Method for testing possibility of pregnancy and / or possibility of childbirth resulting from said preganancy

Abstract

Provided is technology for testing the possibility of pregnancy and / or the possibility of childbirth resulting from the pregnancy. Provided is a method for testing the possibility of pregnancy due to an egg retained in a follicular fluid and / or the possibility of childbirth resulting from the pregnancy, the method including (1) a step for detecting, in a follicular fluid sample collected from a subject, at least one type of miRNA selected from (a) the group consisting of miR-16-2-3p, miR-378a-3p, miR-483-5p, miR-1246, and miR-1290, and / or (b) the group consisting of miR-204-3p, miR-1468-5p, miR-424-5p, miR-30e-5p, miR-146a-5p, miR-202-5p, miR-370-3p, miR-506-3p, miR-3184-3p, miR-423-5p, miR-365a-5p, miR-514a-3p, miR-92b-5p, miR-27a-5p, miR-6873-3p, miR-451a, miR-122-5p, and miR-122b-3p.

Description

Method for determining the possibility of pregnancy and / or the possibility of birth due to said pregnancy

[0001] The present invention relates to a method for examining the possibility of pregnancy and / or the possibility of birth due to said pregnancy.

[0002] In Japan, it is said that 10-15% of couples hoping to have children are infertile, and coupled with the trend toward later marriage, the importance of ART (assisted reproductive technology, i.e., intracytoplasmic sperm injection and in vitro fertilization) in reproductive medicine is increasing. ART has also recently been approved for insurance coverage, and as a result, the importance of ART is expected to increase even further in the future.

[0003] The general flow of ART is as follows: 1) Multiple follicles in the ovaries are matured using ovulation-inducing drugs, and follicular fluid is obtained by puncturing the follicles. 2) Eggs are retrieved from the obtained follicular fluid and fertilized with sperm in culture medium or under a microscope to obtain fertilized eggs. 3) If multiple fertilized eggs are obtained, one or two high-grade fertilized eggs are selected based on visual grading criteria and returned to the uterus. 4) If any high-grade fertilized eggs remain, they may be frozen and stored. From the perspective of medical economics and reducing the burden on the mother, selecting eggs with a higher chance of resulting in pregnancy is important for more efficient ART.

[0004] Non-Patent Document 1 explores fertility test markers by comparing the expression levels of miRNA in embryo culture fluid between successful and unsuccessful pregnancy cases. However, this technique requires egg fertilization and embryo culture, making it inconvenient.

[0005] Journal of Advanced Research. 2021 Jul; 31: 25-34.

[0006] An object of the present invention is to provide a technique for examining the possibility of pregnancy and / or the possibility of birth due to said pregnancy.

[0007] In view of the above problems, the present inventors have conducted extensive research and have found that (1) in a follicular fluid sample collected from a subject, (a) a group consisting of miR-16-2-3p, miR-378a-3p, miR-483-5p, miR-1246, and miR-1290, and / or (b) miR-204-3p, miR-1468-5p, miR-424-5p, miR-30e-5p, miR-146a-5p, miR-202-5p, miR-370-3p, miR-506-3p, miR-3184 The inventors have found that the above-mentioned problems can be solved by a method for examining the possibility of pregnancy and / or the possibility of live birth resulting from an egg contained in follicular fluid, the method comprising the step of detecting at least one miRNA selected from the group consisting of miR-3p, miR-423-5p, miR-365a-5p, miR-514a-3p, miR-92b-5p, miR-27a-5p, miR-6873-3p, miR-451a, miR-122-5p, and miR-122b-3p. Based on this finding, the inventors have conducted further research and have completed the present invention. Specifically, the present invention encompasses the following aspects.

[0008] Section 1. (1) In a follicular fluid sample collected from a subject, (a) the group consisting of miR-16-2-3p, miR-378a-3p, miR-483-5p, miR-1246, and miR-1290, and / or (b) detecting at least one miRNA selected from the group consisting of miR-204-3p, miR-1468-5p, miR-424-5p, miR-30e-5p, miR-146a-5p, miR-202-5p, miR-370-3p, miR-506-3p, miR-3184-3p, miR-423-5p, miR-365a-5p, miR-514a-3p, miR-92b-5p, miR-27a-5p, miR-6873-3p, miR-451a, miR-122-5p, and miR-122b-3p.

[0009] Item 2. The method according to Item 1, wherein the miRNA comprises at least one miRNA selected from the group consisting of miR-16-2-3p, miR-378a-3p, miR-483-5p, miR-1246, and miR-1290.

[0010] Item 3. The method according to Item 1, wherein the miRNA comprises at least one miRNA selected from the group consisting of miR-16-2-3p, miR-378a-3p, and miR-483-5p.

[0011] Item 4. The method according to Item 1, wherein the miRNAs include miR-16-2-3p, miR-378a-3p, and miR-483-5p.

[0012] Item 5. The method of Item 1, wherein the follicular fluid sample is a cell-reduced fraction of follicular fluid.

[0013] Item 6. The method according to Item 1, wherein the follicular fluid sample is extracellular vesicles purified from follicular fluid.

[0014] Item 7. The method according to Item 1, wherein the miRNA comprises at least one miRNA selected from the group consisting of miR-204-3p, miR-1468-5p, miR-424-5p, miR-16-2-3p, miR-30e-5p, miR-1246, miR-1290, miR-378a-3p, miR-483-5p, miR-146a-5p, miR-202-5p, miR-370-3p, miR-506-3p, miR-3184-3p, miR-423-5p, miR-365a-5p, miR-514a-3p, miR-92b-5p, miR-27a-5p, and miR-6873-3p.

