section is transmitted to the container via the plunger, and the composition can be ejected from the ejection port, and the administration device further has a body portion 30. An RNA formulation can be provided in which the body portion has a handle portion 32, a switch 34, a voltage generating unit 35 electrically connected to the switch 34, and a plug 33 electrically connected to the voltage generating unit 35, and also has a holder portion 38 to which a gas generating unit (actuator) 20 can be fixed, the gas generating unit 20 is fixed to the holder portion 38, and the plug 33 of the body and the ignition plug 24 of the gas generating unit (actuator) are electrically connected, so that when the switch 34 is turned on, a voltage is generated from the voltage generating unit 35, igniting the ignition plug 24 and generating gas from the gas generating agent 23 in the second container 21 of the gas generating unit.

[0056] The gas release port of the administration device may be directly or indirectly connected to the pressurization port, for example, via a gas delivery pipe between the gas release port and the pressurization port.

[0057] In some embodiments, the RNA formulation can be a vaccine formulation.

[0058] All references cited herein are incorporated by reference in their entirety.

[0059] Example 1 Materials: CleanCap™ FLuc mRNA, EGFP mRNA, 5moU-modified Cre mRNA, ovalbumin (OVA) mRNA, N1-methylpseudouridine (m1Ψ)-modified OVA mRNA, 5'-cap analog (ARCA), m1Ψ-5'-triphosphate, and m1Ψ-modified COVID-19 spike protein mRNA were purchased from Trilink biotechnologies (San Diego, CA, USA). The intradermal administration device, Actranza™ (actuator: 1A1MD-5, container unit: 1C20-5), was purchased from Daicel. cGAMP and OVA were purchased from Sigma. Goat anti-mouse IgG horseradish peroxidase (HRP)-conjugated antibody was purchased from R&D Systems, IgG1 and IgG2a HRP-conjugated antibodies were purchased from Abcam, anti-IFNγ ELISpot was purchased from MABTECH, PepTivator OVA epitope mix was purchased from Miltenyi Biotec, PepMix TM SARS-CoV-2 (Nsp13) epitope mix was purchased from JPT peptide technologies. TM , mMESSAGE mMACHINE TM T7 Transcription Kits were purchased from Thermo Fisher Scientific.

[0060] mRNA synthesis: We commissioned Genscript to create a plasmid containing coronavirus NSP13 in a pSP73 vector with a 120-base polyA / T chain. TM In vitro transcription was performed using a kit, and the DNA was extracted using an RNeasy Mini Kit (Qiagen, Hilden, Germany).

[0061] A 24-nt RNA (GGUGUGUGUGUGUGUGUGUGUGUGUG: SEQ ID NO: 1) was in vitro transcribed from a DNA template of the sequence TAATACGACTCACTATAGGTGTGTGTGTGTGTGTGTGTGTTGTGTGTG (SEQ ID NO: 2) using MEGAshortscript. This RNA was mixed with five types of 43-nt RNAs with the following sequences and OVA mRNA, and hybridized by heat treatment at 65°C for 5 minutes and then at 30°C for 10 minutes to prepare double-stranded mRNA.

[0062]

[0063] Preparation of lipid nanoparticles (LNPs) A citrate buffer solution (pH = 3) containing 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), alpha-(3'-{[1,2-di(myristyloxy)propanoxy]carbonylamino}propyl)-ω-methoxy, polyoxyethylene (PEG2000-DMG), cholesterol, and (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (D-Lin-MC3-DMA) in ethanol was mixed with a NanoAssemblr™ Ignite™ solution containing 3x the volume of mRNA. TM The mixture was prepared using a Precision NanoSystems Inc. (Vancouver, BC, Canada) at a flow rate of 12 mL / min. It was then diluted 40-fold with PBS and ultrafiltered through a 30 kD filter. Ribogreen assay confirmed that the mRNA encapsulation rate was 80% or higher.

[0064] IVIS observation: 20 μL of a solution containing 1 μg of FLuc mRNA was administered to C57BL / 6J mice and Balb / C mice using a syringe (manual) or an Actranza device. For IVIS, 200 μL of a 5 mg / mL luciferin solution was administered, and IVIS was measured 10 minutes later.

[0065] Vaccine: Female C57BL / 6J mice were purchased from Charles River and used for vaccine experiments at 7-9 weeks of age. mRNA was diluted in 10 mM HEPES buffer (pH 7.4), and 20 μL was administered into the flank. To assess efficacy, blood was collected from the inferior vena cava, centrifuged at 2000 × g for 10 minutes at 4°C, and used for antibody detection. Spleens were also collected and used for ELISpot and in vivo cytotoxic T cell assays. For the LNP test of NSP13 (helicase) mRNA, 50 μL of PBS was injected into both quadriceps muscles.

