Ribonucleic acid production technology

Abstract

The present disclosure provides a ribonucleic acid production technology. More specifically, the present disclosure provides Escherichia coli in which one or more RNA producing plasmid improvement-related (RPPI) genes are disrupted. In detail, the RPPI genes, when being disrupted, increase an mRNA synthesis evaluation value. The present disclosure also provides: a microorganism such as a microbe for mRNA production; production of a plasmid for mRNA production by using the microorganism; a plasmid produced thereby; and the like.

Description

Ribonucleic acid production technology

[0001] The present disclosure relates to techniques related to the production of ribonucleic acid (RNA) such as mRNA. More specifically, the present disclosure relates to microorganisms such as bacteria for producing mRNA, the production of plasmids for mRNA production using the same, and the plasmids produced thereby.

[0002] In recent years, messenger RNA (mRNA) drugs have been attracting attention as a new drug discovery modality, and are being applied to vaccines against infectious diseases, as well as cancer immunotherapy, protein replacement therapy, genome editing therapy, and more.

[0003] There are several methods for producing mRNA, but the basic industrial method that has been established is to use Escherichia coli to amplify a plasmid incorporating template DNA encoding the target mRNA, extract the amplified plasmid, linearize it, and then transcribe and synthesize mRNA using the In Vitro Transcription (IVT) method.

[0004] However, there are still many challenges in the production of mRNA pharmaceuticals, and there is a need to develop methods for producing mRNA with higher yields and higher quality, particularly in terms of price and quality, which are important factors for pharmaceutical raw materials.

[0005] There have been many reports of modifying Escherichia coli strains to increase the yield of plasmids for producing biopharmaceuticals (Biotechnol. J. 2012, 7, 251-261 = Non-Patent Document 1).

[0006] Goncalves GA, “Rational engineering of Escherichia coli strains for plasmid biopharmaceutical manufacturing “Biotechnol. J. 2012, 7, 251-261

[0007] As a result of extensive investigations, the present inventors have found that there is a group of genes that can be named RNA producing plasmid improvement-related (RPPI) genes, and have confirmed the usefulness of this as an mRNA production technology, in that high-yield, high-quality mRNA can be produced by using template plasmid DNA (hereinafter also referred to as "pDNA") prepared using E. coli in which the RPPI genes have been artificially disrupted, and a composition containing this E. coli. This has led to the completion of the present disclosure.

[0008] Accordingly, the present disclosure provides the following: (Item 1) Escherichia coli in which one or more RNA producing plasmid improvement-related (RPPI) genes have been disrupted. (Item 2) The Escherichia coli according to any one of the above items, wherein the RPPI genes are selected based on one or more factors selected from the group consisting of: (A) sugar metabolism, (B) amino acid metabolism, (C) replication, (D) homologous recombination, (E) nucleic acid biosynthesis, (F) nucleic acid modification, and (G) transporter membrane transport. (Item 3) The Escherichia coli according to any one of the above items, wherein the RPPI genes, when disrupted, increase the mRNA synthesis score. (Item 3A) The Escherichia coli according to any one of the above items, wherein, when one or more genes are disrupted, the mRNA synthesis score is 1.2 or higher. (Item 3B) The Escherichia coli according to any one of the preceding items, wherein when one or more genes are disrupted, the mRNA synthesis evaluation value is 1.5 or more. (Item 3C) The Escherichia coli according to any one of the preceding items, wherein when one or more genes are disrupted, the mRNA synthesis evaluation value is 2.0 or more. (Item 4) The RPPI genes are selected from the group consisting of ECK0337 cynS, ECK0416 xseB, ECK0448 ybaZ, ECK0482 ybbJ, ECK0506 ybbY, ECK0671 fur, ECK0797 ybiO, ECK0816 moeB, ECK0870 macB, ECK0899 aroA, ECK0974 yccZ, ECK1012 ycdQ, ECK1105 ycfX, ECK1190 ycgV, ECK1254 trpA, ECK1349 ydaE, ECK1382 feaB, ECK1487 gadB, ECK1505 ydeW, ECK1529 ydeI, ECK1548 ydfQ, ECK1597 pntB, ECK1648 rnt, ECK1680 sufA, ECK1690 ydiB, ECK1701 ydiA, ECK1729 cedA, ECK1743 astB, ECK1752 ynjB, ECK1770 ydjH, ECK1788 yeaM, ECK1834 yebU, ECK1844 yobB,ECK1880 flhA, ECK1929 yedF, ECK1949 rcsA, ECK1966 yedX, ECK2010 yeeZ, ECK2023 ugd, ECK2041 wcaJ, ECK2104 yehD, ECK2123 yehY, ECK2193 ccmA, ECK2196 naph, ECK2267 yfbN, ECK2273 nuoK, ECK2274 nuoJ, ECK2295 yfcF, ECK2312 truA, ECK2392 yfeC, ECK2404 yfeH, ECK2628 yfjP, ECK2660 yqaE, ECK2674 ygaX, ECK2706 norW, ECK2709 ascG, ECK2729 pphB, ECK2754 ygcK, ECK2767 ygcU, ECK2869 hyuA, ECK2897 ygfF, ECK2952 ansB, ECK2959 nupG, ECK3003 yqhD, ECK3085 exuR, ECK3133 yraK, ECK3137 yraO, ECK3138 yraP, ECK3139 yraQ, ECK3141 yhbO, ECK3319 gspK, ECK3331 yheM, ECK3346 ybeH, ECK3367 yhfW, ECK3513 dctA, ECK3526 yhjV, ECK3539 yiaD, ECK3564 yiaK, ECK3606 tdh, ECK3683 dgoT, ECK3733 gidB, ECK3836 fre, ECK3868 ompL, ECK3893 frvA, ECK4014 yjbC, ECK4017 pgi, ECK4034 dgkA, ECK4112 melA, ECK4207 ytfG, and ECK4233 nrdD (Item 5) The Escherichia coli according to any one of the preceding items, wherein the RPPI gene is selected from the group consisting of ECK0337 cynS, ECK0506 ybbY, ECK0671 fur, ECK0797 ybiO, ECK0816 moeB, and ECK0870 macB.ECK1105 ycfX, ECK1254 trpA, ECK1349 ydaE, ECK1382 feaB, ECK1505 ydeW, ECK1597 pntB, ECK1680 sufA, ECK1701 ydiA, ECK1729 cedA, ECK1743 astB, ECK1770 ydjH, ECK1834 yebU, ECK1880 flhA, ECK1929 yedF, ECK1949 rcsA, ECK2023 ugd, ECK2041 wcaJ, ECK2104 yehD, ECK2123 yehY, ECK2193 ccmA, ECK2273 nuoK, ECK2274 nuoJ, ECK2404 yfeH, ECK2628 yfjP, ECK2674 ygaX, ECK2729 pphB, ECK3085 exuR, ECK3133 yraK, ECK3138 yraP, ECK3141 yhbO, ECK3319 gspK, ECK3526 yhjV, ECK3564 yiaK, ECK3606 tdh, ECK3733 gidB, ECK3868 ompL, ECK3893 frvA, ECK4014 yjbC, The E. coli of any one of the preceding items, wherein the gene is selected from ECK4034 dgkA, ECK4112 melA, ECK4207 ytfG, and ECK4233 nrdD. (Item 6) The Escherichia coli according to any one of the preceding items, wherein the RPPI gene is selected from ECK1382 feaB, ECK1597 pntB, ECK1743 astB, ECK1770 ydjH, ECK1929 yedF, ECK1949 rcsA, ECK2023 ugd, ECK2273 nuoK, ECK2274 nuoJ, ECK3141 yhbO, ECK3539 yiaD, ECK3564 yiaK, ECK3733 gidB, and ECK3836 fre. (Item 7) The RPPI gene is selected from ECK1382 feaB, ECK1597 pntB, ECK1949 rcsA, ECK2023 ugd,The E. coli according to any one of the above items, wherein the E. coli is selected from ECK2273 nuoK, ECK3141 yhbO, and ECK3564 yiaK. (Item 8) The E. coli according to any one of the above items, wherein one of the genes is disrupted. (Item 9) The E. coli according to any one of the above items, wherein two or three of the genes are disrupted. (Item 10) The E. coli according to any one of the above items, wherein the E. coli is at least one selected from the group consisting of JM109 strain, DH5α strain, BL21 strain, SCS1 strain, XL1-blue strain, HB101 strain, and derivatives thereof. (Item 11) A composition for producing pDNA for RNA production, comprising the E. coli according to any one of the above items. (Item 12) The composition according to any one of the above items, wherein the RNA is messenger RNA. (Item 13) pDNA produced using the E. coli described in any one of the above items or the composition described in any one of the above items. (Item 14) A method for producing pDNA using the E. coli described in any one of the above items, the method comprising the steps of introducing a vector into the E. coli and culturing the E. coli. (Item 15) Plasmid pDNA produced by the method described in any one of the above items. (Item 16) The pDNA described in any one of the above items, wherein the pDNA has a polyA sequence. (Item 17) The pDNA described in any one of the above items, wherein the length of the polyA sequence is about 20 to about 600 nucleotides. (Item 18) The pDNA described in any one of the above items, wherein the length of the polyA sequence is about 120 to about 200 nucleotides. (Item 18A) The pDNA described in any one of the above items, characterized in that polyA deletion for mRNA production is 50% or less. (Item 19) A composition for mRNA production comprising a plasmid, wherein the pDNA has 50% or less of a polyA deletion. (Item 20) A plasmid composition for RNA production produced using the E. coli described in any one of the above items or the composition described in any one of the above items, wherein 50% or less of the pDNA lacks polyA. (Item 21) A composition for mRNA production using the pDNA described in any one of the above items or the composition described in any one of the above items.A method for producing RNA. (Item 22) RNA produced using the pDNA described in any one of the above items, the composition described in any one of the above items, or by the method described in any one of the above items. (Item 23) The RNA described in any one of the above items, wherein the RNA is messenger RNA. (Item 24) The messenger RNA described in any one of the above items, wherein the messenger RNA has a reduced polyA deletion. (Item 25) A composition for producing pDNA for RNA production, comprising Escherichia coli in which one or more RNA producing plasmid improvement-related (RPPI) genes have been disrupted. (Item 26) The RPPI gene is ECK0337 (cynS), ECK0416 (xseB), ECK0448 (ybaZ), ECK0482 (ybbJ), ECK0506 (ybbY), ECK0671 (fur), ECK0797 (ybiO), ECK0816 (moeB), ECK0870 (macB), ECK0899 (aroA), ECK0974 (yccZ ), ECK1012 (ycdQ), ECK1105 (ycfX), ECK1190 (ycgV), ECK1254 (trpA), ECK1349 (ydaE), ECK1382 (feaB ), ECK1487 (gadB), ECK1505 (ydeW), ECK1529 (ydeI), ECK1548 (ydfQ), ECK1597 (pntB), ECK1648 (rnt) , ECK1680 (sufA), ECK1690 (ydiB), ECK1701 (ydiA), ECK1729 (cedA), ECK1743 (astB), ECK1752 (ynjB) , ECK1770 (ydjH), ECK1788 (yeaM), ECK1834 (yebU), ECK1844 (yobB), ECK1880 (flhA), ECK1929 (yedF) , ECK1949 (rcsA), ECK1966 (yedX), ECK2010 (yeeZ), ECK2023 (ugd), ECK2041 (wcaJ), ECK2104 (yehD), ECK2123 (yehY), ECK2193 (ccmA), ECK2196 (napH), ECK2267 (yfbN), ECK2273 (nuoK), ECK2274 (nuoJ),ECK2295 (yfcF), ECK2312 (truA), ECK2392 (yfeC), ECK2404 (yfeH), ECK2628 (yfjP), ECK2660 ( yqaE), ECK2674 (ygaX), ECK2706 (norW), ECK2709 (ascG), ECK2729 (pphB), ECK2754 (ygcK), ECK 2767 (ygcU), ECK2869 (hyuA), ECK2897 (ygfF), ECK2952 (ansB), ECK2959 (nupG), ECK3003 (yqh D), ECK3085 (exuR), ECK3133 (yraK), ECK3137 (yraO), ECK3138 (yraP), ECK3139 (yraQ), ECK314 1 (yhbO), ECK3319 (gspK), ECK3331 (yheM), ECK3346 (ybeH), ECK3367 (yhfW), ECK3513 (dctA), ECK3526 (yhjV), ECK3539 (yiaD), ECK3564 (yiaK), ECK3606 (tdh), ECK3683 (dgoT), ECK3733 (gi (Item 27) The composition according to any one of the preceding items, wherein the pDNA is selected from ECK4014 (yjbC), ECK4017 (pgi), ECK4034 (dgkA), ECK4112 (melA), ECK4207 (ytfG), and ECK4233 (nrdD). (Item 28) A pDNA for RNA production produced using the composition according to any one of the preceding items.

[0009] It is contemplated that the present disclosure may provide one or more of the above-described features in combinations other than those explicitly stated. Still further embodiments and advantages of the present disclosure will be recognized by those skilled in the art upon reading and understanding the following detailed description, if necessary.

[0010] The present disclosure relates to the artificial disruption or deletion of specific genes in E. coli production strains, thereby improving the plasmid DNA that serves as a template for mRNA production and producing mRNA with high yield and quality, and also to the discovery that such genes exist.

[0011] The plasmids produced in E. coli of the present disclosure not only produce high mRNA yields when used as template plasmid DNA for mRNA production, but also have the advantage of being less prone to defects in the production of mRNA with long poly(A) tails. Long poly(A) tails are known to increase mRNA stability, which contributes to the effectiveness of mRNA medicines. Furthermore, improvements at the production stage can be combined with any methods previously investigated for increasing mRNA yield and quality, such as mRNA design, transcription reactions, and purification processes.

[0012] In other words, by using E. coli in which the RPPI gene has been artificially disrupted as a strain for producing template plasmid DNA, it is possible to produce a plasmid with improved RNA productivity, and by using this as a template, it is possible to produce high-yield, high-quality mRNA.

[0013] Figures 1-1 and 1-2 are a series of figures showing the results of the same experiment and are sometimes collectively referred to as Figure 1. These figures show the results of mRNA synthesis using a plasmid prepared from a gene-disrupted strain created using the E. coli JM109 strain as a parent strain, as a template, and the amount of mRNA synthesis and mRNA poly(A) tail length were evaluated using the fluorescent dye thioflavin T. The fluorescence measurement value of each E. coli strain was used as the mRNA synthesis evaluation value, with the fluorescence measurement value of the parent JM109 strain set at 1. Of the 88 gene-disrupted strains listed in this panel, 48 had mRNA synthesis evaluation values ​​1.2-fold or higher compared to the parent JM109 strain, which was set as the standard strain. Figures 1-1 and 1-2 are a series of figures showing the results of the same experiment and are sometimes collectively referred to as Figure 1. For legends, see Figure 1-1. This figure shows the results of three experiments in which mRNA was synthesized using plasmids prepared from 14 strains selected from 90 gene-disrupted strains generated using E. coli JM109 as a parent strain, and the amount of mRNA synthesis and mRNA poly(A) tail length were evaluated using thioflavin T. Increased mRNA synthesis values ​​were observed in the selected gene-disrupted strains. Figures 3-1 and 3-2 are a series of figures showing the results of the same experiment and are sometimes collectively referred to as Figure 3. This figure shows the topology verification by agarose electrophoresis of plasmids prepared from seven strains selected from 90 gene-disrupted strains generated using E. coli JM109 as a parent strain. The results are shown for miniprep plasmids (left panel) and plasmids prepared by cesium chloride density gradient centrifugation (right panel). Three bands (A, B, and C) with different mobilities were detected, and the differences in their detection levels reflect differences in topology. Increased detection of band C relative to band A was observed in the gene-disrupted strains described in this panel compared to the parent strain. Figures 3-1 and 3-2 are a series of figures showing the results of the same experiment and may be collectively referred to as Figure 3. For legends, see Figure 3-1. Figures 4-1 and 4-2 are a series of figures showing the results of the same experiment and may be collectively referred to as Figure 4. These figures verify the poly(A) sequence length of plasmids prepared from seven strains selected from 90 gene-disrupted strains created using the E. coli JM109 strain as a parent strain.A DNA fragment (490 bp) containing the poly(A) sequence was verified by agarose electrophoresis (left panel). The amounts of the plasmids with the full-length poly(A) sequence and the deleted poly(A) sequence were quantified using a bioanalyzer (middle panel), and the percentage of the deleted poly(A) sequence was calculated (right panel). Compared to the parent strain JM109, deletion of the poly(A) sequence was suppressed by 50% or more in several of the selected strains. Figures 4-1 and 4-2 are a series of figures showing the results of the same experiment and are sometimes collectively referred to as Figure 4. For legends, see Figure 4-1. This figure shows the results of an experiment in which mRNA synthesis was performed using a plasmid prepared from six strains selected from 90 gene-disrupted strains generated using E. coli DH5α as a parent strain, and the amount of mRNA synthesis and mRNA poly(A) length were evaluated using thioflavin T. Increased mRNA synthesis values ​​were observed in the selected gene-disrupted strains. This figure shows the topology of plasmids prepared from six strains selected from 90 gene-disrupted strains created using E. coli DH5α as a parent strain, verified by agarose electrophoresis. Three bands (A, B, and C) with different mobilities were detected, and the differences in their detection levels reflect differences in topology. Compared to the parent strain, an increased level of band C was observed relative to band A in the gene-disrupted strains described in this panel. This figure shows the poly(A) sequence length of plasmids prepared from six strains selected from 90 gene-disrupted strains created using E. coli DH5α as a parent strain. A DNA fragment (490 bp) containing the poly(A) sequence was verified by agarose electrophoresis. Compared to the parent DH5α strain, deletion of the poly(A) sequence was suppressed in several of the selected strains.