[0015] Item 8. The method according to Item 1, further comprising: (2) determining the possibility of pregnancy from the egg and / or the possibility of birth from the pregnancy based on the amount or concentration of the miRNA detected in step (1).

[0016] Item 9. The step (2) comprises: (2a) determining that the possibility of pregnancy by the egg and / or birth due to the pregnancy is high when the amount or concentration of at least one miRNA selected from the group consisting of miR-1468-5p, miR-424-5p, miR-16-2-3p, miR-30e-5p, miR-146a-5p, miR-202-5p, and miR-451a detected in the step (1) is equal to or higher than a cutoff value, and / or determining that the possibility of pregnancy by the egg and / or birth due to the pregnancy is low when the amount or concentration is equal to or lower than the cutoff value; and (2b) determining that the possibility of pregnancy by the egg and / or birth due to the pregnancy is high when the amount or concentration of at least one miRNA selected from the group consisting of miR-204-3p, miR-1246, miR-1290, miR-378a-3p, miR-483-5p, miR-370-3p, miR-506-3p, miR-3184-3p, miR-423-5p, miR-365a-5p, miR-514a-3p, miR-92b-5p, miR-27a-5p, miR-6873-3p, miR-122-5p, and miR-122b-3p detected in the step (1) is equal to or lower than a cutoff value, and / or determining that the possibility of pregnancy by the egg and / or birth due to the pregnancy is low when the amount or concentration is equal to or higher than the cutoff value; Item 9. The method according to Item 8, comprising at least one step selected from the group consisting of:

[0017] Item 10. The method according to any one of Items 1 to 9, wherein the pregnancy is a pregnancy resulting from assisted reproductive technology.

[0018] Item 11. The method according to any one of Items 1 to 9, wherein the subject is a human.

[0019] Item 12. (a) the group consisting of miR-16-2-3p, miR-378a-3p, miR-483-5p, miR-1246, and miR-1290, and / or (b) A diagnostic agent for determining the possibility of pregnancy by an egg of a subject and / or the possibility of birth due to said pregnancy, the diagnostic agent comprising a detector for at least one miRNA selected from the group consisting of miR-204-3p, miR-1468-5p, miR-424-5p, miR-30e-5p, miR-146a-5p, miR-202-5p, miR-370-3p, miR-506-3p, miR-3184-3p, miR-423-5p, miR-365a-5p, miR-514a-3p, miR-92b-5p, miR-27a-5p, miR-6873-3p, miR-451a, miR-122-5p, and miR-122b-3p.

[0020] According to the present invention, a technique for examining the possibility of pregnancy and / or the possibility of birth due to said pregnancy can be provided.

[0021] For the marker miRNA selected in Test Example 1, the number of reads in non-pregnant cases (non-pregnancy, left side of the graph) and pregnant cases (pregnancy, right side of the graph) is shown. The name of the marker miRNA and the P value between groups are shown at the top of the graph. Same as in Figure 1. Same as in Figure 1. Same as in Figure 1. Same as in Figure 1. Same as in Figure 1. Same as in Figure 1. Same as in Figure 1. Same as in Figure 1. Same as in Figure 1. Same as in Figure 1. Same as in Figure 1. Same as in Figure 1. Same as in Figure 1. Same as in Figure 1. Same as in Figure 1. Same as in Figure 1. Same as in Figure 1. Same as in Figure 1.

[0022] In this specification, the expressions "contain" and "comprise" include the concepts of "contain," "comprise," "consist essentially of," and "consist only of."

[0023] 1. Testing Method In one aspect, the present invention provides a method for detecting (1) the expression of (a) miR-16-2-3p, miR-378a-3p, miR-483-5p, miR-1246, and miR-1290, and / or (b) miR-204-3p, miR-1468-5p, miR-424-5p, miR-30e-5p, miR-146a-5p, miR-202-5p, miR-370-3p, miR-506-3p, miR-3184-3p, miR-42 The present invention relates to a method for testing the possibility of pregnancy and / or birth due to said pregnancy from an egg contained in the follicular fluid, the method comprising the step of detecting at least one miRNA selected from the group consisting of miR-3-5p, miR-365a-5p, miR-514a-3p, miR-92b-5p, miR-27a-5p, miR-6873-3p, miR-451a, miR-122-5p, and miR-122b-3p (also referred to herein as the "testing method of the present invention"). This method is described below.

[0024] 1-1. Step (1) In the testing method of the present invention, the possibility of pregnancy and / or birth due to an egg held in the follicular fluid that is the target of miRNA detection (i.e., an egg contained in the same follicle as the follicular fluid) is tested.

[0025] Pregnancy refers to a state in which a fertilized egg has implanted on the surface of the endometrium and is able to grow, or a state in which a fertilized egg is growing, and is not particularly limited thereto. Pregnancy preferably refers to pregnancy continuing until the middle of pregnancy, and more preferably until the late stage of pregnancy. According to the method of the present invention, it is possible to examine the possibility of pregnancy continuing until the middle of pregnancy (for example, any time between 16 and 27 weeks of pregnancy in the case of humans) or until the late stage of pregnancy (for example, any time between 28 and 40 weeks of pregnancy in the case of humans).