[0066] ELISpot After harvesting, the spleen was immersed in 5 mL of RPMI-1640 medium (containing 10% FBS, 1 mM sodium pyruvate, 10 mM HEPES, 50 μM mercaptoethanol, and 1% penicillin-streptomycin), and a splenocyte suspension was prepared using a metal mesh. The suspension was passed through a 40 μm nylon mesh (Cell strainer, Falcon). A Manual MACS™ Magnetic Separator (Miltenyi Biotec) was used to separate CD4-positive and CD8-positive T cells. These cells were collected at a concentration of 2.5 × 10 5 The cells were seeded onto an anti-IFNγ ELISpot 96-well plate at a concentration of 1000 cells / well, and an epitope mix was added at 0.025 μg / well for OVA and 0.2 μg / well for NSP13. After overnight incubation, the plates were stained according to the protocol, and the number of spots was counted using an ELISpot plate reader (AID GmbH, Germany).

[0067] Antibody quantification Plasma antibody titers were quantified by enzyme-linked immunosorbent (ELISA). To prepare ELISA plates, OVA protein was prepared at a concentration of 2 μg / mL in 50 mM carbonate buffer (pH = 9.6). 50 μL of this solution was added to Clear Flat-Bottom Immuno Nonsterile 96-Well Plates (Thermo) at 50 μL / well and incubated overnight at 4°C. The plates were washed three times with PBS containing 0.5% v / v Tween 20 (PBS-T), and 100 μL of PBS-T containing 1% BSA and 2.5 mM EDTA was added and incubated at room temperature for 1 hour. The solution was then removed and the plate was used for ELISA. Plasma samples were diluted with 1% BSA and 2.5 mM EDTA in PBS-T, then added to the plate at 50 μL / well and incubated overnight at 4°C. After washing three times with PBS-T, 50 μL of goat anti-mouse IgG-HRP (1:8000), goat anti-mouse IgG1-HRP, or IgG2a-HRP (1:10,000) was added and incubated at room temperature for 2 hours. Finally, 100 μL / well of HRP substrate was added and incubated at room temperature for 30 minutes. The reaction was stopped by adding 2 M sulfuric acid, and the absorbance at 492 nm was observed using a plate reader (Tecan, Switzerland). The antibody titer was determined using an absorbance of 0.1 as the threshold.

[0068] In vivo cytotoxic T cell (CTL) test: Vaccinated mice were administered splenocytes treated with an OVA epitope (SIINFEKL), and the survival of the splenocytes in the mice was assessed to evaluate cytotoxic T cell immunity. For SIINFEKL treatment, splenocytes were collected from unvaccinated mice and hemolyzed with ACK lysis buffer to prepare SIINFEKL-treated and untreated cells. SIINFEKL-treated cells were treated with SIINFEKL for 1 hour at 37°C, followed by treatment with 5 μM carboxyfluorescein diacetate (CFSE) at 37°C for 10 minutes. Untreated cells were treated with 0.5 μM CFSE at 37°C for 10 minutes. Equal amounts of SIINFEKL-treated and untreated cells were mixed, and the cell number was 1 × 10 7 The next day, the spleens were collected, suspended, and analyzed using a flow cytometer (LSR Fortessa). TM The cell number was assessed using a Cell Analyzer (BD Biosciences). The cytotoxic activity (%) was calculated by the following formula: [(number of SIINFEKL-untreated cells) - (SIINFEKL-treated cells)] / (SIINFEKL-untreated cells) x 100.

[0069] Lipoplex Preparation: To prepare 1,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA) liposomes, 200 μL of a 60 mM DOTMA (MW = 670.6 g / mol) chloroform solution and 200 μL of a 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) (744 g / mol) chloroform solution were mixed and dried in a glass tube using argon gas to form a film on the wall of the tube. 4 ml of water was added, vortexed vigorously, and sonicated at 23 Hz for 5 minutes. The final DOTMA concentration was adjusted to 3 μmol / mL. The liposomes and mRNA were then mixed at a nitrogen / phosphate (N / P) ratio of 0.5. The final NaCl concentration was adjusted to 150 mM.

[0070] Preparation and observation of HE-stained specimens: The injection site was marked, and a 1 cm square piece of skin tissue was collected with the injection site at the center and fixed in neutral buffered formalin for 24 hours. After fixation, a section approximately 2 mm wide was cut, and the cut skin tissue was infiltrated with paraffin using a paraffin infiltration device. After embedding, the tissue was cooled to prepare a tissue paraffin block (FFPE block). The prepared paraffin block was sliced ​​at 4 μm, stained with hematoxylin and eosin, and then examined under a biological microscope.