[0014] Throughout this specification, singular expressions should be understood to include the plural concept unless otherwise specified. Thus, singular articles (e.g., "a," "an," "the," etc. in English) should be understood to include the plural concept unless otherwise specified. Furthermore, it should be understood that terms used in this specification are used in the sense commonly used in the art unless otherwise specified. Therefore, unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In case of conflict, the present specification (including definitions) will control.

[0015] (Definitions) We first explain the terms and general techniques used in this disclosure.

[0016] As used herein, the term "RNA producing plasmid improvement-related (RPPI)" refers to a gene that has an effect of increasing the amount of mRNA synthesis and / or lengthening the length of the mRNA poly(A) tail when mRNA is synthesized from a template plasmid DNA prepared in a production bacterium (e.g., Escherichia coli) in which the gene has been disrupted.

[0017] In this specification, RPPI can be determined using an "mRNA synthesis evaluation value." The "mRNA synthesis evaluation value," also referred to as an "mRNA index," is defined in the present disclosure as an index of high yield and high quality in mRNA production. It is an index that evaluates both the amount of mRNA synthesis and the length of the mRNA poly(A) tail. Typically, the intensity of fluorescence generated by thioflavin T binding to mRNA transcribed and synthesized using, as a template, a plasmid prepared from a gene-disrupted strain transformed with a plasmid containing an open reading frame (ORF) encoding a specific protein mRNA can be measured, and the RPPI can be calculated as a relative value when the value for mRNA transcribed and synthesized from a standard E. coli-derived plasmid is set to 1 (this method is referred to as the standard E. coli method in this specification). However, the measurement method is not limited thereto, and any method capable of determining the amount of mRNA and poly(A) tail length may be used, as long as it can provide values ​​similar to those of the standard E. coli method. Non-limiting examples of methods for quantifying mRNA include measurement by ultraviolet absorption of nucleic acid bases, and measurement methods using RNA-binding fluorescent dyes such as Qubit, SYBR Green II, and RiboGreen. Methods for determining the poly(A) tail length of mRNA include preparation of the poly(A) tail portion of mRNA by RNase T1 treatment or treatment with mRNA-binding oligonucleotides and RNase H, followed by measurement by bioanalyzer, capillary electrophoresis, or LC-MS. In the present disclosure, an mRNA synthesis evaluation value greater than 1 can be considered more useful for production than standard E. coli strains, such as existing strains and derivatives used in production of E. coli JM109, but industrially, it is preferably 1.2 or higher, more preferably 1.5 or higher, and even more preferably 2.0 or higher. It is contemplated that the present disclosure may provide one or more of the above-described features in combinations other than those explicitly stated. Still further embodiments and advantages of the present disclosure will be recognized by those skilled in the art upon reading and understanding the following detailed description, if necessary.

[0018] As used herein, an "RPPI gene" is characterized by being associated with at least one of the following functions, but the following does not limit the invention related to this disclosure: (A) sugar metabolism, (B) amino acid metabolism, (C) replication, (D) homologous recombination, (E) nucleic acid biosynthesis, (F) nucleic acid modification, and (G) transporter membrane transport.

[0019] In this specification, the term "sugar metabolism" refers in a narrow sense to the reaction of breaking down sugar to obtain energy, or the reverse reaction, but in the broad sense generally adopted in this specification, it also includes reactions indirectly involved in this. The genes related to the above include ECK0671 fur; ECK0870 macB; ECK1105 ycfX; ECK1349 ydaE; ECK1529 ydeI; ECK1597 pntB; ECK1680 sufA; ECK1701 ydiA; ECK1770 ydjH; ECK1788 yeaM; ECK1844 yobB; ECK1929 yedF; ECK1949 rcsA; ECK2010 yeeZ; ECK2023 ugd; ECK2041 wcaJ; ECK2196 napH; ECK2267 yfbN; ECK2273 nuoK; ECK2274 nuoJ; ECK2628 yfjP; and ECK2706 Examples of such genes include, but are not limited to, norW; ECK2709 ascG; ECK2767 ygcU; ECK2897 ygfF; ECK3003 yqhD; ECK3085 exuR; ECK3138 yraP; ECK3141 yhbO; ECK3513 dctA; ECK3539 yiaD; ECK3564 yiaK; ECK3683 dgoT; ECK3836 fre; ECK3893 frvA; ECK4017 pgi; ECK4034 dgkA; ECK4112 melA; and ECK4207 ytfG.

[0020] In this specification, the term "amino acid metabolism" refers in a narrow sense to a reaction in which amino acids are broken down to obtain energy, or the reverse reaction, but in the broad sense generally adopted in this specification, it also includes reactions indirectly involved in this. Genes associated with the above include, but are not limited to, ECK0337 cynS; ECK0671 fur; ECK0899 aroA; ECK1012 ycdQ; ECK1254 trpA; ECK1349 ydaE; ECK1382 feaB; ECK1487 gadB; ECK1690 ydiB; ECK1743 astB; ECK1929 yedF; ECK2123 yehY; ECK2267 yfbN; ECK2295 yfcF; ECK2869 hyuA; ECK2952 ansB; ECK3138 yraP; ECK3141 yhbO; ECK3539 yiaD; and ECK3606 tdh.

[0021] As used herein, "replication" refers in a narrow sense to the self-replication reaction of DNA and the replication reaction of cells, but in the broader sense generally used herein, it also includes genes indirectly involved in these reactions. Genes related to the above include, but are not limited to, xseB (ECK0416); ydeI (ECK1529); cedA (ECK1729); yfeC (ECK2392); pphB (ECK2729); yraO (ECK3137); and cynS (ECK0337).

[0022] As used herein, the term "homologous recombination" refers in a narrow sense to recombination occurring at sites of similar DNA sequences (homologous sites), but in the broader sense generally used herein, it also includes genes indirectly involved in this process. Genes related to the above include, but are not limited to, ECK0416 xseB; ECK2392 yfeC; ECK3137 yraO.

[0023] As used herein, the term "nucleic acid biosynthesis" refers in a narrow sense to the reaction of synthesizing purine nucleotides or pyrimidine nucleotides in vivo, but in the broader sense generally employed herein, it also includes genes indirectly involved in this process. Genes related to the above include, but are not limited to, ybbY (ECK0506); fur (ECK0671); moeB (ECK0816); rnt (ECK1648); yedX (ECK1966); yfjP (ECK2628); ygcK (ECK2754); nupG (ECK2959); yhfW (ECK3367); and nrdD (ECK4233).

[0024] As used herein, the term "nucleic acid modification" refers in a narrow sense to in vivo chemical modification, such as methylation, of nucleic acids constituting DNA or RNA, but in the broader sense generally employed herein, it also includes those indirectly involved in this process. Genes related to the above include, but are not limited to, ybaZ (ECK0448); yebU (ECK1834); truA (ECK2312); yfjP (ECK2628); ygcK (ECK2754); yheM (ECK3331); gidB (ECK3733); and yjbC (ECK4014).

[0025] In this specification, the term "transporter / membrane transport" refers in a narrow sense to a membrane transporter that penetrates a biological membrane and the transport of substances into and out of a cell through that transporter, but in the broad sense generally adopted in this specification, it also includes those that are indirectly involved in this. The genes related to the above include ybbJ (ECK0482); ybbY (ECK0506); ybiO (ECK0797); macB (ECK0870); ycgV (ECK1190); ydeW (ECK1505); ydfQ (ECK1548); ynjB (ECK1752); flhA (ECK1880); yehD (ECK2104); ccmA (ECK2193); yfeH (ECK2404); yqaE (ECK2660); ygaX (ECK2674); nupG (ECK2959); yraK (ECK3133); yraQ (ECK3139); gspK (ECK3319); ybeH (ECK3346); yhjV (ECK3526); dgoT (ECK3683); and flhA (ECK3868). Examples of such a vector include, but are not limited to, ompL; ECK4207 ytfG; and the like.

[0026] The above shows the gene names and gene numbers (ECK numbers) on Escherichia coli K-12 strain as used herein.

[0027] As used herein, "modification" with respect to a gene (nucleic acid, protein, etc.) refers to inserting a base sequence into a cellular base sequence (e.g., DNA), deleting a portion of a cellular RNA or DNA base sequence, or a combination thereof. One aspect of modification includes destruction.

[0028] As used herein, "disruption" of a gene refers to the function of the gene becoming different from its normal function, and includes complete loss as well as a change in one amino acid or one nucleotide that results in a function different from the original function. Non-limiting examples of disruption include methods for reducing or eliminating an inherent function, such as removing the entire length of a gene encoding a functional protein, removing a portion, adding a portion to change the function of the protein, or modifying or replacing a portion of a nucleic acid. Disruption outside the region encoding the protein also includes methods such as expression control or silencing by modifying the promoter portion of the gene.

[0029] As used herein, "modified (organism)" or "modified (organism)" (both in English, modified (organism)) refers to an organism in which the nucleotide sequence of the organism has been altered relative to a reference organism. Reference organisms include, but are not limited to, naturally occurring organisms, organisms that were unknown before modification, and organisms that did not exist before modification. One form of modification is intended to be gene disruption or modification. As used herein, "organism" may be a "microorganism," "bacteria," "E. coli," etc.

[0030] As used herein, the term "plasmid" refers to a DNA, usually circular, that exists separately from chromosomes in a cell or that exists separately from chromosomes when introduced into a cell, and is also called "plasmid DNA" or "pDNA." Unless otherwise specified, the term "plasmid" may refer to pDNA in this specification. A composition containing a plasmid is called a "plasmid composition."

[0031] As used herein, "about" means ±10% of the value that follows, or, when referring to significant figures, means rounding to the nearest significant figure to arrive at the value.

[0032] As used herein, "organism" refers to any living system (e.g., animal, fungus, microorganism, or plant) and virus. Organisms include prokaryotes and eukaryotes. Prokaryotes include bacteria, etc. Eukaryotes include unicellular and multicellular eukaryotes. When the eukaryote is a multicellular organism, it can be used for parts of the eukaryote (e.g., genes, cells, tissues, organs, etc.). As used herein, "part of an organism" refers to parts of genes, cells, tissues, organs, etc. that make up an organism.

[0033] As used herein, the term "for RNA production" refers to anything intended for the production of RNA.

[0034] As used herein, "E. coli" refers to a gram-negative bacterium with the scientific name Escherichia coli (E. coli). E. coli is used to express proteins by incorporating genes into it, as well as to amplify genes by incorporating them into replicable plasmids in E. coli, and for cloning.

[0035] As used herein, when referring to a gene, the term "vector" refers to a vector capable of transferring a polynucleotide sequence of interest into a cell of interest. Examples of such vectors include those capable of autonomous replication in a host cell, such as E. coli, or capable of integration into a chromosome, and containing a promoter in a location suitable for transcription of the polynucleotide of the present disclosure. As used herein, a vector may be an expression vector, a recombinant vector, or the like. A vector is a type of construct, and the present disclosure will be referred to as a "construct" where appropriate. As used herein, a "construct" refers to one or more nucleic acids having a specific structure. Unless explicitly specified, a "construct" refers to one or more constructs. A construct is not limited to an isolated construct itself; when a foreign sequence is inserted into a longer nucleic acid (e.g., genomic DNA), it may also refer to a portion having a non-naturally occurring structure containing the foreign sequence. As used herein, examples of E. coli include the JM109 strain, DH5α strain, BL21 strain, SCS1 strain, XL1-blue strain, HB101 strain, and derivatives thereof. As used herein, the term "derivative" of a specific strain of E. coli is synonymous with "origin strain" (both are "derivative" in English), and includes naturally occurring or artificially created sub-strains and mutant strains based on the original strain, and such derivative strains share basic properties with the original strain.

[0036] As used herein, "polyA sequence" refers to a DNA sequence that directs both the termination and polyadenylation of the nascent RNA transcript. Efficient polyadenylation of recombinant transcripts is desirable because transcripts lacking a polyA tail are unstable and rapidly degraded.

[0037] As used herein, "introduction" of a gene refers to the introduction of an exogenous or endogenous gene, preferably a functional gene, into, for example, a chromosomal genome, using an appropriate introduction technique. Gene introduction can be performed using vectors such as phages and plasmids, and natural transformation, conjugation, protoplast-PEG, and electroporation can also be used. Furthermore, by utilizing targeted gene recombination methods known in the art, an exogenous functional gene can be introduced by replacing an endogenous functional gene. An exogenous functional gene is a gene that is not originally present in the chromosomal genome of the organism, and can be a gene derived from another biological species or a synthetic gene created by PCR or the like. Gene introduction also includes converting an existing genome into a desired gene by genome editing.

[0038] As used herein, "operably linked" means that a polypeptide encoded by a nucleic acid is linked to an element such as a promoter so that the polypeptide is expressed in a state that exhibits biological activity of the polypeptide under the control of the element. As used herein, "operably linked" sequences include both expression control sequences or regulatory DNA elements adjacent to a gene of interest, and expression control sequences or regulatory DNA elements that act in trans or at a distance to control the gene of interest.

[0039] In this specification, the term "production" of a substance is a concept that includes not only the production of a substance within a cell or an organism, but also the excretion of a substance outside the cell, for example, as a culture medium.

[0040] As used herein, "culturing" refers to maintaining, propagating (growing), and / or differentiating cells in an in vitro environment. "Culturing" refers to maintaining, propagating (growing), and / or differentiating cells outside a tissue or body, for example, in a cell culture dish or flask.