[0026] The process leading up to pregnancy is not particularly limited, but in the test method of the present invention, eggs are typically collected along with follicular fluid, and therefore it is possible to test the possibility of pregnancy through assisted reproductive technology (e.g., in vitro fertilization / embryo transfer, intracytoplasmic sperm injection, frozen embryo / thawed embryo transfer, etc.). The method of assisted reproductive technology is not particularly limited, and a method according to or similar to a known method can be adopted.

[0027] Birth is the phenomenon of giving birth to a live baby, and is not particularly limited insofar as such. Birth is preferably birth after the late stages of pregnancy, more preferably full-term birth. If the subject is a human, birth is, for example, birth after the 28th week of pregnancy, more preferably birth after the 32nd week of pregnancy, even more preferably birth after the 35th week of pregnancy, and even more preferably birth after the 37th week of pregnancy.

[0028] The subject is a living organism that is the target of the testing method of the present invention, and the species of the subject is not particularly limited. Examples of the subject include various mammals such as humans, monkeys, mice, rats, dogs, cats, and rabbits, and preferably humans.

[0029] The follicular fluid sample is not particularly limited as long as it is derived from the follicular fluid of a subject and can contain miRNA. The follicular fluid sample includes both the follicular fluid itself and a sample prepared from the follicular fluid. The sample prepared from the follicular fluid (a follicular fluid-derived sample) can be a sample obtained by concentrating and purifying extracellular mRNA in the follicular fluid, specifically, for example, a cell-reduced fraction of the follicular fluid, preferably extracellular vesicles purified from the follicular fluid.

[0030] A cell-depleted fraction of follicular fluid can be obtained by reducing or removing cells in the follicular fluid by centrifugation or the like.

[0031] Extracellular vesicles are not particularly limited as long as they are membrane vesicles secreted, released, or the like from cells. Extracellular vesicles are generally defined as membrane vesicles that are responsible for local or systemic intercellular signaling by transporting intracellular proteins and genetic information (mRNA, microRNA, etc.) to the outside of cells. Examples of extracellular vesicles include exosomes, microvesicles, apoptotic bodies, ectosomes, microparticles, and secreted microvesicles. From the viewpoint of test accuracy, etc., exosomes are particularly preferred as extracellular vesicles.

[0032] Extracellular vesicles can be purified, separated, concentrated, etc. from follicular fluid according to or in accordance with known methods. Methods for purifying, separating, concentrating, etc. extracellular vesicles include, for example, ultracentrifugation (e.g., pellet-down method, sucrose cushion method, density gradient centrifugation, etc.), methods using immunoaffinity carriers, gel filtration, field-flow fractionation, FACS, etc. Purification, separation, concentration, etc. of extracellular vesicles can also be performed using commercially available kits. These methods may be used alone or in combination of two or more.

[0033] The method for collecting follicular fluid is not particularly limited, and can be performed according to or a method similar to a known method, for example, by puncturing a follicle while checking an in vivo image such as an ultrasound image. Typically, when collecting follicular fluid, eggs within the same follicle are also collected. The follicles from which follicular fluid is collected are not particularly limited, as long as they are follicles containing eggs that have reached a certain level of maturity (preferably mature follicles). From the perspective of the accuracy of the testing method of the present invention, in the case of humans, follicles with a diameter of preferably 16 mm or greater, more preferably 18 mm or greater, and even more preferably 18 to 25 mm, are preferred. The follicles may be naturally matured follicles or follicles matured by the administration of a drug (e.g., follicle-stimulating hormone (FSH)).

[0034] In step (1), miRNAs are detected in a follicular fluid sample collected from a subject. The detection targets in step (1) are: (a) the group consisting of miR-16-2-3p, miR-378a-3p, miR-483-5p, miR-1246, and miR-1290; and / or (b) at least one miRNA selected from the group consisting of miR-204-3p, miR-1468-5p, miR-424-5p, miR-30e-5p, miR-146a-5p, miR-202-5p, miR-370-3p, miR-506-3p, miR-3184-3p, miR-423-5p, miR-365a-5p, miR-514a-3p, miR-92b-5p, miR-27a-5p, miR-6873-3p, miR-451a, miR-122-5p, and miR-122b-3p. Hereinafter, these may be collectively referred to as "target biomarkers."

[0035] The base sequence of the target biomarker can be identified in a publicly known database (e.g., miRBase: http: / / www.mirbase.org / ). For example, in the case of humans, the base sequence is as follows:

[0036] >hsa-miR-204-3p MIMAT0022693 GCUGGGAAGGCAAAGGGACGU (SEQ ID NO: 1).

[0037] >hsa-miR-1468-5p MIMAT0006789 CUCCGUUUGCCUGUUUCGCUG (SEQ ID NO: 2).

[0038] >hsa-miR-424-5p MIMAT0001341 CAGCAGCAAUUCAUGUUUUGAA (SEQ ID NO: 3).

[0039] >hsa-miR-16-2-3p MIMAT0004518 CCAAUAUUACUGUGCUGCUUUA (sequence number 4).

[0040] >hsa-miR-30e-5p MIMAT0000692 UGUAAACAUCCUUGACUGGAAG (SEQ ID NO: 5).

[0041] >hsa-miR-1246 MIMAT0005898 AAUGGAUUUUUGGAGCAGG (SEQ ID NO: 6).