[0071] Multi-fluorescence immunohistochemistry was performed on the FFPE blocks prepared as described above. After antigen retrieval by autoclaving in pH 7.0 citrate buffer, the blocks were incubated overnight at 4°C with a diluted mixture of anti-CD11c antibody (Cell Signaling Technology #97585, 200x dilution) and anti-GFP antibody (bcam ab6673, 1000x dilution). After washing, the blocks were incubated at room temperature for 1 hour with a diluted mixture of secondary antibodies (Rabbit 567, Goat 488, Invitrogen). After washing, nuclear staining with DAPI was performed, and images were captured under a fluorescence microscope (Keyence, BZ-X).

[0072] Results: We investigated methods for transdermal administration of naked mRNA encoding luciferase. The first method was intradermal injection. A solution containing 1 μg of mRNA was intradermally injected into the ventral region of mice (Balb / c, n=3) (intradermal administration group). Ivis observation revealed a total luminescence intensity of approximately 100,000 (see Figure 1). Known devices for transdermal administration of DNA include those that jet-eject DNA from a nozzle for transdermal administration (see, for example, JP 2012-061269, JP 2012-065920, JP 2012-065922, JP 2014-147841, JP 2014-176759, JP 2016-221411, PHARMACEUTICS, DRUG DELIVERY AND PHARMACEUTICAL TECHNOLOGY | VOLUME 108, ISSUE 7, P2415-2420, JULY 01, 2019, AAPS PharmSciTech volume 21, Article 1). number: 19 (2020), https: / / doi.org / 10.1101 / 2021.01.13.426436, which are incorporated herein by reference in their entireties.) A delivery device based on these technologies is Actranza. TM It is sold by Daicel Corporation under the name Labo. Hereinafter, "transdermal administration" refers to transdermal administration using this administration device. Actranza TM Rather than simply using a single gas jet to deliver a substance to the skin, the lab uses two gas jets. The first is thought to improve skin permeability, while the second allows the drug to penetrate. TM The laboratory administered the above-mentioned luciferase-encoding naked mRNA transdermally to mice (Balb / c, n=3) (referred to as the "transdermal administration group"). The total luminescence intensity measured by Ivis exceeded approximately 10 million (see Figure 1). This demonstrated an expression efficiency 100 times higher than that of the intradermal administration group.

[0073] Figure 2A shows the appearance of the administration site. As shown in Figure 2A, no difference in the appearance of the skin was observed between the intradermal administration group and the percutaneous administration group. Next, Actranza was similarly applied to the shaved skin of the monkeys. TM The luciferase-encoding naked mRNA (50 μL) was administered transdermally by a laboratory. As shown in Figure 2B, the resulting swelling after administration was approximately 1 cm in diameter, suggesting that the mRNA penetrated a wide area of ​​the skin. The ability to penetrate the mRNA over a wide area is considered advantageous in terms of increasing the possibility of delivery to immune cells (especially dendritic cells) present in the skin.

[0074] Actranza (trademark) performs two jet sprays with one operation, improving skin permeability with the first spray and allowing the medicinal solution to penetrate more widely into the skin with the second spray (see, for example, JP 2021-061269 A). The two sprays are expected to be effective in increasing the amount of medicinal solution that penetrates. Furthermore, by utilizing jet spray, Actranza (trademark) can spray the medicinal solution over a wide area, which is expected to result in the medicinal solution penetrating more widely into the skin.

[0075] The same experiment was also performed on mice (C57BL6J). The results are shown in Figure 3A. The transdermal administration group showed significantly higher gene expression levels than the intradermal administration group, even depending on the mouse strain. The site of luciferase expression after administration was observed using Ivis. As a result, as shown in Figure 3B, in the transdermal administration group, gene expression was localized to the administration site. LNPs encapsulating luciferase-encoding mRNA were intradermally injected, and the site of luciferase expression after injection was observed using Ivis. As shown in Figure 3B, strong luciferase expression was observed in the liver, not at the administration site.

[0076] Skin tissue sections were prepared from the administration site of mice in the transdermal administration group and subjected to hematoxylin-eosin staining. Surprisingly, in the transdermal administration group, lymph nodes (lymph follicles) were observed to be induced in the subcutaneous tissue (see Figure 4). Such lymph follicle induction was not observed in the intradermal administration group. This suggests that immunity was induced at the administration site in the transdermal administration group. Normally, lipid nanoparticles (LNPs) leak from the skin even after intradermal administration, migrate throughout the body, and some of them are thought to migrate to lymph nodes, where they activate the immune system. This suggests that the immune induction mechanism and risk of side effects are different from those of LNP administration.