[0041] As used herein, the term "gene" refers to a factor that determines a genetic trait, and "gene" may refer to "polynucleotide," "oligonucleotide," and "DNA." Such protein-encoding genes may be endogenous or exogenous to the target organism. Furthermore, these known genes may be used as appropriate. Genes may be used regardless of their origin. In other words, genes may be derived from organisms of other species or genus than the target organism, or may be derived from organisms such as animals, plants, fungi (molds, etc.), and bacteria. Those skilled in the art can obtain information on such genes from NCBI (National Center for Biotechnology Information; http: / / www.ncbi.nlm.nih.gov), AmiGo (https: / / amigo.geneontology.org / ), UniProt (https: / / www.uniprot.org / ), GenoBase ver. These genes can be appropriately obtained by accessing the websites of the following organizations: http: / / togodb.biosciencedbc.jp / togodb / view / genobase_v6_main, EcoCyc (https: / / www.ecocyc.org / ). These genes may be genes encoding proteins that have a certain relationship to the sequence information disclosed in databases, etc., as long as they have the respective activities. One such embodiment includes genes consisting of an amino acid sequence in which one or several amino acids have been deleted, substituted, inserted, or added in the disclosed amino acid sequence, and encoding a protein having the activity to be enhanced in the present disclosure. The amino acid mutations in the disclosed amino acid sequence, i.e., deletion, substitution, insertion, or addition, may be any one type, or two or more types may be combined. The total number of these mutations is not particularly limited, but is preferably from 1 to 10, and more preferably from 1 to 5. Examples of amino acid substitutions include conservative substitutions, specifically substitutions within the following groups:(Glycine, Alanine) (Valine, Isoleucine, Leucine) (Aspartic Acid, Glutamic Acid) (Asparagine, Glutamine) (Serine, Threonine) (Lysine, Arginine) (Phenylalanine, Tyrosine).

[0042] In the context of the present disclosure, the term "RNA" refers to a molecule comprising at least one ribonucleotide residue, preferably consisting entirely or substantially of ribonucleotide residues. "Ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2' position of a β-D-ribofuranosyl group. The term "RNA" includes recombinantly produced RNA, such as double-stranded RNA, single-stranded RNA, isolated RNA, such as partially or completely purified RNA, essentially pure RNA, synthetic RNA, and modified RNA that differs from naturally occurring RNA by the addition, deletion, substitution, and / or alteration of one or more nucleotides. Such alterations can include, for example, the addition of non-nucleotide material to the end of the RNA or internally, for example, at one or more nucleotides of the RNA. Nucleotides in an RNA molecule can also include non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be referred to as analogs or analogs of naturally occurring RNA.

[0043] As used herein, the term "RNA" includes and preferably relates to "mRNA." The term "mRNA" means "messenger RNA" and relates to a "transcript" that is made by using a DNA template and encodes a peptide or polypeptide. Typically, an mRNA comprises a 5'-UTR, a protein-coding region, and a 3'-UTR.

[0044] As used herein, "UTR" is an abbreviation for untranslated region (UTR), and refers to the regions on either side of the coding region of mRNA that are not translated into protein. Any UTR may be used, but examples of 5'UTR include those encoding GAPDH, HSD17B4, PSMB3, RPL31, RPL32, RPL35, RPL21, Albumin7, LDHB, ACAT2, ATP5A1, Ndufa4, Mp68, NOSIP, SLC7A3, TUBB4B, UBQLN2, mRPL35A, mRPL21, AIG1, COX6C, α-globin, β-globin, RPS8, TOP, MCP-1, and RPL12s.c. The 3'UTR may be selected from the UTRs of Ang-2, HSP70, H3.3, Galectin-9, GADD34, EDN1, HSP70m5, E-selectin, ICAM-1, IL-6, or vWF. Other examples of UTRs are disclosed in JP-A-2021-501572, JP-A-2015-517803, and JP-A-2022-164843. The 3'UTR may be selected from GAPDH, Albumin, LDHB, ACAT2, α-globin, β-globin, PSMB3, CASP1, COX6B1, GNAS, NDUFA1, and RPS9, histone stem loops, or natural or artificial sequences complementary to the 5'UTR. In a nucleic acid construct comprising a 5' untranslated region (UTR) and a 3' UTR, at least one of the UTRs in the nucleic acid construct comprises a non-complementary portion and a complementary portion to the other UTR, and the non-complementary portion and the complementary portion may alternate. The sequence having such partial complementarity preferably has a complementarity of 40% to 90% (e.g., but not limited to, 40%, 50%, 60%, 70%, 80%, 90%, or values ​​in between), and more preferably 75% or greater.In particular, from the viewpoint of enhancing mRNA productivity, the following are desirable: a substitution in which all of the non-complementary portions are 1-base long and the complementary portions are each independently 3 to 7 bases long (for example, 3, 4, 5, 6, or 7 bases); a substitution in which the non-complementary portions are 2-base long and the complementary portions are each independently 5 to 7 bases long (for example, 5, 6, or 7 bases); a removal in which the non-complementary portions are 2-base long and the complementary portions are each independently 5 to 11 bases long (for example, 5, 6, 7, 8, 9, 10, or 11 bases); a substitution in which the non-complementary portions are 3-base long and the complementary portions are each independently 8 to 9 bases long (for example, 8 or 9 bases); and a removal in which the non-complementary portions are 3-base long and the complementary portions are each independently 8 to 11 bases long (for example, 8, 9, 10, or 11 bases). A polyA tail may be selected for the 3' end of the 3'UTR. This poly(A) tail functions to improve mRNA stability and translation efficiency.

[0045] As used herein, the terms "mutually" or "complementarity" refer to the specific pairing of adenine with thymine or uracil, or guanine with cytosine or uracil (wobble base pairing) in a nucleic acid base sequence. A "non-complementary portion" refers to a portion of a base sequence that is not complementary, and a "complementary portion" refers to a portion of a base sequence that is complementary. As used herein, complementary portions and non-complementary portions can be specified in single-base increments. The phrase "all non-complementary portions are 1 base in length" refers to the following: when a complementary portion and a non-complementary portion are specified in a portion of a nucleic acid of interest, if there is a single non-complementary portion, the non-complementary portion is 1 base in length; and if there are multiple non-complementary portions, all of the multiple non-complementary portions are 1 base in length. In addition, in a non-complementary portion, either the 5'UTR or the 3'UTR may be 0 bases long. In this case, the term "removal" may be used herein (although it may also be referred to as "addition" when viewed from the other side, the term "removal" is used herein unless otherwise specified, and "removal" is understood in a broad sense to include removal and addition in the narrow sense). Furthermore, when one or more non-complementary bases are present in the 5'UTR and 3'UTR in the non-complementary portion, the term may be used herein as "substitution." Note that, in the non-complementary portion, when the number of bases on one side is different from the number of bases on the other side, the portion with the same number corresponds to "substitution," and in the portion with a different number of bases, the side with fewer bases relative to the side with more bases corresponds to "removal." For example, in the case of 5'-NNNAGNNN 3'-NNNA0NNN (N is the complementary strand, 0 is no base), A for A on the 5' side is a substitution where U would be in the complementary strand, but 0 for G on the 5' side corresponds to removal.

[0046] Furthermore, in the case of 5'-NNNAGNNNU0NNN 3'-NNNA0NNNUGNNN, the AG portion on the 5' side is the same as above, but the portion corresponding to U0, G, can be considered as "addition", but in this specification, it may be described as "removal" in a broad sense.

[0047] Unless otherwise specified, in this specification, deletions, substitutions, and additions are determined by comparing nucleic acids in order from the 5' side.

[0048] In the context of the present disclosure, mRNA can be produced by in vitro transcription from a DNA template. In vitro transcription methods are known to those skilled in the art. For example, various in vitro transcription kits are commercially available.

[0049] As used herein, "ECK0337 (cynS)", "ECK0337" and "cynS" are all used interchangeably and have the same meaning, and refer to a gene encoding cyanate hydratase in Escherichia coli, and are synonymous with cntJW0331, b0340, etc., and correspond to P00816 in UniProtKB (Swiss-Prot). In addition, as used herein, the expression "ECK*** (XXXX)" is sometimes written in a composite form as "ECK*** XXXX" or in other formats, but these have the same meaning.

[0050] As used herein, "ECK0416 (xseB)", "ECK0416" and "xseB" are all used interchangeably and have the same meaning, and refer to a gene encoding the exodeoxyribonuclease 7 small subunit of Escherichia coli, and are synonymous with yajE, JW0412, b0422 and the like, and correspond to P0A8G9 in UniProtKB (Swiss-Prot).

[0051] As used herein, "ECK0448 (ybaZ)", "ECK0448" and "ybaZ" are all used interchangeably and have the same meaning, and refer to a gene encoding a DNA base-flipping protein of Escherichia coli, which is synonymous with atl, JW0444, b0454, etc., and corresponds to P0AFP2 in UniProtKB (Swiss-Prot).

[0052] As used herein, "ECK0482 (ybbJ)", "ECK0482" and "ybbJ" are all used interchangeably and have the same meaning, and refer to a conserved gene encoding the inner membrane protein YbbJ of Escherichia coli, which is synonymous with JW0477, JW5065, b0488 and the like, and corresponds to P0AAS3 in UniProtKB (Swiss-Prot).

[0053] As used herein, "ECK0506 (ybbY)", "ECK0506" and "ybbY" are all used interchangeably and have the same meaning, and refer to a gene encoding a protein presumed to be a purine permease of Escherichia coli, and is synonymous with glxB4, JW0501, b0513 and the like, and corresponds to P77328 in UniProtKB (Swiss-Prot).

[0054] As used herein, "ECK0671(fur)", "ECK0671" and "fur" are all used interchangeably and have the same meaning, and refer to a gene encoding an Escherichia coli iron uptake regulation protein, which is synonymous with JW0669, b0683 and the like, and corresponds to P0A9A9 in UniProtKB (Swiss-Prot).

[0055] As used herein, "ECK0797 (ybiO)," "ECK0797," and "ybiO" are all used interchangeably and have the same meaning, and refer to a gene encoding a moderate conductance mechanosensitive channel in Escherichia coli, which is synonymous with JW7093, JW5108, b0808, etc., and corresponds to P75783 in UniProtKB (Swiss-Prot).

[0056] As used herein, "ECK0797 (ybiO)" is a gene predicted to encode the moderate conductance mechanosensitive channel YbiO of Escherichia coli, and is synonymous with JW0793, JW5108, b0808, etc., and corresponds to P75783 in UniProtKB (Swiss-Prot).

[0057] As used herein, "ECK0816 (moeB)", "ECK0816" and "moeB" are all used interchangeably and have the same meaning, and refer to a gene encoding molybdopterin synthase adenylyltransferase in Escherichia coli, and are synonymous with chlN, JW0810, b0826 and the like, and correspond to P12282 in UniProtKB (Swiss-Prot).

[0058] As used herein, "ECK0870 (macB)," "ECK0870," and "macB" are all used interchangeably and have the same meaning, and refer to a gene encoding an Escherichia coli macrolide export ATP-binding / permease protein, which is synonymous with ybjZ, JW0863, b0879, etc., and corresponds to P75831 in UniProtKB (Swiss-Prot).

[0059] As used herein, "ECK0899 (aroA)," "ECK0899," and "aroA" are all used interchangeably and have the same meaning, and refer to a gene encoding 3-phosphoshikimate 1-carboxyvinyltransferase of Escherichia coli, which is synonymous with JW0891, b0908, etc., and corresponds to P0A6D3 in UniProtKB (Swiss-Prot).

[0060] As used herein, "ECK0974(yccZ)", "ECK0974" and "yccZ" are all used interchangeably and have the same meaning, and refer to a gene encoding a protein presumed to be a polysaccharide export protein of Escherichia coli, which is synonymous with gfcE, JW0966, b0983 and the like, and corresponds to P0A932 in UniProtKB (Swiss-Prot).

[0061] As used herein, "ECK1012(ycdQ)," "ECK1012," and "ycdQ" are all used interchangeably and have the same meaning, and refer to a gene encoding Escherichia coli poly-beta-1,6-N-acetyl-D-glucosamine synthase, which is synonymous with pgaC, JW1007, b1022, etc., and corresponds to P75905 in UniProtKB (Swiss-Prot).

[0062] As used herein, "ECK1105 (ycfX)," "ECK1105," and "ycfX" are all used interchangeably and have the same meaning, and refer to a gene encoding Escherichia coli N-acetyl-D-glucosamine kinase, which is synonymous with nagK, JW1105, b1119, etc., and corresponds to P75959 in UniProtKB (Swiss-Prot).

[0063] As used herein, "ECK1190 (ycgV)," "ECK1190," and "ycgV" are all used interchangeably and have the same meaning, and refer to a gene encoding an uncharacterized protein (Uncharacterized protein YcgV) of Escherichia coli that is presumed to encode an adhesion factor (Adhesin), and is synonymous with JW1193, b1202, etc., and corresponds to P76017 in UniProtKB (Swiss-Prot).

[0064] As used herein, "ECK1254 (trpA)," "ECK1254," and "trpA" are all used interchangeably and have the same meaning, and refer to a gene encoding the tryptophan synthase alpha chain of Escherichia coli, which is synonymous with JW1252, b1260, etc., and corresponds to P0A877 in UniProtKB (Swiss-Prot).

[0065] As used herein, "ECK1349 (ydaE)," "ECK1349," and "ydaE" are all used interchangeably and have the same meaning, and refer to an uncharacterized protein (Uncharacterized protein YdaE) of Escherichia coli that encodes a conserved protein (Rac prophage; conserved protein) derived from a Rac prophage, and is synonymous with JW1346, b4526, etc., and corresponds to P38394 in UniProtKB (Swiss-Prot).

[0066] As used herein, "ECK1382 (feaB)," "ECK1382," and "feaB" are all used interchangeably and have the same meaning, and refer to a gene encoding phenylacetaldehyde dehydrogenase in Escherichia coli, which is synonymous with maoB, padA, ydbG, JW1380, b1385, etc., and corresponds to P80668 in UniProtKB (Swiss-Prot).

[0067] As used herein, "ECK1487 (gadB)," "ECK1487," and "gadB" are all used interchangeably and have the same meaning, and refer to a gene encoding glutamate decarboxylase beta in Escherichia coli, which is synonymous with JW1488, b1493, etc., and corresponds to P69910 in UniProtKB (Swiss-Prot).

[0068] As used herein, "ECK1505 (ydeW)", "ECK1505", and "ydeW" are all used interchangeably and have the same meaning, and refer to a gene encoding the transcriptional regulator LsrR of Escherichia coli, which is synonymous with lsrR, JW1505, b1512, etc., and corresponds to P76141 in UniProtKB (Swiss-Prot).

[0069] As used herein, "ECK1529 (ydeI)", "ECK1529" and "ydeI" are all used interchangeably and have the same meaning, and refer to a gene encoding a conserved protein of Escherichia coli that is an uncharacterized protein (uncharacterized protein YdeI), and is synonymous with JW1529, b1536 and the like, and corresponds to P31130 in UniProtKB (Swiss-Prot).

[0070] As used herein, "ECK1548 (ydfQ)", "ECK1548" and "ydfQ" are all used interchangeably and have the same meaning, and refer to a gene encoding a protein that is a probable prophage lysozyme of Escherichia coli, and is synonymous with rrrQ, arrQ, JW1546, b1554 and the like, and corresponds to P76159 in UniProtKB (Swiss-Prot).

[0071] As used herein, "ECK1597(pntB)", "ECK1597" and "pntB" are all used interchangeably and have the same meaning, and refer to a gene encoding the NAD(P) transhydrogenase subunit beta of Escherichia coli, which is synonymous with JW1594, b1602 and the like, and corresponds to P0AB67 in UniProtKB (Swiss-Prot).

[0072] As used herein, "ECK1648(rnt)", "ECK1648" and "rnt" are all used interchangeably and have the same meaning, and refer to a gene encoding Escherichia coli ribonuclease T, which belongs to the DNA polymerase III ε subunit (DNA polymerase III subunit epsilon), has the same meaning as JW1644, b1652 and the like, and corresponds to P30014 in UniProtKB (Swiss-Prot).

[0073] As used herein, "ECK1680 (sufA)," "ECK1680," and "sufA" are all used interchangeably and have the same meaning, and refer to a gene encoding Escherichia coli protein SufA, which belongs to iron-sulfur cluster assembly proteins and is synonymous with ydiC, JW1674, b1684, etc., and corresponds to P77667 in UniProtKB (Swiss-Prot).

[0074] As used herein, "ECK1690 (ydiB)," "ECK1690," and "ydiB" are all used interchangeably and have the same meaning, and refer to a gene encoding quinate / shikimate dehydrogenase in Escherichia coli, which corresponds to P0A6D5 in UniProtKB (Swiss-Prot).