[0042] >hsa-miR-1290 MIMAT0005880 UGGAUUUUUGGAUCAGGGA (SEQ ID NO: 7).

[0043] >hsa-miR-378a-3p MIMAT0000732 ACUGGACUUGGAGUCAGAAGGC (SEQ ID NO: 8).

[0044] >hsa-miR-483-5p MIMAT0004761 AAGACGGGAGGAAAGAAGGGAG (SEQ ID NO: 9).

[0045] >hsa-miR-146a-5p MIMAT0000449 UGAGAACUGAAUUCCAUGGGUU (SEQ ID NO: 10).

[0046] >hsa-miR-202-5p MIMAT0002810 UUCCUAUGCAUAUACUUCUUUG (SEQ ID NO: 11).

[0047] >hsa-miR-370-3p MIMAT0000722 GCCUGCUGGGGUGGAACCUGGU (SEQ ID NO: 12).

[0048] >hsa-miR-506-3p MIMAT0002878 UAAGGCACCCUUCUGAGUAGA (SEQ ID NO: 13).

[0049] >hsa-miR-3184-3p MIMAT0022731 AAAGUCUCGCUCUCUGCCCCUCA (SEQ ID NO: 14).

[0050] >hsa-miR-423-5p MIMAT0004748 UGAGGGGCAGAGAGCGAGACUUU (SEQ ID NO: 15).

[0051] >hsa-miR-365a-5p MIMAT0009199 AGGGACUUUUGGGGGCAGAUGUG (SEQ ID NO: 16).

[0052] >hsa-miR-514a-3p MIMAT0002883 AUUGACACUUCUGUGAGUAGA (SEQ ID NO: 17).

[0053] >hsa-miR-92b-5p MIMAT0004792 AGGGACGGGACGCGGUGCAGUG (SEQ ID NO: 18).

[0054] >hsa-miR-27a-5p MIMAT0004501 AGGGCUUAGCUGCUUGUGAGCA (SEQ ID NO: 19).

[0055] >hsa-miR-6873-3p MIMAT0027647 UUCUCUCUGUCUUUCUCUCUCAG (SEQ ID NO: 20).

[0056] >hsa-miR-451a MIMAT0001631 AAACCGUUACCAUUACUGAGUU (SEQ ID NO: 21).

[0057] >hsa-miR-122-5p MIMAT0000421 UGGAGUGUGACAAUGGUGUUUG (SEQ ID NO: 22).

[0058] >hsa-miR-122b-3p MIMAT0019877 AAACACCAUUGUCACACUCCAC (sequence number 23).

[0059] The target biomarker is preferably a mature miRNA, but may also be a precursor (e.g., pri-miRNA, pre-miRNA, etc.).

[0060] Among the target biomarkers, preferred are miR-204-3p, miR-1468-5p, miR-424-5p, miR-16-2-3p, miR-30e-5p, miR-1246, miR-1290, miR-378a-3p, miR-483-5p, miR-146a-5p, miR-202-5p, miR-370-3p, miR-506-3p, miR-3184-3p, miR-423-5p, miR-365a-5p, miR-514a-3p, miR-92b-5p, miR-27a-5p, and miR-6873-3p, from the viewpoint of being more suitable for determining the possibility of pregnancy and / or the possibility of birth due to said pregnancy, More preferred examples include miR-204-3p, miR-1468-5p, miR-424-5p, miR-16-2-3p, miR-30e-5p, miR-1246, miR-1290, miR-378a-3p, and miR-483-5p, and even more preferred example is miR-204-3p.

[0061] Among the target biomarkers, preferred are miR-451a, miR-202-5p, miR-3184-3p, miR-423-5p, miR-514a-3p, miR-122-5p, miR-122b-3p, and miR-483-5p, from the viewpoint of being highly expressed and being excellent targets for detection.

[0062] The number of target biomarkers to be detected in step (1) may be one or more, but from the viewpoint of test accuracy and the like, the number of target biomarkers to be detected is preferably two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, twenty or more, twenty-one or more, twenty-two or more, or all (23) types.

[0063] In one embodiment of the present invention, the target biomarker detected in step (1) preferably comprises at least one miRNA selected from the group consisting of miR-16-2-3p, miR-378a-3p, miR-483-5p, miR-1246, and miR-1290, more preferably at least one miRNA selected from the group consisting of miR-16-2-3p, miR-378a-3p, and miR-483-5p, and particularly preferably miR-16-2-3p, miR-378a-3p, and miR-483-5p, from the viewpoints of test accuracy and being particularly suitable for measurement by simpler methods (e.g., PCR) (e.g., being able to be detected stably).

[0064] Detection is typically achieved by measuring the amount or concentration of the target biomarker. "Concentration" does not necessarily mean absolute concentration, but may also include relative concentration, weight per unit volume, or raw data measured to determine absolute concentration.

[0065] The method for detecting a target biomarker is not particularly limited as long as it can specifically detect part or all of the target biomarker, and specific examples of the detection method include RNA-seq analysis, RT-PCR, nucleic acid chip analysis, and Northern blotting.

[0066] When using RNA-seq analysis, specifically, cDNA is prepared from RNA derived from the subject according to standard methods, and sequence analysis is performed using a next-generation sequencer, etc., and mapping, gene expression analysis, expression level analysis, etc. are performed based on the obtained data to obtain expression level information.