[0077] Immune cells in lymphoid follicles induced as described above were observed. mRNA encoding green fluorescent protein (GFP) was prepared as described above and administered intradermally to mice in the same manner. One day later, tissues containing intradermally induced lymphoid follicles were subjected to immunohistochemical staining. Dendritic cells were detected by staining with an anti-CD11 antibody to confirm the expression of the introduced mRNA in dendritic cells. As shown in Figure 5, the GFP fluorescent signal colocalized with the CD11 signal. This demonstrates that the mRNA was internalized and expressed in dendritic cells in the induced lymphoid follicles. In this example, the mRNA was administered to the subject at a dose that reached the dermis but not the subcutaneous tissue. Therefore, the above results suggest that dendritic cells in the epidermis or dermis internalized the mRNA and then gathered in the subcutaneous tissue to form lymph nodes.

[0078] Example 2: Induction of antigen-specific immunity by transdermal administration Naked m1Ψ-modified mRNA encoding ovalbumin was prepared as described in Example 1. 4.5 μg of the mRNA was administered to the right ventral side of each mouse, 4.5 μg of the mRNA was administered to the left ventral side of each mouse, and Actranza TMThe mice were administered the vaccine either intradermally (transdermal administration group) or intradermally (intradermal administration group) by the laboratory. At week 3, the same amount of naked mRNA encoding ovalbumin was administered as a booster immunization in the same manner as above. At week 5, plasma was collected and subjected to ELISA assay, and spleen cells were collected and subjected to ELISpot assay.

[0079] The results are shown in Figure 6A. While no significant difference in OVA-specific IgG induction was observed between the intradermal administration and the untreated group, the transdermal administration significantly induced OVA-specific IgG (see Figure 6A, left). Furthermore, ELISpot assays showed a significant increase in the number of INF-γ-producing T cell spots in the transdermal administration group compared with the intradermal administration group (see Figure 6A, center). ELISpot assays performed on CD4-single-positive T cells and CD8-single-positive T cells revealed that transdermal administration significantly induced both CD4-single-positive T cells and CD8-single-positive T cells (see Figure 6A, right).

[0080] Each mouse was administered 2 μg (1 μg each on the left and right), 9 μg (4.5 μg each on the left and right), or 18 μg (9 μg each on the left and right) of mΨU-modified OVA mRNA by transdermal administration according to the present invention. As a control, LNP containing 2 μg of the same mRNA was injected intramuscularly. OVA-specific IgG was then measured in the mice. The results are shown in Figure 6B. As shown in Figure 6B, transdermal administration according to the present invention induced antigen-specific IgG at levels equivalent to or exceeding those induced by intramuscular injection of LNP.

[0081] The induction of cytotoxic T cells was confirmed. 4.5 μg of unmodified OVA mRNA was administered to each mouse in the right ventral region, 4.5 μg of unmodified OVA mRNA in the left ventral region, and Actranza TMThe mice were administered either intradermally (transdermal administration group) or intradermally (intradermal administration group) by the laboratory. At week 3, splenocytes were collected, treated with OVA epitopes, and cell counts were counted using a flow cytometer. As shown in Figure 7, transdermal administration significantly increased CTL activity (%) compared to intradermal injection.

[0082] Furthermore, the combined effect of adjuvants was confirmed. Double-stranded RNA (RIG-I ligand) or cGAMP (STING activator) was used as the adjuvant. Mice (n = 4) were administered either naked unmodified ovalbumin mRNA or m1Ψ-modified mRNA. Plasma was collected, and the levels of IgG, IgG1, and IgG2a in the plasma were measured by ELISA. The results are shown in Figure 8. As shown in Figure 8, induction of IgG, IgG1, and IgG2a was observed in both cases. The IgG2a / IgG1 ratio was found to be improved in all adjuvant-combined groups. This suggests that the risk of antibody-dependent enhancement may be reduced by combining double-stranded RNA with an adjuvant. Note that double-stranded RNA exhibited adjuvant effects when unmodified mRNA was used, but not when m1Ψ mRNA was used.

[0083] Next, 9 μg of the m1Ψ-modified mRNA encoding ovalbumin prepared as described above was administered to one ventral region of mice, and three weeks later, the same amount of m1Ψ-modified mRNA was re-administered to the same ventral region (ipsilateral group, n = 4) and the same amount of m1Ψ-modified mRNA was re-administered to the opposite ventral region (contralateral group, n = 4). Plasma was collected from each group, and antibody titers were compared. As shown in Figure 10, significantly higher antibody induction was observed in the ipsilateral group compared to the contralateral group.

