Neutralizable blood coagulation inhibitor

Abstract

The present invention provides a bivalent DNA aptamer and pharmaceutical use thereof. In the bivalent DNA aptamer, a DNA aptamer that binds to exosite I of thrombin and a DNA aptamer that binds to exosite II are linked via a double-stranded DNA.

Description

Neutralizable blood coagulation inhibitors

[0001] The present invention relates to monovalent nucleic acid aptamers, bivalent nucleic acid aptamers, and neutralizable blood coagulation inhibitors containing them.

[0002] Thrombin is a multifunctional serine protease and an important enzyme in the hemostatic network. It plays a role in blood coagulation through platelet activation and the induction of fibrin formation by proteolysis of fibrinogen. Inhibition of thrombin enzymatic activity is caused by blocking the anion-binding exosites I and II, which are involved in substrate recognition and binding. Exosite I binds fibrinogen, factor XI, factor XIII, etc.

[0003] Fibrinogen is a protein present in plasma at high concentrations (2 to 4 mg / mL, 6 to 12 μM), and is converted into fibrin by thrombin, thereby playing a role in hemostasis.

[0004] Blood coagulation is a chain reaction involving multiple factors, and when one coagulation factor is activated, the activated coagulation factor activates another coagulation factor. The initiation of this reaction is broadly divided into the intrinsic system and the extrinsic system, and both activate factor X in the common system. Activated factor Xa, together with factor Va, degrades and activates prothrombin to generate thrombin. Ultimately, thrombin converts fibrinogen into fibrin, forming a blood clot, which is how blood clots.

[0005] Thromboembolism is a disease with high morbidity and mortality. Therefore, heparin, an anticoagulant that can treat this disease, is frequently used. However, in recent years, serious side effects associated with heparin administration have become a problem. Argatroban, a small molecule drug, is known as an alternative anticoagulant to heparin, but there is a problem in that there is no reversal agent that can reverse the drug's effects in the event of a bleeding event. Therefore, there is a need for the development of an anticoagulant that has strong anticoagulant properties and for which a reversal agent exists.

[0006] Nucleic acid aptamers are single-stranded functional oligonucleotides that function to specifically recognize various molecules (metal ions, small molecules, proteins, cells, etc.). Compared to antibodies, nucleic acid aptamers have several advantages: they can be screened without using animals, they are inexpensive and easy to synthesize and modify artificially, they are highly thermostable, and they are easy to store, and they have low immunogenicity. Furthermore, while it is difficult to develop neutralizing agents to administer when side effects occur with antibodies and small molecules, aptamers can be easily controlled by adding complementary strands or small molecules.

[0007] Representative conventionally known thrombin nucleic acid aptamers are shown below.

[0008] TBA15 (also known as HD1: 5'-GGTTGGGTGTGGTTGG-3'; SEQ ID NO: 1) is a 15-mer thrombin aptamer that contains a G-quadruplex structure sandwiching two TT loops and a TGT motif. TBA15 is known to bind to and inactivate thrombin exosite I, and clinical trials were conducted as an anticoagulant (ARC183) during coronary artery bypass surgery. However, although administration of TBA15 produced anticoagulant activity, the drug dose required to achieve the desired anticoagulant activity was inadequate, and the clinical trials were discontinued after the completion of Phase I (Non-Patent Document 1).

[0009] NU172 (5'-CGCCTAGGTTGGGTAGGGGTGGTGGCG-3': SEQ ID NO: 2) is a 26-mer thrombin aptamer that binds to exosite I. This aptamer was developed as an alternative to TBA15 for the purpose of developing an anticoagulant. Like TBA15, NU172 has been shown to inhibit blood coagulation, and is currently undergoing clinical trials as an anticoagulant (ARC2172) during coronary artery bypass surgery, and is currently in Phase II trials.

[0010] TBA29 (also known as HD22: 5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACT-3'; SEQ ID NO: 3) is a 29-mer thrombin aptamer with a mixed duplex and G-quadruplex structure. It has high binding affinity, but has little anticoagulant activity because it binds to exosite II.

[0011] The present inventors have also developed a 43-mer thrombin aptamer called M08s (5'-AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT-3': SEQ ID NO: 14; hereinafter, sometimes referred to as M08s(43) or M08s-1(43)), but have reported that it is difficult to further shorten its length while maintaining its activity (Non-Patent Document 5).

[0012] Thrombin aptamers are classified into two types based on their binding sites (Exosite I and Exosite II; hereinafter referred to as exosite I and exosite II) (Figure 1), and it has been known that a single molecule of a bivalent nucleic acid aptamer can be constructed by connecting an aptamer that binds to exosite I and an aptamer that binds to exosite II with a linker. In this case, it has been known that a single-stranded polyA or polyT linker, which has a flexible structure and is advantageous for binding to thrombin, is optimal (Non-Patent Document 2). The present inventors have also constructed a single molecule of a bivalent nucleic acid aptamer by connecting an aptamer that binds to exosite I and an aptamer that binds to exosite II with a single-stranded polyA or polyT linker (Patent Document 1 and Non-Patent Document 4).

[0013] A. Schwienhorst, Cell. Mol. Life Sci. Vol.63, (2006) 2773-2791Jens Muller et al., ChemBioChem 2007,8, 2223-2226JOSEPH N. ZADEH et al., J Comput Chem 32: 170-173, 2011Toru Yoshitomi et al., Res Pract Thromb Haemost. 2021;5:e12503.Koji Wakui et al., Molecular Therapy: Nucleic Acids Vol. 16 348-359, 2019

[0014] International Publication No. 2019 / 146676

[0015] The present invention provides a monovalent nucleic acid aptamer, a bivalent nucleic acid aptamer, and a blood coagulation inhibitor containing the same, as well as a neutralizing agent thereof.

[0016] The present inventors have succeeded in creating 1) a modified M08s and 2) a new bivalent nucleic acid aptamer that are more suitable for pharmaceutical use. Furthermore, they have newly discovered that when forming a bivalent nucleic acid aptamer, using a highly rigid, linear double-stranded DNA structure, known as a double helix structure, as a linker rather than a single-stranded structure that has a flexible structure, results in superior blood coagulation inhibitory activity, leading to the completion of the present invention.

[0017] The present invention includes the following: [A1] A DNA aptamer comprising the following primary structure: (wherein k, m, and n represent the number of bases in DNA, k is 0, 1, 2, or 3, m is an integer selected from the group consisting of 1 to 15, n is 0, 1, 2, or 3, each X and Y is independently any base, α and β are bases, and 5'-(α) ｍ -3' and 5'-(β) ｍ (-3' forms an antiparallel double-stranded structure). [A2] The DNA aptamer according to [A1], comprising the following primary structure: [A3] The DNA aptamer according to [A1], comprising M08s-1(36) (sequence number 107).

[0018] [0] Two DNA aptamers that bind to exosite I of thrombin; two DNA aptamers that bind to exosite II; or a bivalent DNA aptamer in which a DNA aptamer that binds to exosite I of thrombin and a DNA aptamer that binds to exosite II are linked via double-stranded DNA.

[0019] [1] A single-stranded bivalent DNA aptamer according to [0], comprising any one of the following primary structures: a-1) a-2) (wherein k, m, n, p, and q represent the number of bases in DNA, k is 0, 1, 2, or 3, m is an integer selected from the group consisting of 1 to 15, n is 0, 1, 2, 3, 4, or 5, p is an integer selected from the group consisting of 1 to 17, q is 0, 1, 2, or 3, each of X, Y, and Z is independently any base, α, β, γ, and δ are bases, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ [2] A single-stranded bivalent DNA aptamer according to [0], comprising any one of the following primary structures: a1-1) a1-2) (wherein k, m, n, p, and q represent the number of bases in DNA, k is 0, 1, 2, or 3, m is an integer selected from the group consisting of 1 to 10, n is 0, 1, 2, 3, 4, or 5, p is an integer selected from the group consisting of 1 to 10, q is 0, 1, 2, or 3, each of X, Y, and Z is independently any base, α, β, γ, and δ are bases, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ a2-1) a single-stranded bivalent DNA aptamer according to [0], comprising any one of the following primary structures: a2-2) (wherein, m and p represent the number of bases in DNA, m is an integer selected from the group consisting of 1 to 10, p is an integer selected from the group consisting of 1 to 10, α, β, γ, and δ are bases, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0020] [4] A single-stranded bivalent DNA aptamer according to [0], comprising any one of the following primary structures: b-1) b-2) (wherein k, m, n, p, and q represent the number of bases in DNA, k is 0, 1, 2, or 3, m is an integer selected from the group consisting of 1 to 15, n is 0, 1, 2, 3, 4, or 5, p is an integer selected from the group consisting of 1 to 13, q is 0, 1, 2, or 3, each of X, Y, and Z is independently any base, α, β, γ, and δ are bases, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ [5] A single-stranded bivalent DNA aptamer according to [0], comprising any one of the following primary structures: b1-2) (wherein k, m, n, p, and q represent the number of bases in DNA, k is 0, 1, 2, or 3, m is an integer selected from the group consisting of 1 to 10, n is 0, 1, 2, 3, 4, or 5, p is an integer selected from the group consisting of 1 to 10, q is 0, 1, 2, or 3, each of X, Y, and Z is independently any base, α, β, γ, and δ are bases, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ-3' and 5'-(δ) ｐ b2-1) b2-2) b2-3) b2-4) b2-5) b2-6) b2-7) b2-8) b2-9) b2-10) b2-2) (wherein, m and p represent the number of bases in DNA, m is an integer selected from the group consisting of 1 to 10, p is an integer selected from the group consisting of 1 to 10, α, β, γ, and δ are bases, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0021] [7] A single-stranded bivalent DNA aptamer according to [0], comprising the following primary structure: c) (wherein k, m, n, p, and q represent the number of bases in DNA, k is 0, 1, 2, or 3, m is an integer selected from the group consisting of 1 to 15, n is 0, 1, 2, 3, 4, or 5, p is an integer selected from the group consisting of 1 to 15, q is 0, 1, 2, or 3, each of X, Y, and Z is independently any base, α, β, γ, and δ are bases, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ [8] A single-stranded bivalent DNA aptamer according to [0], comprising the following primary structure: c1) (wherein k, m, n, p, and q represent the number of bases in DNA, k is 0, 1, 2, or 3, m is an integer selected from the group consisting of 1 to 10, n is 0, 1, 2, 3, 4, or 5, p is an integer selected from the group consisting of 1 to 10, q is 0, 1, 2, or 3, each of X, Y, and Z is independently any base, α, β, γ, and δ are bases, and 5'-(α) ｍ -3' and 5'-(β)ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ c2) c3) c4) c5) c6) c7) c8) c9) c10) c11) c12) c13) c14) c15) c16) c17) c18) c19) c20) (wherein, m and p represent the number of bases in DNA, m is an integer selected from the group consisting of 1 to 10, p is an integer selected from the group consisting of 1 to 10, α, β, γ, and δ are bases, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0022] [B1] A single-stranded bivalent DNA aptamer according to [0], comprising any one of the following primary structures: d-2) e-1) e-2) f) (wherein k, m, n, p, and q represent the number of bases in DNA, k is 0, 1, 2, or 3, m is an integer selected from the group consisting of 1 to 10, n is 0, 1, 2, 3, 4, or 5, p is an integer selected from the group consisting of 1 to 10, q is 0, 1, 2, or 3, each of X, Y, and Z is independently any base, α, β, γ, and δ are bases, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0023] [C1] A single-stranded bivalent DNA aptamer according to [0], comprising any one of the following primary structures: d1-2) e1-1) e1-2) f1) (wherein k, m, n, p, and q represent the number of bases in DNA, k is 0, 1, 2, or 3, m is an integer selected from the group consisting of 1 to 10, n is 0, 1, 2, 3, 4, or 5, p is an integer selected from the group consisting of 1 to 10, q is 0, 1, 2, or 3, each of X, Y, and Z is independently any base, α, β, γ, and δ are bases, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0024] [D1] A single-stranded bivalent DNA aptamer according to [0], comprising any one of the following primary structures: d2-2) e2-1) e2-2) f2) (wherein, m and p represent the number of bases in DNA, m is an integer selected from the group consisting of 1 to 10, p is an integer selected from the group consisting of 1 to 10, α, β, γ, and δ are bases, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0025]

[10] The single-stranded bivalent DNA aptamer according to any one of [1] to [D1] above, wherein each α and β are bases that form a base pair, and / or each γ and δ are bases that form a base pair.