[0067] When RT-PCR is used, a specific example is a method in which cDNA is prepared from RNA derived from a test subject in a standard manner, and a pair of primers (a positive strand that binds to the above-mentioned cDNA (-strand), and a reverse strand that binds to the + strand) is hybridized to this as a template so that the target region can be amplified, PCR is performed in a standard manner, and the resulting amplified double-stranded DNA is detected. The amplified double-stranded DNA can be detected by performing the above-mentioned PCR using primers that have been labeled in advance with RI or a fluorescent substance, detecting the resulting labeled double-stranded DNA, or by transferring the produced double-stranded DNA to a nylon membrane or the like in a standard manner, and then hybridizing it with a labeled probe for detection.

[0068] When nucleic acid chip analysis is used, a method can be used in which a nucleic acid chip with a nucleic acid probe (single-stranded or double-stranded) attached thereto is prepared, and this is hybridized with RNA derived from the subject or nucleic acid prepared from the RNA by conventional methods, and the formed double strand is detected.

[0069] When using the Northern blot method, a specific example is a method in which a probe is labeled with a radioactive isotope (such as 32P or 33P: RI) or a fluorescent substance, and then hybridized with RNA derived from the test subject.The formed double strand is then detected and measured using a radiation detector or a fluorescence detector to detect the signal derived from the label on the probe (such as RI or a fluorescent substance).

[0070] According to the testing method of the present invention including step (1), it is possible to provide the amount and / or concentration of a target biomarker that is an indicator for determining the possibility of pregnancy due to an egg held in the follicular fluid and / or the possibility of birth due to said pregnancy, thereby assisting in said determination.

[0071] The test results obtained by the test method of the present invention, including step (1), can be applied to determining whether or not to fertilize collected eggs, determining whether or not to cryopreserve collected eggs, determining whether or not to thaw and fertilize frozen eggs, determining whether or not to cryopreserve fertilized eggs after fertilization, and determining which fertilized eggs to thaw and implant.

[0072] 1-2. Step (2) In one embodiment, the testing method of the present invention preferably further comprises: (2) a step of determining the possibility of pregnancy from the egg and / or the possibility of birth from the pregnancy based on the amount or concentration of the miRNA detected in step (1).

[0073] More specifically, step (2) comprises: (2a) determining that the possibility of pregnancy by the egg and / or birth due to the pregnancy is high when the amount or concentration of at least one miRNA selected from the group consisting of miR-1468-5p, miR-424-5p, miR-16-2-3p, miR-30e-5p, miR-146a-5p, miR-202-5p, and miR-451a detected in step (1) is equal to or higher than a cutoff value, and / or determining that the possibility of pregnancy by the egg and / or birth due to the pregnancy is low when the amount or concentration is equal to or lower than the cutoff value; and (2b) determining that the possibility of pregnancy by the egg and / or birth due to the pregnancy is high when the amount or concentration of at least one miRNA selected from the group consisting of miR-204-3p, miR-1246, miR-1290, miR-378a-3p, miR-483-5p, miR-370-3p, miR-506-3p, miR-3184-3p, miR-423-5p, miR-365a-5p, miR-514a-3p, miR-92b-5p, miR-27a-5p, miR-6873-3p, miR-122-5p, and miR-122b-3p detected in the step (1) is equal to or lower than a cutoff value, and / or determining that the possibility of pregnancy by the egg and / or birth due to the pregnancy is low when the amount or concentration is equal to or higher than the cutoff value; The method may include at least one step selected from the group consisting of:

[0074] If it is determined that there is a high possibility of pregnancy and childbirth, steps of assisted reproductive technology can be carried out, such as fertilizing the collected eggs, freezing and preserving the collected eggs, thawing and fertilizing the frozen and preserved eggs, transplanting cultured embryos, etc. The method of assisted reproductive technology is not particularly limited, and a method according to or similar to a known method can be adopted.

[0075] The cutoff value can be appropriately determined by those skilled in the art from the perspectives of sensitivity, specificity, positive predictive value, negative predictive value, etc., and can be a value determined on a case-by-case basis or a predetermined value based on the amount and / or concentration of the target biomarker in various follicular fluid samples (e.g., follicular fluid samples from eggs that resulted in pregnancy, follicular fluid samples from eggs that did not result in pregnancy). More specifically, the cutoff value can be determined, for example, by measuring the amount or concentration of the target biomarker in the follicular fluid sample and using the measured value to perform statistical analysis based on receiver operating characteristic (ROC) curve analysis (more specifically, a method using the Youden index is exemplified). The cutoff value can be, for example, a percentile value of the amount or concentration of the target protein in follicular fluid samples from a reference subject group, for example, any of the 10th to 90th percentile values, any of the 30th to 70th percentile values, or any of the 40th to 60th percentile values. Once established, the database of the evaluation population may be used to set the cutoff value without any changes. Alternatively, new subjects, including the subjects of the present invention, may be incorporated into the evaluation population, and the database of the evaluation population may be updated as appropriate and used to set the cutoff value.

[0076] 2. Test Agent for Target Disease In one aspect, the present invention relates to a test agent for determining the possibility of pregnancy due to an egg in a subject and / or the possibility of birth due to said pregnancy, comprising a detection agent for a target biomarker (also referred to herein as the "detection agent of the present invention"). (Also referred to herein as the "test agent of the present invention"). This will be described below.

[0077] The target biomarkers, target diseases, etc. are the same as those defined above in "1. Testing methods."