[0084] Naked, unmodified mRNA encoding a coronavirus helicase protein was prepared as described above. In contrast, a group with and without double-stranded RNA was prepared as described above. As controls, a group of micelles encapsulating the mRNA and a group of lipid nanoparticles (LNPs) were also prepared. The mRNA-encapsulating micelles were obtained by mixing PEG-PAsp (DET) and mRNA at an N / P ratio of 5 (see, for example, Kim H. J. et al., ACS Cent. Sci., 5, 1866-1875 (2019)). The naked mRNA and micelles were prepared using Actranza. TM The naked mRNA was administered transdermally by lab. LNP was administered intramuscularly. The results are shown in Figure 11. As shown in Figure 11, significant induction of INF-γ positive cells was confirmed in the naked mRNA transdermal administration group and the micellar transdermal administration group. In particular, an extremely high specific immunity induction effect was observed in the group co-administered with naked mRNA and double-stranded RNA (sdRNA). The specific immunity induction effect in the group co-administered with double-stranded RNA (sdRNA) and naked mRNA was comparable to the induction effect of LNP similar to BioNTech's LNP, which is currently used as a coronavirus vaccine (see Figure 12A).

[0085] Transdermal administration of naked mRNA according to the present invention can induce lymphoid follicles in the skin (particularly the dermis), suggesting that these lymphoid follicles contribute to the induction of antigen-specific immunity by transdermal administration of naked mRNA.

[0086] Lipid nanoparticle (LNP) mRNA vaccines have various known issues. For example, after intramuscular injection, most of the vaccine migrates to the liver, where mRNA is expressed (Figure 12B and J. Control. Release, 217: 345-351, 2015). For example, the liver and spleen enlarge after LNP administration (Figure 13). It has been reported that pH-responsive lipids have strong immunogenicity (Immunity, 54(12): 2877-2892, 2021), leading to toxicity. While the effectiveness of lipid nanoparticles for nucleic acid delivery has been confirmed, toxicity issues have arisen. Therefore, there is great hope for formulations that avoid the use of lipid nanoparticles. Transdermal administration of naked mRNA according to the present invention is believed to be one solution to this problem. In addition, experiments were conducted in which naked unmodified mRNA was administered transdermally by electrical stimulation, but the nucleic acid did not penetrate the skin by electrical stimulation and did not show detectable expression in the skin.

[0087] Naked mRNA encoding the spike protein of coronavirus (Wuhan strain) was prepared as described above. This mRNA had mΨ modifications on all uracils. This naked mRNA (doses: 5 μg, 10 μg, or 30 μg) was used in Actranza TM The lab administered the vaccine intradermally to mice (BALB / c and C58BL6 / J) twice every three weeks. Two weeks after the second administration, blood was collected from the mice, and plasma was analyzed for antibody titers, neutralizing antibodies, and cellular immunity.

[0088] Antibody titers were measured using spike protein-immobilized plates. Specifically, spike protein (2 μg / mL in bicarbonate buffer (50 mM, pH 9.6)) was added at 50 μL / well to Clear Flat-Bottom Immuno Nonsterile 96-Well Plates (Thermo) and incubated overnight at 4°C to immobilize the spike protein on the well bottom. The plates were washed three times with PBS containing 0.5% Tween 20 (PBS-T). 100 μL of PBS-T solution (containing 1% BSA and 2.5 mM EDTA) was added and incubated at room temperature for 1 hour. The plates were washed three times with PBS-T. 50 μL of appropriately diluted plasma sample was added to each well and incubated overnight at 4°C. The plates were washed three times with PBS-T. 50 μL of horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG antibody (1:8000) was added and incubated at room temperature for 2 hours to allow the labeled antibody to bind to the plasma antibody bound to the immobilized spike protein. After washing, 100 μL / well of HRP substrate was added and incubated at room temperature for 30 minutes. The reaction was stopped with 2 M sulfuric acid, and the absorbance at 492 nm was measured using a plate reader (Tecan) to determine the amount of labeled antibody bound to the plasma antibody bound to the spike protein.

[0089] The results are shown in Figures 14A and 14B. As shown in Figure 14A, the group of BALB / c mice to which mRNA encoding the spike protein was administered transdermally using the method of the present invention showed antibody titers of 10,000 or more.

[0090] Next, we evaluated the neutralizing ability of antibodies in the obtained plasma (specifically, their ability to neutralize the binding of spike protein to ACE2). The neutralizing ability of spike protein RBD and ACE2 was quantified using the SARS-CoV-2 Spike RBD-ACE2 Blocking Antibody Detection ELISA Kit (Cell Signaling Technologies). As shown in Figure 14A, the presence of antibodies with neutralizing ability was clearly demonstrated in the obtained plasma.