[11] The single-stranded bivalent DNA aptamer according to any one of [1] to [D1] above, wherein m + p is 5 to 21.

[12] The single-stranded bivalent DNA aptamer according to any one of [1] to [D1] above, wherein m + p is 5 to 17.

[13] The single-stranded bivalent DNA aptamer according to [0], comprising the sequence of pse(M08s-M03s) (SEQ ID NO: 12).

[14] The single-stranded bivalent DNA aptamer according to [0], comprising the sequence of pse(M08s-TBA29) (SEQ ID NO: 13).

[15] The single-stranded bivalent DNA aptamer according to [0], which comprises the sequence pse(M08s-M08s) (SEQ ID NO: 22).

[0026] [E1] The single-stranded bivalent DNA aptamer according to [0], comprising the sequence of M08s-1(36) (sequence number 107) and the sequence of TBA29 (sequence number 3). [E2] Pse08-29 ss1-TTACG (70) (SEQ ID NO: 108); Pse08-29 ss1-5A (70) (SEQ ID NO: 109); Pse08-29 ss1-4A (69) (SEQ ID NO: 110); Pse08-29 ss1-2A (67) (SEQ ID NO: 111); Pse08-29 ss1-5T (70) (SEQ ID NO: 112); Pse08-29 ss1-4T (69) (SEQ ID NO: 113); Pse08-29 ss1-2T (67) (SEQ ID NO: 114); Pse08-29 ss1-0A (65) (SEQ ID NO: 115); Pse08-29 ss1-0Aa (65) (SEQ ID NO: 116); Pse08-29 ss1-0Ab (65) (SEQ ID NO: 117); Pse08-29 ss1-0Ac (65) (SEQ ID NO: 118); Pse08-29 ss2-CGTAA (70) (SEQ ID NO: 119); Pse08-29 ss2-5A (70) (SEQ ID NO: 120); Pse08-29 ss2-4A (69) (SEQ ID NO: 121); Pse08-29 ss2-2A (67) (SEQ ID NO: 122); Pse08-29 ss2-5T (70) (SEQ ID NO: 123); Pse08-29 ss2-4T (69) (SEQ ID NO: 124); Pse08-29 ss2-2T(67) (SEQ ID NO: 125); Pse08-29 ss2-0B(65) (SEQ ID NO: 126); Pse08-29 ss2-0Ba(65) (SEQ ID NO: 127); Pse08-29 ss2-0Bb(65) (SEQ ID NO: 127); and Pse08-29 ss2-0Bc(65) (SEQ ID NO: 129). [E3] The single-stranded bivalent DNA aptamer according to [0], comprising two copies of the sequence of M08s-1(36) (SEQ ID NO: 107).[E4] The single-stranded bivalent DNA aptamer according to [0], comprising a sequence selected from the group consisting of Pse08-08(72) (SEQ ID NO: 130); Pse08-08(68) (SEQ ID NO: 131); Pse08-08(64) (SEQ ID NO: 132); Pse08-08(60) (SEQ ID NO: 133); Pse08-08 (72-GC) (SEQ ID NO: 134); and Pse08-08(60-GC) (SEQ ID NO: 135).

[0027] [1A] 5'-(α) ｍ -AGATGATGGGGATGGGGGGTTGGAGGAATGGAT- (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ -ATGGTGGTCGGGGTGGTGGGATGAGGGTTCTGACCT-(δ) ｍ -(Y) ｎ a) a double-stranded bivalent DNA aptamer according to [0], consisting of an oligonucleotide B comprising the sequence of -3': (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 27, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure). [2A] 5'-(α) ｍ -AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT- (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ -AGGTCAGATGGTGGTCGGGGTGGTGGGATGAGGGTTCTGACCT-(δ)ｍ -(Y) ｎ aa1) a double-stranded bivalent DNA aptamer according to [0], consisting of an oligonucleotide B containing the sequence of -3': (wherein m, n, and p represent the number of bases in DNA, m is 0 to 20, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms a double-stranded structure in an antiparallel fashion). [3A] 5'-(Y) ｎ - (α) ｍ -AGATGATGGGGATGGGGGGTTGGAGGAATGGAT- (β) ｍ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ -ATGGTGGTCGGGGTGGTGGGATGAGGGTT-(δ) ｍ -3'- The following double-stranded bivalent DNA aptamer according to [0], consisting of an oligonucleotide B containing the sequence: bb) (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 27, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms a double-stranded structure in an antiparallel fashion). [4A] 5'-(Y)ｎ - (α) ｍ -AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT- (β) ｍ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ -AGGTCAGATGGTGGTCGGGGTGGTGGGATGAGGGTTCTGACCT-(δ) ｍ -3', and the following double-stranded bivalent DNA aptamer according to [0], consisting of an oligonucleotide B containing the sequence: bb1) (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 20, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure). [5A] 5'-(α) ｍ -AGATGATGGGGATGGGGGGTTGGAGGAATGGAT- (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ -CCGTGGTAGGGCAGGTTGGGTG-(δ) ｍ -(Y) ｎ -3', a double-stranded bivalent DNA aptamer according to [0], consisting of an oligonucleotide B containing the sequence: (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 23, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ-3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure). [6A] 5'-(α) ｍ -AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT- (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ -AGTCCGTGGTAGGGCAGGTTGGGGTGACT-(δ) ｍ -(Y) ｎ -3', and the following double-stranded bivalent DNA aptamer according to [0], consisting of an oligonucleotide B containing the sequence: cc1) (wherein m, n, and p represent the number of bases in DNA, m is 0 to 20, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms a double-stranded structure in an antiparallel fashion). [7A] 5'-(Y) ｎ - (α) ｍ -AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT- (β) ｍ -(X) ｎ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ -AGTCCGTGGTAGGGCAGGTTGGGGTGACT-(δ) ｍ-3'- ... (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 23, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms a double-stranded structure in an antiparallel fashion). [8A] 5'-(Y) ｎ - (α) ｍ -AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT- (β) ｍ -(X) ｎ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ -AGTCCGTGGTAGGGCAGGTTGGGGTGACT-(δ) ｍ -3'- ... (wherein m, n, and p represent the number of bases in DNA, m is 0 to 20, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure). [9A] 5'-(α)ｍ - AGATGATGGGGATGGGGGGTTGGAGGAATGGAT - (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ - AGATGATGGGGATGGGGGGTTGGAGGAATGGAT - (δ) ｍ -(Y) ｎ A bivalent DNA aptamer according to [0], which is of the following double-stranded type and which consists of an oligonucleotide B containing the sequence of -3': (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 25, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure). [10A] 5'-(α) ｍ -AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT- (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ - AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT - (δ) ｍ -(Y) ｎ A bivalent DNA aptamer according to [0], which is of the following double-stranded type and which consists of an oligonucleotide B containing the sequence of -3': (wherein m, n, and p represent the number of bases in DNA, m is 0 to 20, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ-3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms a double-stranded structure in an antiparallel fashion). [11A] 5'-(Y) ｎ - (α) ｍ -AGATGATGGGGATGGGGGGTTGGAGGAATGGAT- (β) ｍ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ - AGATGATGGGGATGGGGGGTTGGAGGAATGGAT - (δ) ｍ -3'- ... (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 25, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms a double-stranded structure in an antiparallel fashion). [12A] 5'-(Y) ｎ - (α) ｍ -AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT- (β) ｍ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ -AGGTCAGATGGTGGTCGGGGTGGTGGGATGAGGGTTCTGACCT-(δ) ｍ-3'-3'-containing oligonucleotide B, a double-stranded bivalent DNA aptamer according to [0], (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 20, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0028] [F1] 5'-(α) ｍ -TGGGGATGGGGGGTTGGAGGAA- (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ -ATGGTGGTCGGGGTGGTGGGATGAGGGTT-(δ) ｍ -(Y) ｎ -3'- ... (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 27, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure). [F2] 5'-(α)ｍ -AGGTCAATGGGGATGGGGGGTTGGAGGAATTGACCT- (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ -AGGTCAGATGGTGGTCGGGGTGGTGGGATGAGGGTTCTGACCT-(δ) ｍ -(Y) ｎ -3'- ... (wherein m, n, and p represent the number of bases in DNA, m is 0 to 20, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0029] [F3] 5'-(Y) ｎ - (α) ｍ -TGGGGATGGGGGGTTGGAGGAA- (β) ｍ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ -ATGGTGGTCGGGGTGGTGGGATGAGGGTT-(δ) ｍ -3') a double-stranded bivalent DNA aptamer according to [0], consisting of an oligonucleotide B containing the sequence: BB) (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 27, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ-3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure). [F4] 5'-(Y) ｎ - (α) ｍ - AGGTCAATGGGGATGGGGGGTTGGAGGAATTGACCT - (β) ｍ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ -AGGTCAGATGGTGGTCGGGGTGGTGGGATGAGGGTTCTGACCT-(δ) ｍ -3'-containing oligonucleotide B, a double-stranded bivalent DNA aptamer according to [0], comprising the following: BB1) (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 20, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0030] [F5] 5'-(α) ｍ - TGGGGATGGGGGGTTGGAGGAA-(β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ -CCGTGGTAGGGCAGGTTGGGTG-(δ) ｍ -(Y) ｎ-3', a double-stranded bivalent DNA aptamer according to [0], consisting of an oligonucleotide B comprising the sequence: CC) (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 23, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure). [F6] 5'-(α) ｍ - AGGTCAATGGGGATGGGGGGTTGGAGGAATTGACCT - (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ -AGTCCGTGGTAGGGCAGGTTGGGGTGACT-(δ) ｍ -(Y) ｎ -3'- ... (wherein m, n, and p represent the number of bases in DNA, m is 0 to 20, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0031] [F7] 5'-(Y)ｎ - (α) ｍ - TGGGGATGGGGGGTTGGAGGAA - (β) ｍ -(X) ｎ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ -CGTGGTAGGGCAGGTTGGGGT-(δ) ｍ -3') a double-stranded bivalent DNA aptamer according to [0], consisting of an oligonucleotide B comprising the sequence: DD (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 23, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms a double-stranded structure in an antiparallel fashion. [F8] 5'-(Y) ｎ - (α) ｍ - AGGTCAATGGGGATGGGGGGTTGGAGGAATTGACCT - (β) ｍ -(X) ｎ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ - AGTCCGTGGTAGGGCAGGTTGGGGTGACT - (δ) ｍ -3'- ... (wherein m, n, and p represent the number of bases in DNA, m is 0 to 20, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y)ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0032] [F9] 5'-(α) ｍ - TGGGGATGGGGGGTTGGAGGAA - (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ - TGGGGATGGGGGGTTGGAGGAA - (δ) ｍ -(Y) ｎ -3' of the following double-stranded bivalent DNA aptamer according to [0], consisting of an oligonucleotide B comprising the sequence: EE) (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 25, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure). [F10] 5'-(α) ｍ - AGGTCAATGGGGATGGGGGGTTGGAGGAATTGACCT - (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ - AGGTCAATGGGGATGGGGGGTTGGAGGAATTGACCT - (δ) ｍ -(Y) ｎ-3'- ... (wherein m, n, and p represent the number of bases in DNA, m is 0 to 20, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0033] [F11] 5' - (Y) ｎ - (α) ｍ - TGGGGATGGGGGGTTGGAGGAA - (β) ｍ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ - TGGGGATGGGGGGTTGGAGGAA - (δ) ｍ -3'- ... (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 25, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms a double-stranded structure in an antiparallel fashion. [F12] 5'-(Y) ｎ - (α)ｍ - AGGTCAATGGGGATGGGGGGTTGGAGGAATTGACCT - (β) ｍ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ - AGGTCAATGGGGATGGGGGGTTGGAGGAATTGACCT - (δ) ｍ -3'- ... (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 20, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0034] [13A] The double-stranded bivalent DNA aptamer according to any one of [1A] to [12A] and [F1] to [F12] above, wherein each X and Y are bases that form a base pair, each α and β are bases that form a base pair, and / or each γ and δ are bases that form a base pair. [14A] The double-stranded bivalent DNA aptamer according to any one of [1A] to [12A] and [F1] to [F12] above, wherein m+n+p is 5 to 21. [15A] 5'-(β) ｍ -(X) ｎ -(γ) ｐ The sequence at 5'-(δ) becomes 5'-CTAGTGACTGATTTACG-3', and the sequence at 5'-(δ) ｐ -(Y) ｎ - (α) ｍThe double-stranded bivalent DNA aptamer according to any one of [2A], [4A], [6A], [8A], [10A], [12A], [F2], [F4], [F6], [F8], [F10] and [F12], wherein the sequence of 5'-(X)-3' is 5'-CGTAAATCAGTCACTAG-3'. [16A] The double-stranded bivalent DNA aptamer according to [15A], wherein m is 0, n is 17 and p is 0. [17A] 5'-(X) ｎ -3' sequence is 5'-CTAGTGACTGATTTACG-3', and 5'-(Y ｎ A double-stranded bivalent DNA aptamer according to [16A], wherein the -3' sequence is 5'-CGTAAATCAGTCACTAG-3'.