[0075] As used herein, "ECK1701 (ydiA)," "ECK1701," and "ydiA" are all used interchangeably and have the same meaning, and refer to a gene encoding a phosphoenolpyruvate synthase regulatory protein of Escherichia coli, which is synonymous with ppsR, JW1693, b1703, etc., and corresponds to P0A8A4 in UniProtKB (Swiss-Prot).

[0076] As used herein, "ECK1729 (cedA)", "ECK1729" and "cedA" are all used interchangeably and have the same meaning, and refer to a gene encoding the cell division activator CedA of Escherichia coli, which is synonymous with ydjP, JW1720, b1731 and the like, and corresponds to P0AE60 in UniProtKB (Swiss-Prot).

[0077] As used herein, "ECK1743(astB)," "ECK1743," and "astB" are all used interchangeably and have the same meaning, and refer to a gene encoding N-succinylarginine dihydrolase of Escherichia coli, and are synonymous with ydjT, JW1734, b1745, etc., and correspond to P76216 in UniProtKB (Swiss-Prot).

[0078] As used herein, "ECK1752 (ynjB)," "ECK1752," and "ynjB" are all used interchangeably and have the same meaning, and refer to a gene encoding a conserved protein in Escherichia coli known as Protein YnjB, which is synonymous with JW5284, b1754, and the like, and corresponds to P76223 in UniProtKB (Swiss-Prot).

[0079] As used herein, "ECK1770 (ydjH)", "ECK1770" and "ydjH" are all used interchangeably and have the same meaning, and refer to a gene encoding the Escherichia coli sugar kinase YdjH (Uncharacterized sugar kinase YdjH), which is an uncharacterized sugar kinase of Escherichia coli, belongs to the hexokinase family, and is synonymous with JW5289, b1772 and the like, and corresponds to P77493 in UniProtKB (Swiss-Prot).

[0080] As used herein, "ECK1788 (yeaM)", "ECK1788" and "yeaM" are all used interchangeably and have the same meaning, and refer to a gene encoding the HTH-type transcriptional regulator NimR of Escherichia coli, and are synonymous with nimR, JW1779, b1790 and the like, and correspond to P76241 in UniProtKB (Swiss-Prot).

[0081] As used herein, "ECK1834 (yebU)," "ECK1834," and "yebU" are all used interchangeably and have the same meaning, and refer to a gene predicted to encode ribosomal RNA small subunit methyltransferase F of Escherichia coli, and is synonymous with JW1824, JW5301, b1835, etc., and corresponds to P76273 in UniProtKB (Swiss-Prot).

[0082] As used herein, "ECK1844 (yobB)," "ECK1844," and "yobB" are all used interchangeably and have the same meaning, and refer to a gene encoding a conserved protein of Escherichia coli known as the uncharacterized protein YobB (Uncharacterized protein YobB), which is synonymous with JW1832, b1843, and the like, and corresponds to P76280 in UniProtKB (Swiss-Prot).

[0083] As used herein, "ECK1880 (flhA)," "ECK1880," and "flhA" are all used interchangeably and have the same meaning, and refer to a gene encoding the flagellar biosynthesis protein FlhA of Escherichia coli, and are synonymous with JW1868, b1879, etc., and correspond to P76298 in UniProtKB (Swiss-Prot).

[0084] As used herein, "ECK1929 (yedF)," "ECK1929," and "yedF" are all used interchangeably and have the same meaning, and refer to a gene encoding a protein presumed to be the putative sulfur carrier protein YedF of Escherichia coli, and is synonymous with JW1915, b1930, etc., and corresponds to P0AA31 in UniProtKB (Swiss-Prot).

[0085] As used herein, "ECK1949 (rcsA)," "ECK1949," and "rcaA" are all used interchangeably and have the same meaning, and refer to a gene encoding the Escherichia coli transcriptional regulatory protein RcsA, which is synonymous with JW1935, b1951, etc., and corresponds to P0DMC9 in UniProtKB (Swiss-Prot).

[0086] As used herein, "ECK1966 (yedX)," "ECK1966," and "yedX" are all used interchangeably and have the same meaning, and refer to a gene encoding 5-hydroxyisourate hydrolase in Escherichia coli, which is synonymous with hiuH, JW1953, b1970, etc., and corresponds to P76341 in UniProtKB (Swiss-Prot).

[0087] As used herein, "ECK2010(yeeZ)," "ECK2010," and "yeeZ" are all used interchangeably and have the same meaning, and refer to a gene encoding a protein predicted to be an epimerase with an NAD(P)-binding Rossmann-fold domain in Escherichia coli Protein YeeZ, and is synonymous with JW1998, b2016, etc., and corresponds to P0AD12 in UniProtKB (Swiss-Prot).

[0088] As used herein, "ECK2023(ugd)", "ECK2023" and "ugd" are all used interchangeably and have the same meaning, and refer to a gene encoding UDP-glucose 6-dehydrogenase of Escherichia coli, and are synonymous with pmrE, udg, yefA, JW2010, b2028 and the like, and correspond to P76373 in UniProtKB (Swiss-Prot).

[0089] As used herein, "ECK2041 (wcaJ)", "ECK2041" and "wcaJ" are all used interchangeably and have the same meaning, and refer to a gene encoding UDP-glucose:undecaprenyl-phosphate glucose-1-phosphate transferase of Escherichia coli, which is synonymous with JW2032, b2047 and the like, and corresponds to P71241 in UniProtKB (Swiss-Prot).

[0090] As used herein, "ECK2104 (yehD)", "ECK2104" and "yehD" are all used interchangeably and have the same meaning, and refer to a gene encoding the uncharacterized flagella-like protein YehD of Escherichia coli (Uncharacterized fimbrial-like protein YehD), which belongs to the fimbrial subunit elfa-related and is synonymous with JW2098, b2111 and the like, and corresponds to P33343 in UniProtKB (Swiss-Prot).

[0091] As used herein, "ECK2123(yehY)", "ECK2123" and "yehY" are all used interchangeably and have the same meaning, and refer to a gene encoding the glycine betaine uptake system permease protein YehY of Escherichia coli, which is synonymous with glxB4, JW0501, b0513 and the like, and corresponds to P33361 in UniProtKB (Swiss-Prot).

[0092] As used herein, "ECK2193 (ccmA)", "ECK2193" and "ccmA" are all used interchangeably and have the same meaning, and refer to a gene encoding a protein presumed to be a putative purine permease of Escherichia coli, and are synonymous with JW2118, b2130 and the like, and correspond to P33931 in UniProtKB (Swiss-Prot).

[0093] As used herein, "ECK2196 (napH)", "ECK2196" and "napH" are all used interchangeably and have the same meaning, and refer to a gene encoding the ferredoxin-type protein NapH of Escherichia coli, which is synonymous with yejZ, JW2192, b2204 and the like, and corresponds to P33934 in UniProtKB (Swiss-Prot).

[0094] As used herein, "ECK2267 (yfbN)," "ECK2267," and "yfbN" are all used interchangeably and have the same meaning, and refer to a gene presumed to encode an uncharacterized protein (Uncharacterized protein YfbN) of Escherichia coli, and is synonymous with JW2268, b2273, etc., and corresponds to P76484 in UniProtKB (Swiss-Prot).

[0095] As used herein, "ECK2273 (nuoK)", "ECK2273", and "nuoK" are all used interchangeably and have the same meaning, and refer to a gene encoding the NADH-quinone oxidoreductase subunit K of Escherichia coli, and are synonymous with JW2274, b2279, etc., and correspond to P0AFE4 in UniProtKB (Swiss-Prot).

[0096] As used herein, "ECK2274(nuoJ)", "ECK2274" and "nuoJ" are all used interchangeably and have the same meaning, and refer to a gene of Escherichia coli encoding * (NADH-quinone oxidoreductase subunit J), which is synonymous with JW2275b2280 and the like, and corresponds to P0AFE0 in UniProtKB (Swiss-Prot).

[0097] As used herein, "ECK2295 (yfcF)," "ECK2295," and "yfcF" are all used interchangeably and have the same meaning, and refer to a gene encoding Escherichia coli glutathione S-transferase YfcF, which is synonymous with JW2298, b2301, and the like, and corresponds to P77544 in UniProtKB (Swiss-Prot).

[0098] As used herein, "ECK2312 (truA)," "ECK2312," and "truA" are all used interchangeably and have the same meaning, and refer to a gene encoding Escherichia coli tRNA pseudouridine synthase A, and are synonymous with asuC, hisT, leuK, JW2315, b2318, etc., and correspond to P07649 in UniProtKB (Swiss-Prot).

[0099] As used herein, "ECK2392 (yfeC)," "ECK2392," and "yfeC" are all used interchangeably and have the same meaning, and refer to a gene encoding an uncharacterized protein (Uncharacterized protein YfeC) of Escherichia coli, which is presumed to be a predicted DNA-binding transcriptional regulator, and is synonymous with JW2393, b2398, etc., and corresponds to P0AD37 in UniProtKB (Swiss-Prot).

[0100] As used herein, "ECK2404 (yfeH)," "ECK2404," and "yfeH" are all used interchangeably and have the same meaning, and refer to a gene encoding a protein presumed to be the Escherichia coli symporter protein YfeH (putative symporter YfeH), which belongs to solute carrier family 10 member 7, is synonymous with JW5876, b2410, etc., and corresponds to P39836 in UniProtKB (Swiss-Prot).

[0101] As used herein, "ECK2628 (yfjP)" refers to a gene predicted to encode a GTP-binding protein of the Escherichia coli protein YfjP (Uncharacterized protein YfjP), of unknown character, and is synonymous with JW2613, JW5419, b2632, etc., and corresponds to P52131 in UniProtKB (Swiss-Prot).

[0102] As used herein, "ECK2660 (yqaE)," "ECK2660," and "yqaE" are all used interchangeably and have the same meaning, and refer to a gene encoding the UPF0057 membrane protein YqaE of Escherichia coli, which belongs to the hydrophobic protein rci2 low temperature and salt responsive protein lti6-related group and is synonymous with JW2641, b2666, and the like, and corresponds to P0AE42 in UniProtKB (Swiss-Prot).

[0103] As used herein, "ECK2674 (ygaX)," "ECK2674," and "ygaX" are all used interchangeably and have the same meaning, and refer to a gene encoding the Escherichia coli transporter ygaY, for which corresponding UniProtKB (TrEMBL) names include A0A377AHV1, A0A2X1N9K0, and A03A377DPF0.

[0104] As used herein, "ECK2706(norW)", "ECK2706" and "norW" are all used interchangeably and have the same meaning, and refer to a gene encoding Escherichia coli nitric oxide reductase FIRd-NAD(+) reductase (Nitric oxide reductase FIRd-NAD(+) reductase), which belongs to the fad-dependent oxidereductase family and is synonymous with flrR, ygbD, JW2681, b2711 and the like, and corresponds to P37596 in UniProtKB (Swiss-Prot).

[0105] As used herein, "ECK2709 (ascG)," "ECK2709," and "ascG" are all used interchangeably and have the same meaning, and refer to a gene encoding the HTH-type transcriptional regulator AscG of Escherichia coli, which belongs to the laci-related transcriptional repressor family and is synonymous with JW5434, b2714, and the like, and corresponds to P24242 in UniProtKB (Swiss-Prot).

[0106] As used herein, "ECK2729 (pphB)," "ECK2729," and "pphB" are all used interchangeably and have the same meaning, and refer to a gene encoding Escherichia coli serine / threonine-protein phosphatase 2, which belongs to the metallophosphoesterase family and is synonymous with prpB, ygbH, JW2704, b2734, and the like, and corresponds to P55799 in UniProtKB (Swiss-Prot).

[0107] As used herein, "ECK2754 (ygcK)", "ECK2754" and "ygcK" are all used interchangeably and have the same meaning, and are a gene encoding the CRISPR system cascade subunit CasB of Escherichia coli, and are synonymous with casB, cse2, JW2729, b2759 and the like, and correspond to P76632 in UniProtKB (Swiss-Prot).

[0108] As used herein, "ECK2869 (hyuA)," "ECK2869," and "hyuA" are all used interchangeably and have the same meaning, and refer to a gene encoding D-phenylhydantoinase of Escherichia coli, which belongs to the hydrantoinase / dihydropyrimidinase family member and is synonymous with ygeZ, JW2841, b2873, etc., and corresponds to Q46806 in UniProtKB (Swiss-Prot).

[0109] As used herein, "ECK2897 (ygfF)," "ECK2897," and "ygfF" are all used interchangeably and have the same meaning, and refer to a gene encoding the Escherichia coli oxidoreductase YgfF (Uncharacterized oxidoreductase YgfF) of unknown characteristics, which belongs to the oxidoreductase, short-chain dehydrogenase / reductase family (afu_orthologue afua_5g02870), is synonymous with yqfD, JW2870, b2902, etc., and corresponds to P52037 in UniProtKB (Swiss-Prot).

[0110] As used herein, "ECK2952(ansB)," "ECK2952," and "ansB" are all used interchangeably and have the same meaning, and refer to a gene encoding L-asparaginase 2 of Escherichia coli, which is synonymous with JW2924, b2957, and the like, and corresponds to P00805 in UniProtKB (Swiss-Prot).

[0111] As used herein, "ECK2959 (nupG)," "ECK2959," and "nupG" are all used interchangeably and have the same meaning, and refer to a gene encoding the nucleoside permease NupG of Escherichia coli, which belongs to the bll5896 protein and is synonymous with JW2932, b2964, etc., and corresponds to P0AFF4 in UniProtKB (Swiss-Prot).

[0112] As used herein, "ECK3003 (yqhD)", "ECK3003" and "yqhD" are all used interchangeably and have the same meaning, and refer to a gene encoding the alcohol dehydrogenase YqhD of Escherichia coli, which is synonymous with JW2978, b3011 and the like, and corresponds to Q46856 in UniProtKB (Swiss-Prot).

[0113] As used herein, "ECK3085 (exuR)," "ECK3085," and "exuR" are all used interchangeably and have the same meaning, and refer to a gene encoding an Exu regulon transcriptional regulator of Escherichia coli, which belongs to the transcriptional regulator, gntr family, is synonymous with JW3065, b3094, and the like, and corresponds to P0ACL2 in UniProtKB (Swiss-Prot).

[0114] As used herein, "ECK3133 (yraK)," "ECK3133," and "yraK" are all used interchangeably and have the same meaning, and refer to a gene encoding the uncharacterized pilus-like protein YraK (Uncharacterized fimbrial-like protein YraK) of Escherichia coli, which belongs to the fimbrial subunit elfa-related and is synonymous with JW3114, b3145, etc., and corresponds to P43319 in UniProtKB (Swiss-Prot).

[0115] As used herein, "ECK3137(yraO)," "ECK3137," and "yraO" are all used interchangeably and have the same meaning, and refer to a gene encoding the DnaA initiator-associating protein DiaA of Escherichia coli, which belongs to the sedoheptulose 7-phosphate isomerase / dnaa initiator-associating factor for replication initiation, and is synonymous with yraO, JW3118, b3149, etc., and corresponds to P66817 in UniProtKB (Swiss-Prot).

[0116] As used herein, "ECK3138 (yraP)," "ECK3138," and "yraP" are all used interchangeably and have the same meaning, and refer to a gene encoding the outer membrane lipoprotein DolP of Escherichia coli, which belongs to the bone domain-containing protein family and is synonymous with dolP, JW3119, b3150, etc., and corresponds to P64596 in UniProtKB (Swiss-Prot).

[0117] As used herein, "ECK3139 (yraQ)," "ECK3139," and "yraQ" are all used interchangeably and have the same meaning, and refer to a gene encoding the UPF0718 protein YraQ of Escherichia coli (UPF0718 protein YraQ), which is synonymous with JW3120, b3151, etc., and corresponds to P45468 in UniProtKB (Swiss-Prot).

[0118] As used herein, "ECK3141(ybbO)", "ECK3141" and "ybbO" are all used interchangeably and have the same meaning, and refer to a gene encoding a protein presumed to be an Escherichia coli putative purine permease, and are synonymous with glxB4, JW0501, b0513 and the like, and correspond to P0AFP4 in UniProtKB (Swiss-Prot).

[0119] As used herein, "ECK3319 (gspK)," "ECK3319," and "gspK" are all used interchangeably and have the same meaning, and refer to a gene encoding a protein presumed to be Escherichia coli type II secretion system protein K, which is synonymous with glxB4, JW0501, b0513, etc., and corresponds to P45762 in UniProtKB (Swiss-Prot).

[0120] As used herein, "ECK3331(yheM)," "ECK3331," and "yheM" are all used interchangeably and have the same meaning, and refer to a gene encoding Escherichia coli protein TusC, which is synonymous with tusC, JW3306, b3344, etc., and corresponds to P45531 in UniProtKB (Swiss-Prot).

[0121] As used herein, "ECK3346 (ybeH)," "ECK3346," and "ybeH" are all used interchangeably and have the same meaning, and refer to a gene encoding a protein presumed to be Escherichia coli protein YbeH (putative protein YbeH), which is synonymous with b4581, JW0620, b0625, etc., and corresponds to P0DP63 in UniProtKB (Swiss-Prot).

[0122] As used herein, "ECK3367 (yhfW)," "ECK3367," and "yhfW" are all used interchangeably and have the same meaning, and refer to a gene encoding the Escherichia coli protein YhfW (Uncharacterized protein YhfW), which is of unknown character and belongs to the phosphopentomutase family, and is synonymous with JW3343, b3380, and the like, and corresponds to P45549 in UniProtKB (Swiss-Prot).

[0123] As used herein, "ECK3513(dctA)," "ECK3513," and "dctA" are all used interchangeably and have the same meaning, and refer to a gene encoding an aerobic C4-dicarboxylate transport protein of Escherichia coli, which belongs to the proton / glutamate-aspartate symporter family and is synonymous with JW3496, b3528, and the like, and corresponds to P0A830 in UniProtKB (Swiss-Prot).

[0124] As used herein, "ECK3526 (yhjV)," "ECK3526," and "yhiV" are all used interchangeably and have the same meaning, and refer to a gene encoding the Escherichia coli inner membrane transport protein YhjV, which belongs to the serine transporter family and is synonymous with JW3508, b3539, and the like, and corresponds to P37660 in UniProtKB (Swiss-Prot).

[0125] As used herein, "ECK3539 (yiaD)," "ECK3539," and "yiaD" are all used interchangeably and have the same meaning, and refer to a gene encoding a protein that may be the lipoprotein YiaD of Escherichia coli, which belongs to the stator element of the flagellar motor complex, and is synonymous with JW5657, b3552, and the like, and corresponds to P37665 in UniProtKB (Swiss-Prot).

[0126] As used herein, "ECK3564 (yiaK)," "ECK3564," and "yiaK" are all used interchangeably and have the same meaning, and refer to a gene encoding 2,3-diketo-L-gulonate reductase in Escherichia coli, which belongs to the oxidoreductase-related group and is synonymous with dlgD, JW3547, b3575, and the like, and corresponds to P37672 in UniProtKB (Swiss-Prot).

[0127] As used herein, "ECK3606(tdh)", "ECK3606", and "tdh" are all used interchangeably and have the same meaning, and refer to a gene encoding L-threonine 3-dehydrogenase of Escherichia coli, which is synonymous with JW3591, b3616, etc., and corresponds to P07913 in UniProtKB (Swiss-Prot).

[0128] As used herein, "ECK3683 (dgoT)," "ECK3683," and "dgoT" are all used interchangeably and have the same meaning, and refer to a gene encoding a D-galactonate transporter in Escherichia coli, which belongs to solute carrier family 17 and is synonymous with yidT, JW5859, b3691, etc., and corresponds to P0AA76 in UniProtKB (Swiss-Prot).

[0129] As used herein, "ECK3733 (gidB)," "ECK3733," and "gidB" are all used interchangeably and have the same meaning, and refer to a gene encoding ribosomal RNA small subunit methyltransferase G of Escherichia coli, which belongs to the s-adenosyl-l-methionine-dependent methyltransferases superfamily protein and is synonymous with rsmG, JW3718, b3740, etc., and corresponds to P0A6U5 in UniProtKB (Swiss-Prot).

[0130] As used herein, "ECK3836(fre)," "ECK3868," and "fre" are all used interchangeably and have the same meaning, and refer to a gene encoding an Escherichia coli NAD(P)H-flavin reductase, which belongs to the Na(+)-translocating NADH-quinone reductase subunit and is synonymous with fadI, flrD, fsrC, ubiB, JW3820, b3844, etc., and corresponds to P0AEN1 in UniProtKB (Swiss-Prot).

[0131] As used herein, "ECK3868 (ompL)," "ECK3868," and "ompL" are all used interchangeably and have the same meaning, and refer to a gene encoding Escherichia coli porin OmpL, which belongs to the outer membrane protein-related-related group and is synonymous with yshA, JW3846, b3875, and the like, and corresponds to P76773 in UniProtKB (Swiss-Prot).

[0132] As used herein, "ECK3893 (frvA)," "ECK3893," and "frvA" are all used interchangeably and have the same meaning, and refer to a gene encoding the PTS system fructose-like EIIA component of Escherichia coli, and are synonymous with yiiK, JW3871, b3900, etc., and correspond to P32155 in UniProtKB (Swiss-Prot).

[0133] As used herein, "ECK4014 (yjbC)," "ECK4014," and "yjbC" are all used interchangeably and have the same meaning, and refer to a gene encoding the Escherichia coli dual-specificity RNA pseudouridine synthase RluF, which belongs to the mitochondrial RNA pseudouridine synthases and is synonymous with yjbC, JW3982, b4022, etc., and corresponds to P32684 in UniProtKB (Swiss-Prot).

[0134] As used herein, "ECK4017(pgi)", "ECK4017" and "pgi" are all used interchangeably and have the same meaning, and refer to a gene encoding glucose-6-phosphate isomerase of Escherichia coli, which is synonymous with JW3985, b4025 and the like, and corresponds to P0A6T1 in UniProtKB (Swiss-Prot).

[0135] As used herein, "ECK4034 (dgkA)", "ECK4034" and "dgkA" are all used interchangeably and have the same meaning, and refer to a gene encoding diacylglycerol kinase in Escherichia coli, which is synonymous with dgk, JW4002, b4042 and the like, and corresponds to P0ABN1 in UniProtKB (Swiss-Prot).

[0136] As used herein, "ECK4112 (melA)," "ECK4112," and "melA" are all used interchangeably and have the same meaning, and refer to a gene encoding Escherichia coli α-galactosidase (Alpha-galactosidase), which belongs to the 6-phospho-beta-glucosidase-related family and is synonymous with mel-7, JW4080, b4119, etc., and corresponds to P06720 in UniProtKB (Swiss-Prot).

[0137] As used herein, "ECK4207(ytfG)", "ECK4207", and "ytfG" are all used interchangeably and have the same meaning, and refer to a gene encoding Escherichia coli quinone oxidoreductase 2, which is synonymous with qorB, qor2, JW4169, b4211, etc., and corresponds to P39315 in UniProtKB (Swiss-Prot).

[0138] As used herein, "ECK4233 (nrdD)," "ECK4233," and "nrdD" are all used interchangeably and have the same meaning, and refer to a gene encoding an anaerobic ribonucleoside-triphosphate reductase of Escherichia coli, which is synonymous with JW4197, b4238, and the like, and corresponds to P28903 in UniProtKB (Swiss-Prot).

[0139] In this specification, "or" is used when "at least one or more" of the items listed in the sentence can be employed. The same applies to "alternative." In this specification, when it is specified that "within a range of two values," the range includes the two values ​​themselves.

[0140] For the understanding of the various terms used in this specification, including those mentioned above, where appropriate, all references cited in this specification, including scientific literature, patents, patent applications, and the like, are incorporated by reference in their entirety to the same extent as if each were specifically set forth.

[0141] (Preferred Embodiments) Preferred embodiments of the present disclosure will be described below. The embodiments provided below are provided for a better understanding of the present disclosure, and it is understood that the scope of the present disclosure should not be limited to the following description. Therefore, it is clear that those skilled in the art can make appropriate modifications within the scope of the present disclosure in light of the description herein. It is also understood that the following embodiments of the present disclosure can be used alone or in combination.

[0142] (E. coli for Producing an RNA Producing Plasmid) In one aspect, the present disclosure provides E. coli in which one or more RNA producing plasmid improvement-related (RPPI) genes have been disrupted.

[0143] In another aspect, the present disclosure provides a composition for producing a plasmid for RNA production, that is, the composition for producing a plasmid for RNA production includes E. coli in which one or more RNA producing plasmid improvement-related (RPPI) genes have been disrupted.

[0144] In another aspect, the present disclosure provides use of E. coli in which one or more RNA producing plasmid improvement-related (RPPI) genes have been disrupted, for producing a plasmid for RNA production.

[0145] In another aspect, the present disclosure provides a method for producing a plasmid for RNA production, comprising the step of culturing Escherichia coli in which one or more RNA producing plasmid improvement-related (RPPI) genes have been disrupted. For example, when the Escherichia coli of the present disclosure is used, this method can comprise the steps of introducing a vector into the Escherichia coli and culturing the Escherichia coli.

[0146] Hereinafter, embodiments applicable to each of these aspects will be described.

[0147] An RNA producing plasmid improvement-related (RPPI) gene is a gene that, when disrupted or deleted, improves the plasmid DNA that serves as a template for mRNA production for use in mRNA production, enabling the production of high-yield, high-quality mRNA. While not intended to be limiting, RPPI genes have the properties of being genes involved in any of the following in E. coli: (A) sugar metabolism, (B) amino acid metabolism, (C) replication, (D) homologous recombination, (E) nucleic acid biosynthesis, (F) nucleic acid modification, (G) transporter membrane transport, etc. Energy production, nucleic acid metabolism, or membrane structure. When mRNA is synthesized from template plasmid DNA produced in E. coli in which this gene has been disrupted, the amount of mRNA synthesized and / or the length of the mRNA poly(A) tail is increased.

[0148] When E. coli with a disrupted RPPI gene produces plasmid DNA that serves as a template for mRNA production, the template plasmid DNA has the property of producing high-yield, high-quality mRNA. Not only is the mRNA yield high, but the transcribed mRNA also contains a long poly(A) residue, resulting in fewer deletions. Long poly(A) residues are known to enhance mRNA stability and translation efficiency, contributing to its effectiveness as an mRNA drug. Furthermore, improvements in the manufacturing process can be combined with any of the mRNA design, transcription reaction, and purification processes previously considered for increasing mRNA yield and quality, providing beneficial effects and functions when producing mRNA that can be applied to a variety of technologies.

[0149] E. coli in which the RPPI gene has been disrupted is provided by disrupting one or more of the genes identified in this disclosure using the genetic modification techniques described herein or known in the art. Such E. coli may be produced or prepared before use using the following techniques, or prepared E. coli may be obtained from another source.

[0150] E. coli in which the RPPI gene is disrupted can be prepared as follows.

[0151] As an illustrative example, a commonly available E. coli strain can be obtained and the translation region of the RPPI gene to be disrupted can be replaced with a kanamycin resistance gene or a chloramphenicol resistance gene to create E. coli in which the RPPI gene has been disrupted.

[0152] In addition to the above methods, the RPPI gene may be disrupted by any method, such as removing a portion of the translation region, adding a portion to change the function of the protein, or modifying or substituting a portion of the nucleic acid. Disruption outside the translation region encoding the protein, for example, expression control or silencing by modifying the promoter portion of the gene, may also be used. References such as Hirotada Mori, Masakazu Kataoka, Xi Yang, Microorganisms. 2022, 10, 1835; Yamada Masami, Environ. Mutagen Res., 2003, 25, 87-92 can be referenced.

[0153] The RPPI gene can be provided as follows.

[0154] For example, if a common Escherichia coli strain such as K-12 or a substrain thereof is obtained, the RPPI gene is contained therein.

[0155] E. coli in which the RPPI gene has been disrupted can be used as follows: For example, a plasmid containing template DNA encoding a target mRNA is amplified in E. coli in which the RPPI gene has been disrupted, and the amplified plasmid is then extracted, linearized, and transcribed and synthesized into mRNA by in vitro transcription (IVT), thereby obtaining pharmaceutical mRNA in high yield and high quality.

[0156] In one embodiment, the E. coli of the present disclosure is JM109 strain, DH5α strain, BL21 strain, SCS1 strain, XL1-blue strain, HB101 strain, or a derivative thereof. However, the E. coli of the present disclosure is not limited to these, and any E. coli strain generally used for production can be used. For example, any of the strains and derivatives shown in Biotechnol. J. 2012, 7, 251-261 Figure 2 can be used.

[0157] In one embodiment, the E. coli includes an RPPI gene disrupted in one or more genes selected from the group consisting of cynS (ECK0337); xseB (ECK0416); ybaZ (ECK0448); ybbJ (ECK0482); ybbY (ECK0506); fur (ECK0671); ybiO (ECK0797); moeB (ECK0816); macB (ECK0870); aroA (ECK0899); yccZ (ECK0974); ycdQ (ECK1012); ycfX (ECK1105); ycgV (ECK1190); trpA (ECK1254); ydaE (ECK1349); feaB (ECK1382); gadB (ECK1487); ydeW (ECK1505); ydeI (ECK1529); and ECK1548. ydfQ; ECK1597 pntB; ECK1648 rnt; ECK1680 sufA; ECK1690 ydiB; ECK1701 ydiA; ECK1729 cedA; ECK1743 astB; ECK1752 ynjB; ECK1770 ydjH; ECK1788 yeaM; ECK1834 yebU; ECK1844 yobB; ECK1880 flhA; ECK1929 yedF; ECK1949 rcsA; ECK1966 yedX; ECK2010 yeeZ; ECK2023 ugd; ECK2041 wcaJ; ECK2104 yehD; ECK2123 yehY;ECK2193 ccmA; ECK2196 napH; ECK2267 yfbN; ECK2273 nuoK; ECK2274 nuoJ; ECK2295 yfcF; ECK2312 truA; ECK2392 yfeC; ECK2404 yfeH; ECK2628 yfjP; ECK2660 yqaE; ECK2674 ygaX; ECK2706 norW; ECK2709 ascG; ECK2729 pphB; ECK2754 ygcK; ECK2767 ygcU; ECK2869 hyuA; ECK2897 ygfF; ECK2952 ansB; ECK2959 nupG; ECK3003 yqhD;ECK3085 exuR; ECK3133 yraK; ECK3137 yraO; ECK3138 yraP; ECK3139 yraQ; ECK3141 yhbO; ECK3319 gspK; ECK3331 yheM;ECK3346 ybeH;ECK3367 yhfW;ECK3513 dctA;ECK3526 yhjV;ECK3539 yiaD;ECK3564 yiaK;ECK3606 tdh;ECK3683 dgoT;ECK3733 gidB;ECK3836 fre;ECK3868 ompL;ECK3893 frvA;ECK4014 yjbC;ECK4017 pgi;ECK4034 dgkA;ECK4112 melA;ECK4207 ytfG;ECK4233;

[0158] Of the above-mentioned E. coli gene-disrupted strains, the following 48 strains had mRNA synthesis evaluation values ​​1.2 times or more compared to the parent strain JM109. As mentioned above, strains with an mRNA synthesis evaluation score of more than 1 are considered more useful for production than existing strains and their derivatives. However, the following 48 strains are more preferable: cynS (ECK0337); ybbY (ECK0506); fur (ECK0671); ybiO (ECK0797); moeB (ECK0816); macB (ECK0870); ycfX (ECK1105); trpA (ECK1254); ydaE (ECK1349); feaB (ECK1382); ydeW (ECK1505); pntB (ECK1597); sufA (ECK1680); ydiA (ECK1701); cedA (ECK1729); astB (ECK1743); ydjH (ECK1770); yebU (ECK1834); flhA (ECK1880); and sufA (ECK1680). yedF; ECK1949 rcsA; ECK2023 ugd; ECK2041 wcaJ; ECK2104 yehD; ECK2123 yehY; ECK2193 ccmA; ECK2273 nuoK; ECK2274 nuoJ; ECK2404 yfeH; ECK2628 yfjP; ECK2674 ygaX; ECK2729 pphB; ECK3085 exuR; ECK3133 yraK; ECK3138 yraP; ECK3141 yhbO; ECK3319 gspK; ECK3526 yhjV; ECK3564 yiaK; ECK3606 tdh;ECK3733 gidB;ECK3868 A disruptant strain of a gene selected from the group consisting of ompL; ECK3893 frvA; ECK4014 yjbC; ECK4034 dgkA; ECK4112 melA; ECK4207 ytfG; and ECK4233 nrdD.

[0159] More preferably, the strain has high reproducibility and stability in production, and examples thereof include the following 14 strains: strains in which a gene selected from the group consisting of feaB (ECK1382); pntB (ECK1597); astB (ECK1743); ydjH (ECK1770); yedF (ECK1929); rcsA (ECK1949); ugd (ECK2023); nuoK (ECK2273); nuoJ (ECK2274); yhbO (ECK3141); yiaD (ECK3539); yiaK (ECK3564); gidB (ECK3733); and fre (ECK3836).

[0160] Even more preferred are strains with higher productivity and / or less deletion of polyA tails, such as the following seven strains: strains in which a gene selected from the group consisting of feaB (ECK1382); pntB (ECK1597); rcsA (ECK1949); ugd (ECK2023); nuoK (ECK2273); yhbO (ECK3141); and yiaK (ECK3564).

[0161] Most preferred are disruptant strains of ECK1949 rcsA; ECK2023 ugd; and ECK2273 nuoK.

[0162] In the E. coli of the present disclosure, the number of genes to be disrupted is not limited, and any number of genes may be disrupted as long as they are one or more types. For example, in one embodiment, one type of gene of the present disclosure is disrupted in the E. coli of the present disclosure. In yet another embodiment, two or three types of genes of the present disclosure are disrupted. Examples of such disruption include, but are not limited to, the disruption of two or more genes thought to have different functions. Other examples include gene disruption known to have other effects, such as a combination with a mutation known to increase plasmid yield.

[0163] (Plasmid for RNA Production) In another aspect, the present disclosure provides a plasmid for RNA production produced using the E. coli or composition, etc., of the present disclosure.

[0164] The structural features of the plasmid of the present disclosure include, but are not limited to, the following: the plasmid is composed of a plasmid replication origin, a drug resistance gene, an RNA polymerase recognition sequence, a 5'UTR, a translation region, a 3'UTR, a polyA sequence, and a restriction enzyme recognition sequence for linearization, and has a circular and supercoiled structure. The plasmid is sequence-specifically methylated by a methylation enzyme contained in E. coli.

[0165] The method for producing the plasmid of the present disclosure includes, but is not limited to, the following: E. coli transformed with the plasmid is cultured in a liquid medium. The cultured cells are recovered from the culture medium, and the plasmid is extracted from the cells by a method such as the alkaline-SDS method. The extracted plasmid is used as a template plasmid for mRNA synthesis after complete removal of E. coli-derived substances by a method such as hydrophobic chromatography or cesium chloride density gradient centrifugation.

[0166] The plasmids of the present disclosure can be used in methods for producing RNA, particularly mRNA. Such plasmids can be sold as kits for pharmaceutical production together with other in vitro transcription (IVT) reaction reagents (e.g., commercially available products include, but are not limited to, the T7 RiboMAX Express Large Scale RNA Production System (Promega), the CUGA7 in vitro Transcription Kit (Nippon Gene), the Takara IVTpro mRNA Synthesis System (Takara), and the ScriptMAX Thermo T7 Transcription Kit (Toyobo)). Alternatively, the plasmids can be incorporated into RNA production devices. The structure of such an RNA manufacturing device is exemplified as follows: The illustrated RNA manufacturing device has heating and cooling functions to maintain a constant temperature, and a stirring function to homogenize the solution inside the device. It has a sealed structure to prevent functional deterioration due to decomposition of the template plasmid, IVT reaction reagents, and newly synthesized RNA inside the device.

[0167] The plasmids produced by the methods of the present disclosure have the following characteristic: polyA deletion for mRNA production is 50% or less, for example, polyA deletion can be about 10% or less, about 20% or less, about 30% or less, about 40% or less, about 50% or less, about 60% or less, about 70% or less, about 80% or less, about 90% or less, etc. Alternatively, compositions for mRNA production are provided in which the plasmids have a polyA deletion of about 50% or less, for example, polyA deletion can be about 10% or less, about 20% or less, about 30% or less, about 40% or less, about 50% or less, about 60% or less, about 70% or less, about 80% or less, about 90% or less, etc. These compositions or plasmids can be produced using the techniques (such as E. coli or compositions) of the present disclosure.

[0168] Although the method for producing template plasmids for RNA production using the E. coli or compositions disclosed herein is no different from conventional methods, the topologies of the plasmids prepared from the RPPI gene-disrupted strain by a simple method (miniprep) or a purification method (cesium chloride density gradient centrifugation) have been demonstrated to have higher contents of DNA that appear to be dimers and / or supercoils compared to the parent strain (Figure 3). Such a topology is advantageous in that it results in high mRNA transcription efficiency. Plasmids exhibiting this topology are characterized by a degree of dimerization of about 20% or more; for example, the dimerization may be about 20% or more, about 30% or more, about 40% or more, or about 50% or more.

[0169] Furthermore, focusing on the poly A sequence of the plasmid, it has been demonstrated in the Examples that the rate of poly A sequence deletion is low compared to the parent strain (Figure 4). A low rate of deletion of the poly A sequence of the plasmid is advantageous in terms of mRNA stability and quality standards for pharmaceuticals.

[0170] In IVT mRNA synthesis, plasmids with these properties directly contribute to the translation synthesis of high-quality RNA with a high yield and long poly(A) chains, making these plasmids useful for RNA production.

[0171] Furthermore, the difference in the topology of the plasmid also contributes to the usefulness of the present E. coli, plasmid, and composition as a method for producing RNA.

[0172] In one embodiment, the pDNA of the present disclosure has untranslated regions (UTRs) on both sides of the coding region of the mRNA. Any UTRs may be used, but the 5'UTR may be any of those encoding GAPDH, HSD17B4, PSMB3, RPL31, RPL32, RPL35, RPL21, Albumin7, LDHB, ACAT2, ATP5A1, Ndufa4, Mp68, NOSIP, SLC7A3, TUBB4B, UBQLN2, mRPL35A, mRPL21, AIG1, COX6C, α-globin, β-globin, RPS8, TOP, MCP-1, RPL12s.c., Ang-2, HSP70, H3.3. , Galectin-9, GADD34, EDN1, HSP70m5, E-selectin, ICAM-1, IL-6, or vWF UTRs. Other examples of UTRs are disclosed in JP-A-2021-501572, JP-A-2015-517803, and JP-A-2022-164843. The 3' UTR may be selected from GAPDH, Albumin, LDHB, ACAT2, α-globin, β-globin, PSMB3, CASP1, COX6B1, GNAS, NDUFA1, and RPS9, histone stem loops, or natural or artificial sequences complementary to the 5' UTR.

[0173] In one embodiment, a pDNA of the present disclosure is a nucleic acid construct comprising a 5' untranslated region (UTR) and a 3' UTR that are at least partially complementary to each other, wherein at least one UTR comprises non-complementary and complementary portions to the other UTR, and the non-complementary and complementary portions may alternate.

[0174] For such a partially complementary sequence, the complementarity is preferably 40% or more and 90% or less (for example, but not limited to, 40%, 50%, 60%, 70%, 80%, 90% or values ​​in between), and more preferably 75% or more. In particular, from the viewpoint of enhancing mRNA productivity, those in which the non-complementary portions are all 1-base substitutions and the complementary portions are each independently 3 to 7 bases long (for example, 3, 4, 5, 6, or 7 bases); those in which the non-complementary portions are 2-base substitutions and the complementary portions are each independently 5 to 7 bases long (for example, 5, 6, or 7 bases); those in which the non-complementary portions are 2-base removals and the complementary portions are each independently 5 to 11 bases long (for example, 5, 6, 7, 8, 9, 10, or 11 bases); those in which the non-complementary portions are 3-base substitutions and the complementary portions are each independently 8 to 9 bases long (for example, 8 or 9 bases); and those in which the non-complementary portions are 3-base removals and the complementary portions are each independently 8 to 11 bases long (for example, 8, 9, 10, or 11 bases).

[0175] A polyA tail can be selected for the 3' end of the 3'UTR, which functions to improve mRNA stability and translation efficiency.

[0176] In one embodiment, the pDNA of the present disclosure has a polyA sequence. In a preferred embodiment, the length of the polyA sequence is about 20 to about 600 nucleotides, preferably about 120 to about 200 nucleotides, with the lower limit being about 20 bp, about 30 bp, about 40 bp, about 50 bp, about 60 bp, about 70 bp, about 80 bp, about 90 bp, about 100 bp, about 110 bp, about 120 bp, about 130 bp, about 140 bp, about 150 bp, etc., and the upper limit being about 600 bp, about 550 bp, about 500 bp, about 450 bp, about 400 bp, about 350 bp, about 300 bp, about 250 bp, about 200 bp, etc.

[0177] It is well known in the art that longer polyA tails are better for mRNA quality, particularly stability; however, stable addition of long polyA tails presents technical challenges. Prior art (US 2018 / 0272007 A1) on mRNA synthesis with long polyA tails has reported the creation of long polyA tails using cosmid vectors, but deletion of polyA tails is considered significant in conventional plasmid vectors. In contrast, deletion of polyA tails is reduced in RPPI gene-deficient strains, making plasmid vectors constructed using RPPI gene-deficient strains or compositions unprecedentedly superior for use as template DNA for mRNA production. In the exemplary E. coli strains disclosed herein (see Examples), when a plasmid with a 200-base-long polyA tail is maintained and cultured at the normal temperature of 37°C, approximately 50% of the plasmids lose the polyA tail. The present disclosure exemplifies that the deletion of polyA sequences is suppressed by up to 20% using the same plasmid and culture conditions, and it is understood that similar effects are also exhibited in other strains.

[0178] Although the design of the RNA production plasmid can be conventional, culturing a template plasmid with a sequence designed so that the 5' and 3' UTRs are partially complementary in an RPPI gene-disrupted strain will further enhance mRNA production, making it more useful. A sequence with partial complementarity preferably has a complementarity rate of 40% to 90% (e.g., but not limited to, 40%, 50%, 60%, 70%, 80%, 90%, or values ​​in between), and more preferably 75% or higher. In particular, from the viewpoint of enhancing mRNA productivity, those in which the non-complementary portions are all 1-base substitutions and the complementary portions are each independently 3 to 7 bases long (for example, 3, 4, 5, 6, or 7 bases, or any range therebetween); those in which the non-complementary portions are 2-base substitutions and the complementary portions are each independently 5 to 7 bases long (for example, 5, 6, or 7 bases); those in which the non-complementary portions are 2-base removals and the complementary portions are each independently 5 to 11 bases long (for example, 5, 6, 7, 8, 9, 10, or 11 bases); those in which the non-complementary portions are 3-base substitutions and the complementary portions are each independently 8 to 9 bases long (for example, 8 or 9 bases); and those in which the non-complementary portions are 3-base removals and the complementary portions are each independently 8 to 11 bases long (for example, 8, 9, 10, or 11 bases).

[0179] (Method for Producing RNA) In another aspect, the present disclosure provides a method for producing RNA using the plasmid of the present disclosure. That is, mRNA is transcribed and synthesized based on the plasmid obtained in the present disclosure. The method for transcription and synthesis may be any method commonly known in the art. (For example, E T Schenborn and R C Mierendorf, Jr., Nucleic Acids Res. 1985, 13, 6223-6236.; D A Melton, P A Krieg, M R Rebagliati, T Maniatis, K Zinn, M R Green, Nucleic Acids Res. 1984, 12, 7035-56; J F Milligan 1, D R Groebe, G W Witherell, O C Uhlenbeck, Nucleic Acids Res. 1987, 15. 8783-98. ).

[0180] The strains, compositions, and plasmids disclosed herein can be used to produce any type of RNA. However, in this disclosure, the usefulness of RPPI gene disruption was evaluated by the binding of thioflavin T to RNA. Thioflavin T selectively binds to the poly(A) moiety of RNA (Nucleic Acids Res. 2015, 43(14), e92), and is therefore particularly useful for producing RNA with a poly(A) tail, such as mRNA.

[0181] In yet another aspect, the present disclosure provides plasmids characterized by reduced polyA depletion for mRNA production, the extent of which is described elsewhere herein.

[0182] As described elsewhere in this specification, the plasmids of the present disclosure can be used to produce all types of RNA. For example, non-coding RNAs with polyA are known, and the technology is useful for their production. While the functions of non-coding RNAs remain largely unknown, some have been reported to be associated with disease. They can be applied to RNA medicines. Strains that can achieve increased RNA synthesis yields are also useful for non-coding RNAs without polyA. Furthermore, the present disclosure is particularly useful for the production of mRNA. With some exceptions (such as histone mRNA), mRNAs have a polyA tail at their 3' end. This is because the present invention can suppress the loss of polyA sequences within the plasmid, resulting in longer polyA sequences in the produced mRNA, making it an advantageous method for producing mRNA formulations. The technology of the present disclosure is also useful for synthesizing polyA-containing RNAs. For example, non-coding RNAs with polyA are known, and the present disclosure is also useful in this case.

[0183] (RNA) In one aspect, the present disclosure provides RNA produced using a plasmid described herein or by a method described herein. While not intending to be limited thereto, a composition containing the produced RNA has the following characteristics: 1) a low rate of contamination with mRNA lacking polyA; 2) an increased yield of RNA synthesis can reduce the relative amount of impurities, thereby simplifying subsequent purification steps.

[0184] (General Production Method) The present disclosure can be used in the production of E. coli and, in some cases, screening (quality standards). The gene-deleted E. coli strains used in the present disclosure can be prepared, for example, by substituting the translation region of the relevant gene with a kanamycin resistance gene or a chloramphenicol resistance gene. For example, the prepared E. coli can be cultured in a drug-supplemented medium and converted into competent cells by standard methods. For example, the competent cells can be transformed by standard methods with a plasmid containing a designed and constructed template DNA for mRNA production. For example, the transformed E. coli can be cultured, and the plasmid can be recovered from the E. coli by methods such as lysis and disruption. The plasmid is purified and linearized, and used as template DNA to transcribe and synthesize mRNA by IVT.

[0185] (General Method of Use) The mRNA provided by the plasmid and production method of the present disclosure is used as an active ingredient in mRNA pharmaceuticals, particularly pharmaceuticals such as infectious disease vaccines, cancer vaccines, and replacement protein therapy.

[0186] The E. coli of the present disclosure can be used, for example, in the production of mRNA pharmaceuticals. Using a method similar to that described in Example 1, "Preparation, Cultivation, and Transformation of an E. coli Gene-Disrupted Strain," E. coli with the RPPI gene disrupted as described in this patent is cultured to produce competent cells, which are then transformed with a separately designed and prepared plasmid for mRNA pharmaceutical production. The resulting transformed strain is used as an industrial production strain, and seed culture and production culture are carried out in a culture size appropriate for the purpose. The cells are then harvested and lysed, and the plasmid is recovered and purified. After linearization by enzymatic treatment, RNA is produced by in vitro transcription using T7 RNA polymerase or other methods. This is purified, subjected to the necessary specification analysis, and can be used as a drug substance for mRNA pharmaceuticals.

[0187] The present disclosure has been described above by showing preferred embodiments for ease of understanding. The present disclosure will be described below based on examples. However, the above description and the following examples are provided for illustrative purposes only and are not intended to limit the present disclosure. Therefore, the scope of the present disclosure is not limited to the embodiments or examples specifically described herein, but is limited only by the scope of the claims.

[0188] In the examples, the abbreviations shown above and below may be used for ease of description.

[0189] (Example 1 Preparation of an Escherichia coli gene disruptant strain for creating template plasmid DNA suitable for mRNA production) (Preparation of a plasmid for evaluating mRNA synthesis amount) A plasmid (pT7_TLpA_5Pf_E2Crimson_3Pf_pA200) consisting of a T7 promoter sequence, a Kozak sequence, a fluorescent protein E2Crimson translation region, a stop codon, and a 201-base-long poly A consecutive sequence was prepared by inserting a 54-base-long poly A consecutive sequence twice into the BsmBI site of pT7_TLpA_5Pf_E2Crimson_3Pf_pA100 (cited in Japanese Patent Application No. 2023-13390 by the same applicant, and all of the descriptions therein are incorporated by reference in the present disclosure).

[0190]

[0191] The poly(A) stretch was inserted using the GoldenGate method described below. A plasmid (pBR-pA50-BsaI) containing a 54-base-long poly(A) stretch was constructed by annealing the partially complementary synthetic oligonucleotides shown in SEQ ID NOS: 1 and 2, converting the single-stranded portions to double strands using a polymerase extension reaction from 5' to 3' using KOD-Plus-Ver. 2 (Toyobo), and inserting the resulting product into the XcmI site of the pBR322_ΔtypeIIS plasmid. A 54-base poly(A) stretch was inserted into pT7_TLpA_5Pf_E2Crimson_3Pf_pA100 by 80 cycles of incubation at 37°C for 1 minute and 16°C for 1 minute using 1 ng / μg BsmBI-treated pT7_TLpA_5Pf_E2Crimson_3Pf_pA100, 1 ng / μg pBR-pA50-BsaI, 1x T4 DNA ligase buffer, 23 U / μl T4 DNA ligase (Takara Bio), and 0.67 U / μl BsaI-HF-v2 (New England Biolab). This procedure was repeated twice to generate pT7_TLpA_5Pf_E2Crimson_3Pf_pA200.

[0192] (SEQ ID NO: 1) ATGGGTCTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACGAGACCATAGAGGTCTTTCTTCCAACCAGTA (SEQ ID NO: 2) TACTGGTTGGAAGAAAGACCTCTAT

[0193] (Preparation, cultivation, and transformation of E. coli gene-deficient strains) In the E. coli JM109 strain, the genes shown below were replaced with kanamycin resistance genes or chloramphenicol resistance genes as described in Baba et al., Mol Syst Biol. 2006;2:2006.0008., to prepare gene-disrupted strains.

[0194] <h2 style=";text-align:left;direction:ltr">ECK0337 cynS ECK0416 ECK1105 ycfX ECK1190 ycgV ECK1254 trpA ECK1349 ydaE ECK1382 feaB ECK1487 gadB ECK1505 ydeW ECK1529 ydeI ECK1548 ydfQ ECK1597 pntB ECK1648 rnt ECK1680 sufA ECK1690 ydiB ECK1701 ydiA ECK1729 cedA ECK1743 astB ECK1752 ynjB ECK1770 ydjH ECK1788 yeaM ECK1834 yebU ECK1844 yobB ECK1880 flhA ECK1929 yedF ECK1949 rcsA ECK1966 yedX ECK2010 yeeZ ECK2023 ugd ECK2041 wcaJ ECK2104 yehD ECK2123 yehY ECK2193 ccmA ECK2196 napH ECK2267 yfbN ECK2273 nuoK ECK2274 nuoJ ECK2295 yfcF ECK2312 truA ECK2392 yfeC ECK2404 yfeH ECK2628 yfjP ECK2660 yqaE ECK2674 ygaX ECK2706 norW ECK2709 ascG ECK2729 pphB ECK2754 ygcK ECK2767 ygcU ECK2869 hyuA ECK2897 ygfF ECK2952 ansB ECK2959 nupG ECK3003 yqhD ECK3085 exuR ECK3133 yraK ECK3137 yraO ECK3138 yraP ECK3139 yraQ ECK3141 yhbO ECK3319 gspK ECK3331 yheM ECK3346 ybeH ECK3367 yhfW ECK3513 dctA ECK3526 yhjV ECK3539 yiaDECK3564 yiaK ECK3606 tdh ECK3683 dgoT ECK3733 gidB ECK3836 fre ECK3868 ompL ECK3893 frvA ECK4014 yjbC ECK4017 pgi ECK4034 dgkA ECK4112 melA ECK4207 ytfG ECK4233 nrdD

[0195] These E. coli strains were cultured in 300 μl of SOB medium containing 25 μg / ml kanamycin or 12.5 μg / ml chloramphenicol at 37°C for 15 hours at 220 rpm using a medium-sized thermostatic shaker BR-53FP (Taitec). 300 μl of SOB medium was mixed with 10 μl of the aforementioned culture solution, and the mixture was cultured at 37°C for an additional 3.5 hours with shaking, followed by standing on ice for 30 minutes. After culturing, the E. coli were recovered by centrifugation (5,000 × g, 4°C, 5 minutes), and competent cells were prepared according to the instructions for the Mix & Go E. coli Transformation Buffer Set (Zymo Research). Twelve μl of these competent cells was mixed with 20 ng of pT7_TLpA_5Pf_E2Crimson_3Pf_pA200 (SEQ ID NO: 3), and the mixture was left to stand on ice for 30 minutes to 3 hours. After this, 150 μl of SOC medium was added, and the mixture was cultured at 37°C for 1 hour at 220 rpm in a medium-sized thermostatic shaker BR-53FP. Then, 150 μl of LB liquid medium containing 20 μg / ml carbenicillin (Nacalai) was added, and the mixture was cultured at 37°C for an additional 23 hours at 220 rpm. The cultured E. coli was recovered by centrifugation (5,000 × g, 1 minute).

[0196]

[0197] (Example 2: Production of plasmid for mRNA production) (Preparation of template plasmid for mRNA synthesis) When preparing plasmids from a small number of strains, plasmids were prepared (miniprep plasmids) using a QIAprep Spin Miniprep Kit and a QIAcube nucleic acid extraction and purification system (Qiagen) according to the manufacturer's instructions.

[0198] Plasmids were prepared from multiple strains using a 96-well DNA binding unifilter (Cytiva) as follows. The recovered E. coli cells were vortexed for 1 minute in 100 μl of Buffer P1 (Qiagen) containing 10 μg / ml ribonuclease A (Nacalai), followed by the addition of 100 μl of Buffer P2 (Qiagen) for complete lysis. To this lysate, 140 μl of Buffer P3 (Qiagen) was added and gently vortexed for 10 seconds. Then, 20 μl of chloroform (Nacalai) was added and vortexed for 10 seconds. The resulting aggregates were removed by centrifugation (5,000 rpm, 5 minutes) to obtain a plasmid extract. The extract was then added to a 96-well DNA binding unifilter and further centrifuged (3,000 rpm, 5 minutes) to adsorb the plasmids to the filter. The filter was washed twice with 250 μl of Buffer PB (Qiagen) and twice with 250 μl of Buffer PE (Qiagen), and then the plasmid was eluted with 20 μl of TE buffer (Nacalai). The washing and elution procedures were carried out by centrifugation (3,000 rpm, 5 minutes).

[0199] High-purity plasmids were prepared using the cesium chloride density gradient centrifugation method described below. Bacterial cells contained in 100 ml of E. coli culture were collected by centrifugation (5,000 × g, 10 minutes). The collected cells were suspended in 10 ml of Buffer P1 containing 5 mg / ml lysozyme and 0.1 mg / ml ribonuclease A and incubated at room temperature for 5 minutes. Buffer P2 was added in 10 ml increments, mixed slowly, and then incubated at room temperature for 5 minutes. Buffer P3 was then added in 10 ml increments, mixed, and centrifuged (8,000 × g, 20 minutes) to collect the supernatant. 10 ml of TE-saturated phenol (Nacalai) was added to the collected supernatant, mixed vigorously, and centrifuged (8,000 × g, 10 minutes) to separate the phenol layer and aqueous layer. The aqueous layer was mixed with 20 ml of 100% ethanol and centrifuged (8,000 × g, 10 minutes) to obtain a precipitate. The resulting precipitate was dissolved in 5.4 ml of TE buffer, and then 6.45 g of cesium chloride, 2.7 ml of a mixture of 1.1 g of cesium chloride and 1 ml of water, and 600 μl of a 10 mg / ml ethidium bromide solution were added and mixed thoroughly. This mixture was centrifuged at 50,000 rpm and 18°C ​​for more than 15 hours in an Optima XE floor-type ultracentrifuge (Beckman Coulter), and the band of supercoiled circular plasmid was recovered under ultraviolet light (365 nm). The recovered solution was mixed thoroughly with 1 ml of 1-butanol and centrifuged (8,000 × g, 10 minutes) to separate the 1-butanol and aqueous phases. The separated 1-butanol phase was then removed. This series of steps was repeated 5–10 times to remove ethidium bromide. 200 μl of Buffer P3 was added to this solution, followed by distilled water to a total volume of 3 ml. 9 ml of 100% ethanol was added and mixed, followed by centrifugation (8,000 × g, 10 minutes) to obtain a precipitate. The resulting precipitate was dissolved in 700 μl of TE buffer. The butanol extraction was repeated three times, followed by the addition of 50 μl of Buffer P3 and 900 μl of 100% ethanol, followed by mixing, followed by centrifugation (15,000 rpm, 10 minutes) to obtain a precipitate. The resulting precipitate was dissolved in 40 μl of TE buffer.

[0200] The prepared plasmid was quantified using Nano Drop One (Thermo Fisher) or Qubit DNA Broad Range Assay Kit (Thermo Fisher) according to the manufacturer's instructions.

[0201] (Example 3: RNA production according to the present disclosure) (In vitro transcription using T7 RNA polymerase) To terminate RNA synthesis by dissociating RNA polymerase from the template DNA and to generate a continuous A nucleotide sequence at the 3' end of the synthesized RNA, the template plasmid was linearized with the restriction enzyme BsmBI. After BsmBI treatment, TE-saturated phenol was added to the plasmid, which was thoroughly mixed and then centrifuged (20,000 × g, 10 minutes) to separate it into an organic phase and an aqueous phase, and the aqueous phase was recovered in a new tube. 1-butanol was added to the recovered aqueous phase, which was thoroughly mixed and then centrifuged (20,000 × g, 10 minutes) to separate it into a 1-butanol phase and an aqueous phase, and the separated 1-butanol phase was removed. This procedure was repeated three times to completely remove the phenol and reduce the volume of the aqueous phase. To this aqueous phase, 3M sodium acetate solution (pH 5.2) (Nacalai) and ethanol were added, mixed thoroughly, and then centrifuged (20,000 × g, 10 minutes) to precipitate the DNA fragments. The precipitated DNA fragments were washed with 70% ethanol and then dissolved in distilled water to obtain linear template DNA. In vitro transcription reactions were performed in a 384-well black microplate (Greiner) at 37°C for 3 hours using 50 ng of linearized template plasmid, 1x T7 RNA polymerase buffer (Takara Bio), 5 mM DTT, 0.2 mM CleanCap (TriLink), 0.05 mM GTP, 0.25 mM ATP, 0.25 mM CTP, and 0.25 mM N1-methyl pseudo-UTP (Yamasa Shoyu), 1 U / μL Recombinant RNase Inhibitor (Takara Bio), and 1.25 U / μL T7 RNA polymerase (Takara Bio). The reaction was stopped by adding EDTA to a final concentration of 3.3 mM.

[0202] (Calculation of mRNA synthesis evaluation value) The mRNA synthesis evaluation value was calculated by the method described below in Example 10. Specifically, to the reaction solution after the reaction was stopped, Thioflavin T (Fujifilm Wako Pure Chemical Industries, Ltd.) was added to a final concentration of 25 μM, and then the fluorescence intensity was measured at an excitation wavelength of 438 nm and a fluorescence wavelength of 491 nm using a plate reader Infinite 200 PRO (TECAN). The fluorescence measurement value for the JM109 strain was set to 1, and the fluorescence measurement value for the aforementioned E. coli strain was used as the mRNA synthesis evaluation value ( FIG. 1 ( FIG. 1-1 and FIG. 1-2 )).

[0203] In addition, mRNA synthesis evaluation values ​​were similarly measured for ECK3539 (yiaD) and ECK1487 (gadB), which are not shown in FIG.

[0204] Furthermore, when miniprep plasmids were prepared and evaluated for the following representative gene-disrupted strains prepared using the E. coli JM109 strain as a parent strain, a reproducible increase in the mRNA synthesis evaluation value was observed (Figure 2).

[0205] ECK1743 astB ECK1929 yedF ECK3836 fre ECK3141 yhbO ECK3733 gidB ECK1949 rcsA ECK1770 ydjH ECK3539 yiaD ECK3564 yiaK ECK1382 feaB ECK2023 ugd ECK1597 pntB ECK2273 nuoK ECK2274 nuoJ

[0206] (Example 4: Characterization) (Plasmid topology and poly(A) sequence analysis) Plasmids were analyzed by agarose gel electrophoresis prepared using UltraPure Agarose (Thermo Fisher) and 1×TAE buffer (Nacalai).

[0207] When analyzing circular plasmids, they were separated by electrophoresis using 1% agarose gel at a voltage of 135 V for 20 minutes.

[0208] For poly(A) sequence analysis, a 490-bp DNA fragment containing the poly(A) sequence was prepared by digestion with the restriction enzymes BsmBI (New England Biolab) and XhoI (New England Biolab). This DNA fragment was separated by electrophoresis on a 3% agarose gel at 135 V for 25 minutes. Furthermore, for calculating the percentage of poly(A) deletion, electrophoresis was performed using a 2100 Bioanalyzer Electrophoresis System and a DNA1000 Kit (Agilent Technologies) according to the manufacturer's instructions.

[0209] Seven strains were selected from 90 gene-disrupted strains generated using E. coli JM109 as the parent strain: ECK3141 yhbO, ECK1949 rcsA, ECK3564 yiaK, ECK1382 feaB, ECK2023 ugd, ECK1597 pntB, and ECK2273 nuoK. Plasmids prepared from these strains (miniprep plasmids (left panel) and plasmids prepared by cesium chloride density gradient centrifugation (right panel)) are shown in Figure 3. Three bands (A, B, and C) with different mobilities were detected, and the differences in their detection levels reflect differences in topology. Compared to the parent strain, an increased level of band C was observed relative to band A in the gene-disrupted strains described in this panel.

[0210] Furthermore, 7 strains were selected from 90 gene-disrupted strains generated using E. coli JM109 as a parent strain, and the DNA fragments (490 bp) containing the poly(A) sequence were analyzed by agarose electrophoresis (Fig. 4, left panel). The amounts of the plasmids containing the full-length poly(A) sequence and the deleted poly(A) sequence were quantified using a bioanalyzer (Fig. 4, middle panel). The results confirmed that the deletion of the poly(A) sequence was suppressed in multiple strains compared to the parent strain, JM109.

[0211] Example 5: Preparation of a two-gene disrupted strain In the Escherichia coli JM109 strain, the following two genes were replaced with a kanamycin resistance gene or a chloramphenicol resistance gene to prepare a two-gene disrupted strain.

[0212] ECK3141 yhbO and ECK1949 rcsA ECK3141 yhbO and ECK1382 feaB ECK3141 yhbO and ECK1597 pntB ECK1382 feaB and ECK1949 rcsA ECK1382 feaB and ECK1597 pntB ECK2273 nuoK and ECK1949 rcsA Increased mRNA synthesis scores were observed in these strains compared to the parent strain JM109.

[0213] (Example 6-1: Preparation of gene-disrupted strains using Escherichia coli DH5α strain as a parent strain, and production and evaluation of mRNA-producing plasmids) Gene-disrupted strains were prepared by replacing the following ECK3141 yhbO, ECK1949 rcsA, ECK3564 yiaK, ECK1382 feaB, ECK2023 ugd, and ECK2273 nuoK genes with kanamycin resistance genes for the Escherichia coli DH5α strain (Toyobo). The mRNA synthesis evaluation values ​​for these gene-disrupted strains were calculated using the method described in Example 10, and the results are shown in Figure 5. An increase in the mRNA synthesis evaluation value was observed in these gene-disrupted strains.

[0214] The results of examining differences in topology for the above gene disruption strains are shown in Figure 6. Three bands (A, B, and C) with different mobilities were detected, and the differences in their detected amounts reflect differences in topology. Compared to the parent strain, an increase in the detected amount of band C relative to band A was observed in the gene disruption strains described in this panel.

[0215] The DNA fragment (490 bp) containing the polyA sequence of the gene-disrupted strains was examined by agarose electrophoresis, and the results are shown in Figure 7. As a result, it was confirmed that the deletion of the polyA sequence was suppressed in multiple strains compared to the parent strain.

[0216] (Example 6.2: Preparation of gene-disrupted strains in other E. coli strains) The plasmids described in Example 5 are transformed into E. coli strains other than JM109 and DH5α, namely, the BL21, SCS1, XL1-blue, and HB101 strains. Specific procedures follow those in the above examples. These strains are available from Takara Bio and Agilent Technologies. (The BL21 strain is available from Takara Bio, New England Biolab, Nippon Gene, BioDynamics Institute, Agilent Technologies, Promega, etc. The SCS1 strain is available from Agilent Technologies. The XL1-blue strain is available from Agilent Technologies, Nippon Gene, Bio Elegen Technology, etc. The HB101 strain is available from Takara Bio, Promega, Nippon Gene, etc.) Plasmids are obtained from the resulting transformed strains, and by transcribing this into mRNA, it is confirmed that the strains have a high mRNA production ability, similar to the JM109 strain.

[0217] Example 7 Preparation of Cell Lines for Producing mRNA Pharmaceuticals Plasmids for producing mRNA pharmaceuticals are prepared in the same manner as in the plasmid for evaluating mRNA synthesis amount described in Example 1, except that, instead of the fluorescent protein E2Crimson, a gene translation region encoding a protein such as SARS-CoV-2 spike protein, HIV spike protein, HIV envelope glycoprotein, influenza HA protein, HSV-2 glycoprotein, ornithine transcarbamylase (OCT), CFTR, OX40 ligand, IL-2, IL-7, IL-12, IL-23, VEGF-A, GM-CSF, IFNalpha, chimeric antigen receptor (CAR), NY-ESO-1, PD-L1, WT-1, or MAGE-3, which is an antigen to be used as an mRNA pharmaceutical, is incorporated. In a similar manner to "Preparation, cultivation, and transformation of E. coli gene-deficient strains" described in Example 1, E. coli in which the RPPI genes described herein (ECK1949 (rcsA), ECK2023 (ugd), ECK2273 (nuoK)) have been disrupted is cultivated to prepare competent cells, which are then transformed with a plasmid for producing mRNA pharmaceuticals.

[0218] (Example 8: Preparation of a plasmid for producing mRNA pharmaceuticals) A plasmid for producing mRNA is prepared by carrying out seed culture and production culture in an appropriate culture size for a transformant derived from the RPPI gene-disrupted strain, collecting and lysing the cells, and recovering and purifying the plasmid.

[0219] (Example 9: Production of RNA for mRNA medicine) After linearizing the plasmid for mRNA medicine production by enzymatic treatment, RNA is produced by in vitro transcription using T7 RNA polymerase. This is purified and subjected to the necessary specification analysis to be used as the drug substance for mRNA medicine.

[0220] Example 10: Calculation of mRNA synthesis evaluation value Hereinafter, the calculation of mRNA synthesis evaluation value employed in the present specification including the examples will be described.

[0221] It has been reported that the fluorescent dye thioflavin T increases its fluorescence intensity upon binding to mRNA, with further increase observed in a continuous sequence of A, i.e., polyA (Sugimoto et al., Nucleic Acids Res. 2015 18;43(14):e92.). The mRNA synthesis evaluation value is an index that evaluates both the amount of mRNA synthesis and the length of the mRNA polyA chain using thioflavin. Typically, the fluorescence intensity generated by thioflavin T binding to mRNA transcribed and synthesized using as a template a plasmid prepared from a gene-disrupted strain transformed with a plasmid containing an open reading frame (ORF) encoding a specific protein mRNA can be measured, and the fluorescence intensity can be calculated as a relative value when the value for mRNA transcribed and synthesized from a standard E. coli-derived plasmid is set to 1.

[0222] Specifically, after the IVT reaction was stopped, Thioflavin T (Fujifilm Wako Pure Chemical Industries, Ltd.) was added to the reaction solution to a final concentration of 25 μM, and the fluorescence intensity was measured using an Infinite 200 PRO (TECAN) plate reader at an excitation wavelength of 438 nm and a fluorescence wavelength of 491 nm. The fluorescence measurement value of the IVT reaction solution derived from the E. coli strain to be evaluated, relative to the fluorescence measurement value of the IVT reaction solution derived from the JM109 strain as 1, was used as the mRNA synthesis evaluation value.

[0223] (Note) While the present disclosure has been illustrated using preferred embodiments thereof, it is understood that the scope of the present disclosure should be interpreted solely by the claims. It is understood that the patents, patent applications, and other documents cited in this specification are incorporated by reference into this specification in their entirety as if the contents themselves were specifically set forth herein. This application claims priority to Japanese Patent Application No. 2023-135083, filed with the Japan Patent Office on August 22, 2023, the contents of which are incorporated by reference in their entirety herein.

[0224] By using E. coli in which the RPPI gene has been artificially disrupted as a strain for producing template plasmid DNA, it is possible to produce high-yield, high-quality mRNA, making it useful in the biotechnology and pharmaceutical industries.

[0225] SEQ ID NO: 1: Synthetic oligonucleotide for producing pBR-pA50-BsaI SEQ ID NO: 2: Synthetic oligonucleotide for producing pBR-pA50-BsaI SEQ ID NO: 3: pT7_TLpA_5Pf_E2Crimson_3Pf_pA200 SEQ ID NO: 4: Pfizer 5'UTR sequence SEQ ID NO: 5: Pfizer 5'UTR sequence SEQ ID NO: 6: Primer Common-F SEQ ID NO: 7: Primer Common-R SEQ ID NO: 8: pT7_TLpA_5Pf_E2Crimson_3Pf_pA100 SEQ ID NO: 9: Pfizer 3'UTR sequence SEQ ID NO: 10: Pfizer 3'UTR sequence

Claims

1. E. coli in which one or more RNA producing plasmid improvement-related (RPPI) genes have been disrupted.

2. The Escherichia coli according to claim 1, wherein the RPPI gene is selected based on one or more factors selected from the group consisting of: (A) sugar metabolism, (B) amino acid metabolism, (C) replication, (D) homologous recombination, (E) nucleic acid biosynthesis, (F) nucleic acid modification, and (G) transporter membrane trafficking.

3. The Escherichia coli according to claim 1 or 2, wherein the RPPI gene increases an mRNA synthesis score when disrupted.

4. ECK0337 cynS, ECK0416 xseB, ECK0448 ybaZ, ECK0482 ybbJ, ECK0506 ybbY, ECK0482 ybbJ, ECK0506 ybbY, ECK06777 ybiO, ECK0816 moeB, ECK0870 macB, ECK0899 aroA, ECK0974 yccZ, ECK1012 ycdQ, ECK1105 ycfX, ECK1190 ycgV, ECK125 tr134 and ECKA ECK1382 feaB、 ECK1487 gadB、 ECK1505 ydeW、 ECK1529 ydeI、 ECK1548 ydfQ、 ECK1597 pntB、 ECK1648 rnt、 ECK1680 sufA、 ECK1680 ydi ECKB1701 ydiA、 ECK1729 cedA、 ECK1743 astB、 ECK1752 ynjB、 ECK1770 ydjH、 ECK1788 yeaM、 ECK1834 yebU、 ECK1844 yobB、 ECK1880 flhA、 ECKF ECK1949 rcsA、 ECK1966 yedX、 ECK2010 yeeZ、 ECK2023 ugd、 ECK2041 wcaJ、 ECK2104 yehD、 ECK2123 yehY、 ECK2193 ccmA、 ECK2196 and ECKH yfbN、 ECK2273 nuoK、 ECK2274 nuoJ、 ECK2295 yfcF、 ECK2312 truA、 ECK2392 yfeC、 ECK2404 yfeH、 ECK2628 yfjP、 ECK2660 yqa ECK2727 ECK2706 norW, ECK2709 ascG, ECK2729 pphB, ECK2754 ygcK, ECK2767 ygcU, ECK2869 hyuA, ECK2897 ygfF, ECK2952 ansB, ECK2959 nup ECKG3030 yqhD、 ECK3085 exuR、ECK3133 yraK, ECK3137 yraO, ECK3138 yraP, ECK3139 yraQ, ECK3141 yhbO, ECK3319 gspK, ECK3331 yheM, ECK3346 ybeH, ECK3367 yhfW, ECK3513 dctA, ECK3526 yhjV, ECK3539 yiaD, ECK3564 yiaK, ECK3606 tdh, ECK3683 dgoT, ECK3733 gidB, ECK3836 fre, ECK3868 ompL, ECK3893 frvA, ECK4014 yjbC, ECK4017 pgi, ECK4034 dgkA, ECK4112 The E. coli of any one of claims 1 to 3, wherein the E. coli is selected from the group consisting of melA, ECK4207 ytfG, and ECK4233 nrdD.

5. The RPPI genes are ECK0337 cynS, ECK0506 ybbY, ECK0671 fur, ECK0797 ybiO, ECK0816 moeB, ECK0870 macB, ECK1105 ycfX, ECK1254 trpA, ECK1349 ydaE, ECK1382 feaB, ECK1505 ydeW, ECK1597 pntB, ECK1680 sufA, ECK1701 ydiA, ECK1729 cedA, ECK1743 astB, ECK1770 ydjH, ECK1834 yebU, ECK1880 flhA, ECK1929 yedF, ECK1949 rcsA, ECK2023ugd, ECK2041 wcaJ, ECK2104 yehD, ECK2123 yehY, ECK2193 ccmA, ECK2273 nuoK, ECK2274 nuoJ, ECK2404 yfeH, ECK2628 yfjP, ECK2674 ygaX, ECK2729 pphB, ECK3085 exuR, ECK3133 yraK, ECK3138 yraP, ECK3141 yhbO, ECK3319 gspK, ECK3526 yhjV, ECK3564 yiaK, ECK3606 tdh, ECK3733 gidB, ECK3868 ompL, ECK3893 frvA, ECK4014 yjbC, ECK4034 The E. coli of any one of claims 1 to 4, wherein the selected gene is selected from the group consisting of ECK4112 dgkA, ECK4112 melA, ECK4207 ytfG, and ECK4233 nrdD.

6. The Escherichia coli according to any one of claims 1 to 5, wherein the RPPI gene is selected from ECK1382 feaB, ECK1597 pntB, ECK1743 astB, ECK1770 ydjH, ECK1929 yedF, ECK1949 rcsA, ECK2023 ugd, ECK2273 nuoK, ECK2274 nuoJ, ECK3141 yhbO, ECK3539 yiaD, ECK3564 yiaK, ECK3733 gidB, and ECK3836 fre.

7. The Escherichia coli of any one of claims 1 to 6, wherein the RPPI genes are selected from ECK1382 feaB, ECK1597 pntB, ECK1949 rcsA, ECK2023 ugd, ECK2273 nuoK, ECK3141 yhbO, and ECK3564 yiaK.

8. The Escherichia coli according to any one of claims 1 to 7, wherein one of the genes is disrupted.

9. The Escherichia coli according to any one of claims 1 to 7, wherein two or three of the genes are disrupted.

10. The E. coli according to any one of claims 1 to 9, which is at least one selected from the group consisting of JM109 strain, DH5α strain, BL21 strain, SCS1 strain, XL1-blue strain, HB101 strain, and derivatives thereof.

11. A composition for producing pDNA for RNA production, comprising the E. coli according to any one of claims 1 to 10.

12. The composition of claim 11, wherein the RNA is messenger RNA.

13. A pDNA produced using the Escherichia coli according to any one of claims 1 to 10 or the composition according to claim 11 or 12.

14. A method for producing pDNA using the E. coli according to any one of claims 1 to 10, the method comprising the steps of introducing a vector into the E. coli and culturing the E. coli.

15. A pDNA produced by the method of claim 14.

16. The pDNA of claim 13 or 15, wherein the pDNA has a polyA sequence.

17. The pDNA of claim 16, wherein the polyA sequence is from about 20 to about 600 nucleotides in length.

18. The pDNA of claim 17, wherein the polyA sequence is from about 120 to about 200 nucleotides in length.

19. A composition for producing mRNA comprising a plasmid, said pDNA having less than 50% polyA deletion.

20. A plasmid composition for RNA production produced using the Escherichia coli according to any one of claims 1 to 10 or the composition according to claim 11 or 12, wherein the pDNA lacking polyA is 50% or less.

21. A method for producing RNA using the pDNA according to any one of claims 13 or 15 to 18 or the composition according to claims 19 or 20.

22. RNA produced using the pDNA according to any one of claims 13 or 15 to 18 or the composition according to claims 19 or 20, or by the method according to claim 21.

23. The RNA of claim 22, wherein the RNA is messenger RNA.

24. The RNA of claim 23, wherein the messenger RNA is a messenger RNA with reduced polyA deletions.

25. A composition for producing pDNA for producing RNA, comprising E. coli in which one or more RNA producing plasmid improvement-related (RPPI) genes have been disrupted.

26. ECK0337(cynS), ECK0416(xseB), ECK0448(ybaZ), ECK0482(ybbJ), ECK0506(ybbY), ECK0671(ybbY), ECK0506(ybbY), ECK0671(97), ECK0(97), ECK0816(moeB), ECK0870(macB), ECK0899(aroA), ECK0974(yccZ), ECK1012(ycdQ), ECK1105(ycfX), ECK1190(ycgV), ECK1254(trpA), ECK1349(yB), ECK1487(gadB), ECK1505(ydeW), ECK1529(ydeI), ECK1548(ydfQ), ECK1597(pntB), ECK1648(rnt), ECK1680(sufA), ECK1690(ydiB), ECK1701(ydiA29), ECK1690(ydiB), ECK1701(ydiA), ECK1(73), ECK(aastB). ECK1752(ynjB), ECK1770(ydjH), ECK1788(yeaM), ECK1834(yebU), ECK1844(yobB), ECK1880(flhA), ECK1929(yedF), ECK1949(rcsA), ECK1966(yed20), ECK1(eZ),0 ECK2023(ugd), ECK2041(wcaJ), ECK2104(yehD), ECK2123(yehY), ECK2193(ccmA), ECK2196(napH), ECK2267(yfbN), ECK2273(nuoK), ECK2274(nuoJ295), ECK22F,(yfc ECK2312(truA), ECK2392(yfeC), ECK2404(yfeH), ECK2628(yfjP), ECK2660(yqaE), ECK2674(ygaX), ECK2706(norW), ECK2709(ascG), ECK2729(pphB54), ECK27cG,(ygKK), ECK2767(ygcU), ECK2869(hyuA), ECK2897(ygfF), ECK2952(ansB), ECK2959(nupG), ECK3003(yqhD), ECK3085(exuR),ECK3133(yraK), ECK3137(yraO), ECK3138(yraP), ECK3139(yraQ), ECK3141(yhbO), ECK3319(gspK), ECK3331(yheM), ECK3346(ybeH), ECK3367(yhfW), ECK3513(dctA), ECK3526(yhjV), ECK3539(yiaD), ECK3564(yiaK), ECK3606(tdh), ECK3683(dgoT), ECK3733(gidB), ECK3836(fre), ECK3868(ompL), ECK3893(frvA), ECK4014(yjbC), ECK4017(pgi), ECK4034(dgkA), 26. The composition of claim 25, wherein the gene is selected from ECK4112 (melA), ECK4207 (ytfG), and ECK4233 (nrdD).

27. A pDNA for producing RNA, produced using the composition of claim 25 or 26.