[0091] Furthermore, splenocytes were collected from the mRNA-administered mice to evaluate the activation of antigen-specific cellular immunity. The collected splenocytes were cultured at 2.5 × 10 5 The cells were seeded into 96-well plates using Mouse Anti-IFNγ ELISpot PLUS kits (MABTECH) at a concentration of 1000 cells / well. After 24 hours, the plates were processed according to the kit instructions and observed using an ELISpot plate reader (AID GmbH, Germany). ELISpot assays demonstrated an antigen-dependent increase in the number of IFNγ-positive spots after the above-mentioned intradermal administration, indicating activation of antigen-specific cellular immunity.

[0092] Similar experiments were performed in C58BL6 / J mice, and similar results were observed. Specifically, as shown in Figure 14B, transdermal administration of naked, unmodified mRNA encoding the spike protein using the method of the present invention resulted in high antibody titers and activation of cellular immunity.

[0093] Thus, the transdermal administration method of the present invention makes it possible to administer naked mRNA, thereby inducing antibody production and cellular immunity against the protein encoded by the administered mRNA.

[0094] The production of inflammatory cytokines in the liver and spleen after transdermal administration using the method of the present invention was quantified. LNPs were prepared by mixing D-Lin-MC3-DMA, DSPC, cholesterol, PEG2000-DMG (molar ratio 50:10:38.5:1.5, ethanol solvent) with mRNA (pH 3 citrate buffer) in a microchannel (Precision NanoSystems Inc., Vancouver, BC, Canada) at a flow rate of 12 mL / min (N / P = 5). The buffer was then replaced with PBS. OVA mRNA (m1ψ) was administered intradermally in LNP-encapsulated form, or mRNA alone was administered transdermally using Actranza Lab. Livers and spleens were removed 4 hours later. Total RNA was extracted using the RNeasy mini kit (Qiagen) and reverse transcribed using the ReverTraAce with gDNA remover kit (TOYOBO). Quantitative PCR was performed using the 7500 fast real-time PCR (Applied Biosystems) with the FastStart Universal SYBR Green Master kit and forward primers GAACCAGATCACCAAGCCCA and reverse primers GTACAGCTCCTTCACGCACT. Taqman Gene Expression Assays for IL-6 (Mm00446190_m1), IFN-β (Mm00439552_s1), and β-actin (Mm00607939) were used.

[0095] The results are shown in Figure 14C. As shown in Figure 14C, the mRNA transdermally administered group showed almost no production of inflammatory cytokines in either the liver or the spleen, whereas the LNP-administered group induced high levels of inflammatory cytokines in both the liver and the spleen.

[0096] Actranza mRNA was administered to the back of cynomolgus monkeys three times every three weeks. TMThe antibody was administered transdermally using a lab kit, and blood samples were collected over time to evaluate antibody titers and neutralizing activity. Antibody titers were evaluated using HRP-conjugated Goat Anti-Monkey IgG H&L (1:8000) instead of goat anti-mouse IgG (1:8000). As shown in Figure 14D, production of antibodies against the spike protein was confirmed in the plasma of cynomolgus monkeys. Furthermore, the obtained antibodies possessed neutralizing activity. Photographs of the administration site of the monkey after mRNA administration are shown in Figure 2B.

[0097] This suggests that the transdermal administration of the present invention requires administration using a device with sufficient jetting force to penetrate the mRNA solution into the skin by jet spray. In particular, even when naked mRNA is administered transdermally by jet spray, it is believed that the mRNA can be delivered into cells without damage. The importance of wide penetration of the mRNA solution into the skin by jet spray is also evident. Jet spraying can be performed in multiple stages. By using a first stage of spraying to improve skin permeability and a second stage of spraying the mRNA solution, it was possible to administer the mRNA deeply (especially to the dermis) and into the skin in the latter stage. It is believed that the mRNA sprayed by jet spray penetrates tissues widely and deeply and is also introduced into cells. Conventional wisdom has traditionally avoided administering naked mRNA to living organisms because it is rapidly degraded by RNases, which are abundant in living organisms. In contrast, the transdermal administration method of the present invention can stably deliver mRNA into cells without degradation or destruction, and deliver the translation product encoded by the mRNA to tissues such as the epidermis or dermis. Furthermore, while intradermal injections tend to spread the administered ingredients throughout the body rather than remaining localized, jet spraying prevents this. Therefore, jet spray administration of ingredients appears to be effective in reducing unwanted side effects. In particular, for immunostimulation, even if the active ingredient remains intradermally, significant antigen-specific antibodies and immune cells can be induced, suggesting that transdermal administration of ingredients by jet spraying is suitable for vaccine administration.