[0035] [G1] Combinations of oligonucleotides A and B listed below, 1 to 40: The bivalent DNA aptamer according to [0], which is a double-stranded type consisting of a combination of oligonucleotides selected from the group consisting of:

[0036] [H1] A pharmaceutical composition for inhibiting blood coagulation, comprising the DNA aptamer of any one of [A1] to [A3]. [H2] A method for inhibiting blood coagulation by administering the DNA aptamer of any one of [A1] to [A3] to a subject, wherein the DNA aptamer preferably binds to thrombin in the blood and inhibits blood coagulation activity. [H3] The DNA aptamer of any one of [A1] to [A3] for use in treatment for inhibiting blood coagulation. [H4] Use of the DNA aptamer of any one of [A1] to [A3] in the manufacture of a medicament for inhibiting blood coagulation.

[0037] [1B] A pharmaceutical composition for inhibiting blood coagulation, comprising the bivalent DNA aptamer described in any one of [0] to [G1] above. [2B] A method for inhibiting blood coagulation by administering the bivalent DNA aptamer described in any one of [0] to [G1] above to a subject, wherein preferably the DNA aptamer binds to thrombin in the blood and inhibits blood coagulation activity. [3B] The bivalent DNA aptamer described in any one of [0] to [G1] above for use in blood coagulation inhibition treatment. [4B] Use of the bivalent DNA aptamer described in any one of [0] to [G1] above in the manufacture of a medicament for inhibiting blood coagulation.

[0038] [1C] A neutralizer for a pharmaceutical composition for inhibiting blood coagulation, comprising the bivalent DNA aptamer described in any one of [1] to [G1] above, wherein the neutralizer comprises a nucleic acid comprising a complementary sequence of 5'-AGGTCAGATGATGGGGGATGGG-3' (SEQ ID NO: 23). [2C] A neutralizer for a pharmaceutical composition for inhibiting blood coagulation, comprising the bivalent DNA aptamer described in any one of

[14] to

[16] above, wherein the neutralizer comprises a nucleic acid comprising a sequence described in [L-M08s]c (SEQ ID NO: 17) or a nucleic acid comprising a sequence described in 08ad (SEQ ID NO: 15).

[0039] [I] A neutralizing agent for a pharmaceutical composition for inhibiting blood coagulation, comprising a DNA aptamer comprising the sequence of M08s-1(36) (SEQ ID NO: 107), wherein the neutralizing agent comprises a nucleic acid comprising a sequence selected from the group consisting of Ant-M08_36-36 (SEQ ID NO: 142); Ant-M08_36-30 (SEQ ID NO: 143); Ant-M08_36-24 (SEQ ID NO: 144); Ant-M08_36-18 (SEQ ID NO: 145); Ant-M08_36-L18 (SEQ ID NO: 146); Ant-M08_36-R18 (SEQ ID NO: 147); and Ant-M08_36-12 (SEQ ID NO: 148). [J] A neutralizing agent for a pharmaceutical composition for inhibiting blood coagulation, comprising a DNA aptamer comprising the sequence of Pse08-08(64) (sequence number 138), wherein the neutralizing agent comprises a nucleic acid comprising the sequence of 2Ant44_Pse08-08(64) (sequence number 149).

[0040] [1D] A method for producing a pharmaceutical composition for inhibiting blood coagulation, comprising a bivalent DNA aptamer, the method comprising the steps of: 1) preparing or providing a test single-stranded oligonucleotide comprising any one of the following structures: (wherein k, m, n, p, and q represent the number of bases in DNA, k is 0, 1, 2, or 3, m is an integer selected from the group consisting of 1 to 15, n is 0, 1, 2, 3, 4, or 5, p is an integer selected from the group consisting of 1 to 15, q is 0, 1, 2, or 3, each of X, Y, and Z is independently any base, α, β, γ, and δ are bases, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ and 2) examining the affinity of the test oligonucleotide for thrombin, wherein if the affinity of the test oligonucleotide for thrombin is superior to that of a DNA aptamer consisting of the sequence lin(M08s-TBA29) (SEQ ID NO: 11), the test oligonucleotide is incorporated into a pharmaceutical composition as a bivalent DNA aptamer for inhibiting blood coagulation. [2D] A method for producing a pharmaceutical composition for inhibiting blood coagulation, comprising a bivalent DNA aptamer, comprising: 1) preparing or providing a test double-stranded oligonucleotide having any of the following structures: (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 27, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ-3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure); (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 23, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure); (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 25, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ1) a step of determining the affinity of the test oligonucleotide for thrombin, and 2) a step of examining the affinity of the test oligonucleotide for thrombin, wherein if the affinity of the test oligonucleotide for thrombin is superior to that of a DNA aptamer consisting of the sequence lin(M08s-TBA29) (SEQ ID NO: 11), the test oligonucleotide is incorporated into a pharmaceutical composition as a bivalent DNA aptamer for inhibiting blood coagulation. [3D] The manufacturing method according to [1D], wherein each α and β are bases that form a base pair, and / or each γ and δ are bases that form a base pair. [4D] The manufacturing method according to [1D], wherein n is 0 and m+p is 5 to 21. [5D] The manufacturing method according to [2D], wherein each X and Y are bases that form a base pair, each α and β are bases that form a base pair, and / or each γ and δ are bases that form a base pair. [6D] The manufacturing method according to [2D], wherein m+n+p is 5 to 21. [7D] 5'-(β) ｍ -(X) ｎ -(γ) ｐ The sequence at 5'-(δ) becomes 5'-CTAGTGACTGATTTACG-3', and the sequence at 5'-(δ) ｐ -(Y) ｎ - (α) ｍ The method for producing the nucleotide sequence of [6D], wherein the sequence at position 3′ is 5′-CGTAAATCAGTCACTAG-3′. [8D] The method for producing the nucleotide sequence of [6D], wherein m is 0, n is 17, and p is 0.

[0041] According to the present invention, monovalent or bivalent aptamers against thrombin can be efficiently produced, and the monovalent or bivalent aptamers have excellent blood coagulation inhibitory ability, and a neutralizing agent for the monovalent or bivalent aptamer can efficiently block the blood coagulation inhibitory ability of the monovalent or bivalent aptamer.

[0042] FIG. 1 shows, as an example, a schematic diagram of the binding state between thrombin and an aptamer binding to exosite I (TBA15 in the figure) and an aptamer binding to exosite II (TBA29 in the figure) (PDB ID: 5EW1). FIG. 2 shows the results of an investigation into the length of a double-stranded linker suitable for anticoagulation by thrombin inhibition. (a) This shows the anticoagulation effect when the double-stranded DNA linker is formed with TA base pairs. (b) This shows the anticoagulation effect when the double-stranded DNA linker is formed with mixed AT / GC base pairs. FIG. 3 shows the predicted secondary structures of the known monovalent aptamer used in Example 2, a bivalent aptamer in which the monovalent aptamer is linked via polyT, and, as an example, a bivalent aptamer in which the monovalent aptamer is linked via a double-stranded DNA. (a) NU172, (b) M08s, (c) lin (M08s-TBA29), (d) pse (M08s-M03s), (e) pse (M08s-TBA29), (f) pse (M08s-M08s). Figure 4 shows the results of APTT tests using blood samples collected from mice after a single administration of various aptamers and the small molecule drug argatroban. (a) APTT tests at each blood collection time. Mouse weight: 22 g; age: 7 weeks. (b) Comparison of maximum APTT values ​​using blood samples collected 3 minutes after administration. 0.13 μmol / kg. SD means with error bars (n=3 or n=5). § Exceeding the measurement limit (APTT>125 sec). APTT without aptamer administration: 22.5 sec. Figure 5 shows the anticoagulant effect in human plasma of a single-stranded bivalent aptamer (pse(M08s-M08s)), an example of the present invention. Figure 6 shows the neutralizing effect of adding an oligonucleotide with a complementary strand sequence to the nucleic acid aptamer pse(08-29) in human plasma. (a) Correlation diagram between the complementary sequence used as a neutralizing agent and pse(08-29). (b) Neutralizing effect on the anticoagulant action dependent on the complementary strand 08ad concentration. pse(08-29): 0.33 μM. Measurement solvent: 32% human plasma in PBS. Dashline showed an APTT value of 24.7 seconds when using buffer. (c) Neutralizing effect of complementary chains [L-M08s]c and [M08s]c on the concentration-dependent anticoagulant effect. pse(08-29): 0.33 μM. Measurement solvent: 32% human plasma in PBS.Dashline shows an APTT value of 24.7 seconds when buffer was used. FIG. 7 shows the structure of a single-stranded bivalent aptamer (pse(M08s-TBA29)) and one of the corresponding double-stranded bivalent aptamers (pse2(M08s-TBA29)), which is one example of the present invention. FIG. 8 shows the results of a simulation of the stability of the secondary structure of a double-stranded bivalent aptamer, which is one example of the present invention. FIG. 9A shows a schematic diagram of the structure of the double-stranded bivalent aptamer (M08s-TBA29:17-20 linker type) used in Example 4. % indicates the predicted rate of complementary strand formation calculated using NUPACK. FIG. 9B shows the results of an APTT test of the double-stranded bivalent aptamer (M08s-TBA29:17-20 linker type) in Example 4. Figure 10A shows a schematic diagram of the structure of the double-stranded bivalent aptamer (M08s-TBA29:13-16 linker type) used in Example 4. % indicates the predicted rate of complementary strand formation calculated using NUPACK. Figure 10B shows the results of an APTT test of the double-stranded bivalent aptamer (M08s-TBA29:13-16 linker type) used in Example 4. Figure 11A shows the difference between M08s (43mer) and M08s (36mer) used in Example 5. The underlined base in M08s (43mer) is the base missing in M08s (36mer). Figure 11B shows the anticoagulant effects of M08s (43mer) and M08s (36mer) used in Example 5. FIG. 12A shows a schematic diagram of the structure of the single-stranded bivalent aptamer (M08s(36)-TBA29) used in Example 6. FIG. 12B shows the results of an APTT test of the single-stranded bivalent aptamer (M08s(36)-TBA29) in Example 6. FIG. 13A shows a schematic diagram of the structure of the single-stranded bivalent aptamer (M08s(36)-M08s(36)) used in Example 7. FIG. 13B shows the results of an APTT test of the single-stranded bivalent aptamer (M08s(36)-M08s(36)) in Example 7. FIG. 14A shows the sequences of oligonucleotides complementary to M08s(36) and Pse08-08(64) used in Example 8. The underlined sequences indicate the sequences that form the stem structure.Figure 14B shows the neutralizing effect of oligonucleotides with complementary strand sequences to a) Pse08-29 ss1-4A(69); b) Pse08-29 ss1-2A(67); and c) Pse08-08(64) in Example 8.

[0043] As used herein, "comprising" encompasses "substantially comprising," "essentially comprising," "consisting essentially of," and "consisting of."

[0044] The present invention includes a nucleic acid aptamer against thrombin; two nucleic acid aptamers that bind to exosite I of thrombin; two nucleic acid aptamers that bind to exosite II of thrombin; or a bivalent nucleic acid aptamer that links a nucleic acid aptamer that binds to exosite I of thrombin with a nucleic acid aptamer that binds to exosite II of thrombin.

[0045] In the present invention, a nucleic acid aptamer refers to a nucleic acid molecule that has high affinity for and can specifically bind to a predetermined target molecule. A nucleic acid molecule having such properties is called a nucleic acid aptamer, and unless otherwise specified, is not limited by the base sequence, molecular size, or three-dimensional structure of the molecule. Preferably, the nucleic acid aptamer is DNA. Therefore, one embodiment of the present invention is a DNA aptamer for thrombin; two DNA aptamers that bind to exosite I of thrombin (hereinafter sometimes referred to as I-1 and I-2); two DNA aptamers that bind to exosite II of thrombin (hereinafter sometimes referred to as II-1 and II-2); or a bivalent DNA aptamer in which a DNA aptamer that binds to exosite I of thrombin and a DNA aptamer that binds to exosite II are linked.