[0078] The detecting agent of the present invention is not particularly limited as long as it can specifically detect a target biomarker. Examples of the detecting agent include primers and probes for the target biomarker.

[0079] The detection agent of the present invention may be modified, as long as its function is not significantly impaired. Modifications include the addition of labels such as fluorescent dyes, enzymes, proteins, radioisotopes, chemiluminescent substances, biotin, etc.

[0080] Fluorescent dyes suitable for use in the present invention include those typically used to label nucleotides for the detection and quantification of nucleic acids. Examples include, but are not limited to, HEX (4,7,2',4',5',7'-hexachloro-6-carboxylfluorescein, a green fluorescent dye), fluorescein, NED (trade name, manufactured by Applied Biosystems, a yellow fluorescent dye), 6-FAM (trade name, manufactured by Applied Biosystems, a yellow-green fluorescent dye), and rhodamine or its derivatives (e.g., tetramethylrhodamine (TMR)). Nucleotides can be labeled with fluorescent dyes using any suitable known labeling method (see Nature Biotechnology, 14, 303-308 (1996)). Alternatively, commercially available fluorescent labeling kits (e.g., Oligonucleotide ECL 3'-Oligolabeling System, manufactured by Amersham-Pharmacia) can be used.

[0081] The detection agent of the present invention can also be used by immobilizing it on any solid phase, and therefore the test agent of the present invention can be provided in the form of a substrate on which the detection agent is immobilized (for example, a microarray chip on which a probe is immobilized).

[0082] The solid phase used for immobilization is not particularly limited as long as it can immobilize polynucleotides, etc., and examples thereof include glass plates, nylon membranes, microbeads, silicon chips, capillaries, and other substrates. The immobilization of the detection agent to the solid phase is not particularly limited. For example, in the case of a microarray, a commercially available spotter (e.g., manufactured by Amersham) can be used. Immobilization methods are well known in the art depending on the type of immobilized probe (e.g., photolithographic technology (Affymetrix) or in situ synthesis of oligonucleotides using inkjet technology (Rosetta Inpharmatics)).

[0083] Primers, probes, etc. are not particularly limited as long as they selectively (specifically) recognize a target biomarker or a nucleic acid derived therefrom. Here, "selectively (specifically) recognize" means, for example, in Northern blotting, that the target biomarker can be specifically detected, or in RT-PCR, that the target biomarker or a nucleic acid derived therefrom (cDNA, etc.) is specifically amplified. However, the present invention is not limited thereto, and any primer or probe may be used as long as a person skilled in the art can determine that the detected or amplified product is derived from the target biomarker.

[0084] Specific examples of primers and probes include at least one selected from the group consisting of the polynucleotides described in (a) below and the polynucleotides described in (b) below: (a) a polynucleotide having at least 15 consecutive bases in the base sequence of a target biomarker and / or a polynucleotide complementary to said polynucleotide, and (b) a polynucleotide having at least 15 bases that hybridizes under stringent conditions to the base sequence of a target biomarker or a base sequence complementary thereto.

[0085] A complementary polynucleotide or complementary base sequence (complementary strand, reverse strand) refers to a polynucleotide or base sequence that is base-complementary to the full-length polynucleotide sequence of a target biomarker, or a partial sequence thereof having at least 15 consecutive bases in length (for convenience, these are also referred to as the "positive strand" herein), based on base pairing such as A:T and G:C. However, such a complementary strand is not limited to a completely complementary sequence to the base sequence of the target positive strand, but may also have a complementary relationship to the target positive strand that allows hybridization under stringent conditions. Here, stringent conditions can be determined based on the melting temperature (Tm) of the nucleic acid to which the complex or probe binds, as taught by Berger and Kimmel (1987, Guide to Molecular Cloning Techniques Methods in Enzymology, Vol. 152, Academic Press, San Diego, CA). For example, typical post-hybridization washing conditions include approximately 1x SSC, 0.1% SDS, and 37°C. It is preferable that the complementary strand maintains its hybridization state with the target positive strand even when washed under these conditions. While not particularly limited, more stringent hybridization conditions include approximately 0.5x SSC, 0.1% SDS, and 42°C, and even more stringent hybridization conditions include approximately 0.1x SSC, 0.1% SDS, and 65°C. Specifically, examples of such complementary strands include a strand consisting of a nucleotide sequence that is completely complementary to the nucleotide sequence of the target positive strand, and a strand consisting of a nucleotide sequence that shares at least 90%, preferably 95%, more preferably 98% or more, and even more preferably 99% or more identity with the target positive strand.

[0086] Primers, probes, etc. can be designed, for example, based on the nucleotide sequence of a target biomarker using various design programs. Specifically, candidate sequences for primers or probes obtained by applying the nucleotide sequence of the target biomarker to a design program, or sequences containing at least a portion of such sequences, can be used as primers or probes.

[0087] The base length of a primer, probe, or the like is not particularly limited as long as it has a length of at least 15 consecutive bases as described above, and can be appropriately set depending on the application. For example, when used as a primer, the base length can be, for example, 15 to 35 bases, and when used as a probe, the base length can be, for example, 15 to 35 bases.