[0098] The CureVac jet injector demonstrated an improvement in expression levels of 1.5 to 10 times higher than administration by injection, with little vaccine efficacy observed. The method of the present invention enables mRNA to penetrate widely and deeply into the dermis, achieving an expression improvement of more than 100 times that of intradermal injection, and also improving vaccine efficacy (antibody production) by more than 100 times. It has been revealed that in order to effectively deliver mRNA into immune cells (particularly dendritic cells, especially dermal dendritic cells) scattered throughout the skin, it is desirable to be able to deliver the active ingredient to the dermis and administer it over a wide area. Multiple administrations may be used to increase the area on the skin through which the drug solution penetrates. Therefore, by penetrating the active ingredient into a wide area of ​​the skin with one or more administrations, vaccine efficacy can be expected. The present invention proposes administration methods suitable for vaccines, including such administration methods.

[0099] Existing mRNA vaccines involve intramuscular injection of mRNA encapsulated in lipid nanoparticles. However, while many vaccines can be stored refrigerated at temperatures below 10°C, mRNA vaccines must be frozen at -20°C or -80°C, and their effectiveness is thought to be reduced if temperature control is insufficient. It has also been pointed out that allergic reactions may occur to the lipid components contained in mRNA vaccines. In contrast, the transdermal administration method of the present invention allows for naked administration of mRNA, thereby inducing antigen-specific immunity in the body. Therefore, it is suggested that the use of naked mRNA allows for safe administration with extremely low toxicity. Furthermore, since there is room for simplifying the components, it may also be beneficial in terms of reducing production costs.

[0100]

[0033] Explanation of symbols in the drawings: 10: RNA preparation, 11: pressure port, 11a: plunger, 11b: plunger rubber, 12: nozzle, 13: composition containing RNA, 14: container of RNA preparation, 20: gas generator, 21: container of gas generator, 23: gas generator, 24: spark plug, 30: administration device before connecting gas generator, 31: body, 32: handle, 33: plug, 34: switch, 35: voltage generator, 36: conductive wire, 37: conductive wire, 38: holder for fixing gas generator, 50: administration device connected to gas generator, 100: RNA preparation connected to administration device equipped with gas generator [Sequence Listing] Sequence Number (ID): 1 Length: 24 Molecule Type: RNA Features Location / Qualifiers: - misc_feature, 1..24 > note, RNA 1 for double strand RNA - source, 1..24 > mol_type, other RNA > organism, synthetic construct Residues: ggtgtgtgtg tgtgtgtgtg tgtg 24 Sequence Number (ID): 2 Length: 37 Molecule Type: DNA Features Location / Qualifiers: - misc_feature, 1..37 > note, DNA template - source, 1..37 > mol_type, other DNA > organism, synthetic construct Residues: acgactcact ataggtgtgt gtgtgtgtgt gtgtgtg 37 Sequence Number (ID): 3 Length: 43 Molecule Type: RNA Features Location / Qualifiers: - misc_feature, 1..43 > note, RNA 2 for double strand RNA - source, 1..43 > mol_type, other RNA > organism, synthetic construct Residues: ggttcaggat gtcccgcttc acacacacac acacacacac acc 43 Sequence Number (ID): 4 Length: 43 Molecule Type: RNA Features Location / Qualifiers: - misc_feature, 1..43 > note, RNA 3 for double strand RNA - source, 1..43 > mol_type, other RNA > organism, synthetic construct Residues: gggcaggatg gggtaccttc acacacacac acacacacac acc 43 Sequence Number (ID): 5 Length: 43 Molecule Type: RNA Features Location / Qualifiers: - misc_feature, 1..43 > note, RNA 4 for double strand RNA - source, 1..43 > mol_type, other RNA > organism, synthetic construct Residues: gtcctcgtcc ttgaaggatc acacacacac acacacacac acc 43 Sequence Number (ID): 6 Length: 43 Molecule Type: RNA Features Location / Qualifiers: - misc_feature, 1..43 > note, RNA 5 for double strand RNA - source, 1..43 > mol_type, other RNA > organism, synthetic construct Residues: gcttctcgaa gttgatgtac acacacacac acacacacac acc 43 Sequence Number (ID): 7 Length: 43 Molecule Type: RNA Features Location / Qualifiers: - misc_feature, 1..43 > note, RNA 6 for double strand RNA - source, 1..43 > mol_type, other RNA > organism, synthetic construct Residues: ggcgatgtgc ttgatgcttc acacacacac acacacacac acc 43.