[0046] Thrombin (also known as factor IIa) is a multifunctional serine protease and an important enzyme in the hemostatic network (EC 3.4.21.5). It catalyzes the conversion of fibrinogen to fibrin and is encoded by the F2 gene located on chromosome 11 p11-q12 in humans.

[0047] Exosite I of thrombin is a site to which substrates such as fibrinogen, factor X, factor XIII, and protease-activated receptors bind.

[0048] Exosite II of thrombin is the site to which substrates such as factor V, factor VIII, and antithrombin III bind.

[0049] The nucleic acid aptamer of the present invention that binds to exosite I or II of thrombin may be modified in a pharmacologically acceptable manner (e.g., PEGylation, labeling with a fluorescent substance, or the like, substitution with an artificial nucleic acid (e.g., fluorinated pyrimidine), partial or complete conversion of phosphate bonds between bases to phosphorothioate or phosphorodithioate bonds), as long as it maintains its ability to bind to exosite I or II of thrombin. Furthermore, one to several, for example, one, two, or three, bases in the sequence may be substituted, deleted, inserted, or the like.

[0050] Examples of aptamers that bind to exosite I include, but are not limited to, TBA15, NU172, M08s, or M08s (36) described below. Examples of aptamers that bind to exosite II include, but are not limited to, TBA29 and M03s. In one embodiment of the present invention, two DNA aptamers that bind to exosite I of thrombin; two DNA aptamers that bind to exosite II; or a DNA aptamer that binds to exosite I and a DNA aptamer that binds to exosite II of thrombin may be linked via a double-stranded nucleic acid. In the above embodiment, the two DNA aptamers that bind to exosite I of thrombin (I-1 and I-2) may be the same (sequence) molecule or different (sequence) molecules. Similarly, the two DNA aptamers that bind to exosite II (II-1 and II-2) may be the same (sequence) molecule or different (sequence) molecules. A double-stranded nucleic acid refers to a nucleic acid in which two polydeoxypolynucleotides or polyribonucleosides, or complexes thereof, are arranged in an antiparallel orientation and their constituent bases are linked via hydrogen bonds. Although not particularly limited, such a double-stranded nucleic acid is preferably DNA. Therefore, one embodiment of the present invention is a bivalent DNA aptamer in which two DNA aptamers that bind to exosite I of thrombin; two DNA aptamers that bind to exosite II of thrombin; or a DNA aptamer that binds to exosite I of thrombin and a DNA aptamer that binds to exosite II of thrombin are linked via double-stranded DNA.

[0051] One embodiment of the present invention is a single-stranded, bivalent DNA aptamer in which a DNA aptamer that binds to exosite I of thrombin; a DNA aptamer that binds to two exosite IIs; or a DNA aptamer that binds to exosite I of thrombin and a DNA aptamer that binds to exosite II are linked via double-stranded DNA. Such double-stranded DNA may be formed by: (1) maintaining a certain degree of complementarity between a DNA sequence structure (hereinafter also referred to as an α sequence structure) bound to the 5' end of a DNA aptamer (or I-1, II-1) that binds to exosite I of thrombin and a DNA sequence structure (hereinafter also referred to as a β sequence structure) bound to the 3' end of a DNA aptamer (or I-1, II-1) that binds to exosite I of thrombin; (2) maintaining a certain degree of complementarity between a DNA sequence structure (hereinafter also referred to as a γ sequence structure) bound to the 5' end of a DNA aptamer (or I-2, II-2) that binds to exosite II of thrombin and a DNA sequence structure (hereinafter also referred to as a δ sequence structure) bound to the 3' end of a DNA aptamer (or I-2, II-2) that binds to exosite II of thrombin; or (3) by maintaining a certain degree of complementarity between both (1) and (2). The above complementarity may be achieved by so-called Watson-Crick base pairs, or by mismatched base pairs with reduced thermodynamic stability to some extent. The formation of base pairs is preferable for hydrogen bonding between bases. Watson-Crick base pairs include, but are not limited to, A and T and C and G, and mismatched base pairs include eight types: G-G, G-A, G-T, A-A, A-C, C-T, C-C, and T-T.

[0052] Although not particularly limited, (1) a) 5'-α sequence structure-DNA aptamer (or I-1, II-1)-β sequence structure-3', and b) DNA aptamer (or I-2, II-2) sequence binding to exosite II of thrombin may be included in this order, or in the reverse order; (2) a) 5'-γ sequence structure-DNA aptamer (or I-2, II-2)-δ sequence structure-3', and b) DNA aptamer (or I-1, II-1) sequence binding to exosite I of thrombin may be included in this order, or in the reverse order; or (3) a) 5'-α sequence structure - DNA aptamer that binds to exosite I of thrombin (or I-1, II-1) -β sequence structure -3' and b) 5'-γ sequence structure - DNA aptamer that binds to exosite II of thrombin (or I-2, II-2) -δ sequence structure -3' may be included in this order, or in the reverse order. Although not particularly limited, a sequence of 0, 1, 2, or 3 bases that does not form double-stranded DNA (hereinafter also referred to as a Y sequence structure) may be included between a) and b) in (1) to (3) above. Furthermore, the 5' and 3' ends of the single-stranded, bivalent DNA aptamer may contain sequences that do not contribute to double-stranded DNA and do not contribute to the binding ability of the aptamer (hereinafter also referred to as an X sequence structure and a Z sequence structure, respectively). The α and β sequence structures, and the γ and δ sequence structures may contain modified bases that can maintain complementarity (methylcytosine, deoxyuracil, inosine, Ds and Px, NaM and TPT3, etc.) in addition to the usual Watson-Crick complementary bases (i.e., A and T; G ​​and C). Alternatively, the α and β sequence structures, and the γ and δ sequence structures may contain mismatched complementary bases (e.g., G-G, G-A, G-T, etc.).

[0053] The present invention includes a DNA aptamer comprising the sequence of SEQ ID NO: 106. There is no limitation on the total number of bases as long as it functions as a DNA aptamer that binds to exosite I of thrombin, and it may also comprise a sequence that functions with other aptamers (such as those for thrombin). In one embodiment of the present invention, the DNA aptamer has the following structure: (wherein k, m, and n represent the number of bases in DNA, k is 0, 1, 2, or 3, m is an integer selected from the group consisting of 1 to 15, n is 0, 1, 2, or 3, each X and Y is independently any base, α and β are bases, and 5'-(α) ｍ -3' and 5'-(β) ｍ In one embodiment of the present invention, the DNA aptamer has the following structure: The DNA aptamer may also contain the sequence of M08s(36) (SEQ ID NO: 107; hereinafter, also referred to as M08s-1(36)).

[0054] One embodiment of the present invention is a single-stranded, bivalent DNA aptamer comprising any one of the following primary structures a-1) to f): a-1) a-2) b-1) ; b-2) c) ; d-1) d-2) ; e-1) ; e-2) and f) (wherein k, m, n, p, and q represent the number of bases in DNA, k is 0, 1, 2, or 3, m is an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15, n is 0, 1, 2, 3, 4, or 5, p is an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, and 17, q is 0, 1, 2, or 3, each X, Y, and Z is independently any base, α, β, γ, and δ are bases, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel duplex structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms a double-stranded structure in antiparallel fashion), where (X) ｋ , (Y)ｎ , and (Z) ｐ correspond to the X sequence structure, the Y sequence structure, and the Z sequence structure, respectively, and 5'-(α) ｍ -3' and 5' -(β) ｍ -3' forms antiparallel base pairs (hereinafter, dashed lines indicate hydrogen bonds, and covalent bonds are sometimes represented by solid lines), corresponding to α and β sequence structures; 5'-(γ) ｐ -3' and 5' -(δ) ｐ -3' corresponds to the γ sequence structure and the δ sequence structure, in which base pairs are formed in an antiparallel fashion.

[0055] The single-stranded, bivalent DNA aptamer includes: a1-1) ; a1-2) ; b1-1) ; b1-2) c1) ; d1-1) ; d1-2) ; e1-1) ; e1-2) and f1) (i.e., a-1), to f), 5'-(α) ｍ A part of the 3' end of 5'-3' is AGGTC or AGGTCAA, and 5'-(β) ｍ a part of the 5'-end side of -3' is GACCT or TTGACCT, and 5'-(γ) ｐ A part of the 3' end of 5'-3' is AGGTCAG, AGT, AGGTC, or AGGTCAA, and 5'-(δ) ｐ -3', a part of the 5' end of which is CTGACCT, ACT, GACCT or TTGACCT).

[0056] The single-stranded, bivalent DNA aptamer includes: a2-1) ; a2-2) ; b2-1) ; b2-2) and c2) ; d2-1) ; d2-2) ; e2-1) ; e2-2) ; f2) (i.e., having no X, Y, or Z sequence structure). Although not particularly limited, the length of the double-stranded DNA portion (i.e., m+p) is preferably 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21, more preferably 5 to 21, and even more preferably 5 to 17.

[0057] The single-stranded, bivalent DNA aptamer may include: the sequence of pse(M08s-M03s) (SEQ ID NO: 12); the sequence of pse(M08s-TBA29) (SEQ ID NO: 13); the sequence of pse(M08s-M08s) (SEQ ID NO: 22); the sequence of M08s-1(36) (SEQ ID NO: 107) and the sequence of TBA29 (SEQ ID NO: 3); or two sequences of M08s-1(36) (SEQ ID NO: 107).

[0058] Alternatively, single-stranded, bivalent DNA aptamers include: Pse08-29 ss1-TTACG(70) (SEQ ID NO: 108); Pse08-29 ss1-5A(70) (SEQ ID NO: 109); Pse08-29 ss1-4A(69) (SEQ ID NO: 110); Pse08-29 ss1-2A(67) (SEQ ID NO: 111); Pse08-29 ss1-5T(70) (SEQ ID NO: 112); Pse08-29 ss1-4T(69) (SEQ ID NO: 113); Pse08-29 ss1-2T(67) (SEQ ID NO: 114); Pse08-29 ss1-0A(65) (SEQ ID NO: 115); Pse08-29 ss1-0Aa (65) (SEQ ID NO: 116); Pse08-29 ss1-0Ab (65) (SEQ ID NO: 117); Pse08-29 ss1-0Ac (65) (SEQ ID NO: 118); Pse08-29 ss2-CGTAA (70) (SEQ ID NO: 119); Pse08-29 ss2-5A (70) (SEQ ID NO: 120); Pse08-29 ss2-4A (69) (SEQ ID NO: 121); Pse08-29 ss2-2A (67) (SEQ ID NO: 122); Pse08-29 ss2-5T (70) (SEQ ID NO: 123); Pse08-29 ss2-4T (69) (SEQ ID NO: 124); The nucleic acid sequence may include a sequence selected from the group consisting of Pse08-29 ss2-2T(67) (SEQ ID NO:125); Pse08-29 ss2-0B(65) (SEQ ID NO:126); Pse08-29 ss2-0Ba(65) (SEQ ID NO:127); Pse08-29 ss2-0Bb(65) (SEQ ID NO:127); and Pse08-29 ss2-0Bc(65) (SEQ ID NO:129).

[0059] Alternatively, the single-stranded, bivalent DNA aptamer may comprise a sequence selected from the group consisting of: Pse08-08(72) (SEQ ID NO:130); Pse08-08(68) (SEQ ID NO:131); Pse08-08(64) (SEQ ID NO:132); Pse08-08(60) (SEQ ID NO:133); Pse08-08(72-GC) (SEQ ID NO:134); and Pse08-08(60-GC) (SEQ ID NO:135).

[0060] One embodiment of the present invention is a double-stranded bivalent DNA aptamer in which two DNA aptamers that bind to exosite I of thrombin; two DNA aptamers that bind to exosite II of thrombin; or a DNA aptamer that binds to exosite I of thrombin and a DNA aptamer that binds to exosite II of thrombin are linked via double-stranded DNA. One side of the sequence (hereinafter also referred to as an X sequence structure) that forms double-stranded DNA with the DNA aptamer that binds to exosite I of thrombin (or I-1 or II-1) is linked (hereinafter this structure may be referred to as oligonucleotide A), and the other side of the sequence (hereinafter also referred to as a Y sequence structure) that forms double-stranded DNA with the DNA aptamer that binds to exosite II of thrombin (or I-2 or II-2) is linked (hereinafter this structure may be referred to as oligonucleotide B), and by utilizing complementarity to form a double-stranded structure, a bivalent aptamer linked via hydrogen bonds may be formed. Alternatively, conversely, a DNA aptamer (I-1 or II-1) that binds to exosite I of thrombin may be bound to a Y sequence structure, and a DNA aptamer (I-2 or II-2) that binds to exosite II of thrombin may be bound to an X sequence structure, and a bivalent aptamer may be formed by forming a double-stranded structure through the use of complementarity, linked via hydrogen bonds. The above complementarity may be achieved by so-called Watson-Crick base pairs or by mismatched base pairs. The formation of base pairs is preferred for hydrogen bonding between bases. Here, Watson-Crick base pairs are not particularly limited, but include A and T and C and G, and mismatched base pairs include eight types: G-G, G-A, G-T, A-A, A-C, C-T, C-C, and T-T.

[0061] Whether or not a double-stranded structure is maintained in vivo (or in an environment similar thereto) due to the complementarity between the X sequence structure and the Y sequence structure can be simulated using nucleic acid secondary structure prediction software (e.g., NUPACK: Non-Patent Document 3) ( Figure 8 ). According to this simulation, the lengths of the X sequence structure and the Y sequence structure are preferably 6 bases or more, 7 bases or more, 8 bases or more, 9 bases or more, 10 bases or more, 11 bases or more, 12 bases or more, 13 bases or more, 14 bases or more, 15 bases or more, 16 bases or more, or 17 bases or more, and are preferably 25 bases or less, 24 bases or less, 23 bases or less, 22 bases or less, 21 bases or less, 20 bases or less, or 19 bases or less.

[0062] A DNA aptamer (or I-1 or II-1) that binds to exosite I of thrombin may be linked at its 5' end and 3' end with complementary sequence structures (hereinafter also referred to as an α sequence structure and a β sequence structure). The DNA aptamer (or I-1 or II-1) that binds to exosite I may be linked to an X sequence structure via a β sequence structure to form oligonucleotide A, or may be linked to a Y sequence structure via an α sequence structure to form oligonucleotide A. A DNA aptamer (or I-2 or II-2) that binds to exosite II of thrombin may be linked at its 5' end and 3' end with complementary sequence structures (hereinafter also referred to as a γ sequence structure and a δ sequence structure). The DNA aptamer (or I-2 or II-2) that binds to exosite II may be linked to an X sequence structure via a γ sequence structure to form oligonucleotide B, or may be linked to a Y sequence structure via a δ sequence structure to form oligonucleotide B. Therefore, in a double-stranded bivalent aptamer, the double-stranded DNA may be formed of only "X sequence structure and Y sequence structure"; "α sequence structure and β sequence structure" and "X sequence structure and Y sequence structure"; "X sequence structure and Y sequence structure" and "γ sequence structure and δ sequence structure"; or "α sequence structure and β sequence structure", "X sequence structure and Y sequence structure" and "γ sequence structure and δ sequence structure".

[0063] The X and Y sequences, the α and β sequences, and the γ and δ sequences may contain modified bases that can maintain complementarity (methylcytosine, deoxyuracil, inosine, Ds and Px, NaM and TPT3, etc.) in addition to the usual Watson-Crick complementary bases (i.e., A and T; G ​​and C). Alternatively, the α and β sequences, and the γ and δ sequences may contain mismatched complementary bases (e.g., G-G, G-A, G-T, etc.).

[0064] The double-stranded, bivalent DNA aptamer includes a 5'-(α) ｍ -AGATGATGGGGATGGGGGGTTGGAGGAATGGAT (SEQ ID NO: 18)- (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ -ATGGTGGTCGGGGTGGTGGGATGAGGGTTCTGACCT (SEQ ID NO: 19)- (δ) ｍ -(Y) ｎ a) a double-stranded, bivalent DNA aptamer using a 3'-end overhang, consisting of an oligonucleotide B containing the sequence of -3': and 5'-(Y) ｎ - (α) ｍ -AGATGATGGGGATGGGGGGTTGGAGGAATGGAT- (β) ｍ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ -ATGGTGGTCGGGGTGGTGGGATGAGGGTT-(δ) ｍ -3' bb) a double-stranded, bivalent DNA aptamer using the following 5'-end overhang, consisting of oligonucleotide B containing the sequence (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 27, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ-3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0065] The double-stranded, bivalent DNA aptamer includes a 5'-(α) ｍ -AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT (SEQ ID NO: 14)- (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ -AGGTCAGATGGTGGTCGGGGTGGTGGGATGAGGGTTCTGACCT (SEQ ID NO: 21)-(δ) ｍ -(Y) ｎ aa1) a double-stranded, bivalent DNA aptamer using the following 3'-end overhang, consisting of oligonucleotide B containing the sequence: and 5'-(Y) ｎ - (α) ｍ -AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT- (β) ｍ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ -AGGTCAGATGGTGGTCGGGGTGGTGGGATGAGGGTTCTGACCT-(δ) ｍ -3', and oligonucleotide B comprising the following 5'-end overhang: a double-stranded, bivalent DNA aptamer bb1) (wherein m, n, and p represent the number of bases in DNA, m is 0 to 20, n is an integer selected from the group consisting of 1 to 20, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ-3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms a double-stranded structure in antiparallel fashion) (i.e., c) and d), ｍ A part of the 3' end of 5'-3' is AGGTC, and 5'-(β) ｍ A part of the 5'-end side of -3' is GACCT, and 5'-(γ) ｐ A part of the 3'-3' end is AGGTCAG, and a part of the 5'-(δ) ｐ -3', a part of the 5' end side is CTGACCT).

[0066] The double-stranded, bivalent DNA aptamer includes a 5'-(α) ｍ -AGATGATGGGGATGGGGGGTTGGAGGAATGGAT (SEQ ID NO: 18)- (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ -CCGTGGTAGGGCAGGTTGGGGTG (SEQ ID NO: 20)-(δ) ｍ -(Y) ｎ -3': a double-stranded, bivalent DNA aptamer using the following 3'-end overhang, consisting of oligonucleotide B containing the sequence: and 5'-(Y) ｎ - (α) ｍ -AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT- (β) ｍ -(X) ｎ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ - CCGTGGTAGGGCAGGTTGGGTG - (δ) ｍ -3' dd) a double-stranded, bivalent DNA aptamer using the following 5'-end overhang, consisting of oligonucleotide B containing the sequence (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25, n is an integer selected from the group consisting of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25, p is an integer selected from the group consisting of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, and 23, X, Y, α, β, γ and δ are bases, 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ As an example of e, the double-stranded pse2 (M08s-TBA29) corresponding to the single-stranded pse (M08s-TBA29) is shown in Figure 7.

[0067] The double-stranded, bivalent DNA aptamer includes a 5'-(α) ｍ -AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT (SEQ ID NO: 15)- (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ -AGTCCGTGGTAGGGCAGGTTGGGGTGACT (SEQ ID NO: 3)-(δ) ｍ -(Y) ｎ -3' sequence of oligonucleotide B, a double-stranded, bivalent DNA aptamer utilizing the following 3'-end overhang: cc1) and 5'-(Y) ｎ - (α) ｍ -AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT- (β)ｍ -(X) ｎ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ -AGTCCGTGGTAGGGCAGGTTGGGGTGACT-(δ) ｍ -3' sequence of oligonucleotide B, a double-stranded, bivalent DNA aptamer using the following 5'-end overhang: dd1) (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20, n is an integer selected from the group consisting of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25, p is an integer selected from the group consisting of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0068] The double-stranded, bivalent DNA aptamer includes a 5'-(α) ｍ - AGATGATGGGGATGGGGGGTTGGAGGAATGGAT (SEQ ID NO: 18) - (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ - AGATGATGGGGATGGGGGGTTGGAGGAATGGAT (SEQ ID NO: 18) - (δ) ｍ -(Y) ｎ -3' A double-stranded, bivalent DNA aptamer using the following 3'-end overhang, consisting of oligonucleotide B containing the sequence: and 5'-(Y) ｎ - (α) ｍ - AGATGATGGGGATGGGGGGTTGGAGGAATGGAT-(β) ｍ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ - AGATGATGGGGATGGGGGGTTGGAGGAATGGAT - (δ) ｍ -3'-containing oligonucleotide B, a double-stranded, bivalent DNA aptamer utilizing the following 5'-end overhang: (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25, n is an integer selected from the group consisting of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25, and p is an integer selected from the group consisting of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25, X, Y, α, β, γ and δ are bases, 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0069] The double-stranded, bivalent DNA aptamer includes a 5'-(α) ｍ - AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT (SEQ ID NO: 14) - (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ- AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT (SEQ ID NO: 14) - (δ) ｍ -(Y) ｎ -3'-containing oligonucleotide B, a double-stranded, bivalent DNA aptamer utilizing the following 3'-end overhang: ff1) and 5'-(Y) ｎ - (α) ｍ - AGGTCAGATGATGGGGATGGGGGGTTGGAGGAATGGATGACCT - (β) ｍ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ - AGGTCAGATGGTGGTCGGGGTGGTGGGATGAGGGTTCTGACCT-(δ) ｍ -3', and oligonucleotide B comprising the following 5'-end overhang: (wherein m, n, and p represent the number of bases in DNA, m is 0 to 20, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0070] The double-stranded, bivalent DNA aptamer includes a 5'-(α) ｍ -TGGGGATGGGGGGTTGGAGGAA- (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ -ATGGTGGTCGGGGTGGTGGGATGAGGGTT-(δ) ｍ -(Y) ｎ- a double-stranded, bivalent DNA aptamer using the following 3'-end overhang, consisting of oligonucleotide B containing the sequence: AA) and 5'-(Y) ｎ - (α) ｍ -TGGGGATGGGGGGTTGGAGGAA- (β) ｍ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ -ATGGTGGTCGGGGTGGTGGGATGAGGGTT-(δ) ｍ - a double-stranded, bivalent DNA aptamer consisting of an oligonucleotide B containing the sequence of 3' and utilizing the following 5'-end overhang: BB) (where m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 27, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0071] The double-stranded, bivalent DNA aptamer includes a 5'-(α) ｍ -AGGTCAATGGGGATGGGGGGTTGGAGGAATTGACCT- (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ -AGGTCAGATGGTGGTCGGGGTGGTGGGATGAGGGTTCTGACCT-(δ) ｍ -(Y) ｎ -3'-based double-stranded, bivalent DNA aptamer using the following 3'-end overhang: AA1) and 5'-(Y)ｎ - (α) ｍ - AGGTCAATGGGGATGGGGGGTTGGAGGAATTGACCT - (β) ｍ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ -AGGTCAGATGGTGGTCGGGGTGGTGGGATGAGGGTTCTGACCT-(δ) ｍ -3'-based double-stranded, bivalent DNA aptamer using the following 5'-end overhang: BB1) (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 20, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0072] The double-stranded, bivalent DNA aptamer includes a 5'-(α) ｍ - TGGGGATGGGGGGTTGGAGGAA-(β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ -CCGTGGTAGGGCAGGTTGGGTG-(δ) ｍ -(Y) ｎ -3', a double-stranded, bivalent DNA aptamer using the following 3'-end overhang: CC) and 5'-(Y) ｎ - (α) ｍ - TGGGGATGGGGGGTTGGAGGAA - (β) ｍ -(X) ｎan oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ -CGTGGTAGGGCAGGTTGGGGT-(δ) ｍ -3'-based double-stranded, bivalent DNA aptamer using the following 5'-end overhang: DD) (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 23, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0073] The double-stranded, bivalent DNA aptamer includes a 5'-(α) ｍ - AGGTCAATGGGGATGGGGGGTTGGAGGAATTGACCT - (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ -AGTCCGTGGTAGGGCAGGTTGGGGTGACT-(δ) ｍ -(Y) ｎ -3'-based double-stranded, bivalent DNA aptamer using the following 3'-end overhang: CC1) and 5'-(Y) ｎ - (α) ｍ - AGGTCAATGGGGATGGGGGGTTGGAGGAATTGACCT - (β) ｍ -(X) ｎ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ- AGTCCGTGGTAGGGCAGGTTGGGGTGACT - (δ) ｍ -3'-based oligonucleotide B, a double-stranded, bivalent DNA aptamer utilizing the following 5'-end overhang: DD1) (wherein m, n, and p represent the number of bases in DNA, m is 0 to 20, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0074] The double-stranded, bivalent DNA aptamer includes a 5'-(α) ｍ - TGGGGATGGGGGGTTGGAGGAA - (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ - TGGGGATGGGGGGTTGGAGGAA - (δ) ｍ -(Y) ｎ -3' of oligonucleotide B, a double-stranded, bivalent DNA aptamer with the following 3'-overhang: and 5'-(Y) ｎ - (α) ｍ - TGGGGATGGGGGGTTGGAGGAA - (β) ｍ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ - TGGGGATGGGGGGTTGGAGGAA - (δ) ｍ -3'-based double-stranded, bivalent DNA aptamer using the following 5'-end overhang: FF) (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 25, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 25, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0075] The double-stranded, bivalent DNA aptamer includes a 5'-(α) ｍ - AGGTCAATGGGGATGGGGGGTTGGAGGAATTGACCT - (β) ｍ -(X) ｎ -3', and oligonucleotide A containing the sequence 5'-(γ) ｐ - AGGTCAATGGGGATGGGGGGTTGGAGGAATTGACCT - (δ) ｍ -(Y) ｎ -3'-based double-stranded, bivalent DNA aptamer using the following 3'-end overhang: EE1) and 5'-(Y) ｎ - (α) ｍ - AGGTCAATGGGGATGGGGGGTTGGAGGAATTGACCT - (β) ｍ an oligonucleotide A containing the sequence 5'-(X) ｎ -(γ) ｐ - AGGTCAATGGGGATGGGGGGTTGGAGGAATTGACCT - (δ) ｍ -3'-based double-stranded, bivalent DNA aptamer using the following 5'-end overhang: FF1) (wherein m, n, and p represent the number of bases in DNA, m is an integer selected from the group consisting of 0 to 20, n is an integer selected from the group consisting of 6 to 25, p is an integer selected from the group consisting of 0 to 20, X, Y, α, β, γ, and δ are bases, and 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms an antiparallel double-stranded structure, and 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms an antiparallel double-stranded structure, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' forms an antiparallel double-stranded structure).

[0076] In double-stranded, bivalent DNA aptamers, 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' corresponds to the X sequence structure and the Y sequence structure, respectively, which form an antiparallel base pair, and 5'-(α) ｍ -3' and 5'-(β) ｍ - 3' antiparallel base pairing (dashed lines indicate hydrogen bonds, covalent bonds are sometimes represented by solid lines), corresponding to α and β sequence structures; 5'-(γ) ｐ -3' and 3'-(δ) ｐ -5' corresponds to the γ sequence structure and the δ sequence structure, in which base pairs are formed. Although not particularly limited, the length of the double-stranded DNA portion (i.e., m+n+p) is preferably 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25, more preferably 5 to 25, and even more preferably 5 to 17.

[0077] The above-mentioned aa1), bb1), cc1), dd1), ee1) and ff1); and AA1), BB1), CC1), DD1), EE1) and FF1) embodiments include 5'-(β) ｍThe sequence of 5'-(X)n-(γ)p-3' may be 5'-CTAGTGACTGATTTACG-3' (SEQ ID NO: 24) and the sequence of 5'-(δ)p-(Y)n-(α)m-3' may be 5'-CGTAAATCAGTCACTAG-3' (SEQ ID NO: 25). The above embodiments of aa1), bb1), cc1), dd1), ee1) and ff1); and AA1), BB1), CC1), DD1), EE1) and FF1) may include an embodiment in which m is 0, n is 17, and p is 0. 5'-(β) ｍ -(X) ｎ -(γ) ｐ The sequence at 5'-(δ) becomes 5'-CTAGTGACTGATTTACG-3', and the sequence at 5'-(δ) ｐ -(Y) ｎ - (α) ｍ In the case where the sequence of 5'-(X) is 5'-CGTAAATCAGTCACTAG-3', m is 0, n is 17, and p is 0, 5'-(X) ｎ -3' sequence is 5'-CTAGTGACTGATTTACG-3', and 5'-(Y ｎ The sequence at -3' is 5'-CGTAAATCAGTCACTAG-3'.

[0078] The double-stranded bivalent DNA aptamer includes the following combinations of oligonucleotides A and B: The present invention also includes a double-stranded bivalent DNA aptamer consisting of a combination of oligonucleotides selected from the group consisting of:

[0079] The present invention includes pharmaceutical uses of the aptamer. The aptamer of the present invention can be formulated as a pharmaceutical composition containing a therapeutically effective amount thereof and a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers can include binders (e.g., hydroxypropyl cellulose, polyvinyl alcohol, polyvinylpyrrolidone, polyethylene glycol), excipients (e.g., lactose, sucrose, mannitol, sorbitol, corn starch, potato starch, crystalline cellulose, calcium carbonate), lubricants (e.g., magnesium stearate, calcium stearate, talc), disintegrants (e.g., low-substituted hydroxypropyl cellulose, cross-linked carboxymethyl cellulose), and wetting agents (e.g., sodium lauryl sulfate).

[0080] The pharmaceutical composition of the present invention can be administered parenterally and can be used as a suitable pharmaceutical preparation. Suitable pharmaceutical preparations for parenteral administration include suppositories, injections or infusion preparations using distilled water for injection, physiological saline or an aqueous glucose solution, or inhalants.

[0081] The dosage of the pharmaceutical composition of the present invention can be varied depending on the administration method, and the age, weight, and condition of the patient, but is 0.001 to 100 mg / kg, preferably 0.1 to 30 mg / kg, and more preferably 0.1 to 10 mg / kg per day, and can be administered once or in 2 to 4 divided doses.

[0082] The pharmaceutical composition of the present invention is expected to be useful for blood coagulation-related diseases, such as cerebral infarction, congenital antithrombin III deficiency, and heparin-induced thrombocytopenia. It can also be used as an anticoagulant during coronary artery bypass surgery or extracorporeal blood circulation. Furthermore, it can be a first-line alternative or supplementary anticoagulant for bleeding disorders caused by excessive intake of antithrombotic drugs, which are required not only during the perioperative period but also after bypass, stent, or artificial valve surgery, as well as by renal failure, drug interactions, dehydration, and other factors.

[0083] Symptoms caused by blood clots in blood vessels, known as thrombi, are broadly defined as thrombosis (hereafter, the term "thrombosis" refers to thrombosis in the broad sense). Pathological conditions caused by thrombi can be divided into narrowly defined thrombosis and embolism. Thrombosis in the narrow sense refers to a condition caused by a thrombus partially or completely blocking blood flow at the site of formation, while embolism refers to a condition caused by a thrombus breaking off from the site of formation, traveling with the bloodstream, and partially or completely blocking blood flow at another site. Thrombosis can induce a variety of diseases depending on the location of the blood vessel in which the thrombus forms. Thrombosis in the cerebrovascular or cardiac vessels, in particular, can cause cerebral infarction and myocardial infarction, which can have a high mortality rate and, even if the patient survives, can leave irreversible damage such as hemiplegia and functional impairment. Currently, research and development efforts to address thrombosis are focused on antithrombotic drugs that inhibit thrombus formation and thrombolytic agents that dissolve thrombus formation.

[0084] The present invention includes a neutralizing agent for the above-mentioned pharmaceutical composition. Such a neutralizing agent comprises, as a main component, a nucleic acid (including DNA, RNA, PNA, and composites thereof) having complementarity to all or part of the sequence of a DNA aptamer that binds to exosite I of thrombin or a DNA aptamer that binds to exosite II of thrombin. In one embodiment of the present invention, the neutralizing agent comprises a part or all of the DNA aptamer (or I-1, II-1, I-2, II-2) that binds to exosite I of thrombin of the bivalent aptamer of the present invention; and a nucleic acid (including DNA, RNA, PNA, and composites thereof) having complementarity to all or part of the double-stranded DNA.

[0085] In one embodiment of the invention, the neutralizing agent comprises a nucleic acid comprising the complementary sequence of 5'-AGGTCAGATGATGGGGGATGGG-3' (SEQ ID NO: 21). In one embodiment of the invention, the neutralizing agent comprises a nucleic acid comprising the sequence set forth in [L-M08s]c (SEQ ID NO: 17) or 08ad (SEQ ID NO: 15).

[0086] In one embodiment of the present invention, a neutralizing agent for a DNA aptamer comprising the sequence of M08s-1(36) (SEQ ID NO: 107) is a nucleic acid comprising or part of the complementary sequence of M08s-1(36) (SEQ ID NO: 107). In one embodiment of the present invention, a neutralizing agent against a DNA aptamer comprising the sequence of M08s-1(36) (SEQ ID NO: 107) may comprise a nucleic acid comprising a sequence selected from the group consisting of Ant-M08_36-36 (SEQ ID NO: 142); Ant-M08_36-30 (SEQ ID NO: 143); Ant-M08_36-24 (SEQ ID NO: 144); Ant-M08_36-18 (SEQ ID NO: 145); Ant-M08_36-L18 (SEQ ID NO: 146); Ant-M08_36-R18 (SEQ ID NO: 147); and Ant-M08_36-12 (SEQ ID NO: 148).

[0087] By administering such a neutralizing agent, the blood coagulation inhibitory ability of the bivalent aptamer according to the present invention is suppressed or inhibited, thereby promoting the blood coagulation reaction in vivo. The neutralizing agent may be administered locally to body tissues where blood coagulation inhibition is undesirable.

[0088] The present invention includes a method for producing a bivalent aptamer with excellent blood coagulation inhibitory ability. Test oligonucleotides having the above-described structures (e.g., a) to f) as single-stranded oligonucleotides; aa) to ff) as double-stranded oligonucleotides; and AA) to FF) are prepared or prepared; their blood coagulation inhibitory ability is measured by a method such as that shown in the following examples (e.g., measuring APTT). The blood coagulation inhibitory ability is compared with that of a reference aptamer or reagent, and a highly effective bivalent aptamer can be used for formulation.

[0089] As the reference aptamer, an aptamer with excellent blood coagulation inhibition ability is preferred. While not particularly limited, polyA linker-bound bivalent aptamers (e.g., M08a-A15-TBA29 and M08a-A5-M03a described in Patent Document 1, and HD1-15dA-60.29 described in Non-Patent Document 1) and polyT linker-bound bivalent aptamers (e.g., Lin(M08s-TBA29) in the present specification) can be used as the reference aptamer. It has been reported that polyT linker-bound bivalent aptamers have superior blood coagulation inhibition ability compared to polyA linker-bound bivalent aptamers (Non-Patent Document 4), and therefore polyT linker-bound bivalent aptamers are preferred as the reference aptamer. Direct thrombin inhibitors used in clinical practice include argatroban and dabigatran, which are small molecules, and bivalirudin, which is a peptide.

[0090] The present invention will be described in more detail below using examples, but these examples are not intended to limit the scope of the present invention in any way.

[0091] Example 1: Investigation of double-stranded linker length suitable for anticoagulant effect by thrombin inhibition 1. Synthesis of aptamers Single-stranded bivalent aptamers were synthesized in which the exosite I-binding aptamer M08s and the exosite II-binding aptamer TBA29 were linked by double-stranded DNA structures of various lengths (SEQ ID NOs: 4 to 10).

[0092] 2. Measurement of thrombin coagulation inhibition. Thrombin was dissolved in PBS and adjusted to a concentration of 1 μM. Each aptamer was adjusted to 5 μM in PBS and then heated to 95°C for 3 minutes in a dry bath incubator (Major Science Co., Ltd, Taiwan). Annealing was then performed by immediately cooling in a heat block previously stored at 25°C. 100 μL of 12.5 nM aptamer and 100 μL of 6.25 nM thrombin were added and incubated at room temperature for 15 minutes. Eighty μL of the aptamer and thrombin mixture was added to each well of a Costar Assay Plate 96-well (Corning, NY, USA), and 20 μL of fibrinogen solution was then added using an octal pipettor. Immediately thereafter, the absorbance at 350 nm was measured using an ultraviolet-visible microplate reader (Viento nano, Biotek, Vermont, USA) under the following conditions: Aptamer: 5.0 nM, human thrombin: 2.5 nM, human fibrinogen: 1200 nM, PBS (Vehicle), temperature: 25°C, average of two measurements.

[0093] 3. Results The results are shown in Figure 2. The ability to inhibit thrombin coagulation varied greatly depending on the length of the double-stranded DNA structure. Figure 2 shows that the ability to inhibit thrombin coagulation decreased when the length was either too long or too short, indicating that the length of the double-stranded DNA structure is critical.

[0094] Example 2: Evaluation results of anticoagulant activity in human plasma or in plasma after administration of compounds to animals by activated partial thromboplastin time (hereinafter also referred to as APTT) test 1. Synthesis of aptamers Monovalent or bivalent aptamers shown in FIG. 3 and Table 2 below were synthesized (SEQ ID NOs: 11 to 13, 22, 2, and 14).

[0095] 2. In vitro APTT test of aptamers in human plasma. The aptamer was adjusted to a concentration of 150 μM using PBS and heated to 95°C for 3 minutes in a dry bath incubator (Major Science Co., Ltd., Taiwan). Annealing was performed by immediately cooling the aptamer in a heat block pre-heated to 25°C. 50 μL of normal human plasma (George King Bio-Medical Inc., Kansas, USA) was added to a sample cup (Sysmex Co., Ltd., Japan) and incubated at 37°C for 1 minute. Next, 50 μL of APTT reagent (Sysmex Co., Ltd., Japan) was added and incubated at 37°C for 2 minutes. 50 μL of 0.2 M calcium chloride was then added. The APTT was immediately measured by tracking the time course of scattered light intensity at 660 nm using an automated blood coagulation analyzer (Sysmex Co., Ltd., Japan).

[0096] 3. APTT Tests Using Blood Collected from Mice After a Single Administration of Various Aptamers and the Small Molecule Drug Argatroban. Each aptamer was adjusted to 150 μM in PBS and heated to 95°C for 3 minutes in a dry bath incubator (Major Science Co., Ltd, Taiwan). Annealing was performed by immediately cooling in a heat block pre-conditioned at 25°C. Each aptamer was administered via the jugular vein of anesthetized normal mice (22 g, 7 weeks old) at 0.04 μmol / kg or 0.13 μmol / kg. After 3, 10, 30, or 60 minutes of incubation, blood was collected from the inferior vena cava. The collected blood was mixed with 3.8% sodium citrate (blood: 3.8% sodium citrate = 9:1, v / v). The blood was centrifuged at 1,500 xg for 15 minutes in a centrifuge (Thermo Fisher Scientific Inc., Massachusetts, USA), and the plasma layer was collected. 50 μL of plasma was added to a sample cup (Sysmex Co., Ltd., Japan) and incubated at 37°C for 1 minute. Next, 50 μL of APTT reagent (Sysmex Co., Ltd., Japan) was added and the mixture was incubated at 37°C for 2 minutes. 50 μL of 0.2 M calcium chloride was then added. The APTT was then measured immediately using an automated blood coagulation analyzer (Sysmex Co., Ltd., Japan) by tracking the time course of scattered light intensity at 660 nm.

[0097] 4. Results The results are shown in Figures 4 and 5. The bivalent DNA aptamers according to the present invention (pse(M08s-M03s) (Figure 4), pse(M08s-TBA29) (Figure 4), and pse(M08s-M08s) (shown as pse(08-08) in Figure 5)) exhibited a stronger anticoagulant effect than the bivalent DNA aptamer linked to single-stranded DNA (lin(M08s-TBA29) (shown as Lin(08-29) in Figure 5)).

[0098] Example 3 Neutralizing Effect of Adding Oligonucleotides Having Complementary Strand Sequences to Nucleic Acid Aptamer pse (M08s-TBA29) in Human Plasma 1. APTT Test Using pse (M08s-TBA29) and Oligonucleotides with Complementary Strand Sequences The concentrations of the anticoagulant aptamer pse (M08s-TBA29) and the complementary strand sequence oligonucleotides (08d (SEQ ID NO: 15), [M08s]c (SEQ ID NO: 16), [L-M08s]c (SEQ ID NO: 17)) were adjusted to 150 μM and 1000 μM, respectively, using PBS, and then annealed by heating at 95°C for 3 minutes in a dry bath incubator (Major Science Co., Ltd, Taiwan) and immediately cooling in a heat block that had been previously placed at 25°C. 145 μL of normal human plasma (George King Bio-Medical Inc., Kansas, USA), 2.5 μL of 60 μM Pse(08-29), and 2.5 μL of 120, 240, 480, or 960 μM complementary strand sequences were added to a sample cup (Sysmex Co., Ltd., Japan) and incubated at 37°C for 1 minute. Next, 50 μL of APTT reagent (Sysmex Co., Ltd., Japan) was added and incubated at 37°C for 2 minutes. After that, 50 μL of 0.2 M calcium chloride was added, and the APTT was immediately measured by tracking the time course of scattered light intensity at 660 nm using a fully automated blood coagulation analyzer (Sysmex Co., Ltd., Japan) under the following conditions: pse(M08s-TBA29): 0.33 μM (1 eqv.); complementary strand sequence oligonucleotide: 2, 4, 8, or 16 eqv.; normal human plasma: 32% v / v; temperature: 37°C; single measurement.

[0099]

[0100] 2. Results The results are shown in Figure 6. The addition of 08ad inhibited the anticoagulant effect of pse (M08s-TBA29) (Figure 6b). [L-M08s]c, which lacks two bases at the 3' end of 08ad, exhibited a neutralizing effect equivalent to that of 08ad. Conversely, the absence of a complementary chain extending to the double-stranded linker region was insufficient to completely neutralize the drug's efficacy ([M08s]c; Figure 6c). This indicates that the neutralizing agent (complementary chain) sequence must extend beyond the region of M08s that exhibits inhibitory activity, and must also extend to the double-stranded structure.

[0101] Reference Example 1: Dimerization Simulation Using NUPACK The secondary structure stability of a double-stranded bivalent aptamer was simulated using NUPACK. Specifically, the temperature was decreased from 95°C to 5°C in 5°C increments under conditions of 10 μM oligonucleotide concentration, 150 mM NaCl, and 0.5 mM MgCl2, and the hybridization strength of the duplex at 35°C was investigated. However, the simulation did not take into account the sequence stabilization due to the formation of a G-quartet structure between M08s and TBA29. The results are shown in Figure 8. When the gap length was set to 21 bp, which encroaches on the aptamer region, the stem structure of the aptamer was distorted toward M08s and TBA29 (△). When the gap length was set to 17 bp, the stem structure of the aptamer was distorted toward TBA29 (△). When the gap length was set to 13 bp or 9 bp, the expected dimer was predicted to be formed stably (○). On the other hand, when the gap length was set to 5 bp or less, it was found that monomer formation was overwhelmingly dominant (×). Since the simulation did not take into account the sequence stabilization due to the formation of a G-quartet structure formed by M08s and TBA29, even if the simulation result was △, it is quite possible that the protein will fold smoothly at the experimental level and exhibit anticoagulant activity.

[0102] Example 4 Evaluation of the anticoagulant effect of double-stranded bivalent aptamer (M08s-TBA29: 13-20 linker type) in plasma The following combinations of oligonucleotides A and B 1 to 40 were used. The oligonucleotide combinations were adjusted to a concentration of 150 μM each using PBS. Annealing was performed by heating at 95°C for 3 minutes in a dry bath incubator (Major Science Co., Ltd., Taiwan) and immediately cooling in a heat block pre-heated to 25°C. Schematic diagrams of the predicted secondary structure are shown in Figures 9A and 10A. 50 μL of normal human plasma (George King Bio-Medical Inc., Kansas, USA) was added to a sample cup (Sysmex Co., Ltd., Japan) and incubated at 37°C for 1 minute. Next, 50 μL of APTT reagent (Sysmex Co., Ltd., Japan) was added and incubated at 37°C for 2 minutes. 50 μL of 0.2 M calcium chloride was then added. APTT was measured immediately by tracking the time course of scattered light intensity at 660 nm using an automated blood coagulation analyzer (Sysmex Co., Ltd., Japan) (final oligonucleotide concentration: 1 μM). PBS was used as a negative control, and pse(M08s-TBA29) (SEQ ID NO: 13) was used as a positive control.

[0103] The results are shown in Figures 9B and 10B. Regardless of the length of the linker, the overhang (i.e., (Y)) is sufficient for oligonucleotide A and oligonucleotide B to anneal to form a double strand. ｎ :(X) ｎ If the base length of the complementary strand-forming site is long, a thermodynamically stable double strand is formed, but if the position of the break in the double strand approaches the base sequence that directly interacts with thrombin, the binding affinity of the aptamer to thrombin decreases. Therefore, B, C, and D, which have a good balance of both effects, tend to show relatively high anticoagulant activity.

[0104] Example 5: Evaluation of the anticoagulant effect of monovalent DNA aptamer (M08s(36); SEQ ID NO: 107) M08s(43) and M08s(36) were adjusted to a concentration of 150 μM each using PBS, then heated at 95°C for 3 minutes in a dry bath incubator (Major Science Co., Ltd., Taiwan) and immediately cooled in a heat block pre-heated to 25°C for annealing. Figure 11A shows a comparison of the sequences of M08s(43) and M08s(36). 50 μL of normal human plasma (George King Bio-Medical Inc., Kansas, USA) was added to a sample cup (Sysmex Co., Ltd., Japan) and incubated at 37°C for 1 minute. Next, 50 μL of APTT reagent (Sysmex Co., Ltd., Japan) was added and incubated at 37°C for 2 minutes. After that, 50 μL of 0.2 M calcium chloride was added, and immediately, the APTT was measured by tracking the time course of scattered light intensity at 660 nm using an automated blood coagulation analyzer (Sysmex Co., Ltd., Japan) (final concentration of each oligonucleotide: 0.33 μM). PBS was used as a negative control, and pse(M08s-TBA29) (SEQ ID NO: 13) was used as a positive control.

[0105] The results are shown in Figure 11B. M08s(36) exhibited anticoagulant activity comparable to that of M08s(43).

[0106] Example 6 Evaluation of the anticoagulant effect of single-stranded heterobivalent aptamer (M08s(36)-TBA29) in plasma Oligonucleotides in which M08s(36) and TBA29 were linked via a linker (5'-M08s(36)-linker-TBA29-3': Pse08-29 ss1-XX); 5'-TBA29-linker-M08s(36)-3': Pse08-29 ss2-XX) and oligonucleotides in which M08s(36) and TBA29 were linked without a linker and the 5' and 3' ends were designed to be in the stem region of TBA29 (Pse08-29 ss1-0Ax; Pse08-29 ss2-0Bx) were synthesized and diluted to a concentration of 150°C using PBS. After adjusting the concentration to 1 μM, the oligonucleotide was heated to 95°C for 3 minutes in a dry bath incubator (Major Science Co., Ltd., Taiwan) and immediately cooled in a heat block pre-heated to 25°C for annealing. 50 μL of normal human plasma (George King Bio-Medical Inc., Kansas, USA) was added to a sample cup (Sysmex Co., Ltd., Japan) and incubated at 37°C for 1 minute. Next, 50 μL of APTT reagent (Sysmex Co., Ltd., Japan) was added and incubated at 37°C for 2 minutes. 50 μL of 0.2 M calcium chloride was then added. The APTT was immediately measured by tracking the time course of scattered light intensity at 660 nm using an automated blood coagulation analyzer (Sysmex Co., Ltd., Japan) (final oligonucleotide concentration: 0.33 μM). PBS was used as a negative control, and pse(M08s-TBA29) (SEQ ID NO: 13) was used as a positive control.

[0107] The results are shown in Figure 12B. Although the anticoagulant effect was maintained even without a linker, the anticoagulant effect was reduced when the 5' and 3' ends were designed into the stem region of TBA29. This indicates that the position of TBA29 (the structure of the stem region) in the bivalent aptamer and the orientation of the two thrombin-binding sites on the aptamer contribute to the anticoagulant effect.