[0088] The test agent of the present invention may contain a detection agent other than the detection agent of the present invention (e.g., a probe for detecting nucleic acids such as other miRNAs, an antibody, etc.). In this case, the test agent of the present invention may be a test agent that can test for other diseases or conditions in addition to the target disease. In this case, the detection agent of the present invention is included as a detection agent for testing for the target disease. From this perspective, in one aspect, the test agent of the present invention is a test agent for a target disease that contains a detection agent for testing for the target disease consisting of the detection agent of the present invention.

[0089] The test agent of the present invention may be in the form of a composition. The composition may contain other components as needed. Examples of other components include bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, excipients, binders, disintegrants, lubricants, thickeners, moisturizers, colorants, fragrances, chelating agents, etc.

[0090] The test agent of the present invention may be in the form of a kit. In addition to the detection agent or the composition containing the same, the kit may contain other materials that can be used to detect target biomarkers in the body fluid of a subject. Specific examples of such materials include various reagents (e.g., buffer solutions), instruments (e.g., instruments for purifying and separating body fluids), and the like.

[0091] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0092] Test Example 1: Search for Test Markers for the Possibility of Pregnancy and / or the Possibility of Livebirth from the Pregnancy <Research Subjects> Follicular fluid (FF) samples were collected from women undergoing assisted reproductive technology (ART) at a hospital. Informed consent was obtained from each patient before ovarian stimulation. FF samples were analyzed using small RNA sequencing for cases in which pregnancy was achieved using eggs retained in the FF (pregnant cases, N = 10) and cases in which pregnancy was not achieved using eggs retained in the FF (non-pregnant cases, N = 14). Non-pregnant cases were selected based on the maternal age and grade of the transferred embryos, similar to those of pregnant cases. All pregnant cases delivered live babies at term.

[0093] Ovarian stimulation and in vitro fertilization / microinsemination procedures: Ovarian stimulation consisted of urinary follicle-stimulating hormone (FSH) or recombinant FSH administered at 150–300 IU per day for the first 2 days, followed by individualized dose adjustments based on follicular response under a gonadotropin-releasing hormone antagonist or agonist protocol. When follicles reached a mean diameter of 18 mm or greater, 10,000 IU of human chorionic gonadotropin was administered, and oocyte retrieval was performed 35.5 hours later. The protocols used for oocyte collection and preparation, sperm preparation, and in vitro fertilization (IVF) / intracytoplasmic sperm injection (ICSI) were as previously reported (Gynecol Endocrinol. 2010;26(7):494–9. doi:10.3109 / 09513591003632050).

[0094] Sample collection: FF was collected from follicles measuring 18-25 mm in diameter from each patient. Each oocyte and FF were collected individually. All FF samples were placed in individual 15 mL conical tubes and centrifuged at 15,000 rpm for 10 minutes. The clear supernatant was then dispensed into 2 mL tubes and stored at -80°C until analysis.

[0095] <EV isolation> Approximately 1 mL of each sample was centrifuged at 10,000 g for 40 minutes at 4°C in a Kubota Model 7000 ultracentrifuge. The supernatant was filtered using a 0.22 μm filter (Millex-GV 33 mm, Millipore) and ultracentrifuged at 110,000 g for 70 minutes at 4°C in an MLS50 rotor (Beckman Coulter Inc, USA). The pellet was washed with PBS, ultracentrifuged under the same conditions, and resuspended in PBS to extract small EVs. The expression of sEV markers (CD9, CD63, CD81) was confirmed by Western blotting, and the particle size distribution peaked at approximately 100 nm.

[0096] <Small RNA Sequencing> RNA was extracted using the miRNeasy Plus Mini Kit (QIAGEN, Hilden, Germany). The total RNA concentration of each sample was measured using the Qubit RNA HS Assay Kit (Thermo Fisher Scientific, Waltham, MA). Small RNA libraries were created using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England Biolabs, Ipswich, MA), and index codes were added to each sample to identify its sequence. PCR products were then purified using the QIAquick PCR Purification Kit (Qiagen) and 6% TBE gel (120V, 60 minutes). DNA fragments corresponding to 140-160 bp (the length of the small non-coding RNA and 3' and 5' adapters) were isolated, and the complementary DNA concentrations were measured using the Qubit dsDNA HS Assay Kit and a Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA). Finally, single-end reads were performed using Illumina MiSeq or NextSeq (Illumina, San Diego, CA).

[0097] Bioinformatics Analysis: Raw small RNA sequencing data files were analyzed using the CLC Genomics Workbench version 9.5.3 program (Qiagen). After adapter trimming, the data were mapped to the miRbase 22 database, allowing up to two mismatches, and normalized using the number of reads per million mapped. RStudio (RStudio, Boston, MA) and R software (ver. 4.0.3) were then used. To visualize the volcano plot, the log2 fold change (log2 FC) and corrected p-value for each gene were calculated using the Wald test in DESeq2 (ver. 1.30.0). After excluding miRNAs with reads per million (RPM) max <100, 365 miRNAs were selected for subsequent analysis. Differentially expressed miRNAs in FF-EVs between pregnant and non-pregnant cases were selected using a t-test with an adjusted p-value <0.05 and a log2 FC >0.7 as cutoff criteria. As a result, we found that 7 miRNAs were highly expressed in pregnant cases, while 16 miRNAs were highly expressed in non-pregnant cases. Furthermore, to examine the diagnostic ability of miRNAs, we constructed receiver operating characteristic (ROC) curves and calculated the area under the curve (AUC).

[0098] For each of the selected marker miRNAs, the number of reads in pregnant and non-pregnant cases is shown in Figures 1 to 23.