Claims

1. 1. A composition comprising: Nucleic acids include RNA; The composition is administered by an administration method, the administration method comprising spraying the composition against a surface of a target tissue, thereby penetrating the surface of the target tissue and delivering the composition into the target tissue. composition.

2. 10. The composition of claim 1, wherein the pressurization is caused by the generation of gas from a gas generant.

3. The injection is 70 mm 2 The composition of claim 1, wherein the composition is used to introduce mRNA into an area of ​​at least 100 nm.

4. The injection is 200 mm 2 The composition of claim 1, wherein the composition is used to introduce mRNA into an area of ​​at least 100 nm.

5. The composition of claim 1 , wherein the nucleic acid comprises naked mRNA.

6. The composition of claim 1 , wherein the composition further comprises an adjuvant.

7. The composition of claim 6, wherein the adjuvant comprises a RIG-I ligand or a STING activator.

8. The composition of claim 1 , wherein at least some or all of the nucleic acid is contained in a lipid nanoparticle or a polyion complex.

9. (i) for use in delivering a nucleic acid to the epidermis or dermis of a subject; (ii) for use in expressing a nucleic acid in the epidermis or dermis of a subject; (iii) for use in inducing lymphoid follicle formation in the subcutaneous tissue of a subject; and / or (iv) for use in inducing specific immunity against the translation product of the nucleic acid in a subject; The composition according to any one of claims 1 to 8.

10. (iv-1) The composition according to claim 9, for use in inducing an antibody against a translation product of the nucleic acid in a subject.

11. (iv-2) The composition according to claim 9, for use in inducing T cell immunity against a translation product of the nucleic acid in a subject.

12. A composition comprising a nucleic acid for use in a method of administering a nucleic acid to a subject in need thereof, the nucleic acid comprising RNA, the method comprising spraying the composition against the surface of a target tissue of the subject, whereby the composition is sprayed toward the target tissue, penetrates the surface of the target tissue and is delivered into the target tissue.

13. A composition comprising the nucleic acid for use in a method for inducing antigen-specific immunity in a subject in need thereof, the method comprising spraying a composition comprising mRNA encoding the antigen onto the skin surface of the subject, whereby the composition is sprayed toward the target tissue, penetrates the surface of the target tissue and is delivered into the target tissue.

14. 14. The composition of claim 12 or 13, wherein the RNA consists of naked mRNA.

15. 1. An administration device comprising an RNA formulation, (α) An administration device including a gas generating unit containing at least a gas generating agent, the gas generating unit having a drive unit for driving a plunger by pressure due to gas generated from the gas generating agent in the gas generating unit; (β) an RNA formulation comprising a composition containing RNA and a container storing the composition, the container having a pressurizing port for pressurizing and a spray port for spraying; Including, A plunger is inserted into the pressure port of the RNA formulation in an airtight and liquid-tight manner, and when gas is generated in a gas generating unit, a driving unit drives the plunger, causing the plunger to be pushed into the container, thereby causing the composition containing RNA to be sprayed from the injection port.

16. 1. An RNA formulation comprising: a composition containing RNA and a first container storing the composition; The container is provided with a pressure opening for pressurization and an ejection opening for ejection, a plunger is inserted into the pressure opening and can be pushed into the first container, and when the plunger is pushed into the first container from the pressure opening (i.e., pressurized), a composition containing RNA is ejected from the ejection opening, thereby allowing at least the RNA to penetrate the tissue surface and penetrate into the tissue, an RNA formulation.

17. 17. The RNA formulation of claim 16, An RNA formulation further comprising a gas generating unit (actuator) equipped with a second container containing at least a gas generating agent, the gas generating unit (actuator) having a drive unit for pushing the plunger, and the plunger can be pushed into the first container via the drive unit by gas generated from the gas generating agent, and when the plunger is pushed into the first container from the pressure port (i.e., pressurized), a composition containing RNA is sprayed from the spray port, thereby allowing at least the RNA to penetrate the tissue surface and penetrate into the tissue.

18. 18. The RNA formulation of claim 17, further comprising a body portion of the administration device; The body portion has a handle portion, a switch, a voltage generating unit electrically connected to the switch, and a plug electrically connected to the voltage generating unit, and also has a holder portion to which a gas generating unit (actuator) can be fixed, the gas generating unit is fixed to the holder portion, and the plug of the body and the ignition plug of the gas generating unit (actuator) are electrically connected, so that when the switch is turned on, voltage is generated from the voltage generating unit, igniting the ignition plug and generating gas from the gas generating agent in the second container of the gas generating unit.