[0108] Example 7: Evaluation of the anticoagulant activity of a single-stranded homobivalent aptamer (M08s(36)-M08s(36)) in plasma. An oligonucleotide (Pse08-08(xx)) was synthesized by linking M08s(36) and M08s(36) and modifying the length and amino acid sequence of their stem regions. The oligonucleotides were adjusted to 150 μM each using PBS. Annealing was performed by heating at 95°C for 3 minutes in a dry bath incubator (Major Science Co., Ltd., Taiwan) and immediately cooling in a heat block pre-heated to 25°C. Figure 13A shows a schematic diagram of the secondary structure. 50 μL of normal human plasma (George King Bio-Medical Inc., Kansas, USA) was added to a sample cup (Sysmex Co., Ltd., Japan) and incubated at 37°C for 1 minute. Next, 50 μL of APTT reagent (Sysmex Co., Ltd., Japan) was added and incubated at 37°C for 2 minutes. After that, 50 μL of 0.2 M calcium chloride was added, and the APTT was measured immediately by tracking the time course of scattered light intensity at 660 nm using an automated blood coagulation analyzer (Sysmex Co., Ltd., Japan) (final oligonucleotide concentration: 0.33 μM). PBS was used as a negative control, and pse(M08s-TBA29) (SEQ ID NO: 13) was used as a positive control.

[0109] The results are shown in Figure 13B. These results indicate that the stem region of M08s(36) and the orientation of the two thrombin-binding sites on the bivalent aptamer also contribute to the anticoagulant effect.

[0110] Example 8 Neutralizing Effect of Addition of Oligonucleotides Having Complementary Strand Sequences to Nucleic Acid Aptamers a) Pse08-29 ss1-4A(69); b) Pse08-29 ss1-2A(67); and c) Pse08-08(64) in Human Plasma The aptamer Pse08-29 ss1-4A(69) or Pse08-29 ss1-2A(67) and the oligonucleotide with the complementary strand sequence (Ant-M08_36-XX; see FIG. 14A) were adjusted to concentrations of 150 μM and 1000 μM, respectively, using PBS. Annealing was then performed by heating at 95°C for 3 minutes in a dry bath incubator (Major Science Co., Ltd, Taiwan) and immediately cooling in a heat block that had been previously placed at 25°C. 145 μL of normal human plasma (George King Bio-Medical Inc., Kansas, USA), 2.5 μL of Pse08-29 ss1-4A(69) or b) Pse08-29 ss1-2A(67), and 2.5 μL of the complementary strand sequence were added to a sample cup (Sysmex Co., Ltd., Japan), and the mixture was incubated at 37°C for 1 minute. Next, 50 μL of APTT reagent (Sysmex Co., Ltd., Japan) was added and incubated at 37°C for 2 minutes. 50 μL of 0.2 M calcium chloride was then added. The APTT was immediately measured by tracking the time course of scattered light intensity at 660 nm using a fully automated blood coagulation analyzer (Sysmex Co., Ltd., Japan) under the following conditions: nucleic acid aptamer: 0.33 μM (1 eqv.), complementary strand sequence oligonucleotide: 2.64 μM (8 eqv.), normal human plasma: 32% v / v, temperature: 37°C, duplicate measurements. Aptamer alone (a) Pse08-29 ss1-4A(69) + VE; b) Pse08-29 ss1-2A(67) + VE) was used as a control. Similarly, c) APTT was measured using Pse08-08(64) (concentration 0.33 μM) and the complementary strand sequence oligonucleotide (2Ant44_Pse08-08(64)) (concentrations 0.33 μM to 2.64 μM).

[0111] The results are shown in Figure 14B. A reduction in anticoagulant activity was observed for all sequences tested. However, the reduction in anticoagulant activity was greater for sequences that form complementary strands with three of the four GG sequences predicted to form a quadruplex structure. Furthermore, the anticoagulant activity of Pse08-08(64) was reduced in a concentration-dependent manner by the neutralizing agent sequence.

[0112] The sequence information is detailed below.

[0113] The nucleic acid aptamer of the present invention can be used as a neutralizing drug. In particular, the length of each oligonucleotide can be shortened while maintaining activity. The present invention can improve the accuracy of oligonucleotide synthesis (i.e., synthesis of unintended oligonucleotides is less likely to occur), making it suitable for use as a drug.

Claims

1. DNA aptamers containing the following primary structure: 【Chemistry 129】 (Here, k, m, and n represent the number of base pairs in DNA. k is 0, 1, 2, or 3. m is an integer selected from the group consisting of 1 to 15. n is 0, 1, 2, or 3. Each X and Y is independently any base. α and β are bases, 5'-(α) ｍ -3' and 5'-(β) ｍ (The -3' segments are antiparallel and form a double-strand structure).

2. The DNA aptamer according to claim 1, comprising the following primary structure: 【Chemistry 130】

3. The DNA aptamer according to claim 1, comprising the sequence M08s-1(36) (SEQ ID NO: 107).

4. A single-stranded bivalent DNA aptamer containing one of the following primary structures 1) to 5): １） [Chemical 140] ２） 【Chemistry 141】 ３） 【Chemistry 142】 ４） 【Chemistry 143】 ５） 【Chemistry 144】 (Here, k, m, n, p, and q represent the number of base pairs in DNA. k is 0, 1, 2, or 3. m is an integer selected from the group consisting of 1 to 10. n is 0, 1, 2, 3, 4, or 5. p is an integer selected from the group consisting of 1 to 10. q is 0, 1, 2, or 3. Each X, Y, and Z is an arbitrary base, α, β, γ, and δ are bases. 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms a double-chain structure in antiparallel, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ (The -3' segments are antiparallel and form a double-strand structure).

5. A single-stranded bivalent DNA aptamer according to claim 4, comprising any one of the following primary structures 1) to 5): １） 【Chemistry 145】 ２） 【Chemistry 146】 ３） 【Chemistry 147】 ４） 【Chemistry 148】 ５） 【Chemistry 149】 (Here, k, m, n, p, and q represent the number of base pairs in DNA. k is 0, 1, 2, or 3. m is an integer selected from the group consisting of 1 to 10. n is 0, 1, 2, 3, 4, or 5. p is an integer selected from the group consisting of 1 to 10. q is 0, 1, 2, or 3. Each X, Y, and Z is an arbitrary base, α, β, γ, and δ are bases. 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms a double-chain structure in antiparallel, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ -3' form a double-stranded structure in an antiparallel manner).

6. A single-stranded bivalent DNA aptamer according to claim 4, comprising any one of the following primary structures 1) to 5): １） [Chemical 150] ２） 【Chemistry 151】 ３） 【Chemistry 152】 ４） 【Chemistry 153】 ５） 【Chemistry 154】 (Here, m and p indicate the number of base pairs in DNA. m is an integer selected from the group consisting of 1 to 10. p is an integer selected from the group consisting of 1 to 10. α, β, γ, and δ are bases. 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms a double-chain structure in antiparallel, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ (The -3' segments are antiparallel and form a double-strand structure).

7. The sequence of pse(M08s-M03s) (sequence number 12); Sequence of pse(M08s-TBA29) (Sequence ID 13); The sequence of pse(M08s-M08s) (sequence number 22); Sequence M08s-1 (36) (sequence number 107) and TBA29 (sequence number 3); or Two sequences of M08s-1 (36) (sequence number 107) A single-stranded, bivalent DNA aptamer containing [the specified element].

8. Pse08-29 ss1-TTACG(70) (SEQ ID NO: 108); Pse08-29 ss1-5A(70) (SEQ ID NO: 109); Pse08-29 ss1-4A(69) (SEQ ID NO: 110); Pse08-29 ss1-2A(67) (SEQ ID NO: 111); Pse08-29 ss1-5T(70) (SEQ ID NO: 112); Pse08-29 ss1-4T(69) (SEQ ID NO: 113); Pse08-29 ss1-2T(67) (SEQ ID NO: 114); Pse08-29 ss1-0A(65) (SEQ ID NO: 115); Pse08-29 ss1-0Aa(65) (SEQ ID NO: 116); Pse08-29 ss1-0Ab(65) (SEQ ID NO: 117); Pse08-29 ss1-0Ac(65) (SEQ ID NO: 118); Pse08-29 ss2-CGTAA(70) (SEQ ID NO: 119); Pse08-29 ss2-5A(70) (SEQ ID NO: 120); Pse08-29 ss2-4A(69) (SEQ ID NO: 121); Pse08-29 ss2-2A(67) (SEQ ID NO: 122); Pse08-29 ss2-5T(70) (SEQ ID NO: 123); Pse08-29 ss2-4T(69) (SEQ ID NO: 124); Pse08-29 ss2-2T(67) (SEQ ID NO: 125); Pse08-29 A single-stranded bivalent DNA aptamer comprising a sequence selected from the group consisting of ss2-0B(65) (SEQ ID NO: 126); Pse08-29 ss2-0Ba(65) (SEQ ID NO: 127); Pse08-29 ss2-0Bb(65) (SEQ ID NO: 128); and Pse08-29 ss2-0Bc(65) (SEQ ID NO: 129).

9. A single-stranded bivalent DNA aptamer comprising a sequence selected from the group consisting of Pse08-08(72) (SEQ ID NO: 130); Pse08-08(68) (SEQ ID NO: 131); Pse08-08(64) (SEQ ID NO: 132); Pse08-08(60) (SEQ ID NO: 133); Pse08-08 (72-GC) (SEQ ID NO: 134); and Pse08-08(60-GC) (SEQ ID NO: 135).

10. The following are combinations of oligonucleotide A and oligonucleotide B from 1 to 40: Table 8 A double-stranded, bivalent DNA aptamer consisting of a combination of oligonucleotides selected from the group comprising the following.

11. A pharmaceutical composition for inhibiting blood coagulation, comprising a DNA aptamer according to any one of claims 1 to 10.

12. A neutralizing agent for a pharmaceutical composition for inhibiting blood coagulation, comprising a DNA aptamer comprising the sequence M08s-1(36) (SEQ ID NO: 107), wherein the neutralizing agent comprises a nucleic acid comprising a sequence selected from the group consisting of Ant-M08_36-36 (SEQ ID NO: 142); Ant-M08_36-30 (SEQ ID NO: 143); Ant-M08_36-24 (SEQ ID NO: 144); Ant-M08_36-18 (SEQ ID NO: 145); Ant-M08_36-L18 (SEQ ID NO: 146); Ant-M08_36-R18 (SEQ ID NO: 147); and Ant-M08_36-12 (SEQ ID NO: 148).

13. A neutralizing agent for a pharmaceutical composition for inhibiting blood coagulation, comprising a DNA aptamer containing the sequence Pse08-08(64) (SEQ ID NO: 138), wherein the neutralizing agent comprises a nucleic acid containing the sequence 2Ant44_Pse08-08(64) (SEQ ID NO: 149).

14. A method for producing a pharmaceutical composition for inhibiting blood coagulation, comprising a bivalent DNA aptamer. 1) The step of preparing or providing a test single-stranded or double-stranded oligonucleotide containing any of the following structures: 【Chemistry 167】 【Chemical 168】 【Chemistry 169】 【Chemistry 170】 【Chemistry 171】 【Chemistry 172】 【Chemistry 173】 【Chemistry 174】 【Chemistry 175】 【Chemistry 176】 【Chemistry 177】 【Chemistry 178】 【Chemistry 179】 【Transformation 180】 【Chemistry 181】 【Chemistry 182】 (Here, m, n, and p represent the number of base pairs in DNA. m is an integer selected from the group consisting of 0 to 25. n is an integer selected from the group consisting of 6 to 25. p is an integer selected from the group consisting of 0 to 25. X, Y, α, β, γ, and δ are bases. 5'-(X) ｎ -3' and 5'-(Y) ｎ -3' forms a double-chain structure in antiparallel directions. 5'-(α) ｍ -3' and 5'-(β) ｍ -3' forms a double-chain structure in antiparallel, and 5'-(γ) ｐ -3' and 5'-(δ) ｐ (-3' is antiparallel and forms a double-strand structure.) and 2) A step to determine the affinity of the test oligonucleotide for thrombin. Includes, If the affinity of the test oligonucleotide for thrombin is superior to that of the DNA aptamer consisting of the sequence lin(M08s-TBA29) (SEQ ID NO: 11), the test oligonucleotide may be incorporated into a pharmaceutical composition as a bivalent DNA aptamer for inhibiting blood coagulation. Manufacturing method.

15. Sequence of pse(M08s-M03s) (Sequence ID 12); The sequence of pse(M08s-TBA29) (sequence number 13); or Sequence of pse(M08s-M08s) (Sequence ID 22) A neutralizing agent for a pharmaceutical composition for inhibiting blood coagulation, comprising a DNA aptamer containing the sequence, A neutralizing agent comprising a nucleic acid containing the sequence described in [L-M08s]c (Sequence ID 17) or a nucleic acid containing the sequence described in 08ad (Sequence ID 15).

Images