[0099] The AUCs are shown in Table 1. In Table 1, P up indicates miRNAs whose expression levels are increased in pregnant cases compared to non-pregnant cases, and P down indicates miRNAs whose expression levels are decreased in pregnant cases compared to non-pregnant cases.

[0100]

[0101] Furthermore, a new variable (prediction probability) was calculated by combining multiple miRNAs, and a similar ROC was created. Specifically, this was done as follows: Using the glm function in R software, logistic regression analysis was performed on pregnancy and non-pregnancy based on the expression levels of miR-16-2-3p, miR-378a-3p, and miR-483-5p to calculate the prediction probability. As a result, the AUC when miR-16-2-3p, miR-378a-3p, and miR-483-5p were combined was 0.9643.

Claims

1. (1) In a follicular fluid sample collected from a subject (a) the group consisting of miR-16-2-3p, miR-378a-3p, miR-483-5p, miR-1246, and miR-1290, and / or (b) miR-204-3p, miR-1468-5p, miR-424-5p, miR-30e-5p, miR-146a-5p, miR-202-5p, miR-370-3p, miR-506-3p, miR-3184-3p, m a group consisting of iR-423-5p, miR-365a-5p, miR-514a-3p, miR-92b-5p, miR-27a-5p, miR-6873-3p, miR-451a, miR-122-5p, and miR-122b-3p; At least one miRNA selected from detecting Including, the follicular fluid sample is a cell-depleted fraction of follicular fluid; A method for examining the possibility of pregnancy due to the eggs contained in the follicular fluid and / or the possibility of birth due to the pregnancy.

2. 2. The method of claim 1, wherein the miRNA comprises at least one miRNA selected from the group consisting of miR-16-2-3p, miR-378a-3p, miR-483-5p, miR-1246, and miR-1290.

3. The method of claim 1, wherein the miRNA comprises at least one miRNA selected from the group consisting of miR-16-2-3p, miR-378a-3p, and miR-483-5p.

4. 2. The method of claim 1, wherein the miRNAs include miR-16-2-3p, miR-378a-3p, and miR-483-5p.

5. The method of claim 1, wherein the follicular fluid sample is extracellular vesicles purified from follicular fluid.

6. The method of claim 5, wherein the extracellular vesicles comprise exosomes.

7. The method of claim 1, wherein the miRNA comprises at least one miRNA selected from the group consisting of miR-204-3p, miR-1468-5p, miR-424-5p, miR-16-2-3p, miR-30e-5p, miR-1246, miR-1290, miR-378a-3p, miR-483-5p, miR-146a-5p, miR-202-5p, miR-370-3p, miR-506-3p, miR-3184-3p, miR-423-5p, miR-365a-5p, miR-514a-3p, miR-92b-5p, miR-27a-5p, and miR-6873-3p.

8. moreover, (2) determining the possibility of pregnancy due to the egg and / or the possibility of birth due to the pregnancy based on the amount or concentration of the miRNA detected in the step (1); The method of claim 1 , comprising:

9. The step (2) (2a) determining that there is a high possibility of pregnancy due to the egg and / or birth due to the pregnancy when the amount or concentration of at least one miRNA selected from the group consisting of miR-1468-5p, miR-424-5p, miR-16-2-3p, miR-30e-5p, miR-146a-5p, miR-202-5p, and miR-451a detected in the step (1) is equal to or greater than a cutoff value, and / or determining that there is a low possibility of pregnancy due to the egg and / or birth due to the pregnancy when the amount or concentration is equal to or less than the cutoff value; and (2b) miR-204-3p, miR-1246, miR-1290, miR-378a-3p, miR-483-5p, miR-370-3p, miR-506-3p, miR-3184-3p, miR-423-5p, miR-365a-5p, miR-514a-3p, miR-92b-5p, miR-27a-5p, and miR-6873-3p detected in the step (1). determining that there is a high possibility of pregnancy due to the egg and / or a birth due to the pregnancy when the amount or concentration of at least one miRNA selected from the group consisting of miR-122b-3p, miR-122-5p, and miR-122b-3p is equal to or less than a cutoff value, and / or determining that there is a low possibility of pregnancy due to the egg and / or a birth due to the pregnancy when the amount or concentration of at least one miRNA selected from the group consisting of miR-122b-3p, miR-122-5p, and miR-122b-3p is equal to or less than a cutoff value; 9. The method of claim 8, comprising at least one step selected from the group consisting of:

10. The method according to any one of claims 1 to 9, wherein the pregnancy is a pregnancy resulting from assisted reproductive technology.

11. The method according to any one of claims 1 to 9, wherein the subject is a human.

12. (a) the group consisting of miR-16-2-3p, miR-378a-3p, miR-483-5p, miR-1246, and miR-1290, and / or (b) miR-204-3p, miR-1468-5p, miR-424-5p, miR-30e-5p, miR-146a-5p, miR-202-5p, miR-370-3p, miR-506-3p, miR-3184-3p, m a group consisting of iR-423-5p, miR-365a-5p, miR-514a-3p, miR-92b-5p, miR-27a-5p, miR-6873-3p, miR-451a, miR-122-5p, and miR-122b-3p; A test agent for detecting the possibility of pregnancy by an egg of a subject and / or the possibility of birth due to said pregnancy, for use in the method of any one of claims 1 to 9, comprising a detection agent for at least one miRNA selected from the group consisting of: