3 UTR SEQUENCES FOR RNA STABILIZATION

Abstract

The present invention relates to the stabilization of RNA, particularly mRNA, and an increase in mRNA translation. The present invention relates in particular to a modification of RNA, particularly RNA transcribed in vitro, that results in increased transcript stability and / or increased translation efficiency. According to the invention, it has been demonstrated that certain sequences in the 3' untranslated region (UTR) of an RNA molecule improve both stability and translation efficiency.

Description

3' UTR SEQUENCES FOR RNA STABILIZATION Field and Background of the Invention The use of RNA offers an attractive alternative to DNA in order to circumscribe the potential safety risks associated with the therapeutic use of DNA. In vitro transcribed RNA (IVT-RNA) is of particular interest in therapeutic approaches. The advantages of a therapeutic use of RNA include transient expression and a non-transforming character. The RNA does not need to enter the nucleus in order to be expressed and furthermore it cannot integrate into the host genome, thus eliminating the risk of oncogenesis. When used for vaccination, RNA injection can induce both cellular and humoral immune responses in vivo. However, the use of RNA for clinical applications is quite restricted especially because of the short half-life of RNA. IVT vectors can be used in a standardized manner as a template for in vitro transcription. These IVT vectors can have the following structure: a 5'-RNA polymerase promoter that allows RNA transcription, followed by a gene of interest that is flanked either 3' and / or 5' by untranslated regions (UTRs). ), and a 3' polyadenyl cassette containing A nucleotides. Prior to in vitro transcription, the circular plasmid is linearized downstream of the polyadenyl cassette by type II restriction enzymes (recognition sequence corresponds to cleavage site ). The polyadenyl cassette thus corresponds to the last poly(A) sequence in the transcript. Human immature dendritic cells (hiDCs) are widely used to develop and improve immunotherapies for cancer treatment. Loaded with in vitro transcribed (IVT) mRNA encoding a specific tumor antigen (TA), hiDCs are capable of inducing an effective anti-tumor response. However, a prerequisite for an effective immune response using RNA-based cancer vaccines is high stability and translational efficiency of RNA. Both can be improved by structural modifications of the 5'-cap, the 3' poly(A)-end as well as the 5' and 3' untranslated regions (UTRs). Sequence elements within UTRs affect transductional efficiencies (mainly 5'-UTR) and RNA stability (mainly 3'-UTR). In previous work, we demonstrated that two consecutive copies of the human beta-globulin 3'-UTR (now called 2hBg; previously also 2pgUTR) contribute to greater transcript stability and greater transductional efficiency (Holtkamp (2006) Blood 108:4009- 4017). However, the presence of two identical copies of the human beta-globulin 3'-UTR sequence in plasmid DNA, which is ultimately used as a template for in vivo transcription of RNA, carries the risk of recombination during its propagation in E. coli. Similarly, any cloning approach is very difficult, especially using PCR-based amplification. The same holds true for PCR-based amplification of the RNA coding region with the 2hBg at the 3' end to be used as a template for in vitro transcription. Because mispriming has been observed here, leading to skipping of one copy of the 3'-UTR of human beta-globulin. To avoid these problems, ncznnn / ι znz / R / v is sought to identify new sequences that have a stabilizing effect on in vitro transcribed mRNA at least similar to, ideally even better than, the 2hBg sequence. It was the object of the present invention to provide RNA with increased stability and / or increased efficiency of translation and a means for obtaining this RNA. It may be possible to obtain increased degrees of expression when using this RNA in therapy. This object is achieved according to the invention by the subject matter of the claims. The present invention relates to the stabilization of RNA, in particular mRNA, and an increase in mRNA translation. The present invention relates in particular to a modification of RNA, in particular in vitro transcribed RNA, which results in increased stability of transcript and / or increased efficiency of translation. According to the invention, it was shown that certain sequences in the 3'-untranslated region (UTR) of an RNA molecule improve the stability and efficiency of translation. Using the modified RNA according to the invention in the transfection of dendritic cells (DO), it will be possible, for example, to increase the density of antigen-specific peptide / MHC complexes in the transfected cells and their capacity to stimulate and expand antigen-specific CD4+ and CD8+ T cells. Therefore, the invention, in one embodiment, relates to a strategy for optimizing RNA vaccines for transfecting DC or RNA-transfected DC vaccines using RNA that has been modified by the RNA modifications described according to the invention. According to the invention, the modification, and thus the stabilization and / or increase in translation efficiency, of RNA is preferably achieved by genetically engineering expression vectors that preferably serve as a template for RNA transcription in vitro. These expression vectors allow the transcription of RNA with a 3'-non-translated region described according to the invention, and preferably between the sequence that codes for a peptide or protein (open reading frame) and the poly(A) sequence. ). These vectors can also allow the transcription of RNA with a poly(A) sequence that preferentially has an open end on this RNA, i.e., without nucleotides other than A nucleotides flanking the poly(A) sequence at its 3-end. '. An open-ended poly(A) sequence in RNA can be achieved by introducing a type IIS restriction cleavage site into an expression vector that allows the RNA to be transcribed under the control of a 5' RNA polymerase promoter and containing a polyadenyl cassette, wherein the recognition sequence is located 3' of the polyadenyl cassette, while the cleavage site is located 5' and thus within the polyadenyl cassette. Restriction cleavage at the US type restriction cleavage site allows a plasmid to be linearized within the polyadenyl cassette. The linearized plasmid can then be used as a template for in vitro transcription, the resulting transcript ending in an unmasked poly(A) sequence. Additionally, a further interruption of the 3' polyadenyl cassette by a random nucleotide sequence, with an equal distribution of all four nucleotides (linker), increases the stability of the 3' polyadenyl cassette in E. coli. ncznnn / ι zn^ / B / v Brief Description of the Invention In one aspect, the invention relates to a nucleic acid molecule comprising in the 5' —> 3' direction of transcription: (a) a promoter; (b) a transcribed nucleic acid sequence or a nucleic acid sequence for introducing a transcribed nucleic acid sequence; and (c) a nucleic acid sequence which, when transcribed under the control of promoter (A), codes for a 3'-untranslated region in the transcript, said 3'-untranslated region comprising a nucleic acid sequence which is selected from the group consisting of: (c-1) the nucleic acid sequence of the 3'-untranslated region of FCGRT, a fragment thereof, or a variant of this nucleic acid sequence or fragment, (c-2) the nucleic acid sequence of the 3'-untranslated region of LSP1, a fragment thereof, or a variant of this nucleic acid sequence or fragment, (c-3) the nucleic acid sequence of the 3'-untranslated region of CCL22, a fragment thereof, or a variant of this nucleic acid sequence or fragment, (c-4) the nucleic acid sequence of the 3'-untranslated region of, AES a fragment thereof, or a variant of this sequence nucleic acid sequence or fragment, (c-5) the nucleic acid sequence of the 3'-untranslated region of PLD3, a fragment thereof, or a variant of this nucleic acid sequence or fragment, (c-6) the nucleic acid sequence of the MT-RNR1 noncoding RNA, a fragment thereof, or a variant of this nucleic acid sequence or fragment, (c-7) the nucleic acid sequence of the 3'-untranslated region of HLDA-DRB4, a fragment thereof, or a variant of this nucleic acid sequence or fragment, and (c-8) any combination of two or more of the nucleic acid sequences, fragments and / or variants according to (c -1), (c-2), (c-3), (c-4), (c-5), (c-6) and (c-7). In one embodiment, nucleic acid sequences (b) and (c) under the control of promoter (a) can be transcribed to give a common transcript in which the nucleic acid sequence transcribed from nucleic acid sequence (c) it is active to increase the translational efficiency and / or the stability of the nucleic acid sequence transcribed from the transcribable nucleic acid sequence (b). In one embodiment, the nucleic acid sequences (b) and (c) do not link naturally. In one embodiment, (c-4) the AES 3'-untranslated region nucleic acid sequence, a fragment thereof, or a variant of this nucleic acid sequence or fragment comprises a nucleic acid sequence selected from the group consisting of a nucleic acid sequence selected from SEQ ID Nos.: 86 to 89, a fragment thereof, or a variant of this nucleic acid sequence or fragment. In one embodiment, (c-4) the nucleic acid sequence of the 3'-untranslated region of AES, an ncznnn / i ζηζ / κ / γ fragment thereof, or a variant of this nucleic acid sequence or fragment comprises a nucleic acid sequence selected from the group consisting of the nucleic acid sequence of SEQ ID No.: 86, a fragment thereof, or a variant of this nucleic acid sequence or fragment. In one embodiment (c-6) the nucleic acid sequence of the MT-RNR1 noncoding RNA, a fragment thereof, or a variant of this nucleic acid sequence or fragment comprises a nucleic acid sequence selected from the group consisting of a nucleic acid sequence selected from SEQ ID Nos.: 105 to 121, a fragment thereof, or a variant of this nucleic acid sequence or fragment. In one embodiment, (c-6) the MT-RNR1 noncoding RNA nucleic acid sequence, a fragment thereof, or a variant of this nucleic acid sequence or fragment comprises a nucleic acid sequence selected from the group consisting of the nucleic acid sequence of SEQ ID No.: 115, a fragment thereof, or a variant of this nucleic acid sequence or fragment. In one embodiment, the nucleic acid sequence (c-8) comprises a combination of two or more identical or different nucleic acid sequences, fragments and / or variants according to (c-1), (c-2), (c- 3), (c-4), (c-5), (c6) and (c-7). In various embodiments, the nucleic acid sequence (c-8) comprises a combination of (c-1) and (c-2), (c-1) and (c-3), (c-1) and (c -4), (c-1) and (c-5), (c-1) and (c-6), (c-1) and (c-7), (c-2) and (c-3 ), (c-2) and (c-4), (c-2) and (c-5), (c-2) and (c-6), (c-2) and (c-7), (c-3) and (c-4), (c-3) and (c-5), (c-3) and (c-6), (c-3) and (c-7), (c -4) and (c-5), (c-4) and (c-6), (c-4) and (c-7), (c-5) and (c-6), (c-5 ) and (c-7), or (c-6) and (c-7). In one embodiment, the nucleic acid sequence (c-8) comprises a combination of (c-4) the nucleic acid sequence of the AES 3'-untranslated region, a fragment thereof, a variant of this sequence nucleic acid sequence or fragment, and (c-6) the nucleic acid sequence of the MT-RNR1 noncoding RNA, a fragment thereof, or a variant of this nucleic acid sequence or fragment. In one embodiment, (c-4) the nucleic acid sequence of the 3'-untranslated region of AES, a fragment thereof, a variant of this nucleic acid sequence or fragment is located 5' to (c-6 ) the nucleic acid sequence of the MTRNR1 noncoding RNA, a fragment thereof, or a variant of this nucleic acid sequence or fragment. In one embodiment, the combination of (c-4) the AES 3'-untranslated nucleic acid sequence, a fragment thereof, or a variant of this nucleic acid sequence or fragment, and (c-6 ) the nucleic acid sequence of the MT-RNR1 noncoding RNA, a fragment thereof, a nucleic acid sequence variant or fragment comprises a nucleic acid sequence selected from the group consisting of the nucleic acid sequence of SEQ ID No.: 174, a fragment thereof, or a variant of the nucleic acid sequence or fragment. In one embodiment, the nucleic acid molecule of the invention further comprises (d) a nucleic acid sequence that, when transcribed under the control of promoter (a), codes for a nucleic acid sequence that is a polyadenyl sequence that optionally comprises within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides. In one embodiment, this polyadenyl sequence comprises at least 20 A nucleotides, preferably at least 40, at least 80 , at least 100 or at least 120 nucleotides A, preferably ncznnn / i znz / R / v nucleotides to consecutive In one embodiment, the sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides is a sequence, preferably an arbitrary sequence, of two or more consecutive nucleotides, wherein the first and last nucleotides of this sequence of two or more consecutive nucleotides is a nucleotide other than a nucleotide A. In one embodiment, this nucleic acid sequence (d) is a nucleic acid sequence that, when transcribed under the control of promoter (a), codes for a nucleic acid sequence which is a polyadenyl sequence comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than nucleotides A and which exhibits greater propagation stability of this nucleic acid molecule in Escherichia coli compared to a nucleic acid molecule comprising instead of this nucleic acid sequence (d) a nucleic acid sequence (d)' which, when transcribed under the control of promoter (a), codes for a polyadenyl sequence thereof length as the nucleic acid sequence that is a polyadenyl sequence comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than nucleotides A. In one embodiment, this nucleic acid sequence that is a sequence polyadenyl comprising optionally within the polyadenyl sequence, a sequence of one or more consecutive nucleotides containing nucleotides other than nucleotides A comprises at least 80 nucleotides, preferably at least 90 or 100 nucleotides. In one embodiment, this nucleic acid sequence which is a polyadenyl sequence optionally comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than nucleotides A comprises at least 90 nucleotides, preferably at least 100 nucleotides, preferably at least 110 nucleotides. In one embodiment, the nucleic acid sequence that is a polyadenyl sequence optionally comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides comprises about 120 nucleotides. In particular embodiments, the nucleic acid sequence that is a polyadenyl sequence optionally comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides comprises up to 200, preferably up to 150, and in particular, up to 130 nucleotides. In one embodiment, at least 90%, preferably at least 92%, preferably at least 95%, 97%, 98% of the nucleotides of this nucleic acid sequence which is a polyadenyl sequence optionally comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides are A nucleotides in the polyadenyl sequence (not including A nucleotides in the sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides) . In one embodiment, the sequence of one or more consecutive nucleotides containing nucleotides other than nucleotides A is located within a region from position 21 to position 80, preferably from position 21 to position 60, more preferably from position 31 to position 50 of this polyadenyl sequence. In one embodiment, the sequence of one or more consecutive nucleotides containing ncznnn / i znz / R / v nucleotides other than A nucleotides is preceded by at least 20 A residues, preferably at least 30, 40 or 50 A residues in this embodiment. polyadenyl sequence. In particular embodiments, the sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides is preceded by up to 80 A nucleotides, preferably up to 70 or 60 A residues in the polyadenyl sequence. In one embodiment, the sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides is followed by at least 20 A residues, preferably at least 30, 40, 50, 60 or 70 A residues in the polyadenyl sequence. In particular embodiments, the sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides is followed by up to 100 A residues, preferably up to 80 A residues in the polyadenyl sequence. In one embodiment, the sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides is preceded by 20 to 50, preferably 30 to 40 A residues in the polyadenyl sequence and followed by 30 to 80, preferably 40 to 70 A residues in the polyadenyl sequence. In one embodiment, the sequence of one or more consecutive nucleotides containing nucleotides other than nucleotides A has a length of at least 3, at least 4, at least 5, at least 6, at least 8, preferably at least 10, more preferably at least 15 nucleotides. In one embodiment, the sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides is no more than 50, preferably no more than 30, more preferably no more than 20 nucleotides in length. In one embodiment, the sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides comprises no more than 3, preferably no more than 2, preferably no consecutive A residues. In one embodiment, the nucleic acid sequences (b), (o) and (d) under the control of promoter (a) can be transcribed into a common transcript. In one embodiment, the transcribed nucleic acid sequence of nucleic acid sequences (o) and optionally (d) are active to increase the translational efficiency and / or stability of the transcribed nucleic acid sequence of the nucleic acid sequence. (b) transferable. In one embodiment, in the transcript, the nucleic acid sequence that is a polyadenyl sequence optionally comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides is located at the 3' end. . In one embodiment, the nucleic acid molecule of the invention is a DNA molecule. In one embodiment, the nucleic acid molecule is an expression vector or plasmid such as an IVT vector. In one embodiment, the nucleic acid molecule of the invention is a closed circular molecule or a linear molecule. In one embodiment, the transcribed nucleic acid sequence comprises a nucleic acid sequence encoding a peptide or protein and the nucleic acid sequence for introducing a transcribed nucleic acid sequence is a multiple cloning site. nc7nnn / i 7Π7 / Ε / Υ In one embodiment, the nucleic acid molecule of the invention further comprises one or more members selected from the group consisting of: (i) a reporter gene; (ii) a marker gene; and (iii) an origin of replication. In one embodiment, the nucleic acid molecule of the invention is suitable, particularly after linearization, for in vitro transcription of RNA, in particular mRNA. Prior to in vitro transcription, circular IVT vectors are generally linearized downstream of the polyadenyl cassette by type II restriction enzymes (recognition sequence corresponds to cleavage site). The polyadenyl cassette thus corresponds to the poly(A) sequence later in the transcript. As a result of this procedure, some nucleotides remain as part of the enzyme cleavage site after linearization and extend or mask the poly(A) sequence at the 3' end. However, RNA having an open-ended poly(A) sequence was found to be more efficiently translated than RNA having a poly(A) sequence with a masked terminus. Accordingly, the nucleic acid cores of the invention when used as expression vectors preferentially allow the transcription of RNA with a poly(A) sequence that preferentially has an open end in the RNA, i.e. none of nucleotides other than A nucleotides flank this poly(A) sequence at its 3' end. An open-ended poly(A) sequence in RNA can be achieved by introducing a type IIS restriction cleavage site into an expression vector that allows RNA to be transcribed under the control of a 5' RNA polymerase promoter that contains a polyadenyl cassette, where the recognition sequence is located 3' of the polyadenyl cassette, while the cleavage site is located 5' and thus within the polyadenyl cassette. Restriction cleavage at the type II restriction cleavage site allows a plasmid to be linearized within the polyadenyl cassette. The linearized plasmid can then be used as a template for in vitro transcription, the resulting transcript ending in the unmasked poly(A) sequence. Accordingly, in one embodiment, it is preferred that the nucleic acid molecule of the invention can be cleaved, preferably empirically or otherwise biochemically, within nucleic acid sequence (d) in such a way that cleavage yields The result is a nucleic acid molecule comprising, in the 5' —> 3' direction of transcription, the promoter (a), the nucleic acid sequences (b) and (c), and at least a part of the sequence of nucleic acid (d), wherein the at least part of the nucleic acid sequence (d), when transcribed under the control of promoter (a), codes for the nucleic acid sequence which is a polyadenyl sequence that optionally comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides and where in the 3'-terminal nucleotide transcript is an A nucleotide of the nucleic acid molecule that is a sequence of polyadenyl optionally comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides. Preferably, after cleavage, the nucleic acid molecule, at the end of the ncznnn / i ζηζ / κ / γ strand which serves as a template for the nucleic acid sequence which is a polyadenyl sequence optionally comprising within polyadenyl sequence a sequence of one or more consecutive nucleotides that contains nucleotides other than nucleotides A, has a nucleotide T that is part of the nucleic acid sequence that serves as a template for the nucleic acid sequence that is a polyadenyl sequence that optionally comprises within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than nucleotides A. The nucleic acid molecule of the invention is preferably a closed circular molecule before cleavage and a linear molecule after cleavage. Preferably, the cleavage is carried out with the aid of a restriction cleavage site which is preferably a restriction cleavage site for a type IIS restriction endonuclease. In one embodiment, the recognition sequence for type IIS restriction endonuclease is located 5-26 base pairs, preferably 24-26 base pairs, downstream of the 3' end of the nucleic acid sequence ( d). In one embodiment, a nucleic acid molecule according to the invention is in a closed circular conformation and is preferably suitable for in vitro transcription of RNA, in particular mRNA, in particular after linearization. In additional aspects, the invention relates to a nucleic acid molecule obtainable by linearization of a nucleic acid molecule described above, preferably by cleavage within the nucleic acid sequence (d), and to RNA obtainable by transcription, of preferably in vitro transcription, with the nucleic acid molecules described above under the control of promoter (a). Thus, the invention, in one aspect, relates to RNA comprising in the 5' —> 3' direction: (a) a 5'-untranslated line; (b) a nucleic acid sequence encoding a peptide or protein; and (c) a 3'-untranslated region, the 3'-untranslated region comprising a nucleic acid sequence selected from the group consisting of: (c-1) the nucleic acid sequence of the 3'-untranslated region of FCGRT, a fragment thereof, or a variant of the nucleic acid sequence or fragment, (c-2) the nucleic acid sequence of the 3'-untranslated region of LSP1, a fragment thereof, or a variant of this nucleic acid sequence or fragment, (c-3) the nucleic acid sequence of the 3'-untranslated region of CCL22, a fragment thereof, or a variant thereof nucleic acid sequence or fragment, (c-4) the nucleic acid sequence of the AES 3'-untranslated region, a fragment thereof, or a variant sequence nucleic acid sequence or fragment, (c-5) the nucleic acid sequence of the 3'-untranslated region of PLD3, a fragment thereof, or a variant nucleic acid sequence or fragment, ncznnn / ι znz / R / v (c-6) the nucleic acid sequence of the MT-RNR1 noncoding RNA, a fragment thereof, or a variant of this nucleic acid sequence or fragment, (c-7) the nucleic acid sequence of the 3'-untranslated region of HLDA-DRB4, a fragment thereof, or a variant of this nucleic acid sequence or fragment, and (c-8) any combination of two or more of the nucleic acid sequences, fragments and / or variants according to (c-1), (c-2), (c-3), (c-4), (c-5), (c-6) and (c-7). In one embodiment, the nucleic acid sequences (b) and (c) do not link naturally. In one embodiment, the RNA further comprises (d) a nucleic acid sequence that is a polyadenyl sequence optionally comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than nucleotides A. In one embodiment , the nucleic acid sequence (d) is located at the 3' end of the RNA. In one embodiment, the nucleic acid sequences (c) and optionally (d) are active to increase the translational efficiency and / or stability of the nucleic acid sequence encoding a peptide or protein. In one embodiment, the RNA further comprises (e) a 5' cap. The embodiments of the 3'-untranslated region and the nucleic acid sequence that is a polyadenyl sequence optionally comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides are as described. above for the nucleic acid molecules of the invention. In a further aspect, the invention relates to a method for obtaining RNA, comprising: (i) providing a nucleic acid molecule of the invention, and (ii) transcribing RNA using the nucleic acid molecule as a template. In a further aspect, the invention relates to a method for obtaining a peptide or protein, comprising: (i) obtaining an RNA encoding the peptide or protein according to the method for obtaining RNA of the invention, and (ii) translating the RNA. In one embodiment, a method for obtaining RNA or the method for obtaining a peptide or protein further comprises, prior to transcription of the nucleic acid molecule, cleaving the nucleic acid molecule. In a further aspect, the invention relates to a method for obtaining RNA, comprising: (i) coupling a nucleic acid sequence (b) which, when transcribed, codes for a 3'-untranslated region, to the 3' end of a transcribed nucleic acid sequence (a) comprising a nucleic acid sequence encoding a peptide or protein, and (ii) transcribing the nucleic acid obtained, the 3'-untranslated region comprising a nucleic acid sequence selected from the group ncznnn / i 7f\7iw consisting of: (b-1) the nucleic acid sequence of the 3'-untranslated region of FCGRT, a fragment thereof, or a variant of this nucleic acid sequence or fragment, (b-2) the nucleic acid sequence of the 3'-untranslated region of LSP1, a fragment thereof or a variant of this nucleic acid sequence or fragment, (b-3) the nucleic acid sequence of the 3'-untranslated region of CCL22, a fragment of the same or a variant of this nucleic acid sequence or fragment, (b-4) the nucleic acid sequence of the 3'-untranslated region of AES, a fragment thereof or a variant of this nucleic acid sequence or fragment, (b-5) the nucleic acid sequence of the 3'-untranslated region of PLD3, a fragment thereof or a variant of this nucleic acid sequence or fragment, (b-6) the acid sequence nucleic acid sequence of the MT-RNR1 noncoding RNA, a fragment thereof, or a variant of this nucleic acid sequence or fragment, (b-7) the nucleic acid sequence of the 3'-untranslated region of HLDA-DRB4 , a fragment thereof or a variant of this nucleic acid sequence or fragment, and (b-8) any combination of two or more of the nucleic acid sequences, fragments and / or variants according to (b-1), ( b-2), (b-3), (b-4), (b-5), (b-6) and (b-7). In one embodiment, nucleic acid sequences (a) and (b) can be transcribed to give a common transcript in which the nucleic acid sequence transcribed from nucleic acid sequence (b) is active to increase translation efficiency. and / or the stability of the transcribed nucleic acid sequence of the transcribed nucleic acid sequence (a). In one embodiment, the nucleic acid sequences (a) and (b) do not link naturally. In one embodiment, the method further comprises coupling a nucleic acid sequence (c) which, when transcribed, codes for a nucleic acid sequence that is a polyadenyl sequence optionally comprising within the polyadenyl sequence a sequence of one or plus consecutive nucleotides containing nucleotides other than A nucleotides, at the 3' end of the nucleic acid sequence (b). In one embodiment, nucleic acid sequences (a), (b) and (c) can be transcribed to give a common transcript in which the nucleic acid sequences transcribed from nucleic acid sequences (b) and optionally ( c) are active in increasing the translational efficiency and / or the transcribed nucleic acid stability of the transcribed nucleic acid sequence (a). The embodiments of the 3'-untranslated region and the nucleic acid sequence that is a polyadenyl sequence optionally comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides are as described. above for the nucleic acid molecules of the invention. In a further aspect, the invention relates to a method for obtaining a peptide or protein, which ncznnn / i znz / R / v comprises: (i) obtaining RNA by the method for obtaining RNA of the invention, and (ii) translate the RNA. The methods of the invention can be tested in vitro or in vivo. In one embodiment of any of the methods of the invention, transcription is carried out in vitro. In one embodiment, the method for obtaining RNA or the method for obtaining a peptide or protein further comprises, prior to transcription of the nucleic acid molecule, cleaving the nucleic acid molecule. In one embodiment, the cleavage is within the nucleic acid sequence that, when transcribed, codes for a nucleic acid sequence that is a polyadenyl sequence optionally comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than nucleotides A in such a way that transcription of the nucleic acid thus obtained generates a transcript having at its 3'-terminus the nucleic acid sequence which is a polyadenyle sequence optionally comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides, wherein the 3'-terminal nucleotide of the transcript is an A nucleotide of the nucleic acid sequence that is a polyadenyl sequence optionally comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than nucleotides A. In all aspects of the methods according to the invention, cleavage is preferably carried out with the aid of a restriction cleavage site which is preferably a restriction cleavage site for an 11S-type restriction endonuclease. In one embodiment, the recognition sequence for type IIS restriction endonuclease is 526 base pairs, preferably 24-26 base pairs, downstream of the 3' end of the nucleic acid sequence which, when transcribed , encodes for a nucleic acid sequence that is a polyadenyl sequence optionally comprising within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides. The invention also relates to RNA obtainable by the methods according to the invention for obtaining RNA. The invention can be used, for example, to increase the expression of recombinant proteins in cellular transcription and expression. More specifically, it is possible, when producing recombinant proteins, to use expression vectors of the invention for recombinant nucleic acid transcription and recombinant protein expression in cell-based systems. This includes, for example, the preparation of recombinant antibodies, hormones, cytokines, enzymes, and the like. Production costs are allowed to be reduced inter alia. It is also possible to use the nucleic acid molecules of the invention for gene therapy applications. Accordingly, a nucleic acid molecule of the invention can be a gene therapy vector and ncznnn / i znz / R / v is used for expression of a transgene. For this purpose, any nucleic acid (DNA / RNA)-based vector system can be used (eg plasmids, adenovirus, pox virus, influenza virus vectors, alphavirus vectors and the like). Cells can be transfected with these vectors in vitro, for example into lymphocytes or dendritic cells, or else in vivo by direct administration. RNA of the invention (for example obtained using a nucleic acid molecule described herein as a transcription template) can be used, for example, for transient expression of genes, with possible fields of application being RNA-based vaccines. that are transfected into cells in vivo or administered directly in vivo, the transient expression of functional recombinant proteins in vitro, for example in order to initiate differentiation processes in cells or to study protein functions, and the transient expression of functional recombinant proteins such such as erythropoietin, hormones, coagulation inhibitors, etc., in vivo, in particular pharmaceuticals. The RNA of the invention in particular can be used to transfect cells presenting the antigen and thus as a tool to deliver the antigen to be presented and to load the antigen presenting cells with the antigen to be presented. present that corresponds to or is derived from the expressed peptide or protein of the RNA, in particular by means of intracellular processing such as cleavage, i.e. the antigen to be presented is, for example, a fragment of the expressed peptide or protein of the RNA. These antigen presenting cells can be used to stimulate T cells, in particular CD4+ and / or CD8+ cells. Accordingly, in a further aspect, the invention relates to a use of the RNA of the invention for transfecting a host cell. In one embodiment, the host cell is a cell presenting the antigen, in particular a dendritic cell, a monocyte or a macrophage. In a further aspect, the invention relates to the use of the RNA of the invention for therapy, in particular for vaccination. In a further aspect, the invention relates to a pharmaceutical composition such as a vaccine composition comprising the RNA of the invention. In a further aspect, the invention relates to the RNA of the invention for the uses described herein. Detailed description of the invention Although the present invention is described in detail below, it is to be understood that this invention is not limited to the particular methodologies, protocols, and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the invention to be limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by one skilled in the art. In the following, the elements of the present invention will be described. These elements are listed with specific modalities, however it should be understood that they can be combined in any way and in any nc7nnn / i 7Π7 / Ε / Υ number to create additional modalities. The variously described examples and preferred embodiments should not be construed to limit the present invention to only the explicitly described embodiments. This description is to be understood to support and encompass modalities that combine the explicitly described modalities with any number of the described and / or preferred elements. Furthermore, any of the permutations and combinations of all items described in this application are to be considered described by the description of the present application unless the context clearly indicates otherwise. For example, if in one preferred embodiment, a sequence of one or more consecutive nucleotides containing nucleotides other than Ase nucleotides is preceded by at least 20 A residues in the polyadenyl sequence and if in another preferred embodiment, a sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides is followed by at least 20 A residues in the polyadenyl sequence, it is a preferred embodiment contemplated that a sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides is preceded and followed by at least 20 A residues in the polyadenyl sequence. Preferably, terms used herein are defined as described in A multilingual glossary of biotechnological terms: (IUPAC Recommendations)”, H.G.W. Leuenberger, B. Nagel, and H. Kólbl, Eds., Helvetica Chimica Acta, CH-4010 Basel, Switzerland, (1995). The practice of the present invention will employ, unless otherwise indicated, conventional methods of chemistry, biochemistry, cell biology, immunology, and recombinant DNA techniques that are explained in the literature in the field (compare, for example, Molecular Cloning: A Laboratory Manual, 2nd Edition, J. Sambrook et al. eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989). Throughout this specification and the claims that follow, unless the context otherwise requires, the word "comprising", and variations such as "comprising" and "comprising", shall be understood to imply the inclusion of a designated member, integer or step or group of members, integers or steps but not the exclusion of any other member, integer or step or group of members, integers or steps. The terms "a" and "an" and "the" and "the" and similar references used in the context to describe the invention (especially in the context of the claims) are to be taken to cover both the singular and the plural, unless otherwise stated herein or clearly contradicted by the context. The citation of ranges of values ​​herein is only intended to serve as a shortcut for individually referring to each separate value that falls within the range. Unless otherwise stated herein, each individual value is incorporated into the specification as if it were individually cited herein. All of the methods described herein may be performed in any suitable order unless otherwise stated herein or otherwise clearly contradicted by the context. The use of any and all examples, or example language (for example, "such as"), provided herein is intended only to better illustrate the invention and does not possess a limitation on the scope of the invention otherwise claimed. . Nothing in the text in the specification should be construed as indicating that anything not claimed is essential to the practice of the invention. Various documents are cited throughout the text of this specification. Each of the documents ncznnn / i znz / R / v cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated mode as a reference in its entirety. Nothing herein is to be construed as an admission that the invention is not entitled to precede this description by virtue of prior invention. The present invention describes nucleic acid molecules such as useful DNA plasmids such as RNA expression vectors comprising nucleic acid sequences encoding modified 3'-untranslated regions (UTRs) in RNA that have a stabilizing effect on RNA. and / or that increase the efficiency of RNA translation. The term "nucleic acid sequence that, when transcribed, codes for a 3'-untranslated region in the transcript" refers to a nucleic acid sequence that contains a template strand that codes for this 3'-untranslated region. Preferably, the nucleic acid sequence comprises a coding strand comprising the same nucleic acid sequence as the 3'-untranslated region of the DNA transcript produced (albeit with thymine replaced by uracil). Thus, according to the invention a nucleic acid sequence which, when transcribed, codes for a 3'-non-translated region in the transcript", in one embodiment, comprises a coding strand comprising a 3'-non-translated region. translated as specified herein (although with thymine replaced by uracil). The term "FCGRT" refers to the IgG Fe fragment, receptor, transporter, alpha and includes the FCGRT gene. This gene codes for a receptor that binds to the Fe region of monomeric immunoglobulin G. The encoded protein transfers immunoglobulin G antibodies from mother to fetus across the placenta. This protein also binds immunoglobulin G to protect the antibody from degradation. The term "FCGRT 3'-untranslated region nucleic acid sequence, a fragment thereof, or a variant of this nucleic acid sequence or fragment" refers to a nucleic acid sequence comprising, preferably consisting of a nucleic acid sequence selected from the group consisting of SEQ ID Nos.: 1 to 50 of the sequence listing or a fragment thereof, a variant of this nucleic acid sequence or fragment. In one embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical to a nucleic acid sequence selected from the group consisting of SEQ ID Nos.: 1 to 50. In a particularly preferred embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of, the nucleic acid sequence of SEQ ID No.: 27 or comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical to the nucleic acid sequence of SEQ ID No.: 27. The term "LSP1" refers to lymphocyte-specific protein 1 and includes the LSP1 gene. This gene codes for an intracellular F-actin binding protein. The protein is expressed on lymphocytes, neutrophils, macrophages, and endothelium and can regulate neutrophil motility, adhesion to fibrinogen matrix proteins, and transendothelial migration. The term "nucleic acid sequence of the 3'-untranslated region of LSP1, a fragment thereof, or a vanant of this nucleic acid sequence or fragment" refers to a nucleic acid sequence comprising, preferably consisting of a nucleic acid sequence selected from the group consisting of SEQ ID Nos.: 51 to 72 of the sequence listing or a fragment thereof, or a variant of this nucleic acid sequence or fragment. In one embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical. to a nucleic acid sequence selected from the group consisting of SEQ ID Nos.: 51 to 72. In a particularly preferred embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of the nucleic acid sequence SEQ ID No.: 52 or comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical to the acid sequence nucleic acid of SEQ ID No.: 52. The term "CCL22" refers to chemokine ligand 22 (C-C Motif) and includes the CCL22 gene. The product of this gene binds to the chemokine receptor CCR4. This chemokine may play a role in the trafficking of activated T cells to inflammatory sites and other aspects of activated T cell physiology. The term "nucleic acid sequence of the 3'-untranslated region of CCL22, a fragment thereof, a variant of this nucleic acid sequence or fragment" refers to a nucleic acid sequence comprising, preferably consisting of a nucleic acid sequence selected from the group consisting of SEQ ID Nos.: 73 to 85 of the sequence listing or a fragment thereof, or a variant of this nucleic acid sequence or fragment. In one embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical. to a nucleic acid sequence selected from the group consisting of SEQ ID Nos.: 73 to 85. In a particularly preferred embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of the nucleic acid sequence of SEQ ID No.: 79 or comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical to the nucleic acid sequence of SEQ ID No.: 79. The term "AES" refers to the amino-terminal cleavage enhancer and includes the AES gene. The protein encoded by this gene corresponds to the Groucho / TLE family of proteins, it can function as a homoligomer or as a heterooligomer with other family members to dominantly repress the expression of other family member genes. The term "AES 3'-untranslated region nucleic acid sequence, a fragment thereof, or a variant nucleic acid sequence or fragment" refers to a nucleic acid sequence comprising, preferably consisting of of a nucleic acid sequence selected from the group consisting of ncznnn / i 7f\7iw of SEQ ID Nos.: 86 to 89 of the sequence listing or a fragment thereof, or a variant of this nucleic acid sequence or fragment. In one embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical. to a nucleic acid sequence selected from the group consisting of SEQ ID Nos.:86 to 89. In a particularly preferred embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of the nucleic acid sequence of SEQ ID No.: 86 or comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical to the nucleic acid sequence of SEQ ID No.: 86. In a particularly preferred embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of the nucleic acid sequence of positions 1 to 68, positions 1 to 102, positions 35 to 102 , positions 35 to 136, positions 68 to 136 of SEQ ID No.: 86 or comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably al least 98% identical to the nucleic acid sequence of positions 1 to 68, positions 1 to 102, positions 35 to 102, positions 35 to 136, or positions 68 to 136 of SEQ ID No.: 86. The term "PLD3" refers to Phospholipase D Family Member 3 and includes the PLD3 gene. This gene codes for a member of the phospholipase D (PLD) family of enzymes that catalyze the hydrolysis of membrane phospholipids. The encoded protein is a single pass type II membrane protein and contains two PLD phosphodiesterase domains. This protein influences the processing of the amyloid-beta precursor protein. Mutations in this gene are associated with risk of Alzheimer's disease. The term "nucleic acid sequence of the 3'-untranslated region of PLD3, a fragment thereof, or a variant of this nucleic acid sequence or fragment" refers to a nucleic acid sequence comprising, preferably consisting of a nucleic acid sequence selected from the group consisting of SEQ ID Nos.: 90 to 104 of the sequence listing or a fragment thereof, or a variant of this nucleic acid sequence or fragment. In one embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical to a nucleic acid sequence selected from the group consisting of SEQ ID Nos.:90 to 104. In a particularly preferred embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of the nucleic acid sequence of SEQ ID No.: 96 or comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical to the nucleic acid sequence of SEQ ID No.: 96 . The term MT_RNR1 refers to the mitochondrially encoded 12S RNA and includes the MT_RNR1 gene. This RNA gene corresponds to the Mt_rRNA class. Diseases associated with MT-RNR1 include restrictive cardiomyopathy and auditory neuropathy. Among its related pathways are ribosome biogenesis in eukaryotes and the transductional fidelity of CFTR (class I mutations). ncznnn / i znz / R / v The term "nucleic acid sequence of the 3'-untranslated region of MT_RNR1, a fragment thereof, or a variant of this nucleic acid sequence or fragment" refers to a nucleic acid sequence comprising, preferably consisting of of a nucleic acid sequence selected from the group consisting of SEQ ID Nos.: 105 to 121 of the sequence listing or a fragment thereof, or a variant of this nucleic acid sequence or fragment. In one embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical to a sequence of nucleic acid selected from the group consisting of SEQ ID Nos.: 105 to 121. In a particularly preferred embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of the nucleic acid sequence of SEQ ID No. : 115 or comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical to the nucleic acid sequence of SEQ ID No. : 115. In a particularly preferred embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of the nucleic acid sequence of positions 1 to 71, positions 1 to 107, positions 37 to 107, positions 37 to 142, or positions 71 to 142 of SEQ ID Nos.: 115 or comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical to that nucleic acid sequence of positions 1 to 71, positions 1 to 107, positions 37 to 107, positions 37 to 142, or positions 71 to 142 of SEQ ID No.: 115. The term "HLA-DRB4" refers to major histocompatibility complex, class II, DR Beta 4 and includes the HLA-DRB4 gene. HLA-DRB4 corresponds to HLA class II beta chain paralogs. This class II molecule is a heterodimer consisting of an alpha chain (DRA) and a beta chain (DRB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed on cells that present the antigen (APC: B lymphocytes, dendritic cells, macrophages). The term "nucleic acid sequence of the 3'-untranslated region of HLA-DRB4, a fragment thereof, or a variant of this nucleic acid sequence or fragment" refers to a nucleic acid sequence comprising, preferably consisting of a nucleic acid sequence selected from the group consisting of SEQ ID Nos.: 122 to 143 of the sequence listing or a fragment thereof, or a variant of this nucleic acid sequence or fragment. In one embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical to a sequence of nucleic acid selected from the group consisting of SEQ ID Nos.: 122 to 143. In a particularly preferred embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of the nucleic acid sequence of SEQ ID No. : 126 or comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical to the nucleic acid sequence ncznnn / ι znz / R / v deSEQID No.: 126. The term "any combination of two or more of the nucleic acid sequences, fragments and / or variants" with respect to the nucleic acid sequences and the 3'-untranslated regions of certain genes, fragments thereof or variants of these sequences of nucleic acid or fragments means that 2 or more, 3 or more, or 4 or more and preferably up to 6 or up to 5 of the nucleic acid sequences, fragments and / or variants are aligned head to tail, optionally separated by linkers. In one embodiment, the combination of two or more of the nucleic acid sequences, fragments and / or variants comprises two or more different and / or two or more identical nucleic acid sequences, fragments and / or variants. In one embodiment, the combination of two or more of the nucleic acid sequences, fragments and / or variants comprises two or more different nucleic acid sequences, fragments and / or variants of the 3'-untranslated region thereof and / or or different genes. In one embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical to a sequence of nucleic acid selected from the group consisting of SEQ ID Nos.: 144 to < 220, preferably uplink signals 174 and 208 to 220. In one embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of a nucleic acid sequence selected from the group consisting of SEQ ID Nos.: 144 to 220, preferably SEQ ID Nos.: 174 and 208 to 220 in a fragment thereof, or a variant of this nucleic acid sequence or fragment. In a particularly preferred embodiment, the term refers to a nucleic acid sequence comprising, preferably consisting of the nucleic acid sequence of SEQ ID No.: 74 or comprising, preferably consisting of a nucleic acid sequence that is at least 90%, preferably at least 95%, more preferably at least 98% identical to the nucleic acid sequence of SEQ ID No.: 174. The term "linker" according to the invention refers to a nucleic acid sequence added between two nucleic acid sequences in order to connect these two nucleic acid sequences. There is no particular limitation with respect to the linker sequence. According to the invention, a nucleic acid molecule or a nucleic acid sequence refers to a nucleic acid which is preferably deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). According to the invention, nucleic acids comprise genomic DNA, cDNA, mRNA, recombinantly prepared and chemically synthesized molecules. According to the invention, a nucleic acid may be in the form of a covalently closed circular or linear molecule and single-stranded or double-stranded. In the context of the present invention, the term "RNA" refers to a molecule that comprises nucleotide residues and is preferably composed entirely or substantially of ribonucleotide residues. The term "ribonucleotide" refers to a nucleotide with an oxyl group at the 2' position of a β-D-ribofuranosyl group. The term "RNA" includes double-stranded RNA, single-stranded RNA, isolated RNA such as partially or fully purified RNA, essentially pure RNA, synthetic RNA, and recombinantly generated RNA such as modified RNA that differs from naturally occurring RNA. by the addition, deletion, ncznnn / i znz / R / v substitutions and / or alteration of one or more nucleotides. These alterations can include the addition of non-nucleotide material, such as to the ends of an RNA or internally, for example into one or more nucleotides of the RNA. The nucleotides in RNA molecules may also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or chemically synthesized deoxynucleotides. These altered RNAs may be referred to as analogs, particularly naturally occurring RNA analogs. According to the invention, RNA includes mRNA. The term "mRNA" means "messenger RNA" and refers to a transcript that is generated by using a DNA template that codes for a peptide or protein. Typically, mRNA comprises a 5'-UTR, a protein-coding region, a 3'-UTR, and a poly(A) sequence. RNA can be generated by in vitro transcription from an RNA template. The in vitro transcription methodology is known to the skilled person. For example, there are a variety of commercially available in vitro transcription kits. According to the invention, RNA can be modified by further stabilizing modifications and by capping, in addition to the modifications according to the invention. In one embodiment of the present invention, the RNA is self-replicating RNA, such as single-stranded self-replicating RNA. In one embodiment, the self-replicating RNA is sense or sense single-stranded RNA. In one embodiment, the self-replicating RNA is viral RNA or RNA derived from viral RNA. In one embodiment, the self-replicating RNA is alpha-viral genomic RNA or is derived from alpha-viral genomic RNA. In one embodiment, the self-replicating RNA is a viral gene expression vector. In one embodiment, the virus is Semliki forest virus. In one embodiment, the self-replicating RNA contains one or more transgenes. In one embodiment, whether the RNA is viral RNA or is derived from viral RNA, the transgenes may partially or completely replace viral sequences such as sequences encoding structural proteins. In one embodiment, the self-replicating RNA is in vitro transcribed RNA. The term "5'-cap" refers to a cap structure found at the 5' end of an mRNA molecule and generally consists of a guanosine nucleotide connected to the mRNA by an unusual 5' to 5' triphosphate bond. In one embodiment, this guanosine is methylated at position 7. The term "conventional 5'-cap" refers to a naturally occurring RNA 5'-cap, in preference to the 7-methylguanosine (m7G) cap. In the context of the present invention, the term "5'-cap" includes a 5'-cap analog that resembles the RNA cap structure and is modified to possess the ability to stabilize RNA if bound to it. , preferably in vivo and / or in a cell. The provision of an RNA with a 5'-cap or 5'-cap analog can be achieved by in vitro transcription of a DNA template in the presence of this 5'-cap or 5'-cap analog, wherein the 5'-cap is co-transcriptionally incorporated into the generated RNA strand, or the RNA can be generated, for example, by in vitro transcription, and the 5'-cap can be post-transcriptionally generated using enzymes capping enzymes, eg, vaccinia virus capping enzymes. The term "nucleic acid" according to the invention also comprises a chemical derivatization of a nucleic acid on a nucleotide base, on sugar or on phosphate, and nucleic acids containing unnatural nucleotides nc7nnn / i 7Π7 / Β / Υ and nucleotide analogs. "Fragment" or "fragment of a nucleic acid sequence" refers to a part of a nucleic acid sequence, ie, a sequence that represents the nucleic acid sequence shortened at the 5' and / or 3' ends. Preferably, a fragment when replacing this nucleic acid sequence in an RNA molecule retains RNA stability and / or transductional efficiency. Preferably, a fragment of a nucleic acid sequence comprises at least 80%, preferably at least 90%, 95%, 96%, 97%, 98%, or 99% of the nucleotide residues of the nucleic acid sequence. nucleic acid. The term "variant" with respect to, for example, nucleic acid and amino acid sequences, according to the invention includes any of the variants, in particular mutants, splice variants, conformations, isoforms, allelic variants, species variants and species homologues, particularly those that occur naturally. An allelic variant refers to an alteration in the normal sequence of a gene, the meaning of which is often unclear. Whole gene sequencing frequently identifies numerous allelic variants for a given gene. A species homologue is a nucleic acid or amino acid sequence with a different species of origin from that of a given nucleic acid or amino acid sequence. According to the invention, nucleic acid variants include single or multiple nucleotide deletions, additions, mutations and / or insertions compared to the reference nucleic acid. Deletions include removal of one or more nucleotides from the reference nucleic acid. Addition vanities include 5'- and / or 3'-terminal fusions and one or more nucleotides, such as 1, 2, 3, 5, 10, 20, 30, 50, or more nucleotides. Mutations may include but are not limited to substitutions, where at least one nucleotide in the sequence is removed and another nucleotide is inserted in its place (such as transversions and transitions), abasic sites, crosslink sites, and chemically altered or modified bases. Insertions include the addition of at least one nucleotide in the reference nucleic acid. With respect to nucleic acid molecules, the term "variant" includes degenerate nucleic acid sequences, wherein a degenerate nucleic acid according to the invention is a nucleic acid that degenerates from a reference nucleic acid in codon sequence due to to the degeneracy of the genetic code. Preferably, the degree of identity between a given nucleic acid sequence and a nucleic acid sequence that is a vanant of this given nucleic acid sequence will be at least 70%, preferably at least 75%, preferably at least 80%, more preferably 85%, more preferably at least 90% or most preferably at least 95%, 96%, 97%, 98% or 99%. The identity side is preferably given for a region of at least about 30, at least about 50, at least about 70, at least about 90, at least about 100, at least about 150, at least about 200, at least about 250 , at least about 300, or at least about 400 nucleotides. In preferred embodiments, the degree of identity is given for the full length of the reference nucleic acid sequence. ncznnn / i 7f\7iw "Sequence similarity" indicates the percentage of amino acids that are either identical or represent conservative amino acid substitutions. "Sequence identity" between two polypeptide or nucleic acid sequences indicates the percentage of amino acids and nucleotides that are identical between the sequences. The term "% identical" is proposed to refer, in particular, to a percentage of nucleotides that are identical in optimal alignment between two sequences to be compared, with this percentage being purely statistical, and the differences between the two sequences. they may be randomly distributed over the entire length of the sequence and the sequence to be compared may comprise additions or deletions compared to the reference sequence, in order to obtain optimal alignment between two sequences. Comparisons of two sequences are usually carried out by comparing these sequences, after optimal alignment, with respect to a "comparison window" segment, in order to identify local regions of corresponding sequences. The optimal alignment for a comparison can be carried out manually or with the help of the local homology algorithm by Smith and Waterman, 1981, Ads App. Math. 2, 482, with the aid of the local homology algorithm of Neddleman and Wunsch, 1970, J. Mol. Biol. 48,443, and with the help of the similarity search algorithm of Pearson and Lipman, 1988, Proc. nati. Acad. Sci. USA 85, 2444 or with the aid of computer programs using the algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in the Wisconsin Genetics Sorftware Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.) . Percentage identity is obtained by determining the number of identical positions in which the sequences to be purchased correspond, dividing that number by the number of positions compared, and multiplying this result by 100. For example, the BLAST program "BLAST 2 Sequences" which is available from the website http: / / www.ncbi.nlm.nih.gov / blast / bl2seq / wblast2.cgi, can be used. A nucleic acid is "capable of hybridizing" or "hybridizes" to another nucleic acid if the two sequences are complementary to each other. A nucleic acid is "complementary" to another nucleic acid if the two sequences are capable of forming a stable duplex with each other. According to the invention, hybridization is preferably carried out under conditions that allow specific hybridization between polynucleotides (stringent conditions). Stringent conditions are described, for example, in Molecular Cloning: ALaboratory Manual, J. Sambrook et al., Editors, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989 or Current Protocols in Molecular Biology, F.M. Ausubel et al., Editors, John Wiley & Sons, Inc., New York, and refer, for example, to hybridization at 65°C in hybridization buffer (3.5 x SSC), 0.02% Ficoll, 0.02% polyvinylpyrrolidione, 0.02% bovine serum albumin, 2.5mM NaH2PO4 (pH 7), 0.5% SDS, 2mM EDTA). SSC is 0.15 M sodium chloride / 0.15 M sodium citrate, pH 7. After hybridization, the membrane onto which the DNA has been transferred is washed, for example, in 2 x SSC at room temperature and then in 0.1- 0.5 x SSC / 0.1 x SDS at temperatures up to 68°C. Percent complementarity indicates the percentage of contiguous residues in a nucleic acid molecule that can form hydrogen bonds (eg Watson-Crick base pairing) with a second nucleic acid sequence (eg 5,6, 7, 8, 9, 10 out of 10 which is 50%, 60%, 70%, 80%, 90%, and ncznnn / i znz / R / v 100% complementary). "Perfectly complementary" or "completely complementary" means that all contiguous residues in one nucleic acid sequence will hydrogen bond to the same number of contiguous residues in a second nucleic acid sequence. Preferably, the degree of complementarity according to the invention is at least 70%, preferably at least 75%, preferably at least 80%, more preferably at least 8%, even more preferably at least 90% or much more preferably at least 95%, 96%, 97%, 98% or 99%. More preferably, the degree of complementarity according to the invention is 100%. The term "derivative" encompasses any chemical derivatization of a nucleic acid at a nucleotide base, at the sugar, or at the phosphate. The term "derivative" also encompasses nucleic acids that contain nucleotides and nucleotide analogs that do not occur naturally. Preferably, a derivatization of a nucleic acid increases its stability. Fragments or variants of specific nucleic acid sequences or nucleic acid sequences having a particular degree of identity to specific nucleic acid sequences preferably have at least one functional property of the specific sequences and are preferably functionally equivalent to the sequences specific, eg, nucleic acid sequences that exhibit the same or similar properties to those of the specific nucleic acid sequences. An important property is to retain or improve the stability of an RNA molecule and / or transductional efficiency and includes in particular an ability to increase, in a functional binding to a nucleic acid that can be transcribed into RNA (transcriptional nucleic acid sequence) or a nucleic acid sequence encoding a peptide or protein, the stability and / or translation efficiency of the RNA produced from this nucleic acid or from the nucleic acid sequence encoding a peptide or protein in the complete RNA molecule. In one embodiment, if a specific nucleic acid sequence is active to increase the translational efficiency and / or stability of another nucleic acid sequence, a variant fragment of the specific nucleic acid sequence or a nucleic acid sequence having a degree A particular identity to the specific nucleic acid sequence is also active in increasing the translational efficiency and / or stability of the other nucleic acid sequence (when it replaces the specific nucleic acid sequence). A variant fragment of the specific nucleic acid sequence or a nucleic acid sequence having a particular degree of identity to the specific nucleic acid sequence may be as active as or more active than the specific nucleic acid sequence or the activity of a specific nucleic acid sequence. fragment or variant of the specific nucleic acid sequence or of a nucleic acid sequence having a particular degree of identity to the specific nucleic acid sequence may be at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the activity of the specific nucleic acid sequence. According to the invention, "functional link" or "functionally linked" refers to a connection within a functional relationship. A nucleic acid is "functionally linked" and is functionally related to another nucleic acid sequence. For example, a promoter is functionally linked to a ncznnn / i znz / R / v coding sequence if it influences the transcription of this coding sequence. Functionally linked nucleic acids are typically adjacent to each other, where it is appropriate to separate them by additional nucleic acid sequences, and in particular embodiments, are transcribed by RNA polymerase to give a single RNA molecule (common transcript). Preferably, a sequence that is a variant to a specific sequence, when it replaces the specific sequence in an RNA molecule, retains RNA stability and / or transductional efficiency. According to the invention, a "nucleic acid sequence that is derived from a nucleic acid sequence" refers to a nucleic acid that is a variant of the nucleic acid from which it is derived. "3' end of a nucleic acid" refers according to the invention to that end which has a free hydroxy group. In a schematic representation of double-stranded nucleic acids, particularly DNA, the 3' end is always on the right hand side. "5' end of a nucleic acid" refers according to the invention to that end which has a free phosphate group. In a schematic representation of double-stranded nucleic acids, in particular delivery, the 5' end is always on the left side. 5’ end 5’-P-NNNNNN-OH-3’ 3’ end 3’-HO-NNNNNN-P-5’ In particular embodiments, a nucleic acid is operably linked according to the invention to expression control sequences that may be homologous or heterologous to the nucleic acid. A transcribable nucleic acid sequence, in particular a nucleic acid sequence encoding a peptide or protein, and an expression control sequence are "functionally" linked to one another, if they are covalently linked to one another in such a way that the transcription or expression of the transcribable and in particular coding nucleic acid sequence is under the control or under the influence of the expression control sequence. If the nucleic acid sequence is to be translated into a functional peptide or protein, induction of an expression control sequence operatively linked to the coding sequence results in transcription of this coding sequence, without causing a frameshift in the coding sequence. coding sequence or the coding sequence that is incapable of being translated into the desired peptide or protein. The term "expression control sequence" comprises according to the invention promoters, ribosome binding sequences and other control elements that control the transcription of a gene or the translation of an RNA derivative. In particular embodiments of the invention, the expression control sequences may be regulated. The precise structure of expression control sequences can vary depending on the species or cell type but usually includes 5'-nontranscribed and 5'- and 3'-nontranslated sequences involved in the initiation of transcription and translation, respectively, such as TATA sequence, cap sequence, CAAT sequence and the like. More specifically, 5'-nontranscribed expression control sequences include a promoter region encompassing a promoter sequence for transcription control of the operably linked gene. Expression control sequences may also include enhancer sequences or activator sequences in the 5' direction. ncznnn / ι znz / R / v The nucleic acid sequences specified herein, in particular coding and transcriptible nucleic acid sequences, may be combined with any of the expression control sequences, in particular promoters, which may be homologous or heterologous to the nucleic acid sequences, with the term "homologous" referring to the fact that a nucleic acid sequence is also naturally functionally linked to the expression control sequence, and the term "heterologous" referring to the fact that a nucleic acid sequence is not functionally naturally linked to the expression control sequence. The term "promoter" or "promoter region" refers to a DNA sequence upstream of the coding sequence of a gene that controls expression of the coding sequence by providing a recognition and binding site for the RNA polymerase. The promoter region may further include recognition or binding sites for additional factors involved in regulating the transcription of this gene. A promoter may control the transcription of a prokaryotic or eukaryotic gene. A promoter may be "inducible" and initiate transcription in response to an inducer, or may be “constitutive" if transcription is not controlled by an inducer. An inducible promoter is expressed only to a very small degree, or not at all, if an inducer is absent. In the presence After the inducer, the gene is “turned on” or the level of transcription is increased.This was usually measured by the binding of a specific transcription factor. Examples of preferred promoters according to the invention are promoters for SP6, T3 or T7 polymerase. According to the invention, the term "expression" is used in its most general meaning and encompasses the production of RNA or of RNA and protein. It also comprises the partial expression of nucleic acids. Additionally, the expression can be transient or stable. With respect to RNA, the term "expression" or "translation" refers to the process in a cell's ribosomes by which a strand of messenger RNA directs the assembly of an amino acid sequence to produce a peptide or protein. The term "nucleic acid sequences" that can be transcribed into a common transcript" means that these nucleic acid sequences are operatively linked to one another in such a way that, where appropriate after linearization such as enzyme cleavage of restriction of the nucleic acid molecule comprising this nucleic acid sequence, in particular of a closed, circular nucleic acid molecule, transcription under the control of a promoter results in an RNA molecule comprising the transcripts of these sequences of nucleic acids covalently linked together, where appropriate separated by sequences located between them. In the context of the present invention, the term "transcription" refers to a process, whereby the genetic code in a DNA sequence is transcribed into RNA. Subsequently, the RNA can be translated into protein. According to the present invention, the term "transcription" comprises "in vitro transcription" wherein the term "in vitro transcription" refers to a process whereby RNA, particularly mRNA, is synthesized in vitro in a cell-free system. Preferably, cloning vectors are applied for the generation of transcripts. These cloning vectors are generally designed as transcription vectors and are according to the present invention ncznnn / i znz / R / v encompassed by the term "vector". According to the present invention, the RNA is preferably in vitro transcribed RNA (IVT-RNA) and can be obtained by in vitro transcription of an appropriate DNA template. The promoter for controlling transcription can be any promoter for any RNA polymerase. A DNA template for in vitro transcription can be obtained by cloning a nucleic acid, in particular cDNA, and introducing it into an appropriate vector for in vitro transcription. cDNA can be obtained by reverse transcription of RNA. The term "nucleic acid sequence transcribed from a nucleic acid sequence" refers to RNA, where the latter nucleic acid sequence is a transcription product as part of a complete RNA molecule. The term "nucleic acid sequence that is active in order to increase the translational efficiency and / or the stability of a nucleic acid sequence" means that the first nucleic acid sequence is capable of modifying, in a common transcript with the second nucleic acid sequence, the translation efficiency and / or stability of this second nucleic acid sequence in such a way that the translation efficiency and / or stability is increased compared to the translation efficiency and / or stability of the second sequence of nucleic acid without the first nucleic acid sequence. In this context, the term "translation efficiency" refers to the amount of translation product provided by an RNA molecule over a particular period of time and the term "stability" refers to the half-life of an RNA molecule. The modification, and thus the stabilization and / or increase in translation efficiency, of RNA can be achieved according to the invention by genetically modifying expression nucleic acid molecules of the invention when used as expression vectors of a such as to allow the transcription of RNA with 3'-untranslated regions as described herein at its 3' end and preferably between the sequence coding for a peptide or protein (open reading frame) and the poly sequence. (TO). The term "3'-untranslated region" refers to a region that is located at the 3' end of a gene, downstream of the stop codon and a protein-coding region and that is transcribed but not translated. in an amino acid sequence, or to the corresponding region in an RNA molecule. According to the invention, a first polynucleotide region is considered to be located in the 3' direction of a second polynucleotide region, if the 5' end of the first polynucleotide region is the closest part of the first polynucleotide region. to the 3' end of the second polynucleotide region. The 3'-untranslated region typically extends from the stop codon for a translation product to the poly(A) sequence that is usually attached after the transcription process. The 3'-untranslated regions of mammalian mRNA typically have a region of homology known as the AAUAAA hexanucleotide sequence. This sequence is presumably the poly(A) binding signal and is often located 10 to 30 bases downstream of the poly(A) binding site. The 3'-untranslated regions may contain one or more inverted repeats that can fold into stem-loop structures that act as barriers to hexoribonucleases or interact with proteins known to increase RNA stability (for example, RNA-binding proteins). ). ncznnn / ι znz / R / v The 5'-3' untranslated regions may be, according to the invention, operably linked to a transcriptional and in particular coding nucleic acid, so that these regions are associated with the nucleic acid in such a way as to increase stability and / or efficiency of translation of the transcribed RNA of the transcribed nucleic acid. The 3'-untranslated regions of immunoglobulin mRNAs are relatively short (less than AP 300 nucleotides), whereas the 3'-untranslated regions of other genes are relatively long. For example, the 3'-untranslated region of tPA is approximately 800 nucleotides in length, that of factor VIII is approximately 1800 nucleotides in length, and that of erythropoietin is approximately 560 nucleotides in length. It can be determined according to the invention, whether a 3'-untranslated region or a nucleic acid sequence derived from it increases the stability and / or translation efficiency of the RNA, by incorporating the 3'-untranslated region or the sequence of nucleic acid derived from it in the 3'-untranslated region of a gene and by measuring whether this incorporation increases the amount of protein synthesized. The foregoing therefore applies to the case in which, according to the invention, a nucleic acid comprises two or more 3'-untranslated regions that are preferably sequentially coupled with or without a linker between them, preferably in a "chain relationship". "tailed" (ie, the 3'-untranslated regions have the same orientation, preferably the orientation that occurs naturally in a nucleic acid). According to the invention, the term "gene" refers to a particular nucleic acid sequence that is responsible for producing one or more cellular products and / or for achieving one or more intercellular or intracellular functions. More specifically, the term refers to a section of DNA that comprises a nucleic acid encoding a specific protein or a functional or structural RNA molecule. Polladenlation is the addition of a poly(A) sequence or tail to a primary RNA transcript. The poly(A) sequence consists of multiple adenosine monophosphates. In other words, it is a stretch of RNA that has only adenine chains. In eukaryotes, polladenlation is part of the process that produces mature messenger RNA (mRNA) for translation. Therefore, it is part of the larger process of gene expression. The polling process begins as the transcription of a gene ends, or ends. The 3'-major segment of the newly made pre-mRNA is first cleaved by a set of proteins; these proteins then synthesize the poly(A) sequence at the 3' end of the RNA. The poly(A) sequence is important for nuclear export, translation, and mRNA stability. The sequence shortens over time, and when it is short enough, the mRNA is enzymatically degraded. The terms "polyadenyl sequence," "poly(A) sequence," or "poly(A) tail or tip" refer to a sequence of adenyl residues that is typically located at the 3' end of an RNA molecule. The invention provides this sequence to be bound during RNA transcription by means of a DNA template based on repeating thymidyl residues in the strand complementary to the strand complementary to the coding strand, whereas the sequence would not normally be found. encodes in DNA but binds to the free 3' end of ncznnn / ι ζηζ / κ / γ RNA by a template-independent RNA polymerase after transcription in the nucleus. According to the invention, in one embodiment, a poly(A) sequence has at least 20, preferably at least 40, preferably at least 80, preferably at least 100 and preferably up to 500, preferably up to 400, so preferably up to 300, preferably up to 200, and in particular up to 150, A nucleotides, preferably consecutive A nucleotides, and in particular about 120 A nucleotides. The term "A nucleotides" or "A" refers to adenyl residues. In a preferred embodiment, a nucleic acid molecule according to the invention is a vector. The term "vector" is used herein in its most general meaning and encompasses any of the intermediate vehicles for a nucleic acid that, for example, allow this nucleic acid to be introduced into prokaryotic and / or eukaryotic host cells, and where appropriate, integrate into a genome. These vectors are replicated and / or expressed preferentially in a cell. Vectors comprise plasmids, phagemids, or virus genomes. The term "plasmid", as used herein, generally refers to a construct of extrachromosomal genetic material, usually a circular duplex DNA, that can replicate independently of chromosomal DNA. The nucleic acids described herein can be recombinant and / or isolated molecules. An "isolated molecule" is used as an example, it is intended to refer to a molecule that is substantially free of other molecules such as other cellular material. The term "isolated nucleic acid" means according to the invention that the nucleic acid has been (i) amplified ¡55, for example by polymerase chain reaction (PCR), (ii) produced recombinantly by cloning, ( iii) purified, eg by cleavage and gel electrophoretic fractionation, or (iv) synthesized, eg by chemical synthesis. An isolated nucleic acid is a nucleic acid available for manipulation by recombinant DNA techniques. The term "recombinant" in the context of the present invention means "made through genetic engineering". Preferably, a "recombinant subject" such as a recombinant cell in the context of the present invention is not naturally occurring. The term "naturally occurring" as used for example refers to the fact that an object can be found in nature. For example, a peptide or nucleic acid that is present in an organism (including viruses) and can be isolated from a source in nature and has not been intentionally modified by man in the laboratory is occurring naturally. According to the invention, the term "host cell" refers to any cell that can be transformed or transfected with an exogenous nucleic acid. The term "host cell" comprises, according to the invention, prokaryotic (for example E. coli) or eukaryotic (for example yeast cells and insect cells) cells. Particular preference is given to mammalian cells such as cells from humans, mice, hamsters, pigs, goats, primates. Cells can be derived from a multiplicity of tissue types and include primary cells and cell lines. Specific examples include keratinocytes, peripheral blood leukocytes, bone marrow stem cells, and embryonic stem cells. In other embodiments, the host cell is a cell presenting ncznnn / i znz / R / v the antigen, in particular a dendritic cell, a monocyte or a macrophage. A nucleic acid may be present in the host cell in a single copy or in multiple copies, in one embodiment, it is expressed in the host cell. E. coli is a gram-negative, facultatively anaerobic, rod-shaped bacterium of the genus Escherichia that is commonly found in the small intestine of warm-blooded organisms. The bacterium can be easily and inexpensively grown in a laboratory setting and has been intensively researched for over 60 years. E. coli is the most widely studied prokaryotic model organism, and an important species in the fields of biotechnology and microbiology, where it has served as the host organism for much of the recombinant DNA work. E. coli strains according to the invention include AG1, AB1157, B2155, BL21, BNN93, BNN97, BW26434, C600, CSH50, D1210, DB3.1, DH1, DH5a, DH10B, DH12S, DM1, E. cloni( f E.coli K12 ER2738, ER2566, ER2267, HB101, IJ1126, IJ1127, JM83, JM101, JM103, JM105, JM106, JM107, JM108, JM109, JM110, JM2.300, LE392, Machi, MC1061, MC1061, MC1061, MC1061, MC1061, MC1061 , Omn¡MAX2, RR1, RV308, SOLR, SS320, STBL2, STBL3, STBL4, SURE, SURE2, TG1, TOP10, ToplOF', W3110, WM3064, XL1-Blue, XL2-Blue, XL1-Red and XL10-Gold. According to the present invention, the term "peptide" comprises oligo- and poly-peptides and refers to substances comprising two or more, preferably 3 or more, preferably 4 or more, preferably 6 or more, preferably 8 or more, preferably 10 or more, preferably 13 or more, preferably 16 or more, preferably 20 or more, and up to preferably 50, preferably 100 or preferably 150, consecutive amino acids linked together by peptide bonds. The term "protein" refers to large peptides, preferably peptides having at least 151 amino acids, but the terms "peptide" and "protein" are usually used herein synonymously. The terms "peptide" and "protein" comprise according to the invention substances containing not only amino acid components but also non-amino acid components such as sugars and phosphate structures, and also comprise substances comprising linkages such as ester, thioether or disulfide. According to the present invention, a nucleic acid such as RNA can code for a peptide or protein. Accordingly, a transcribed nucleic acid sequence or a transcript thereof may contain an open reading frame (ORF) encoding a peptide or protein. This nucleic acid can express the encoded peptide or protein. For example, this nucleic acid can be a nucleic acid encoding and expressing an antigen or a pharmaceutically active peptide or protein such as an immunologically active compound (which is preferably not an antigen). According to the invention, the term "nucleic acid encoding a peptide or protein" means that the nucleic acid, if present in the appropriate environment, preferably within a cell, can direct the assembly of amino acids to produce the peptide or protein. during the translation process. Preferably, the RNA according to the invention is capable of interacting with the cellular translation machinery that allows the translation of the peptide or protein. According to the invention, in one embodiment, the RNA comprises or consists of pharmaceutically active ncznnn / i znz / R / v RNA. A "pharmaceutically active RNA" can be RNA encoding a pharmaceutically active peptide or protein. A "pharmaceutically active peptide or protein has an advantageous positive effect on the condition or disease state of a subject when administered to the subject in a therapeutically effective amount." Preferably, a pharmaceutically active peptide or protein has curative or palliative properties and can be administered to ameliorate, alleviate, ameliorate, reverse, delay the onset of, or lessen the severity of one or more symptoms of a disease or disorder. A pharmaceutically active peptide or protein may have prophylactic properties and may be used to delay the onset of a disease or to lessen the severity of this disease or pathological condition. The term "pharmaceutically active protein or peptide" includes complete proteins or polypeptides, and may also refer to pharmaceutically active fragments thereof. It can also include pharmaceutically active analogues of a peptide or protein. The term "pharmaceutically active peptide or protein" includes peptides and proteins that are antigenic, ie, the peptide or protein elicits an immune response in a subject that may be therapeutically or partially or fully protective. Examples of pharmaceutically active proteins include, but are not limited to, cytokines and immune system proteins such as immunologically active compounds (for example interleukins, colony-stimulating factor (CSF), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), erythropoietin, tumor necrosis factor (TNF), interferons, integrins, addressins, seletins, homing receptors, T-cell receptors, immunoglobulins, soluble major histocompatibility complex antigens , immunologically active antigens such as bacterial, parasitic or viral antigens, allergens, self-antigens, antibody), hormones (insulin, thyroid hormone, catecholamines, gonadotropins, trophic hormones, prolactin, oxytocin, dopamine, bovine somatotropin, leptins and the like), growth hormones (for example, human growth hormone), growth factors (for example, epidermal growth factor, nerve growth factor, insulin-like growth factor, and the like), growth factor receptors, enzymes (plasminogen activator cells, streptokinase, biosynthetic or degradative cholesterol, steriodogenic enzymes, kinases, phosphodiesterases, methylases, des-methylases, dehydrogenases, cellulases, proteases, lipases, phospholipases, aromatases, cytochromes, adenylate- or guaniblasto-cyclases, neuramidases and the like), receptors (steroid hormone receptor, peptide receptors), binding proteins (growth hormone or growth factor binding proteins and the like), transcription and translation factors, tumor growth suppressor proteins (for example, angiogenesis inhibiting proteins) , structural proteins (such as collagen, fibroin, fibrinogen, elastin, tubulin, actin, and myosin), blood proteins (thrombin, serum albumin, Factor VIII, Factor VIII, insulin, Factor IX, Factor X, tissue plasminogen activator , protein C, von Wilebrand factor, anthrombin II, glucocerebrosidase, erythropoietin granulocyte colony-stimulating factor (GCSF) or modified Factor III, anticoagulants and the like. In one embodiment, the pharmaceutically active protein according to the invention is a cytokine that is involved in the regulation of lymphoid homeostasis, preferably a cytokine that is comprised of nc7nnn / i 7Π7 / Β / Υ and preferentially induces or enhances development, T cell priming, expansion, differentiation and / or survival. In one embodiment, the cytokine is an interleukin. In one embodiment, the pharmaceutically active protein according to the invention is not an interleukin selected from the group consisting of IL-2, IL-7, IL-12, IL-15, and IL-21. The term "immunologically active compound" refers to any compound that alters an immune response, preferably by inducing and / or suppressing immune cell maturation, inducing and / or suppressing cytokine biosynthesis, and / or altering humoral immunity by stimulate the production of antibodies by B cells. Immunologically active compounds possess potent immunostimulatory activity including, but not limited to, antiviral and antitumor activity, and may also reduce the expression of other aspects of the immune response, for example, change in the immune response away from a TH2 immune response, which is useful for treating a wide variety of TH2-mediated diseases. Immunologically active compounds may be useful as vaccine adjuvants. If, according to the present invention, an immune response has been induced to be enhanced by using RNA as described herein, the immune frequency can be activated or enhanced by the RNA. For example, the proteins or peptides encoded by the RNAs or process products thereof can be presented by major histocompatibility complex (MHC) proteins expressed in cells presenting the antigen. The MHC peptide complex can then be recognized by immune cells such as T cells leading to their activation. In one embodiment, RNA encoding an antigen such as a disease-associated antigen is administered to a mammal, particularly if treatment of a mammal having a disease comprising the antigen is desired. The RNA is taken up in the antigen-presenting cells (monocytes, macrophages, dendritic cells, or other cells) of the mammal. An antigenic RNA translation product is formed and the product is displayed on the cell surface for recognition by T cells. In one embodiment, the antigen is displayed on the cell surface for recognition by antigen-targeted CAR-driven T cells. In one embodiment, the antigen, or a product produced by optional processing thereof, is displayed on the cell surface in the context of MHC molecules for recognition by T cells via their T cell receptor. Alternatively, the present invention contemplates embodiments wherein RNA expressing an antigen is introduced into cells presenting the antigen ex vivo, for example antigen-presenting cells taken from a patient, and antigen-presenting cells propagated from optionally cloned ex vivo, they are transplanted back into the same patient. The transfected cells can be reintroduced into the patient using any means known in the art, preferably in sterile form by intravenous, intracavitary, intraperitoneal, or intratumoral administration. The methods of the invention may comprise an antigen presenting cell to express the RNA encoding the antigen. To this end, the methods of the invention may comprise the introduction of RNA encoding antigens into cells presenting the antigen such as dendritic cells. For the transfection of cells presenting the antigen such as dendritic cells, a pharmaceutical composition ncznnn / i znz / R / v comprising RNA encoding the antigen can be used. A delivery vehicle that targets RNA to a dendritic or other antigen-presenting cell can be administered to a patient, resulting in transfection occurring in vivo. According to the invention, it is preferred to use formulations of the RNA encoding an antigen which deliver the RNA with high selectivity to antigen-presenting cells such as dendritic cells (DC) in the vessel after systemic administration. For example, RNA formulations of nanoparticles with defined particle size where the net charge of the particles is close to zero or negative, such as electro-neutral or negatively charged RNA lipoplexes and liposomes, for example, lipoplexes comprising DOTMA and DOPE, or DOTMA and cholesterol, lead to substantial RNA expression in vessel DCs after systemic administration. Strong expression was found in target cells (vessel) while expression in other organs was low. As used herein, the term "nanoparticle" refers to any particle having a diameter that makes the particle suitable for systemic, in particular parenteral, administration of, in particular, nucleic acids, typically a diameter of less than 1000 nanometers (nm). In some embodiments, a nanoparticle has a diameter of less than 600 nm. In some embodiments, a nanoparticle has a diameter of less than 400 nm. As used herein, the term "nanoparticle formulation" or similar terms refers to any substance that contains at least one nanoparticle. In some embodiments, a nanoparticle composition is a uniform collection of nanoparticles. In some embodiments, the nanoparticle compositions are dispersions or emulsions. In general, a dispersion or emulsion is formed when at least two immiscible materials are combined. The term, "lipoplex" or "nucleic acid lipoplex", in particular "RNA lipoplex", refers to a complex of lipids and nucleic acids, in particular RNA. Lipoplexes are spontaneously formed with cationic liposomes, also frequently including a neutral "helper" liquid, mixed with nucleic acids. If the present invention relates to a charge such as a positive charge, negative charge or neutral charge or a cationic compound, negative compound or neutral compound this generally means that the mentioned charge is present at a selected pH, such as a physiological pH. . For example, the term "cationic lipid" means a lipid that has a net positive charge or a selected pH, such as physiological pH. The term "neutral lipid" means a lipid that has no net positive or negative charge and may be present in the form of an uncharged or neutral amphoteric ion at a selected pH (such as physiological pH). By "physiological pH" herein is meant a pH of about 7.5. Nanoparticle carriers such as lipid carriers contemplated for use in the present invention include any of the substances or vehicles with which nucleic acid such as RNA can associate, for example, by complexing with nucleic acid by forming vesicles in which the nucleic acid is enclosed or encapsulated. This may result in this increased range of nucleic acid compared to ncznnn / i znz / R / v naked nucleic acid. In particular, the stability of nucleic acid in blood can be increased. Cationic lipids, cationic polymers, and other positively charged substances can form complexes with negatively charged nucleic acids. These cationic molecules can be used to complex nucleic acids, thus forming eg so-called lipoplexes or polyplexes, respectively, and these complexes have been shown to deliver nucleic acids to cells. Nanoparticle nucleic acid preparations for use in the present invention can be obtained by various protocols and from various nucleic acid complexing compounds. Lipids, polymers, oligomers, or amphiphiles are typical complexing agents. In one embodiment, the complexing compound comprises at least one agent selected from the group consisting of protamine, polyethyleneimine, a poly-L-lysine, a poly-L-arginine, or a histone. According to the invention, protamine is useful as a cationic carrier agent. The term "protamine" refers to any of several relatively molecular weight, strongly basic proteins that are rich in arginine and are found especially associated with DNA rather than somatic histones in the sperm cells of various animals (such as fish). In particular, the term "protamine" refers to proteins found in fish sperm that are strongly basic, are soluble in water, do not set on heat, and yield primarily arginine on hydrolysis. In purified form, they are used in a long-acting formulation of insulin and to neutralize the anticoagulant effects of heparin. According to the invention, the term "protamine" as used herein is intended to denote any protamine amino acid sequence obtained or derived from native or biological sources including fragments thereof and multimeric forms of this amino acid sequence or fragment. Of the same. Additionally, the term encompasses (synthesized) polypeptides that are artificial and specifically designed for specific purposes and cannot be isolated from native or biological sources. The protamine used in accordance with the present invention may be sulfated protamine or protamine hydrochloride. In a preferred embodiment, the source of protamine used for the production of the nanoparticles described herein is protamine 5000 containing protamine at greater than 10 mg / ml (5000 heparin neutralizing units per ml) in isotonic saline. Liposomes are microscopic lipid vesicles that often have one or more bilayers of a vesicle-forming lipid, such as a phospholipid, and are capable of encapsulating a drug. Different types of liposomes can be used in the context of the present invention, including, but not limited to, multilamellar vesicles (MLV), small unilamellar vesicles (SUV), large unilamellar vesicles (LUV), spherically stabilized liposomes (SSL) , multivesicular vesicles (MV) and large multivesicular vesicles (LMV) as well as other bilayer forms known in the art. The size and lamellarity of the liposome will depend on the manner of preparation and the selection of the type of vesicles to be used will depend on the preferred mode of administration. There are several other forms of supramolecular organization in which lipids can occur in an aqueous medium, including lamellar phases, hexagonal and inverted hexagonal phases, cubic phases, micelles, ncznnn / i 7f\7iw inverted micelles composed of monolayers. These phases can also be obtained in combination with DNA or RNA and the interaction with RNA and DNA can substantially affect the state of the phase. The described phases may be present in the nanoparticle nucleic acid formulations of the present invention. For the formation of nucleic acid lipoplexes from nucleic acid and liposomes, any suitable method for forming liposomes can be used as long as it provides the contemplated nucleic acid lipoplexes. Liposomes can be formed using standard methods such as the reverse evaporation (REV) method, ethanol injection method, dehydration-rehydration (DRV) method, ultrasound treatment, or other suitable methods. After liposome formation, the liposomes can be sized to obtain a population of liposomes having a substantially homogeneous size range. Bilayer-forming lipids typically have two hydrocarbon chains, particularly asylum chains, and a head group, either polar or nonpolar. Bilayer-forming lipids are composed of either naturally occurring lipids or of synthetic origin, including phospholipids such as phosphatidylcholine, phosphatidylethanolamine, acid phosphatide, phosphatidylinositol, and sphingomyelin, where the two hydrocarbon chains are typically between about 14-22 carbon atoms in length, and having varying degrees of unsaturation. Other suitable lipids for use in the composition of the present invention include glycolipids and sterols such as cholesterol and its various analogs which can also be used in liposomes. Cationic lipids typically have a lipophilic moiety, such as a steral, acyl, or diacyl chain, and have an overall net positive charge. The lipid head group typically has the positive charge. The cationic lipid preferably has a positive charge of 1 to 10 valences, more preferably a positive charge of 1 to 3 valences, and most preferably a positive charge of 1 valence. Examples of cationic lipids include, but are not limited to, 1,2-di-O-octadecen¡l-3-trimethyllammon¡o-propane (DOTMA); dimethyldioctadecylammonium (DDAB); 1,2-d¡oleo¡l-3-trimethylammonio-propane (DOTAP); 1,2-dioleoyl-3-dimethyllammonio-propane (DODAP); 1,2-diacyloxy3-dimethylammonium propanes; 1,2-dialkylox¡-3-methylammon¡or propanes; dioctadecyldimethylammonium chloride (DODAC), 1,2-dimyristoyloxypropyl-1,3-dimethylhydroxyethyl ammonium chloride (DMRIE), and 2,3-dioleoyloxy¡-N-[2(sperminecarboxamide)ethyl]-N,N-dimethyl trifluoroacetate -1-propanam¡o (DOSPA). DOTMA, DOTAP, DODAC, and DOSPA are preferred. Most preferred is DOTMA. Furthermore, the nanoparticles described herein further preferably include a neutral lipid in view of structural stability and the like. The neutral lipid can be appropriately selected in view of the administration efficiency of the nucleic acid-lipid complex. Examples of neutral lipids include, but are not limited to, 1,2-di-(9Z-octadecenoyl)-SINR-glycero-3-phosphoethanolamine (DOPE), 1,2-diooleoyl-SINRglycero-3- phosphocholine (DOPC), diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, spphingomyelin, cephalin, sterol, and cerebroside. DOPE and / or DOPC is preferred. Most preferred is DOPE. In the case where a cationic liposome includes both a cationic lipid and a neutral lipid, the molar ratio of the cationic lipid to neutral lipid can be appropriately determined in view of the stability of the liposome and the like. ncznnn / ι znz / R / v According to one embodiment, the nanoparticles described herein may comprise phospholipids. The phospholipids may be a glycerophospholipid. Examples of glycerophospholipid include, but are not limited to, three types of lipids: (i) zwitterionic phospholipids, including, for example, phosphatidylcholine (PC), egg yolk phosphatidylcholine, naturally derived soybean PC, partially hydrogenated or fully hydrogenated, dimyristoyl-phosphatidylcholine (DMPC)-sphingomyelin (SM); (ii) Negatively charged phospholipids: including, for example, phosphatidylserine (PS), phosphatidylinositol (Pl), phosphatidic acid (PA), phosphatidylglycerol (PG)-d¡palm¡l PG, dimyristoyl-phosphatidylglycerol (DMPG) ; synthetic derivatives in which the conjugate produces a negatively charged zwitterionic phospholipid such as methoxy-polyethylene, glycol-diasteroyl-phosphatidylethanolamine (mPEGDSPE); and (iii) cationic phospholipids, including, for example, phosphatidylcholine or sphingomyelin of which the phosphomonoester has been O-methylated to form the cationic lipids. Association of nucleic acid to lipid carrier can occur, for example, by nucleic acid filling interstitial spaces of the carrier, such that the carrier physically entraps the nucleic acid or by covalent, ionic or hydrogen binding or by adsorption or non-specific links. Whatever the mode of association, the nucleic acid must retain its therapeutic, ie, antigen-encoding, properties. The term "disease" refers to an abnormal condition that affects the body of an individual. A disease is often considered to be a medical condition associated with specific symptoms and signs. A disease can be caused by factors originally from an external source, such as infectious disease, or it can be caused by internal dysfunctions, such as autoimmune diseases. According to the invention, the term "disease" also refers to cancer diseases. The terms cancer disease” or “cancer” (medical term: malignant neoplasm) refer to a class of diseases in which a group of cells exhibit uncontrolled growth (and vision beyond normal limits), invasion (intrusion into and destruction of adjacent tissues), and sometimes metastasis (spread to other locations in the body via lymph or blood). These three malignant properties of cancers differentiate them from benign tumors, which are self-limited and do not invade or metastasize. Most cancers form a tumor, that is, a swelling or lesion formed by abnormal growth of cells (called neoblast cells or tumor cells), but some, such as leukemia, do not. Examples of cancers include, but are not limited to, carcinoma, lymphoma, blastema, sarcoma, glioma, and leukemia. More particularly, examples of these cancers include bone cancer, blood cancer, lung cancer, liver cancer, pancreatic cancer, skin cancer, head or neck cancer, cutaneous or infraocular malignant melanoma, uterine cancer, cancer ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, colon cancer, breast cancer, prostate cancer, uterine cancer, carcinoma of the sexual and reproductive organs, Hodgkin's disease, esophageal cancer, cancer small intestine cancer, endocrine system cancer, thyroid gland cancer, parathyroid gland cancer, adrenal gland cancer, soft tissue sarcoma, bladder cancer, kidney cancer, renal cell carcinoma, renal pelvis carcinoma, central nervous system (CNS) neoplasms, neuroectodermal cancer, spinal axis tumors, glioma, meningioma, and pituitary adenoma. The term "cancer" of ncznnn / i znz / R / v according to the invention also comprises cancer metastases. The term "infectious disease" refers to any disease that can be transmitted from individual to individual or from organism to organism and is caused by a microbial agent (for example, the common cold). Examples of infectious diseases include viral infectious diseases, such as AIDS (HIV), hepatitis A, B or C, herpes, herpes zoster (chicken pox), German measles (rubella virus), yellow fever, dengue, etc., flavivirus, influenza virus, haemorrhagic infectious diseases (Marburg or Ebola virus), severe acute respiratory syndrome (SARS), bacterial infectious diseases, such as Legionnaires' disease (Legionella), sexually transmitted diseases (for example chlamydia or gonorrhea), gastric ulcer (Heliocobacter), cholera (Vibrio), tuberculosis, diphtheria, E. coli, Staphylococci, Salmonella, or Streptococci (tetanus) infections; infections by protozoan pathogens such as malaria, sleeping sickness, leishmaniasis; toxoplasmosis, ie Plasmodium, trypanosome, Leishmania and Toxoplasma infections; or fungal infections, which are caused, for example, by Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis or Candida albicans. The term "autoimmune disease" refers to any disease in which the body produces an immunogenic (ie immune system) response to some constituent of its own tissue. In other words, the immune system loses its ability to recognize some tissue or system within the body as itself and targets it and attacks it as if it were foreign. Autoimmune diseases can be classified into those in which one organ is predominantly affected (for example, autoimmune hemolytic anemia and thyroiditis), and those in which the autoimmune disease process spreads through many tissues (for example, systemic lupus erythematosus). . For example, multiple sclerosis is thought to be caused by T cells attacking the sheaths that surround nerve fibers in the brain and spinal cord. This results in loss of coordination, weakness, and blurred vision. Autoimmune diseases are known in the art and include, for example, Hashimoto's thyroiditis, Grave's disease, lupus, multiple sclerosis, rheumatoid arthritis, hemolytic anemia, anti-immune thyroiditis, systemic lupus erythematosus, celiac disease, Crohn's disease, colitis. , diabetes, scleroderma, psoriasis and the like. According to the invention, an immune response can be stimulated by introducing into a subject suitable mRNA encoding an antigen or a fragment thereof, eg, a disease-associated antigen. The term "antigen" refers to an agent comprising an epitope against which an immune response is to be generated. The term "antigen" includes in particular proteins, peptides, polysaccharides, nucleic acids, especially RNA and DNA, and nucleotides. The term "antigen" also includes agents, which become antigenic and sensitizing, only through transformation (eg immediately on the molecule or by termination with the body protein). An antigen is preferentially presentable by cells of the immune system such as cells presenting the antigen such as dendritic cells or macrophages. Furthermore, an antigen or a processing product thereof is preferentially recognizable by a T or B cell receptor, or an immunoglobulin ncznnn / i znz / R / v molecule such as an antibody. In a preferred embodiment, the antigen is a disease-associated antigen, such as a tumor-associated antigen, a viral antigen, or a bacterial antigen. The term disease-associated antigen is used in the broadest sense to refer to any antigen associated with a disease. A disease-associated antigen is a molecule containing epitopes that will stimulate the host's immune system to produce a cellular antigen-specific immune response and / or a tumor antibody response against the disease. The disease-associated antigen can therefore be used for therapeutic purposes. Disease-associated antigens are preferentially associated with infection by microbes, typically microbial agents, or are associated with cancer, typically tumors. The term "antigen-comprising disease" refers to any disease involving an antigen, for example a disease characterized by the presence and / or expression of an antigen. The disease comprising an antigen may be an infectious disease, an autoimmune disease or a cancer disease or simply cancer. As mentioned above, the antigen may be a disease-associated antigen, such as a tumor-associated antigen, a viral antigen, or a bacterial antigen. In one embodiment, a disease associated antigen is a tumor associated antigen. In this embodiment, the present invention may be useful in the treatment of cancer or cancer metastasis. Preferably, the diseased organ or tissue is characterized by diseased cells such as cancer cells that express a disease-associated antigen and / or are characterized by association of a disease-associated antigen with their surface. Immunization with disease-associated antigens intact or substantially intact tumor or fragments thereof such as MHC class I and class II peptides or nucleic acids, in particular mRNA, coding for this antigen or fragment makes it possible to produce an MHC class I and / or class II type response and of thereby stimulating T cells such as CD8+ cytotoxic T cells that are capable of using cancer cells and / or CD4+ T cells. This immunization can also produce a humoral immune response (B cell response) which results in the production of antibodies against the tumor associated antigen. Additionally, antigen presenting cells (APCs) such as dendritic cells (DCs) can be loaded with MHC class I-presented peptides by transfection with nucleic acids encoding tumor antigens in vitro and administered to a patient. In one embodiment, the term "tumor-associated antigen" refers to a cancer cell constituent that can be derived from the cytoplasm, cell surface, and cell nucleus. In particular, it refers to those antigens that are produced, preferably in large quantities, intracellularly or as surface antigens and in tumor cells. Examples for tumor antigens include, but are not limited to, HER2, EGFR, VEGF, CAMPATH1-antigen, CD22, CA-125, HLA-DR, Hodgkin's lymphoma, or mucin-1. According to the present invention, the tumor-associated antigen preferably comprises any antigen that is characteristic for tumors or cancers as well as for tumor or cancer cells with respect to the type and / or level of expression. In one embodiment, the term "tumor-associated antigen" refers to proteins that, under normal conditions, ie, in a healthy subject, are specifically expressed in a limited number of organs and / or tissues or at specific stages of development, for example, the tumor-associated antigen can, under normal conditions, be specifically expressed in stomach tissue, preferably in the gastric mucosa, in reproductive organs, for example, in testis, in trophoblastic tissue, for example, in placenta, or in cells germ line, and are expressed or formally expressed in one or more tumor tissues or cancer tissues. In this context, "a limited number" means preferably not more than 3, more preferably not more than 2 or 1. Tumor-associated antigens in the context of the present invention include, for example, differentiation antigens, preferably cell type-specific differentiation antigens, i.e. proteins that under normal conditions are specifically expressed in a certain type of cells at a certain stage of differentiation, cancer / testis antigens, i.e. proteins that under normal conditions are specifically expressed in testes and sometimes in placenta, and specific germline antigens. In the context of the present invention, the tumor associated antigen is not preferentially or only rarely expressed in normal tissues or is mutated in tumor cells. Preferably, tumor associated antigen or normal expression of tumor associated antigen identifies cancer cells. In the context of the present invention, the tumor-associated antigen that is expressed by a cancer cell in a subject, for example, in a patient suffering from a cancer disease, is preferably a self-protein in the subject. In preferred embodiments, the tumor associated antigen in the context of the present invention is expressed under normal conditions specifically in a non-essential tissue or organ, i.e. tissues or organs which when damaged by the immune system do not lead to death. of the subject, or in organs or structures of the body that are not accessible or are only difficult to access by the immune system. Preferably, a tumor associated antigen is presented in the context of MHC molecules by a cancer cell in which it is expressed. Examples for differentiation antigens that ideally meet the criteria for tumor-associated antigens as contemplated by the present invention as target structures in tumor immunotherapy, in particular, in tumor vaccination are the cell surface proteins of the Claudin family, such such as CLDN6 and CLDN18.2. These differentiation antigens are expressed in tumors of various origins and are particularly suitable as target structures in conjunction with antibody-mediated cancer immunotherapy due to their selective expression (no expression in normal tissue relevant to toxicity) and localization to the plasma membrane. . Additional examples for antigens that may be useful in the present invention are p53, ART4, BAGE, beta-catenin / m, Bcr-abL CAMEL, CAP-1, CASP-8, CDC27 / m, CDK4 / m, CEA, CLAUDIN -12, c-MYC, CT, Cyp-B, DAM, ELF2M, ETV6-AML1, G250, GAGE, GnT-V, Gap100, HAGE, HER-2 / neu, HPV-E7, HPV-E6, HAST-2 , hTERT (or hTRT), LAGE, LDLR / FUT, MAGE-A, preferably MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGEA5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE- A9, MAGE-A10, MAGE-A11, or MAGE-A12, MAGE-B, MAGE-C, MART1 / Melan-A, MC1R, Myosin / m, MUC1, MUM-1, -2, -3, NA88-A , NF1, NY-ESO-1, NY-BR-1, p190 minor BCR-abL, Pm1 / RARa, PRAME, proteinase 3, PSA, PSM, RAGE, RU1 or RU2, SAGE, SART-1 or SART-3, SCGB3A2, SCP1, SCP2, SCP3, SSX, SURVIVIN, TEL / AML1, TPI / m, TRP-1, TRP-2, TRP-2 / INT2, TPTE, and WT, preferably WT-1. The term "viral antigen" refers to any viral component that has antigenic properties, ie ncznnn / i znz / R / v, that is capable of eliciting an immune response in an individual. The viral antigen can be a viral ribonucleoprotein or an envelope protein. The term "bacterial antigen" refers to any bacterial component that has antigenic properties, ie, that is capable of eliciting an immune response in an individual. The bacterial antigen can be derived from the cell wall or membrane in the cytoplasm of the bacterium. "Antigen processing" refers to the degradation of an antigen into processing products, which are fragments of this antigen (for example, the degradation of a protein into peptide) and the association of one or more of these fragments (for example, by binding) with MHC molecules for presentation by cells, preferably cells that present the antigen to specific T cells. The term "immune response", as used herein, refers to a reaction of the immune system such as immunogenic organisms, such as bacteria or viruses, cells or substances. The term "immune response" includes the innate immune response and the adaptive immune response. Preferably, the immune response is related to an activation of immune cells, an induction of cytokine biosynthesis and / or production of antibodies. It is preferred that the immune response comprises the steps of activation of cells presenting the antigen, such as dendritic cells and / or macrophages, presentation of an antigen or fragment thereof by the cells presenting the antigen, and activation of cytotoxic T cells. because of this presentation. The term "treat" or "treatment" refers to any treatment that improves the state of health and / or prolongs (increases) the life span of an individual. This treatment can eliminate disease in an individual, stop or slow the development of a disease in an individual, inhibit or slow the development of a disease in an individual, decrease the frequency or severity of symptoms in an individual, and / or decrease recurrence in an instruction who currently has or who has previously had a disease. In particular, the term "treatment of a disease" includes curing, shortening the duration, ameliorating, slowing down, or inhibiting the progress or worsening of a disease or the symptoms thereof. The term "immunotherapy" refers to a treatment that preferably comprises a specific immune reaction and / or immune effector functions. The term "immunization" or "vaccination" describes the process of treating a subject for therapeutic or prophylactic reasons. The term "subject" or "individual" as used herein preferably refers to mammals. For example, in mammals in the context of the present invention are humans, non-human primates, domesticated animals such as dogs, cats, sheep, cattle, goats, pigs, horses, etc., laboratory animals such as mice, rats, rabbits. , horses, etc., as well as captive animals, such as zoo animals. In a preferred embodiment, the subject is a human. The term "antigen presenting cells" (APC) refers to a cell of a variety of cells capable of displaying, acquiring, and / or presenting at least one antigen or antigenic fragment in (or on) its cell surface. Antigen-presenting cells can be distinguished into professional ncznnn / i znz / R / v antigen-presenting cells and non-professional antigen-presenting cells. The term "professional antigen-presenting cells" refers to antigen-presenting cells or antigen-presenting cells that constitutively express the major histocompatibility complex class II (MHC class II) molecules required for interaction with naïve T cells. Without a T cell interacting with the MHC class II molecule complex on the membrane of the antigen-presenting cell, the antigen-presenting cell produces a costimulatory molecule that induces T cell activation. Professional antigens include dendritic cells and macrophages. The term "non-professional antigen-presenting cells" refers to antigen-presenting cells that do not constitutively express MHC class II molecules, but on stimulation by certain cytokines such as interferon-gamma. Exemplary non-professional antigen-presenting cells include fibroblasts, chemical epithelial cells, thyroid epithelial cells, glial cells, pancreatic beta cells or vascular endothelial cells. The term "major histocompatibility complex" and the abbreviation "MHC" includes MHC class I molecules and MHC class II refers to a gene complex that occurs in all vertebrates. MHC proteins or molecules are important for signaling between lymphocytes and antigen-presenting cells or diseased cells in immune reactions, where MHC proteins or molecules bind peptides and present them for recognition by T-cell receptors. MHC are expressed on the surface of cells and display both self-antigens (peptide fragments of the cell itself) and non-self-antigens (for example fragments of invading microorganisms) to a T cell. According to the invention, the term "chimeric antigen receptor (CAR)" is synonymous with the terms "chimeric T cell receptor" and "artificial T cell receptor". These terms refer to engineered receptors, which confer arbitrary specificity such as the specificity of a monoclonal antibody on an immune effector cell such as a T cell. In this way, large numbers of cancer-specific T cells can be generated for transfer. adoptive cell. Thus, a CAR may be present on T cells, for example instead of or in addition to the T cell receptor itself. This T cell does not necessarily require the processing or presentation of an antigen for target cell recognition but rather it can preferentially recognize with specificity any antigen present on a target cell. Preferably, this CAR is expressed on the surface of cells. For the purpose of the present invention, T cells comprising a CAR are encompassed by the term "T cell" as used herein. According to the present invention, the term "CAR" (or "chimeric antigen receptor") refers to an artificial receptor comprising a single molecule or a complex of molecules that recognizes, ie binds to, a target structure ( for example an antigen) on a target cell such as a cancer cell (for example by the binding of an antigen-binding domain to an antigen expressed on the surface of the target cell) and may confer specificity on an immune effector cell such such as a T cell that expresses this CAR on the cell surface. ncznnn / i 7f\7iw Preferably, recognition of the target structure by a CAR results in the activation of an immune effector cell expressing this CAR. A CAR may comprise one or more protein units, these protein units comprising one or more domains as described herein. The term "CAR" does not include T cell receptors. In one embodiment, a single chain variable fragment (scFV) derived from a monoclonal antibody is fused to CD3-zeta transmembrane and endodomain. These molecules result in the transmission of a zeta signal in response to recognition by the scFv of its target antigen on a target cell and the killing of the target cell expressing the target antigen. Antigen recognition domains that can also be used include but are not limited to individual cell receptor (TCR) alpha and beta chains in fact almost anything that binds to a given target with high affinity can be used as an antigen recognition domain. antigen recognition. After recognition of the antigen, the receptors clump together and a signal is transmitted to the cell. In this regard, a "T cell signaling domain" is a domain, preferably an endodomain, that transmits an activation signal to the T cell after antigen binding. The most commonly used endodomain component is CD3-zeta. Adaptive cell transfer therapy with CAR-engineered T cells expressing chimeric antigen receptors is a promising anti-cancer therapeutic since CAR-engineered T cells can be engineered to target virtually any tumor antigen. For example, the patient's T cells can be genetically engineered (engineered) to express specifically targeted CAR antigens on the patient's tumor cells, then infused back into the patient. According to the invention, a CAR may replace the function of a T cell receptor, and in particular, may confer reactivity such as cytolytic activity to a cell such as a T cell. However, in contrast to receptor binding of T cell to an antigen-peptide-MHC complex, a CAR can bind to a particular antigen when expressed on the cell surface. According to the invention, CARs can generally comprise three domains. The first domain is the binding domain that recognizes and binds antigen. The second domain is the costimulation domain. The costimulation domain serves to enhance the proliferation and survival of cytotoxic lymphocytes upon CAR binding to a targeted portion. The identity of the costimulatory domain is limited only in that it has the ability to enhance cell proliferation and survival at the binding of the portion targeted by the CAR. Suitable costimulatory domains include CD28, CD137 (4-1BB), a member of the tumor necrosis factor (TNF) receptor family, CD134 (0X40), a member of the TNFR receptor superfamily, and CD278 ( ICOS), a costimulatory molecule of the CD28 superfamily expressed on activated T cells. The skilled person will understand that sequence variants of these noted costimulation domains can be used without adversely impacting the invention, where the variants have the same or similar activity as the domain on which they are patterned. These variants will have at least about 80% sequence identity to the amino acid sequence of the domain from which ncznnn / i 7f\7iw are derived. In some embodiments of the invention, CAR constructs comprise two costimulation domains. While particular combinations include all possible variations of the four noted domains, specific examples include CD28+CD137 (4-1BB) and CD28+CD134 (0X40). The third domain is the activation signaling domain (or the T cell signaling domain). The activation signaling domain serves to activate cytotoxic lymphocytes in CAR binding to antigen. The identity of the activation signaling domain is limited only as it has the ability to induce selected cytotoxic lymphocyte activation upon antigen binding by the CAR. Suitable activation signaling domains include the T cell CD3[zeta] chain and the Fe[gamma] receptor. It will be understood by the skilled artisan that sequence variants of these reported activation signaling domains can be used without adversely impacting the invention, where the variants have the same or similar activity as the domain on which they are modelled. These AP variants will have at least 80% sequence identity to the amino acid sequence of the domain from which they are derived. CARs can comprise all three domains, together in the form of a fusion protein. These fusion proteins will generally comprise a binding domain, one or more costimulatory domains, and an activation signaling domain, linked in an N-terminal to C-terminal direction. However, CARs are not limited to this arrangement and other arrangements including a binding domain, an activation signaling domain, and one or more co-stimulation domains are acceptable. It will be understood that because the binding domain must be free to bind antigen, the placement of the binding domain in the fusion protein will generally be such that visualization of the region on the outside of the cell is achieved. Likewise, because the activation and costimulation signaling domains serve to induce the activity and proliferation of cytotoxic lymphocytes, the fusion protein will generally display these two domains within the cell. CARs can include additional elements, such as a signal peptide to ensure proper export of the fusion protein to the cell surface, a transmembrane domain to ensure the fusion protein is maintained as an integral membrane protein, and a hinge domain (the gap region) that imparts flexibility to the binding domain and allows for strong antigen binding. The cells used in conjunction with the CAR system of the present invention are preferably T cells, in particular cytotoxic lymphocytes, preferably selected from cytotoxic T cells, natural killer (NK) cells, and lymphokine-activated killer (LAK) cells. On activation, each of these cytotoxic lymphocytes activates the killing of target cells. For example, cytotoxic T cells activate the killing of target cells by either or both of the following means. First, on activation T cells release cytokines such as perforin, granzymes, and granulysin. Perforin and granulysin create porous cells in the target cell and the granzymes enter the cell and activate a caspase cascade in the cytoplasm that induces apoptosis (programmed cell death) of the cell. Second, apoptosis can be induced by Fas-Fas ligand interaction between T cells and target cells. The cytotoxic lymphocytes will preferably be autologous cells, although heterologous cells or allogeneic cells may be used. nc7nnn / i 7Π7 / Β / Υ A variety of methods can be used to introduce CAR constructs into T cells including non-viral-based DNA transfection, transposon-based systems, and viral-based systems. Non-viral DNA-based transfection has little risk of insertional mutagenesis. Transposon-based systems can integrate transgenes more efficiently than plasmids that do not contain an integrating element. Viral-based systems include the use of and retrovirus and lentiviral vectors. γ-retroviruses are relatively easy to produce, efficiently and permanently transduce T cells, and have been preliminarily proven to be safe from an integration standpoint in primary human T cells. Lentiviral vectors also efficiently and permanently transduce T cells but are more expensive to manufacture. They are also potentially more secure than retrovirus-based systems. The RNA described herein (for example, obtained using a nucleic acid molecule described herein as a transcription template) is also useful in the reprogramming or de-differentiation of somatic cells into stem-like cells, i.e., cells that have characteristics of stem cells, in vitro or in vivo. This may comprise the transient expression of reprogramming factors in vitro or in vivo in order to initiate reprogramming or de-differentiation processes in cells. Thus, in one embodiment, the protein or peptide encoded by a nucleic acid such as RNA described herein is a factor that allows reprogramming of somatic cells to cells having stem cell characteristics. Stem cells can be provided according to the invention without generating embryos or fetuses. Dedifferentiation of somatic cells to cells having stem cell characteristics, in particular pluripotency, can be effected by introducing RNA encoding factors that induce somatic cell dedifferentiation into somatic cells (also called somatic cell transcription factors). reprogramming (rTF)) and by culturing the somatic cells which allows the cells to dedifferentiate. After they dedifferentiate, the cells can be induced to re-differentiate into the same or a different somatic cell type such as neuronal, hematopoietic, muscular, epithelial, and other cell types. In this way, these stem cells have medical applications for the treatment of degenerative diseases by cell therapy" that can be used in new therapeutic strategies in the treatment of cardiac, neurological, endocrinological, vascular, retinal, dermatological, musculoskeletal and other disorders. diseases. Accordingly, the invention also relates to a method of providing cells having stem cell characteristics comprising the steps of (i) providing a cell population comprising somatic cells, (ii) introducing RNA of the invention capable of expressing one or more factors that allow reprogramming of somatic cells to cells having stem cell characteristics in somatic cells, and (II) allow development of cells having stem cell characteristics. In one embodiment, the method further comprises introducing into the somatic cells mlRNA that enhances the reprogramming of the somatic cells to cells having stem cell characteristics. In one embodiment, the one or more factors comprise OCT4 and SOX2. The one or more factors may further comprise KLF4 and / or c-MYC and / or NANOG and / or LIN28. In one embodiment, the one or more factors comprise ncznnn / ι znz / R / v OCT4, SOX2, KLF4 and c-MYC and may comprise LIN28 and optionally NANOG. In one embodiment, the one or more factors comprise OCT4, SOX2, NANOG, and LIN28. In one embodiment, the method further comprises the step of culturing the somatic cells in the presence of at least one histone deacetylase inhibitor, wherein the at least one histone deacetylase inhibitor preferably comprises valproic acid, sodium butyrate , trichostatin A and / or scriptaid. In one embodiment, step (iii) comprises culturing the somatic cells under embryonic stem cell culture conditions. In one embodiment, the stem cell characteristics comprise an embryonic stem cell morphology. In one embodiment, cells having stem cell characteristics have normal karyotypes, express telomerase activity, express cell surface markers that are characteristic of embryonic stem cells, and / or express genes that are characteristic of embryonic stem cells. In one embodiment, cells having stem cell characteristics exhibit a pluripotent state. In one embodiment, cells having stem cell characteristics have the developmental potential to differentiate into advanced derivatives of the three primary germ layers. In one embodiment, the somatic cells are fibroblasts such as lung fibroblasts, foreskin fibroblasts, or dermal fibroblasts. Preferably, the somatic cells are human cells. In one embodiment, the RNA is introduced into somatic cells by electroporation or lipofection. In one embodiment, RNA is introduced into somatic cells, repetitively. In one embodiment, introduction of RNA capable of expression of certain factors as described herein into somatic cells results in expression of these factors for a prolonged period of time, preferably for at least 10 days, preferably for at least 11 days and more preferably for at least 12 days. To achieve this long-term expression, the RNA is preferably introduced periodically (ie, repetitively) into cells more than once, preferably using electroporation. Preferably, RNA is introduced into the cells at least twice, more preferably at least 3 times, more preferably at least 4 times, even more preferably at least 5 times to preferably 6 times, most preferably up to 7 times or even up to 8, 9 or 10 times, preferably for a period of time of at least 10 days, preferably for at least 11 days and more preferably for at least 12 days to ensure expression of one or more factors over an extended period of time. Preferably, the time periods between repeated RNA introductions are from 24 hours to 120 hours, preferably 48 hours to 96 hours. In one embodiment, the time periods between repeated RNA introductions are no longer than 72 hours, preferably no longer than 48 hours or 36 hours. In one embodiment, prior to the next electroporation, cells are allowed to recover from the previous electroporation. In either case, conditions must be selected so that the factors are expressed in the cells in amounts and for periods of time that support the reprogramming process. ncznnn / ι znz / R / v A "stem cell" is a cell with the ability to self-renew, to remain undifferentiated, and to become differentiated. A stem cell can divide without limit, for at least the lifetime of the animal in which it naturally resides. A stem cell is not terminally differentiated; it is not in the final stage of a differentiation path. When a stem cell divides, each daughter cell can either retain a stem cell or embark on a course that leads to terminal differentiation. Totipotent stem cells are cells that have totipotent differentiation properties and are capable of developing into a complete organism. This property is possessed by cells up to the 8-cellular stage after fertilization of an oocyte by sperm. When these cells are isolated and transplanted into the uterus, they can develop into a complete organism. Pluripotent stem cells are cells capable of developing into various cells and tissues derived from the ectodermal, mesodermal, and endodermal layers. Pluripotent stem cells that are derived from the inner cell mass located within blasts, generated 4-5 days after fertilization are called “embryonic stem cells” and can differentiate into various cells of different tissue but cannot form new living organisms. . Pluripotent stem cells are stem cells that normally differentiate into only cell types specific to their tissue and organ of origin. Multipotent stem cells are involved not only in the growth and development of various tissues and organs during the fetal, neonatal and adult periods but also in the maintenance of adult tissue homeostasis and the function of inducing regeneration in tissue damage. Tissue-specific multipotent cells are collectively called "adult and stem cells." An "embryonic stem cell" or "ESC" is a stem cell that is present in or isolated from an embryo. It can be pluripotent, having the ability to differentiate into each and every cell present in the organism, or multipotent, having the ability to differentiate into more than one cell type. As used herein, "embryo" refers to an animal in the early stages of its development. These stages are characterized by implantation and gastrulation, where the three germ layers are defined and established, and by the differentiation of the germ layers into the respective organs and organ systems. The three germ layers are the endoderm, ectoderm, and mesoderm. A "blastocyst" is an embryo at an early stage of development in which the fertilized egg has cleaved, and a spherical layer of cells surrounding a fluid-filled cavity is forming, or has formed. This spherical layer of cells is the trophectoderm. Within the trophectoderm is a grouping of cells called the inner cell mass (ICM). The trophectoderm is the precursor of the placenta and the ICM is the precursor of the embryo. An adult stem cell, also called a somatic stem cell, is a stem cell found in an adult. An adult stem cell is found in a differentiated tissue, can self-renew, and can differentiate, with some limitations to produce specialized cell types from its tissue of origin. Examples include mesenchymal stem cells, hematopoietic stem cells, and neural stem cells. ncznnn / i znz / R / v A "differentiated cell" is a mature cell that has undergone progressive developmental changes to a more specialized form or function. Cellular differentiation is the process that a cell undergoes as it matures into a distinctly specialized cell type. Differentiated cells have different characteristics, perform specific functions, and are less likely to divide than their less-differentiated counterparts. An "undifferentiated" cell, eg, an immature, embryonic, or primitive cell, typically has a nonspecific appearance, may perform multiple nonspecific activities, and may poorly, if any, perform functions typically performed by differentiated cells. "Somatic cell" refers to any and all differentiated cells and does not include stem cells, germ cells, or gametes. Preferably, "somatic cell" as used herein refers to a terminally differentiated cell. As used herein, "committed" refers to cells that are believed to be permanently committed to a specific function. Committed cells are also referred to as "terminally differentiated cells." As used herein, "differentiation" refers to the adaptation of cells for a particular form or function. In cells, differentiation leads to a more committed cell. As used herein, "de-differentiation" refers to the loss of specialization in form or function. In cells, de-differentiation leads to a less committed cell. As used herein, "reprogramming" refers to the readjustment of a cell's genetic program. A reprogrammed cell preferentially exhibits pluripotency. The terms "de-differentiated" and "reprogrammed" or similar terms are used interchangeably herein to denote somatic cell-derived cells that have stem cell characteristics. However, these terms are not intended to limit the subject matter described herein by mechanical or functional considerations. The term "RNA that induces development of stem cell characteristics" or "RNA capable of expressing one or more factors that allow reprogramming of somatic cells to cells having stem cell characteristics" refers to RNA that when introduced into a somatic cell induces the cell to de-differentiate. As used herein, "germ cell" refers to a reproductive cell such as a spermatocyte or an oocyte, or a cell that will develop into a reproductive cell. As used herein, "pluripotent" refers to cells that can give rise to any cell type except cells of the placenta or other supporting cells of the uterus. Terms such as "cell having stem cell characteristics", "cell having stem cell properties" or "stem-like cell" are used herein to designate cells which, although derived from differentiated somatic non-stem cells, exhibit one or more typical characteristics of stem cells, in particular embryonic stem cells. These features include an embryonic stem cell morphology such as compact colonies, high nucleus-to-cytoplasm ratio and prominent nucleoli, normal karyotypes, expression of telomerase ncznnn / i znz / R / v activity, expression of cell surface markers that are characteristic of embryonic stem cells, and / or expression of genes that are characteristic of embryonic stem cells. Cell surface markers that are characteristic of embryonic stem cells are selected, for example, from the group consisting of stage-specific embryonic antigen-3 (SSEA-3), SSEA-4, tumor-associated antigen-1-60 (TRA-1 -60), TRA-1 -11, and TRA2-49 / 6E. These genes that are characteristic of embryonic stem cells are selected, for example, from the group consisting of endogenous OCT4, endogenous NANOG, growth and differentiation factor 3 (GDF3), reduced expression 1 (REX1), fibroblast growth factor 4 ( FGF4), embryonic cell-specific gene 1 (ESG1), developmental-associated pluripotency 2 (DPPA2), DPPA4, and telomerase reverse transcriptase (TERT). In one embodiment, the one or more typical characteristics of stem cells include pluripotency. In one embodiment of the invention, the stem cell characteristics comprise an embryonic stem cell morphology, wherein the embryonic stem cell morphology preferably comprises morphological criteria selected from the group consisting of compact colonies, high ratio of nucleus or cytoplasm, and prominent nucleoli. In certain embodiments, cells having stem cell characteristics have normal karyotypes, express telomerase activity, express cell surface markers that are characteristic of embryonic stem cells, and / or express genes that are characteristic of embryonic stem cells. Cell surface markers that are characteristic of embryonic stem cells may be selected from the group consisting of stage-specific embryonic antigen-3 (SSEA-3), SSEA-4, tumor-associated antigen-1-60 (TRA-1- 60), TRA-1-81, and TRA-2-49 / 6E and genes that are characteristic of embryonic stem cells can be selected from the group consisting of endogenous OCT4, endogenous NANOG, growth and differentiation factor 3 (GDF3) , reduced expression 1 (REX1), fibroblast growth factor 4 (FGF4), embryonic cell-specific gene 1 (ESG1), developmental associated pluripotency 2 (DPPA2), DPPA4, and telomerase reverse transcriptase (TERT). Preferably, the cells having stem cell characteristics are dedifferentiated and / or reprogrammed somatic cells. Preferably, cells having stem cell characteristics exhibit the essential characteristics of embryonic stem cells such as a pluripotent state. Preferably, cells having stem cell characteristics have the developmental potential to differentiate into advanced derivatives of all three primary germ layers. In one embodiment, the primary germ layer is endoderm and the advanced derivative is gut-like epithelial tissue. In a further embodiment, the primary germ layer is mesoderm and the advanced derivative is striated muscle and / or cartilage. In a still further embodiment, the primary germ layer is ectoderm and the advanced derivative is neural tissue and / or epidermal tissue. In a preferred embodiment, cells having stem cell characteristics have the developmental potential to differentiate into neuronal cells and / or cardiac cells. In one embodiment, the somatic cells are somatic cell-derived embryonic stem cells with a mesenchymal phenotype. In one embodiment, the somatic cells are fibroblasts such as fetal fibroblasts or postnatal fibroblasts or keratinocytes, preferably hair follicle-derived keratinocytes. In additional ncznnn / ι znz / R / v modalities, the fibroblasts are lung fibroblasts, foreskin fibroblasts, or dermal fibroblasts. In particular embodiments, the fibroblasts are fibroblasts as deposited with the American Type Culture Collection (ATCC) under Catalog number CCL-186, as deposited with the American Type Culture Collection (ATCC) under Catalog number CRL-2097, or as deposited with the American Type Culture Collection (ATCC) under Catalog Number CRL-2522, or as distributed by System Biosciences under Catalog Number PC501A-HFF. In one embodiment, the fibroblasts are adult human dermal fibroblasts. Preferably, the somatic cells are human cells. In accordance with the present invention, somatic cells may be genetically modified. The term "factor" according to the invention when used in conjunction with the expression thereof by RNA includes proteins and peptides as well as derivatives and variants thereof. For example, the term "factor" encompasses OCT4, SOX2, NANOG, LIN28, KLF4, and c-MYC. The factors can be from any animal species; for example, mammals and rodents. Mammalian examples include but are not limited to humans and non-human primates. Primates include but are not limited to humans, chimpanzees, baboons, cynomolgus monkeys, and other Old and New World monkeys. Rodents include but are not limited to mouse, rat, guinea pig, gerbil hamster. According to the present invention, one or more factors capable of allowing the reprogramming of somatic cells and cells having stem cell characteristics comprise an assembly of factors selected from the group consisting of (i) OCT4 and SOX2, (ii) OCT4, SOX2, and one or more of NANOG and LIN28, (iii) OCT4, SOX2, and one or both of KLF4 and c-MYC. In one embodiment, the one or more factors capable of being expressed by RNA comprise OCT4, SOX2, NANOG and LIN28 or OCT4, SOX2, KLF4 and c-MYC. Preferably, the RNA is introduced into somatic cells by electroporation or microinjection. Preferably, the invention further comprises allowing growth of cells having stem cell characteristics, for example, by culturing the somatic cell under embryonic stem cell culture conditions, preferably conditions suitable for maintaining pluripotent stem cells in a state not differentiated. OCT4 is a transcription factor of the eukaryotic POU transcription factors and an indicator of embryonic stem cell pluripotency. It is a maternally expressed octamer-binding protein. It has been shown to be present in oocytes, the inner cell mass of blasts, and also in the primordial germ layer. The POU5F1 gene codes for the OCT4 protein. Synonyms to gene names include OCT3, OCT4, OTF3, and MGC22487. In the presence of OCT4 the specific concentration is necessary for the embryonic stem cells to remain undifferentiated. Preferably, "OCT4 protein" or simply "OCT4" refers to human OCT4. Sox2 is a member of the Sox gene family (SRY-related HMG sequence) encoding transcription factors with a single HMG DNA-binding domain. SOX2 has been found to control neural progenitor cells by inhibiting their ability to differentiate. Repression of the factor results in delamination of the ventricular zone, which is followed by an exit from the cell cycle. These cells also begin to lose their progenitor character ncznnn / i znz / R / v through the loss of progenitor and early neuronal differentiation markers. Preferably, "SOX2 protein" or simply "SOX2" refers to human SOX2. NANOG is an NK-2-like homeodomain gene, and it has been proposed that it plays a key role in the maintenance of stem cell pluripotency presumably by regulating the expression of genes critical to embryonic stem cell renewal and differentiation. NANOG behaves as a transcriptional activator with two unusually strong activation domains embedded at its C-terminals. Downregulation of NANOG expression induces embryonic stem cell differentiation. Preferably, "NANOG protein" or simply "NANOG" refers to human NANOG. LIN28 is a conserved cytoplasmic protein with an unusual pairing of RNA-binding motifs: a cold shock domain and a pair of retroviral-like CCHC zinc overhangs. In mammals, it is abundant in various types of undifferentiated cells. In pluripotent mammalian cells, LIN28 is observed in RNase-sensitive complexes with poly(A)-binding protein, and in polysomal fractions of sucrose gradients, suggesting that it is associated with RNA translation. Preferably, "LIN28 protein" or simply LIN28 refers to human LIN28. Krueppel-like factor (KLF4) is a zinc salient transcription factor, which is highly expressed in postmitotic epithelial cells of different tissues, eg colon, stomach and skin. KLF4 is essential for the terminal differentiation of these cells and is involved in cell cycle regulation. Preferably, "KLF4 protein" or simply "KLF4" refers to human KLF4. MYC (cMYC) is a proto-oncogene, which is overexpressed in a wide variety of human cancers. When specifically mutated or overexpressed, it increases cell proliferation and functions as an oncogene. The MYC gene codes for a transcription factor that regulates the expression of 15% of all genes through binding to Enhancer Box sequences (E-sequences) and recruiting histone acetyltransferases (HATs). MYC corresponds to the MYC family of transcription factors, which also includes the N-MYC and L-MYC genes. The MYC family transcription factors contain the bHLH / LZ (Basic Helix-Loop-Helix-LeucineZipper) domain. Preferably, "cMYC protein" or simply "cMYC" refers to human MYC. Reference herein to specific factors such as OCT4, SOX2, NANOG, LIN28, KLF4 or cMYC is to be understood to also include all variants of these factors. In particular, it is to be understood that it also includes all splice variants, post-translationally modified variants, conformations, isoforms and species homologues of these factors that are naturally expressed by cells. The term "miRNA" (microRNA) refers to noncoding RNAs 21-23 nucleotides long found in eukaryotic cells that, by inducing degradation and / or preventing translation of target mRNAs, modulate a plethora of cellular functions, including those related to ESC self-renewal / differentiation and cell cycle progress. miRNAs are post-transcriptional regulators that bind to complementary sequences on target messenger RNA (mRNA) transcripts, usually resulting in transductional repression or target degradation and gene slowing. miRNAs in the correct ncznnn / i znz / R / v combination have been found to be capable of inducing direct cellular reprogramming from somatic cells to cells having stem cell characteristics in vitro. For example, the 302-367 miRNA cluster has been shown to enhance somatic cell reprogramming. Preferably, the step of allowing the development of cells having stem cell characteristics comprises culturing the somatic cells under embryonic stem cell culture conditions, preferably conditions suitable for maintaining pluripotent stem cells in an undifferentiated state. Preferably, to allow growth of cells having stem cell characteristics, the cells are cultured in the presence of one or more inhibitors of DNA methyltransferase and / or one or more inhibitors of histone deacetylase. Preferred compounds are selected from the group consisting of 5'-azacitidine (5'-azaC), sub-eroylanilide-hydroxamic acid (SAHA), dexamethasone, trichostatin A (TSA), sodium butyrate (NaBu), Scriptaid and valproic acid (VPA). Preferably, cells are cultured in the presence of valproic acid (VPA), preferably at a concentration of between 0.5 and 10 mM, more preferably between 1 and 5 mM, most preferably at a concentration of about 2 mM. The methods of the present invention can be used to effect de-differentiation of any somatic cell type. Cells that can be used include cells that can be de-differentiated or reprogrammed by the methods of the present invention, in particular cells that are fully or partially differentiated, more preferably terminally differentiated. Preferably, the somatic cell is a diploid cell derived from multicellular pre-embryonic, embryonic, fetal and postnatal organisms. Examples of cells that can be used include but are not limited to fibroblasts, such as fetal and neonatal fibroblasts or adult fibroblasts, keratinocytes, in particular primary keratinocytes, more preferably hair-derived keratinocytes, adipose cells, epithelial cells, cells epidermal cells, chondrocytes, cumulus cells, neural cells, glial cells, astrocytes, cardiac cells, esophageal cells, muscle cells, melanocytes, hematopoietic cells, osteocytes, macrophages, monocytes, and mononuclear cells. The cells with which the methods of the invention can be used can be from any animal species; for example, mammals and rodents. Examples of mammalian cells that can be dedifferentiated and redifferentiated by the present invention include but are not limited to human or non-human primate cells. Primate cells with which the invention may be carried out include but are not limited to cells from humans, chimpanzees, baboons, cynomolgus monkeys, and any other Old or New World monkeys. Rodent cells with which the invention may be embodied include but are not limited to mouse, rat, guinea pig, hamster, and gerbil cells. Dedifferentiated cells prepared according to the present invention are expected to exhibit many of the same requirements as pluripotent stem cells and can be expanded and maintained under conditions used for embryonic stem cells, eg ES cell medium or any medium that supports the growth of embryonic cells. Embryonic stem cells retain their pluripotency in vitro when maintained in inactivated fetal fibroblasts such as irradiated mouse embryonic fibroblasts or human fibroblasts (eg, human foreskin fibroblasts, human skin fibroblasts, human endometrial fibroblasts, human oviductal fibroblasts) in culture. . In one embodiment, the human feeder cells may be autologous feeder cells derived from the same culture as the cells reprogrammed by direct differentiation. Additionally, human embryonic stem cells can be successfully propagated on Matrigel in medium conditioned by mouse fetal fibroblasts. Human stem cells can be grown in culture for an extended period of time and remain undifferentiated under specific culture conditions. In certain embodiments, cell culture conditions may include contacting cells with factors that can inhibit differentiation or otherwise enhance de-differentiation of cells, eg, prevent differentiation of cells into non-ES cells. , trophectoderm or other cell types. Dedifferentiated cells prepared according to the present invention can be evaluated by methods including monitoring of changes in the phenotype of the cells and characterization of their gene expression and protein expression. Gene expression can be determined by RT-PCR, and translation products can be determined by immunocytochemistry and Western blotting. In particular, dedifferentiated cells can be characterized to determine the gene expression pattern and whether the reprogrammed cells exhibit a gene expression pattern similar to the expression pattern expected from undifferentiated pluripotent control cells such as embryonic stem cells using either techniques. known in the art including transcriptomics. The expression of the following genes from dedifferentiated cells can be assessed in this regard: OCT4, NANOG, concentration and differentiation factor 3 (GDF3), reduced expression 1 (REX1), fibroblast concentration factor 4 (FGF4), gene embryonic cell-specific 1 (ESG1), developmental-associated pluripotency 2 (DPPA2), DPPA4, telomerase reverse transcriptase (TERT), embryonic antigen 3 (SSEA-3), SSEA4, tumor-associated antigen-1 -60 (TRA- 1 -60), Tra-1 -81, and TRA-2-49 / 6E. The undifferentiated or embryonic stem cells to which the reprogrammed cells can be compared may be of the same species as the differentiated somatic cells. Alternatively, the undifferentiated or embryonic stem cells to which the reprogrammed cells can be compared may be of a different species such as differentiated somatic cells. In some embodiments, a similarity in the pattern of gene expression exists between a reprogrammed cell and an undifferentiated cell, eg, embryonic stem cell, if certain genes specifically expressed in an undifferentiated cell are also expressed in the reprogrammed cell. For example, certain genes, eg telomerase, that are typically undetectable in differentiated somatic cells can be used to monitor the degree of reprogramming. Likewise, for certain genes, the absence of expression can be used to assess the degree of reprogramming. The self-renewal capacity, marked by the induction of telomerase activity, is another characteristic of stem cells that can be monitored in dedifferentiated cells. Karyotypic analysis can be performed by means of chromosome strands from myphotic cells, ncznnn / i znz / R / v spectral karyotyping, telomere length assays, whole genomic hybridization, or other techniques well known in the art. Using the present invention, RNA encoding appropriate factors is incorporated into one or more somatic cells, eg, by electroporation. Following incorporation, cells are preferably cultured using conditions that support the maintenance of dedifferentiated cells (ie, stem cell culture conditions). The dedifferentiated cells can then be expanded and induced to re-differentiate into a different type of somatic cell that is needed for cell therapy. Dedifferentiated cells obtained according to the present invention can be induced to differentiate into one or more desired types of somatic cells in vitro or in vivo. Preferably, the dedifferentiated cells obtained according to the present invention can give rise to cells from any of the three embryonic germ layers, ie, endoderm, mesoderm and ectotherm. For example, undifferentiated cells can differentiate into skeletal muscle, skeleton, skin dermis, connective tissue, urogenital system, heart, blood (lymph cells), and spleen (mesoderm); stomach, colon, liver, pancreas, urinary bladder; lining of urethra, epithelial parts of trachea, lungs, pharynx, thyroid, parathyroid, intestine (endoderm); or central nervous system, retina and lens, cranial and sensory, ganglia and nerves, pigment cells, head connective tissue, epidermis, hair, mammary glands (ectoderm). Dedifferentiated cells obtained according to the present invention can be re-differentiated in vitro or in vivo using techniques known in the art. In one embodiment of the present invention, the reprogrammed cells resulting from the methods of this invention are used to produce differentiated progeny. Thus, in aspect, the present invention provides a method of producing differentiated cells, comprising: (i) obtaining reprogrammed cells using the methods of this invention; and (ii) induce differentiation of the reprogrammed cells to produce differentiated cells. Step (ii) can be performed in vivo or in vitro. Additionally, differentiation can be induced through the presence of appropriate differentiation factors which may either be added or may be present in situ, for example in a body, organ or tissue into which the reprogrammed cells have been introduced. The differentiated cells can be used to derive cells, tissues, and / or organs that are used to advantage in the area of ​​cell, tissue, and / or organ transplantation. If desired, genetic modifications can be introduced, for example, into somatic cells prior to reprogramming. The differentiated cells of the present invention preferably do not possess the pluripotency of an embryonic stem cell, or embryonic germ cell, and are, in essence, tissue-specific partially or fully differentiated cells. An advantage of the methods of the present invention is that the reprogrammed cells obtained by the present invention can be differentiated without prior selection or purification or establishment of a cell line. Accordingly in certain embodiments, a heterogeneous population of cells comprising reprogrammed cells differentiate into a desired cell type. In one embodiment, a mixture of cells obtained from the methods of the present invention is exposed to one or more differentiation factors and cultured in vitro. Methods for differentiating reprogrammed cells obtained by the methods described herein may comprise a step of permeabilizing the reprogrammed cell. For example, cells generated by the reprogramming techniques described herein, alternatively a heterogeneous mixture of cells comprising reprogrammed cells, can be permeabilized prior to exposure to one or more differentiation factors or cell extract or other preparation that includes differentiation factors. For example, differentiated cells can be obtained by culturing undifferentiated reprogrammed cells in the presence of at least one differentiating factor and selecting differentiated cells from the culture. Selection for differentiated cells can be based on phenotype, such as the expression of certain cell markers present on differentiated cells, or by functional assays (eg, the ability to perform one or more functions of a particular differentiated cell type). In another embodiment, cells reprogrammed in accordance with the present invention are genetically modified through the addition, deletion, or modification of their DNA sequences. The reprogrammed or dedifferentiated cells prepared according to the present invention or cells derived from the reprogrammed or dedifferentiated cells are useful in research and in therapy. The reprogrammed stem cells can differentiate into any of the cells in the body including, without limitation, skin, cartilage, skeletal muscle, bone, cardiac muscle, kidney, liver, blood and blood-forming cells, vascular and vascular endothelial precursor cells, pancreatic-beta, neurons, glia, retinal, neuronal, intestinal, pulmonary and hepatic. The reprogrammed cells are useful for regenerative / repartitional therapy and can be transplanted into a patient in need thereof. In one embodiment, the cells are autologous to the patient. The reprogrammed cells provided according to the present invention can be used, for example, in therapeutic strategies in the treatment of cardiac, neurological, endocrinological, vascular, retinal, dermatological, musculoskeletal and other diseases. For example, and not intended as a limitation, the reprogrammed cells of the present invention can be used to replenish cells in animals whose natural cells have been depleted due to age or ablation therapy such as cancer radiation therapy or cancer chemotherapy. In another non-limiting example, the reprogrammed cells of the present invention are useful in organ regeneration and tissue repair. In one embodiment of the present invention, reprogrammed cells can be used to reinvigorate damaged muscle tissue including dystrophic muscles in muscles damaged by ischemic events such as myocardial infarctions. In another embodiment of the present invention, the reprogrammed cells described herein can be used to enhance healing in animals, including humans, after traumatic injury or surgery. In this embodiment, the reprogrammed cells of the present invention are administered systemically, such as intravenously, they immigrate to the site of the newly traumatized site, recruited by circulating cytokines secreted by the damaged cells. In another embodiment of the present invention, the reprogrammed cells can be delivered locally to a site in need of treatment or repair or regeneration. ncznnn / i 707 iw In one embodiment of the invention, nucleic acids such as RNA are administered to a patient by ex vivo methods, ie by removing cells from a patient, genetically modifying these cells, and reintroducing the modified cells into the patient. Methods of transfection and transduction are known to the skilled worker. The term "transfection" refers to the introduction of nucleic acids, in particular RNA, into a cell. For purposes of the present invention, the term "transfection" also includes the introduction of a nucleic acid into a cell or the uptake of a nucleic acid by this cell, where the cell may be present in a subject, for example, a patient. . Thus, according to the present invention, a cell for transfection of a nucleic acid described herein can be presented in vitro or in vivo, for example, the cell can form part of an organ, a tissue and / or a organism of a patient. According to the invention, the transfection can be transient or stable. For some transfection applications, it is sufficient if the transfected genetic material is only transiently expressed. Since the nucleic acid introduced in the transfection process usually does not integrate into the nuclear genome, the foreign nucleic acid will either be diluted through mitosis or degraded. Cells that allow episomal amplification of nucleic acids generally reduce the rate of dilution. If the transfected nucleic acid is to actually remain in the genome of the cell and its daughter cells, a stable transfection must occur. RNA can be transfected into cells to transiently express its purified protein. In accordance with the present invention, any technique useful for introducing, ie, transferring or transfecting, nucleic acids into cells can be used. Preferably, the RNA is transfected into cells by standard techniques. These techniques include electroporation, lipofection, and microinjection. In a particularly preferred embodiment of the present invention, RNA is introduced into cells by electroporation. Electroporation or electropermeation refers to a significant increase in the electrical conductivity and permeability of the cell plasma membrane caused by an externally applied electric field. It is usually used in molecular biology as a way to introduce some substance into a cell. According to the invention, it is preferred that the introduction of the nucleic acid encoding a protein or peptide into cells results in the expression of this protein or peptide. According to the invention, nucleic acids can be targeted to particular cells. In these embodiments, a carrier used to deliver a nucleic acid to a cell (eg, a retrovirus or a liposome) may have a single targeting molecule. For example, a molecule such as an antibody specific for a surface membrane protein on the target cell, or a ligand for a receptor on the target cell can be incorporated into or attached to the nucleic acid carrier. If delivery of a nucleic acid by liposomes is desired, proteins that bind to an endocytosis-associated surface membrane protein can be incorporated into the liposome formulation to allow for targeting and / or uptake. These proteins include capsid proteins or fragments thereof that are specific to a particular cell type, antibodies to proteins that internalize, proteins that target an intracellular site, and the like. "Reporter" refers to a molecule, typically a peptide or protein, that is encoded by a reporter nc7nnn / i 7Π7 / Β / Υ gene and is measured in a reporter assay. Conventional systems usually employ an enzymatic indicator and measure the activity of the indicator. The term "multiple cloning site" refers to a region of nucleic acid containing restriction enzyme sites, any of which can be used for excision of, for example, a vector and insertion of a nucleic acid. According to the invention, elements such as nucleotides or amino acids are constitutive, thus they are directly adjacent to each other, without any interruption. For example, a sequence of x consecutive N nucleotides is referred to as the sequence (N)x. "Restriction endonuclease" or "restriction enzyme" refers to a class of enzymes that cleaves phosphodiester bonds on both strands of a DNA molecule with specific base sequences. They recognize specific binding sites, referred to as recognition sequences, on a double-stranded DNA molecule. The sites at which phosphodiester bonds in DNA are cleaved by these enzymes are referred to as cleavage sites. In the case of type IIS enzymes, the cleavage site is located at a defined distance from the DNA binding site. According to the invention, the term "restriction endonuclease" comprises, for example, the enzymes Sapl, Ecil, Bpil, Aarl, Allol, Bael, BbvCI, Ppil and Psrl, BsrD1, Btsl, Earl, Bmrl, Bsal, BsmBI, Faul, Bbsl, BciVI, BfuAl, BspMI, BseRI, Ecil, BtgZI, BpuEl, Bsgl, Mmel, CspCI, Bael, BsaMI, Mva1269l, Pctl, Bse3DI, BseMI, Bst6l, Eam11041, Ksp632l, Bfil, Bso31l, BspTNI, Eco31l, Esp3l, Bful, Acc36l, Aarl, Eco57l, Eco57MI, Gsul, Allol, Hin4l, Ppil, and Psrl. The term "stability" of RNA refers to the "half-life of the RNA." “Half-life refers to the period of time it takes to eliminate half the activity, quantity or number of molecules. In the context of the present invention, the half-life of an RNA is indicative of the stability of this RNA. Nucleic acids such as the RNA described herein, particularly when used for the treatments described herein, may be presented in the form of a pharmaceutical composition or kit comprising the nucleic acid and optionally one or more carriers, diluents and / or pharmaceutically acceptable excipients. The pharmaceutical compositions are preferably sterile and contain an effective amount of the nucleic acid. Pharmaceutical compositions are usually provided in uniform dosage form and can be prepared in a manner known in the art. The pharmaceutical composition may be, for example, in the form of a solution or suspension. The pharmaceutical composition may comprise salts, buffers, preservatives, carriers, diluents, and / or excipients, all of which are preferably pharmaceutically acceptable. The term "pharmaceutically acceptable" refers to the non-toxicity of a material that does not interfere with the action of the active components of the pharmaceutical composition. Salts that are not pharmaceutically acceptable can be used to prepare pharmaceutically acceptable salts and are included in the invention. Pharmaceutically acceptable salts of this class ncznnn / i znz / R / v comprise, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric acids , formic, malonic, succinic and the like. Pharmaceutically acceptable salts may also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium salts, potassium salts or calcium salts. Buffering substances suitable for use in the pharmaceutical composition include acetic acid in a salt, citric acid in a salt, boric acid in a salt, and phosphoric acid in a salt. Suitable preservatives for use in the pharmaceutical composition include benzalkonium chloride, chlorobutanol, paraben, and thimerosal. The term "carrier" refers to an organic or inorganic component, of a natural or non-natural (synthetic) nature, with which the active component is combined in order to facilitate, improve or enable application. According to the invention, the term "carrier" also includes one or more compatible solid or liquid fillers, compatible diluents or compatible encapsulating substances, which are suitable for administration to a patient. Possible carrier substances for parenteral administration are, for example, sterile water, glucose solutions, Ringer's, Ringer's lactate, sterile sodium chloride solution, polyalkylene glycols, hydrogenated naphthalenes and in particular biocompatible lactide polymers, lactide / glycolide copolymers or polyoxyethylene / polyoxy-propylene copolymers. The term "excipient" when used herein is intended to indicate all substances that may be present in a pharmaceutical composition and are not active ingredients such as for example carriers, binders, lubricants, thickeners, surface active agents, preservatives , emulsifiers, buffers, flavoring or coloring agents. The pharmaceutical compositions described herein can be administered by any conventional route, such as by parenteral administration including by injection or infusion. Administration is preferably parenterally, eg intravenously, intraarterially, subcutaneously, in the lymph node, intradermally or intramuscularly. Compositions suitable for parenteral administration usually comprise a sterile aqueous or non-aqueous preparation of the active compound, which is preferably isotonic with the blood of the recipient. Examples of compatible carriers and compatible solvents are Ringer's solution and isotonic sodium chloride solution. In addition, usually sterile non-volatile oils are used as the solution or suspension medium. The agents and compositions described herein are preferably administered in effective amounts. An "effective amount" refers to the amount that achieves a desired reaction or effect alone or in conjunction with additional doses. In the case of treatment of a particular disease or condition, the desired reaction is preferably related to the inhibition of the course of the disease. This comprises slowing down the progress of the disease, and in particular, interrupting or reversing the progress of the disease. ncznnn / i znz / R / v The desired response in a treatment of a disease or condition may also be delayed from the onset or prevented from the onset of the disease or condition. An effective amount of an agent or composition described herein will depend on the condition to be treated, the severity of the disease, the individual parameters of the patient, including age, physiological condition, size and weight, the duration of treatment, the type of accompanying therapy (if present), the specific route of administration, and the like. Accordingly, the administered doses of the agents described herein may depend on several of these parameters. In the event that a reaction in a patient is insufficient with an initial dose, higher doses (or actually higher doses achieved by a different, more localized route of administration) may be used. The present invention is described in detail by the following figures and examples which are to be considered by way of illustration only and not by way of limitation. Based on the description and the examples, further embodiments are accessible to the skilled person and are likely to be within the scope of the invention. Brief Description of the Figures Figure 1A-1B: Overview of the selection process in vivo. To prepare the starter library, human immature dendritic cells were cultured in the presence of Actinomycin D, a transcription inhibitor, for five hours to preselect stable RNAs. The remaining cellular mRNA was extracted and purified using the Poly(A)Purist Kit (Ambion) and then cleaved with P1 nuclease (Roche). For this, 10 ug of RNA was incubated for 45 minutes with 0.3 U NP-1 in 8 pL of 50 mM NaAC buffer (pH 5.5) in a total reaction volume of 24 pL. After purification with RNeasy columns (Qiagen) the fragments were ready to be reverse transcribed into cDNA. First and second strand synthesis was performed using and following the RevertAid Premium First Strand cDNA Synthesis Kit protocol (Fermenta) and a hexamer-primer with a defined primer sequence and a Notl restriction site. To fill in the 5' overhang and remove the 3' overhang, the cDNA was then incubated with 12.5 U T4 DNA polymerase for 5 minutes at 15°C. The reaction was terminated by adding 5 pL of 0.5 mM EDTA, pH 8.0 and the cDNA was purified using NucleoBond columns (Macherey-Nagel). Digestion of the cDNA library with Notl (NEB) produced fragments with a blunt and sticky end. Fragments were further selected for size by gel preparation to ensure removal of all fragments smaller than 150 bp. For library cloning the vector as shown in Fig. 1 A was digested with EcoRV and Notl leaving a blunt and sticky end, respectively. In the next step, the library was ligated into the vector using T4-DNA ligase (Fermentas). The ligation mix was used directly as a template for PCR as given in Table 4 using Phusion™ Hot Start High Fidelity DNA Polymerase (Finnzymes). After purification, the PCR product was used as a template for T7-transcription as shown in Table 5. Incubation was at 37°C. After every 30 min, 0.75 pL of 100 mM GTP was added to the reaction. The reaction was stopped after 2.5 h by adding TURBO DNase (2U / pL, Ambion) and incubating for another 15 min at 37°C. The reaction was finally cleaned up using RNeasy columns (Qiagen). The RNA library can then be used for the selection procedure by starting with electroporation of the ncznnn / i znz / R / v RNA into hiDC as previously described (Kuhn et al, 2010). After culturing for selection, RNA extraction and purification was performed using RNeasy columns (Qiagen) and following the manufacturer's instructions. The RNA was then used as a template for cDNA synthesis using Superscript II reverse transcriptase (Invitrogen) and following the manufacturer's instructions and a dT18 primer. The DNA was then used as a template for PCR as described above. Finally, the PCR products can be used as a template for the T7 transcript (see above) to initiate the next round of selection (Fig. 1B). The quality controls of the DNA / DNA and RNA samples were made using agarose gel and the AGILENT 2100 bioanalyzer, respectively. Figure 2A-2B: Schematic view of the appearance of the sample within the luc2CPmut vector. (Fig. 2A) A single element or two elements (in the 5' direction and in the 3' direction, were cloned as 3'-UTR in the vector as given. NEG control samples (negative control without insert) are also shown. of a 3'-UTR, hBg and 2hBg Preparation of RNA for selection rounds (Fig. 2B) By electroporation into the vector hiDC was used as template for PCR using elongated primers comprising the T7-promoter and poly( A) The PCR product was then used as a template for the in vitro synthesis of T7 to produce the respective IVT-RNA. Figure 3: Effect of selected sequences on the stability of luc2CPmut-encoding RNAs. Results showing luciferase activity, half-life, and total protein over time of RNAs containing the selected sequences as 3'-UTR compared to the gold standard 2hBg electroporated into human immature dendritic cells (NEG is as described). defined in Figure 2A-2B). The top panel gives the time courses of 3 example RNAs with 3'-UTR as indicated. In the lower left panel, the half-life of RNAs with the respective 3'-UTR is shown as indicated relative to a 2hBg RNA. Similarly, the total relative expression of protein compared to a 2hBG RNA is given in the lower right panel. Figure 4: Representative luciferase activity using Iuc2mut as reporter gene and the newly selected 3'-UTR. After electroporation of the RNAs with 3'-UTR as indicated into human immature dendritic cells, luciferase activity was measured for 72 hours. Figure 5: Representative results with IVT-RNA electroporation in fibroblasts. Left panel: vector based on luc2Pmut. Right panel: vector based on Iuc2mut. Figure 6: Representative results of IVT-RNA electroporation in T cells. The leftmost panel gives the relative total protein expression of an RNA with the Fl 3' UTR compared to an RNA with 2hBg in CD4+ and CD8+ T cells . Similarly, the relative translation efficiency and mRNA half-life of an RNA with the Fl 3' UTR compared to an RNA with 2hBg in CD4+ and CD8+ T cells is given in the middle and rightmost panel, respectively. . Figure 7A-7B: RNA architecture and integrity for testing nucleotide-modified RNA. Fig.7A: The RNAs used in the luciferase assays were constructed as depicted here. As 5' cap, β-SARCA(D2) was used. As the 5' UTR, the 5' UTR of human alpha globulin was used, including a Kozak sequence. Following the firefly luciferase gene, the two 3'-UTRs to be compared were cloned. As the poly(A) limb, ncznnn / i znz / R / v used an A30L70 sequence. Fig.7B: Prior to transfection, RNAs were checked for integrity on a 2100 Bioanalyzer (Agilent). All RNAs have a sufficiently high and also comparable integrity and can therefore be used in the experiments. Figure 8A-8B: Effect of the Fl 3' UTR on RNA stability and functionality in vivo. Luciferase and gp70 mRNA containing the 2hBg Fl 3' UTR or 3'-UTR were formulated with F12 and administered i.v. in BALB / c mice. After luciferase mRNA administration, expression was monitored after 6 hours and 24 hours; gp70 mRNA was administered on day 0 and day 6 and immune activation was analyzed on day 10 by tet+ staining of CD8 and gp70. Fig.8A) Shows the luciferase expression levels at 6 hours and 24 hours after injection of unmodified and m1Y modified mRNA containing the 2hBg Fl 3' UTR or 3'-UTR. Both unmodified and m1Y-modified luciferase mRNAs containing the Fl 3' UTR show comparable levels of expression as the corresponding mRNA containing the 2hBg 3' UTR. Fig.8B) Shows the percentage of gp70-specific CD8 T cells in response to gp70 mRNA containing either the Fl 3' UTR or the 2hBg. The two 3' UTRs perform equally well in inducing antigen-specific immunity after two immunizations, with a significant increase in antigen-specific CD8 T cells in the spleen of those mice that have received the 3' Fl-containing gp70 mRNA. UTR. Statistics: One-way ANOVA and Tukey's post-test, 'p<0.5. Figure 9: Effect of UTR stabilization on the stability of self-replicating RNA. Destabilized luciferase (Luc2CP) was cloned immediately downstream of the 3'-conserved sequence element of a self-replicating RNA-derived non-cytotoxic Semliki Forest virus (replicon). Replicon RNA was prepared by in vitro transcription from a corresponding IInealized plasmid and subjected to cell electrophoresis. Luciferase expression was measured by adding luminescent substrate for 96 hours to 120 hours. (A) Time course of luciferase expression in a representative experiment with BHK21 cells. (B) Time course of luciferase expression in a representative experiment with human foreskin fibroblasts (HFF). To reduce the cytotoxicity of released type I interferons, vaccinia virus B18R mRNA was co-transfected into each sample. To inhibit protein kinase R activation and to increase the overall level of translation, Vaccinia E3 virus mRNA was co-transfected into each sample. Figure 10: Stretches of homology in the Fl element. Underlined stretches of sequence were predicted to base pair with each other. For the "8nt mutation" construct, the first element was mutated to aaagggcu to disrupt interactions with the second element. Figure 11 A:-11E Artifacts in IVT based on template PCR using 2hBgUTR. Fig.11 A: Schematic representation of IVT template generation by PCR. The 5' primer binds downstream of the T7 promoter, the 3' promoter contains a 120 nt poIyA limb and binds to the plasmid-encoded poIyA and part of the 3' UTR. Electrical energy In the case of 2hBgUTR, mismatching may occur due to fixation at the first repetition. Fig.11B: PCR products of a plasmid containing the 2hBgUTR. The red arrow ncznnn / ι znz / R / v represents the secondary product, but has a truncation of 1hBg. Fig. 11C: The RNA transcribed from this PCR product also has a shortened by-product in this way (arrow). Fig.11D: PCR products of a plasmid containing the Fl element as 3' UTR. The secondary product is not visible. Fig.11E: The resulting mRNA is of the expected high integrity without any additional side peaks. Figure 12A-12B: Schematic representation of the truncated UTR elements and the half-life of the corresponding mRNA constructs. The upper panel of Figure 12A shows a schematic representation of the truncated UTR elements with reference to the nucleic acid positions of the full-length sequence of the F element SEQ ID No.: 86 covered by these truncated variants. The bottom panel of Figure 12A shows the relative half-life of the mRNA comprising the truncated UTR in reference to the mRNA comprising the full-length sequence of the F element SEQ ID No.: 86. The mRNAs encoding a luciferase reporter are They were electrophoresed in hiDC and their expression was followed over time by luciferase measurements to determine the relative half-life of RNA. The upper panel of Figure 12B shows a schematic representation of the truncated UTR elements with reference to the nucleic acid positions of the full length sequence of the I element SEQ ID No.: 115 covered by these truncated variants. The lower panel of Figure 12B shows the relative half-life of the mRNA comprising the truncated UTR with reference to the mRNA comprising the full-length sequence of the I element SEQ ID No.: 115. The mRNAs encoding a luciferase reporter are They were electrophoresed in hiDC and their expression was followed over time by luciferase measurements to determine relative half-life of RNA. Figure 13: Relative half-life and protein expression of mRNA constructs comprising F, I or Fl elements towards random UTRs. Figure 13 shows the relative half-life and protein expression of mRNA constructs comprising the F, I or Fl elements towards random UTRs. For these full length individual Fl elements as well as the Fl combination were compared towards a random 3' UTR (257nt length). All elements were cloned into luciferase-encoding constructs, transcribed in vitro into mRNA, electrophoresed on hiDC, luciferase expression measured over time, and relative half-lives and total protein expression calculated. Figure 14A-14G: UTR elements for cell reprogramming. Figure 14A shows the timeline for reprogramming of primary human foreskin fibroblasts. 40,000 cells were seeded in a 12-well plate and lipofected for three (3x) or four (4x) consecutive days with mRNA mixes that were composed of 0.33 pg of unmodified in vivo transcribed RNA (IVT-RNA) containing codes for reprogramming of TF, OCT4, SOX2, KLF4, cmy, NANOG and LIN28 (OSKMNL) (1:1:1:1:1:1) with 0.08 pg each of B18R, E3 and K3 (EKB) and 0.17 pg of an miRNA mix composed of miRNAs 302a-d and 367 (1:1:1:1:1:1). The RNA constructs in this way only differed in their 3' UTR, which consists of a tandem repeat of the 3' UTR of human β-globulin (2hBg), and either the F-l element (Fl) or the l-F element (IF). From day 9 onwards, colony formation was observed and was performed on d11 of colony analysis. Figure 14B shows an alkaline phosphatase (AP) staining of established colonies and Figure 14C shows a corresponding bar graph where ncznnn / ι znz / R / v represents the counted numbers of AP-positive colonies. Figure 14D shows the morphology of the resulting iPS-cell colonies using the RNAs containing the FI-UTR. It was hES cell-like with small cells tightly packed in distinct colonies and well-defined borders. Figure 14E shows the colonies prepared as in D stained positive for AP at four and ten fold magnification. Figure 14F shows colonies prepared as in D on in vivo staining for the hES cell surface marker TRA-1-60. Figure 14G shows mRNA expression of hES markers OCT4 (endogenous), NANOG (endogenous), LIN28 (endogenous), TERT and REX1 assessed by pelleting colonies, isolating total RNA and quantifying by qRT-PCR. examples Example 1: Identification of sequence elements that stabilize mRNAs To identify novel sequence elements that stabilize mRNAs, an in vivo selection process was developed using hiDC as a selective environment for in vitro transcribed RNA. The starter RNA library was constructed using naturally occurring mRNA sequences derived from hiDC. Prior to RNA isolation, cells were cultured for 5 hours in the presence of the transcription inhibitor Actinomycin D (ActD) to preselect stable RNAs. The remaining mRNA was then excised and reduced to 200-800 nucleotide fragments, reverse transcribed, and cloned as 3' UTR into a vector having a hAg 5' UTR sequence and a reporter gene, which was chosen as the basis of the selection process. The DNA template used for subsequent mRNA library transcription was amplified by PCR, during which a T7 promoter was introduced via the 5'- and a poly(A) A60 extremity via the 3' primer. The transcribed mRNA was then entered into the in vivo selection process, which comprised several rounds of in vitro transcription of the library, electroporation of the corresponding RNAs onto hiDC, and extraction and amplification of stable sequences after defined time points. Amplification of the selected sequence was performed by PCR with specific primers, after cDNA synthesis. The resulting PCR products were subsequently used as templates for the new mRNA library. This was done over six rounds, with extraction of the remaining RNAs after 24 hours in round 1, 48 hours in rounds 2 and 3, 72 hours in rounds 4 and 5, and finally 96 hours as well as one and two. weeks in round 6 (in electroporation, cells were divided into three parts and then individually harvested at the given time points). Monitoring of the selection process after rounds 1 through 5 demonstrated a significant increase in the average half-life of the corresponding RNA mix, which is indicative of an enrichment of the 3'-UTR stabilizing elements (Table 1). However, the increase in stability was less pronounced with larger rounds. Therefore, the selection process was stopped after a final sixth round, in which DNA was extracted from cells after 96 hours, one week, and two weeks. To characterize the selected sequences, more than 350 individual clones were sequenced, 108 from round 5, 88 from round 6 / 96 hours, 110 from round 6 / 1 week, and 96 from round 6 / 2 weeks. All sequences were compared with each other as well as BLASTed to identify their genomic origin. Here, it was especially searched, whether the sequences were derived from endogenous 5'- or 3'-utre or from the coding region. Finally, its expression level in hiDC was downloaded from NestBio (lllumina). nc7nnn / i 7Π7 / Β / Υ In total, seven groups can be identified, (i) for which multiple sequences were found, (ii) that originated from the 3'-UTRs of endogenous RNAs or from an endogenous non-coding RNA, and (iii) that were clearly expressed in hiDC (Table 2). These were derived from the following genes: IgG Fe fragment, receptor, transponder, alpha (B, FCGRT, NM_001136019), lymphocyte-specific protein 1 (D; LSP1, NM_002339), chemokine ligand 22 (E, CCL22, NM_00299) , amino-terminal cleavage enhancer (F, AES, NM_198969), phospholipase D family member 3 (G, PLD3, NM_001031696), mitochondrially encoded 12S RNA (I, MT_RNR1, NC_012920), class II major histocompatibility complex DR beta 4 (J, HLA-DRB4, NM_021983). It is noted that for simplicity, the capital letters B through I given in parentheses are used in the following as abbreviations for these elements. Importantly, in all cases, the clones for a sequence differ at their exact 5' and 3'-ends, demonstrating that they come from different starting clones and are not simply artificially enriched during processing (see appendices for a complete listing of all sequences identified in the exam). Example 2 Characterization of individual sequence elements, identified For characterization of the identified sequence elements, a representative candidate from each group was chosen (detailed sequences are marked in the appendix). This sequence is then cloned as 3'-UTR into a vector with a luciferase reporter gene, the level of expression of which can be analyzed over time on cell transfer. It has previously been shown that from the expression pattern observed for the protein, the relative stability and transductional efficiency of the RNA can be accurately ingested (Kuhn 2010 Gene Ther.). The specific reporter used in this experiment, luc2CPmut, is a destabilized form of luciferase (Promega). This makes it possible to detect even small changes in RNA stability. The in vivo transcribed RNA coming in these vectors can then be compared to our gold standard of mRNA, ie, containing the 2hBg 3'-UTR, with respect to RNA stability and transductional efficiency. As control samples, one in vitro transcribed RNA without a 3'-UTR (ie, containing only sequences used to clone the inserts) and one with only a single Beta-globulin element (1hB) were used. Starting with the UTR-containing vectors, the region to be transcribed was amplified by PCR using a 5' primer containing the T7 promoter and a 3' primer with a 60 nucleotide poly(A) end. Cleanup of PCR fragments was done using AGENCOURT AMPURE XP (Beckman Coulter). 0.6 volumes of beads were added to each PCR reaction and mixed. After a 15 minute room temperature PCR incubation, bead bound PCR products were separated by magnetic beads from excess primers, nucleotides, salts and enzymes. Beads were washed twice for 30 seconds with 80% ethanol to further remove contaminants. The desired PCR products were finally eluted twice with 30 pL of ddH20 and used as a template for in vitro transcription of the corresponding RNAs. For in vitro transcriptions, T7-RNA polymerase (Fermenta), the respective reaction buffer and 6 mM NTP were used. For efficient RNA capping, the GTP concentration was decreased to 1.5 mM and 6 mM 3-S-ARCA(D2) was added to the reaction and incubated for 2.5 hours at 37°C. RNA was purified by ncznnn / i znz / R / v carboxylated magnetic beads (Invitrogen) and RNA concentration and quality assessed by spectrophotometry and analysis on a 2100 Bionanalyzer (Agilent). Consistent with their identification in the screening approach, all of the new sequences showed very similar characteristics compared to 2hBg with respect to RNA stability with pool I (mtRNRI) as the best (Figure 3; Table 3). Importantly, each individual element conferred RNA stabilization compared to RNA without a 3'-UTR and even compared to RNA with only a single copy of the Beta-globin element. Translation efficiency was not significantly affected, as seen by the direct correlation between RNA stability and total protein expressed over time. Example 3: Combination of individual sequence elements In a further experiment, individual sequences from each group were combined with each other in a pairwise fashion (Figure 2). The rationale behind this was our own observations that the combination of two 3'UTRs has an additional effect on RNA stability and transductional efficiency (Holtkamp et al. 2006). RNA stability and transductional efficiency in R were calculated by interpolating the measured luciferase values ​​with a strip, of which the stepwise ascending slope was defined as the transductional efficiency and the signal half-life as stability. The integral of the interpolated strip is interpreted as total protein expression. In total, 64 combinations were cloned, that is, all possible combinations of the seven newly identified sequences and the 3'UTR of human beta-globulin (Table 6). As described above, RNA was prepared from these template DNAs, and then electroporated on hiDC. As controls, RNAs containing the individual elements were also incubated. For most of the seven new elements, it was observed that at least one combination with another element gives an RNA with higher stability than with the single element alone (Table 7 to Table 13). Interestingly, in most cases, the combination with element I (mtRNRI) increased the half-life of the RNA. Here, the overall RNA stability was even higher compared to an RNA with the 2hBg 3'-UTR (Table 7 to Table 13). Almost all combinations have a positive effect on RNA transductional efficiency. In total, the combined effects on RNA stability and transductional efficiency result in an increase in total protein expression of up to 1.74-fold. In this way, individual elements (with lengths below 233 nucleotides) as well as combinations of two different elements that give rise to RNAs with increased stability and / or increased transductional efficiency can be identified, but at the same time avoiding the problems with having two identical copies of an element as described above for 2hBg. To verify the results obtained with the destabilized form of luciferase, the previous experiments were repeated with RNAs containing the standard luciferase (Promega), and the following selected 3'-UTRs: mtRNRI (I), mtRNR1-AES (IF), AES -mtRNR1 (Fl), mtRNR1-hBg (IhBg) and hBg-mtRNR1 (IhBg). As shown in Figure 4 and Table 14, equivalent results as observed above can be obtained by verifying that the new elements, individually or in combination, increase mRNA stability and / or transductional efficiency in a similar way as the 2hBg element. Example 4: Analysis of mRNAs having selected sequence elements in other cell types ncznnn / i znz / R / v The newly selected mtRNRI and AES from the 3'-UTRs were also tested in different cell types and cell lines to see if there is a specificity to hiDC. The sequences were tested in human fibroblasts (HFF), murine myoblasts (C2C12) (Figure 5) and T cells (Figure 6) to assess whether they are also stabilizing in these cells. HFF and C2C12 cells were harvested and prepared by electroporation. 2.0 pg of IVT-RNA was then electroporated together with 1.0 pg of GFP encoding RNA containing the indicated 3'UTRs. After electroporation cells were split 5000 cells per well were distributed in a 96 well plate in triplicates for a total of 7 time points (2, 4, 8, 24, 48 and 72 h) to measure luciferase activity. . 2E+05 cells per well were plated in 6-well plates for collection by FACS after 24h (GFP-signal). This allowed monitoring of transfection efficiencies. This differentiated between 72 and 90% and can be included in the half-life calculation. The results obtained with HFF and C2C12 as well as T cells confirmed the results previously obtained with hiDC. The combination of I with F was in particular 2-3 times better in half-life compared to 2hBg. In addition, Fl showed 3-fold better transductional efficiency in C2C12 cells and 2-fold better protein production over time compared to our gold standard. These results showed, that I and F are not specific for hiDC, but also enhance the stability and transductional efficiency of mRNA in other cells. Example 5: The Fl 3' UTR increases the expression of modified mRNA For some applications, including protein replacement therapy, mRNAs with modified nucleotides are preferable to unmodified ones due to their decreased immunogenicity (Kariko et al., 2008). However, base modifications can have an effect on the stability of an RNA either by directly influencing the interaction with a corresponding protein of an ion to RNA or by altering the formation of RNA secondary structure. Consequently, the selected 3' UTRs may behave differently in the context of the modified mRNAs. Therefore, the combination of Fl was compared with 2hBg in the context of mRNA modified with m1 Y in hiDC, HFF, CD8+ and CD4+ T cells and in murine MEF, C2C12 and bmDC. As indicator, luciferase was used (see Figure 7A for construction design). For generation of the modified mRNAs, U was completely replaced by m1Y in the IVT reaction. In all experiments, unmodified RNA was included as a control. The integrities of the obtained mRNAs were not affected by the exchange of UTP for m1YTP (Figure 7B). Cells were electroporated using the settings described in Table 15 and luciferase levels were measured at 3, 6, 12, 24, 48, 72 and 96h. Electroporation of unmodified luciferase mRNA can produce the effects seen above: In all cell types, the Fl element was equal to or greater than the 2hBg control when carrying RNA stability (Table 16A). Whereas in murine DC and human T cells, mRNA half-lives were comparable between the two 3' UTRs, the Fl element increased mRNA half-lives up to 1.69-fold in HFF cells. The total amount of protein was increased in all cell lines, most prominently in HFF cells (2.45-fold). ncznnn / i znz / R / v With the modified mRNA, the Fl element also leads to an increase in mRNA half-life compared to 2hBg in hiDC, the total amount of protein was increased more than two-fold (Table 16B). Results in other cell types are also similar to those obtained with unmodified mRNA. The Fl element was greater than 2hBg in all experiments involving HFF, MEF and C2C12 cells and comparable in murine DC and T cells (Table 16B). Therefore, the U modification does not alter the stability of the Fl element to stabilize the mRNA. Example 6: Fl 3' UTR Increases mRNA Expression Despite Transfection Method So far, all experiments were performed with electroporation as the transfection method. With electroporation, the mRNA distributed up directly into the cytoplasm, under the circumvention of an endosomal uptake pathway, which is taken up in transfection by lipofection. To see if the Fl element also functions under these conditions, cells were lipofected with the same Fl-containing luciferase mRNAs and 2hBg as used in the previous experiments using RNAIMAX as a transfection reagent. Also in lipofection, the Fl element increased luciferase expression, although the increase was less pronounced compared to experiments where RNA was delivered by electroporation (Table 16C). Therefore, the transfection method has no impact on the stabilizing effect of the Fl element. Example 7: Fl 3' UTR and mRNA containing 2hBqUTR lead to comparable protein expression and comparable immune activation in vivo To assess protein expression of the Fl 3' UTR-containing mRNA in vivo, the same Fl-containing luciferase mRNAs and 2hBg as used in the previous experiments were formulated with F12 and administered i.v. in BALB / c mice. As shown in Figure 8A-8B, luciferase expression was comparable for both 3' UTRs. Antigen-specific immune response was also induced to a comparable degree, with the effect of Fl 3' UTR-containing mRNA being slightly stronger in the spleen. Example 8: IF UTR leads to increased stability of self-replicating RNA in vitro In vitro transcribed self-replicating RNA (replicon RNA) derived from alphaviral genomes are potent vaccine vectors. The replicon RNA encodes in the first two thirds for the enzyme complex necessary for cytoplasmic replication (replicase) of the replicon RNA. This replicase recognizes an internal RNA structure that acts as a subgenomic promoter for replicase-dependent synthesis of subgenomic RNAs. Transgenes or antigens for vaccination are encoded on this subgenomic RNA which is significantly shorter than the full length replicon. Taken together, both genomic RNA (ie full-length replicon RNA) and subgenomic RNA resemble cellular mRNA. Both are flanked by UTR, both are capped, and are polyadenylated. The enzymes responsible for capping and polyadenylation are contained in the replicase enzyme complex. Conserved sequence elements (CSEs) within UTRs, which overlap with the replicase ORF in the case of the 5' CSE, are required for replicase binding and act as promoters for minus-strand (3') synthesis. CSE) or plus strand synthesis (5' CSE). To assess whether the newly identified and validated stabilizing UTRs for non-replicating in vitro transcribed mRNA provide greater stability, and thus greater transgene expression, of replicon RNA, the respective sequences were cloned into the replicon RNA template vectors. Since the 3' CSE needs to be located immediately adjacent to the poly(A) tip, the new UTRs were inserted immediately downstream of the 3' CSE of a replicon encoding destabilized luciferase (Luc2Pmut). Replicon RNA was synthesized by in vitro transcription of linearized template plasmids similar to IVT mRNA. Replicon RNA was introduced into cells (BHK21 and HFF) by electroporation, and luciferase expression was assessed. As shown in Figure 9, all inserted UTRs increased Luc2CP translation in both cell lines used. Interestingly, the combination of "IF UTR" resulted in a remarkable increase in translation. Example 9: Nucleotide exchanges up to 90% homology have no impact on the stabilizing properties of the Fl element Due to the selection procedure that was applied to identify new UTR stabilizing elements, sequences in a certain size range were obtained. Identification of the same sequences with extended 5' and 3' ends gave a first indication for the required minimum length. However, the minimum region required for each element to exert its stabilizing effect can be even shorter. Furthermore, slight variations of the sequences may still be functional, that is, identity of any individual nucleotide may not be of ultra-importance to the stabilizing properties of the Fl element. To see the degree to which elements are strong against nucleotide exchanges, sequences 3 'UTRs with 97.5%, 95.0%, 92.5%, and 90.0% homology to the parent Fl element were tested for total protein expression and mRNA half-life in hiDC. The nucleotides that were changed were chosen randomly over the full length of the sequence (sequence 208-201, random modifications). Luciferase mRNAs with these modified elements, 3' UTR were transcribed in vitro, electroporated into hiDC, and their expression followed over time by luciferase measurements after 3, 6, 24, 48, and 72h. Luciferase mRNAs with the modified Fl element produced the same amount of total protein and had approximately the same half-life (Table 17). In addition to random substitutions with increasing degrees as described above, another set of modified Fl elements were generated by rationally introducing nucleotide substitutions that are likely to disrupt the secondary structure of the Fl element. For multiple natural 3' UTR sequences it is known that its secondary structure is of importance because it provides binding sites for regulatory proteins, which influence mRNA stability (Addess et al., 1997; Putland et al., 2002; Crucs et al., 2000; Adams et al., 2000). al., 2003). Two 8nt sequences that are perfectly complementary to each other are present in the Fl element, one in the F element and the other in the I element (Figure 10). The base pairing of these two regions can also be seen in most of the mfold predictions. mFoId (Zuker, 2003) is a computer program that allows secondary structure predictions of input sequences. To verify the importance of this specific secondary structure element, the sequence was changed in a manner that abolishes base pairing (sequence 12, 8nt mutation). In addition to these rather long complementary sequences, the mfold predictions for the Fl 3' UTR were examined for structural elements present in the ncznnn / ι znz / R / v majority of the output folds, which must therefore have a high probability of formation in vivo. The nucleotides comprised of the base pairing of these folds were changed to 97.5%, 95.0%, 92.5%, and 90.0% homology to the original Fl sequences by sweeping them with their base pairing partners, thereby retaining the secondary structure of the sequence (sequences 217-220, frame retention modifications). Furthermore, the same sequences were swapped in only one strand of the double-stranded part, thereby deliberately destroying the secondary structure. In these cases, the identity to the original sequence was 98.75%, 97.50, 96.25%, and 95.00% respectively (sequences 213-216, destabilizing structure modifications). Luciferase RNAs with the described modified 3' UTR elements were transcribed in vitro, electroporated into hiDC, and their expression over time was followed by luciferase measurements after 3, 6, 24, 48, and 72h. . With no modification strategy, significant impact on mRNA half-life can be observed. Therefore, the stabilizing properties of the Fl element can be seen to be strong against changes in its nucleotide sequence or secondary structures to at least up to 10.0% nucleotide variation. Also, no decline in the total amount of protein can be observed in the Fl sequence modification (Tables 18A and B). Example 10: Use of the Fl element instead of 2hBq avoids poor priming in PCR-based amplification of the RNA coding region As shown, the Fl element is equal to or greater than the 2hBg 3' UTR with respect to stability and mRNA transductional efficiency. Another advantage of the Fl element is its non-repetitive sequence, whereas the two copies of the hBg 3' UTR can cause problems in some cases. This is mainly obvious, when the DNA template for RNA transcription is amplified by PCR. In these cases, the full length poly A limb is added to the 3' oligo primer which binds to the very 3' end of the 3' UTR (Figure 11 A). In the case of 2hBgUTR, truncated secondary products emerge during PCR, which after sequencing is quenched consist of mRNA with only the 1 hBg repeat in the UTR (Figure 11B). After transcription, the truncation is also visible in the mRNA (Figure 11C). This phenomenon occurs in most PCR reactions with constructs containing the 2hBgUTR element and cannot be fully abrogated by optimization efforts including primer fixation temperature, buffer composition, primer sequence, or alternative polymerases. Even after the insertion of a unique linker sequence between the 3' UTR and the polyA tip, the problem remains. Importantly the strength of the secondary peak correlated with PCR reaction performance, indicating poor priming of short, truncated PCR fragments, which increases with each PCR cycle, as the likely cause of the problem. Therefore, satisfactory conditions for DNA templates encoding RNAs with the 2hBg 3'-UTR cannot be identified. In contrast, PCR of DNA templates with the Fl element does not produce any truncated side-products (Figure 11D), and also the resulting mRNA showed no additional peak in the bioanalyzer profile (Figure ncznnn / i znz / R / v 11Ε). Therefore, the Fl element constitutes a considerable improvement as a 3' UTR compared to the 2hBgUTR with respect to PCR template integrity and corresponding RNA quality. Example 11: RNA stabilizing properties of subfragments of the F and I elements Due to the selection procedure that was applied to identify new stabilizing UTR fragments, sequences in a certain range of sizes were obtained. Identification of the same sequences with 5' and 3' ends extended to a first indication for the required minimum length. However, the minimum region required for each element to exert its stabilizing effect can be even shorter. To this end, for both the F and I elements, five luciferase reporter constructs were designed, each containing a shortened UTR covering a different fragment of the original element shortened at the 5' and / or 3' end (see upper panels). of Figures 12A-12B, respectively). These reporter constructs were transcribed in vitro, electroporated into hiDC, and their expression over time was followed by luciferase measurements 3, 6, 24, 48, and 72h after electroporation. The resulting expression curves were analyzed for the relative half-life of RNA with RNA containing the respective full-length set to 1 (see Figure 12A12B lower panels, respectively). For the F element, no significantly decreased half-life of mRNA could be observed for any subsequence tested, indicating a redundant, non-cooperative involvement of various subsequences along the F element in its stabilizing role. A similar result can be obtained for element I, although here a slight drop in performance can be observed only when the central row (nt37-107) was used as 3' UTR. To put these results in perspective, the individual full length F and I elements as well as the Fl pool were compared to a randomly selected 3' UTR from the starter library (257nt in length). This was obtained by cloning the starting DNA mix and selecting an individual random clone. As described above, RNAs encoding luciferase with the respective UTR sequences were electroporated into hiDC, luciferase expression measured over time, and relative half-lives and total protein expression calculated. Compared to the F, I and Fl elements, RNA with the randomly selected 3' UTR is significantly less stable (Figure 13, upper panel). The effect of selected UTRs is even more pronounced for total protein expression (Figure 13, bottom panel). This clearly indicates that the effect of fragmenting the Fl elements as described above are specific to the selected sequences and are not caused simply by the presence of a 3' UTR sequence. This is in line with the observed increase in the RNA stability of the mix during selection (see above). Example 12: Use of Stabilizing UTR Elements for Stem Cell Reprogramming 40,000 cells were seeded in a 12-well plate and lipofected for three (3x) or four (4x) consecutive days with mRNA mixes that were composed of 0.33 pg of unmodified in vitro transcribed (IVT) RNA encoding reprogramming of BLOT OCT4, SOX2, KLF4, cMYC, NANOGyLIN28 (OSKMNL) (1:1:1:1:1:1) with 0.08 pg each of B18R, E3 and K3 (EKB) and 0.17 pg of miRNA mix ncznnn / ι znz / R / v composed of miRNAs 302a-d and 367 (1:1:1:1:1:1). RNA constructs in this manner only differed in their 3' UTR consisting of a tandem repeat of the 3' UTR of human β-globulin (2hBg), the F-l element (Fl) or the l-F element (IF). Cells were grown in human embryonic stem (hES) cell medium and lipofections were performed using RNAIMAX) according to the manufacturer's instructions. From day 9 onwards, colony formation was observed and colony analysis was performed at d11 (see Figure 14A for timeline overview). Established colonies were stained for alkaline phosphatase (AP) on day 11 using an AP stainer. For an overview representative stainings are shown in Figure 14B. It becomes obvious that incorporation of the Fl element results in increased numbers of AP-positive colonies (dark). Colonies stained for AP were counted and the overview results are confirmed: compared to the previously used 2hBg-UTR, replacement with IF-UTR leads to a 3-4 fold excess of colonies when cells are lipofected 3 times. Replacement with the IF-UTR results in a two-fold excess. With four transfections, these effects are less pronounced. Here no improvement is observed with the IF-UTR. On the one hand, the process appears to be in a saturation with four transfections while on the other hand here the colony count is to some degree polarized due to colony outgrowth (see Figure 14C). The morphology of the colonies resulting from iPS-cell using RNAs containing the FI-UTR was hES cell-like with small cells tightly packed into distinct colonies and well-defined boundaries (Figure 14D). These colonies can be stained positive for AP (Figure 14E) and the cell surface marker hES TRA-1-60 (Figure 14F). Live staining with TRA-1-60 was performed with the TRA-1-60 Stain-Alive antibody (Stemgent) according to the manufacturers instructions. Representative images of the colonies are shown. To further assess the pluripotency of the colonies, cells were pelleted, total RNA was isolated, and mRNA expression of the hES-markers OCT4 (endogenous), NANOG (endogenous), LIN28 (endogenous), TERT, and REX1 was quantified by aRT-PCR. mRNA expression was normalized to that of HPRT and shown as fold induction compared to input cell transcript levels. Colony analysis after three lipofections is shown in Figure 14G. All the markers analyzed were highly expressed compared to the input cells indicating pluripotency of reprogrammed cells. The superiority of the synthetic Fl-containing mRNA was confirmed by increased endogenous marker expression compared to reprogramming with the 2hBg- and IF-containing mRNAs. These results show, that the replacement of the 2hBgUTR with the IF-UTR results in a faster and more efficient RNA-based reprogramming technology. This is probably based on the longer and higher expression of reprogramming transcription factors that results from substitution with the Fl element. Targeting of the Fl element thus seems indispensable since no benefit was observed with the IF constructs. Successful reprogramming of cells by Fl-containing mRNA was confirmed by hES cell-type morphology, AP activity, and the expression of endogenous and cell-surface markers hES of the resulting colonies of iPS cells. ncznnn / ι znz / R / v Boards Table 1. Half-life of mRNA in hours (h) calculated from data from real-time reverse transcriptase-PCR (RTPCR) experiments to monitor selection progress. The mRNAs were quantified 8, 24 and 48 hours after electroporation. In experiment I (left), each sample was tested only once. Therefore, no standard deviation is given. ncznnn / i 707 iw Sample mRNA half-life Sample mRNA half-life 2hBg 7.5 h 2hBg 13.5 ± 0.2 h lib 4.5 h Rn4 13.9 ± 0.7 h Rn1 4.9 h Rn5 16.5 ± 0.7 h Rn2 6.7 h Rn3 7.5 h Table 2: Overview of the 7 main groups with the binding region (BR) within the 3' UTR of the BLASTed sequence. Group abbreviation, number of clones identified for the group (no.), genomic origin with respective abbreviation (Abr), NCBI code, and position within the sequence with respect to the coding region are shown. According to NexBio all the sequences were favored in expression in hiDC. group no. BLAST result with representative sequence of each group Homo Sapiens Apr. NCBI code BR B 50 Fe fragment of IgG.receptor, transporter. alpha.mRNA (cDNA clone) FCGRT NM_001136019 3'-UTR D 22 Lymphocyte-specific protein 1.mRNA LSP1 NM_002339 3'-UTR E 13 Chemokine ligand 22 (C-C motif) CCL22 NM_002990 3'-UTR F 4 Amino-terminal enhancer mRNA AES NM_198969 3'-UTR G 15 Phospholipase D family member 3. PLD3 mRNA NM_001031696 CDS+3' UTR I 17 mitochondrially encoded 12S RNA MT- RNR1 NUCLEOTIDE_ 012920 ncRNA J 22 Major histocompatibility complex. class II.DR beta 4.HLA mRNA- DRB4 NM_021983 3'-UTR Table 3. Values ​​calculated relative to our 2hBg gold standard for half-life and total protein over time. The respective gene and group name is shown ΊΟ RefSeq gene Relative to 2hBg Half-life Total protein over time IgG Fe fragment, receptor, transporter, alpha NM_001136019 0.89 ±0.15 0.96 ±0.15 Lymphocyte-specific protein 1 NM_002339 0.80 ± 0.21 0.75 ± 0.03 Chemokine 2M ligand 0.20_0.29 N90_0.21 ± 0.16 0.66 ± 0.12 Division aminoterminal intensifier NMJ98969 0.90 ± 0.06 0.95 ± 0.01 Member 3 of Fospholipase Family B NM_00101696 0.79 ± 0.21 0.66 ± 0.13 RNA of12S Mitochondrially coded NC_012920 1.15 ± 0. NM_021983 0.89 ± 0.08 0.89 ± 0.09 nc7nnn / i 7Π7 / β / υ Table 4. PCR conditions for library amplification and subsequent selection rounds. Time Temperature Step 1 min 30 s 98°C Initial denaturation 20 s 98°C Denaturation 30 s 65°C Staining 45 s 72°C Final extension 5 min 72°C Final extension - 4°C Retention ncznnn / i znz / R / v Table 5. IVT-T7 transcription reaction Conc. / Vol Final Concentration ddH2O Add 50 pL D1 Cap Variable 6.0 mM 100 mM ATP / CTP / UTP 7.5 mM 100 mM GTP 1.5mM T7 Buffer 10x 1x PCR Product Variable 0.05 pg / pL T7 HC Enzyme Mix 10x 1x Table 6. Combinations cloned and compared to our gold standard 2hBg (lower right corner). Individual items cloned twice are highlighted ncznnn / i znz / R / v 1 G 2<ΊΤ%<- Gl G IG GG B IB GB D ID GD J IJ GJ E IE GE F IF GF hBg IhBg GhBg B D J Bl DI Jl BG DG JG DB JB BD 1 TODi / JD BJ DJ Jj BE DE JE BF DF JF BhBg DhBg JhBg E F hBg El Fl hBgl EG FG hBgG EB FB hBgB ED FD KBgD EJ FJ hBgJ i ee FE hBgE EF ==EE= hBgF EhBg FhBg 2hBg Table 7. Results of FCGRT (group B) cloned as a single element or downstream combined with one of the other group sequences as a 3'-element. Values ​​in bold are > 1.0. Values ​​are relative to 2hBg ncznnn / i 7f\7iw SAMPLE Middle lives in relation to 2HBG TRAN3 PROTEIN TRANSDUCTIONAL EFFICIENCY With the passage of time B 0.840 1,320 1,300 BB 0.580 1,530 0.900 BL 0.920 1,750 1,410 BG 0.780 2,300 1,430 BD 0.730 1.970 1,220 BJ 0.710 1.910 1.190 BE 0.720 1,500 1,500 1,030 1,030 BF 0.760 1.7 2,200 1,740 hBgB 0,640 1,750 1,030 2hBg 1,000 1,000 1,000 Table 8. Result of LSP1 (group D) cloned as a single or 5' element, combined with one of the other group sequences as a 3' element. Values ​​in bold are > 1.0. The values ​​in relation to2hBg. ncznnn / i znz / R / v SAMPLE Middle lives in relation to 2HBG Total Protein Transductional Efficiency with the passage of time D 0.770 0.860 1,250 DD 0.680 1.130 1000 DI 0.960 1.440 1,270 DG 0.700 1,530 1,110 dB 0.640 0.900 0.760 DJ 0.640 1.040 0.890 of 0.690 0.690 1,000 0.970 of 0.70 0.70 0.70 0.750 0. 1,120 1,020 hBgD 0,820 1,490 1,160 2hBg 1,000 1,000 1,000 Table 9. Result of CCL22 (group E) cloned as a single element or downstream combined with one of the other group sequences as a 3'-element. Values ​​in bold are >1.0. Values ​​are relative to 2hBg. nc7nnn / i 7Π7 / Β / Υ SAMPLE Middle lives in relation to 2HBG TRAN3 PROTEIN TRANSDUCTIONAL EFFICIENCY With the passage of time E 0.760 0.9710 0.940 EE 0.600 0.950 0.670 The 0.8910 1,120 0.960 EG 0.680 1.590 0.940 EB 0.570 1.470 0.850 ED 0.650 1,350 0.350 0.950 Ex 1,190 0,780 hBgE 0,880 1,630 1,050 2hBg 1,000 1,000 1,000 Table 10. Result of AES (group f) cloned as a single element or downstream combined with one of the other group sequences as a 3'-element. Values ​​in bold are > 1.0. Values ​​are relative to 2hBg. ncznnn / i 7f\7iw SAMPLE Middle lives in relation to 2HBG TRAN3 PROTEIN TRANSDUCTIONAL EFFICIENCY With the passage of time F 0.500 1,760 0.970 FF 0.910 7.770 1,410 FL 1,100 1,490 1,290 FG 0.850 1.680 0.980 FB 0.720 1.360 0.860 FD 0.490 1,350 0.620 FJ 0.780 1.720 1.730 1.090 1.0 1,900 1,530 hBgF 0,940 2,250 1,500 2hBg 1,000 1,000 1,000 Table 11. Result of PLD3 (cluster G) cloned as a single element or downstream combined with one of the other cluster sequences as a 3'-element. Values ​​in bold are > 1.0. Values ​​are relative to 2hBg. ncznnn / i 7f\7iw SAMPLE Middle lives in relation to 2HBG TRAN3 PROTEIN TRANSDUCTIONAL EFFICIENCY With the passage of time G 0.740 1,260 1,110 gg 0.480 1,080 0.690 GL 0.990 1.010 1,000 GB 0.50 0.970 0.620 GD 0.630 1.170 0.780 GJ 0.520 0.940 0.640 GE 0.500 0.730 0.730 0.70 0 0.990 0.860 hBgG 0.720 1.160 0.910 2hBg 1,000 1,000 1,000 Table 12. Result of mtRNRI (group I) cloned as a single element or downstream combined with one of the other group sequences as a 3' element. The values ​​in bold are Values ​​are relative to 2hBg. ncznnn / ι znz / R / v SAMPLE Middle lives in relation to 2HBG TRAN3 PROTEIN TRANSDUCTIONAL EFFICIENCY With the passage of time 1 1,080 1,020 1,440 II 1.170 0.830 1,030 IG 1.040 1,250 1,310 IB 1,100 1,200 1,180 ID 1.190 1,580 1,510 IJ 1,080 1.430 1.330 IE 1,060 1,000 1,070 1,070 1,070 1,070 1,070 1. 1,110 1,210 hBgl 1,210 1,420 1,270 2hBg 1,000 1,000 1,000 Table 13. Result of HLA-DRB 4(group J) cloned as a single element or downstream combined with one of the other group sequences as a downstream element. Values ​​in bold are 1.0. Values ​​are relative to 2hBg. ncznnn / ι znz / R / v SAMPLE Middle lives in relation to 2HBG TRAN3 PROTEIN TRANSDUCTIONAL EFFICIENCY With the passage of time J 0.790 0.930 0.920 JJ 0.490 0.960 0.540 JL 0.880 1,110 0.900 J / G 0.420 1.280 0.630 JB 0.480 1,000 0.520 JD 0.500 1,370 0.830 JE 0.420 0.420 0.520 JhBg 0.730 1,100 0.800 hBgJ 0.770 1,530 1,080 2hBg 1,000 1,000 1,000 Table 14. Representative values ​​using Iuc2mut as reporter gene and the newly selected 3' UTR after electroporation in h¡DC. Luciferase activity was measured for 96h. Values ​​are relative to 2hBg. SAMPLE Middle lives in relation to 2HBG TRAN3 PROTEIN TRANSDUCTIONAL EFFICIENCY With the passage of time non -time 0.300 0.694 0.139 HBG 0.360 1.216 0.437 I 0.800 1,132 0.930 IF 1.110 1,050 1,133 FI 1.020 0.818 0.847 IHBG 0.880 0.860 0.860 0.792 ncznnn / i znz / R / v Table 15: Electroporation settings The table summarizes the details of the electroporation protocol for all cell types used. The amount of cells labeled under cell counts was mixed with the amount of RNA labeled in either pg or pmol in either electroporation tubes or 96-well electroporation plates (as indicated under the format) in X-VIVO15 medium ( lonza). Electroporation was performed by applying a pulse with the designated length and voltage listed under V. Subsequently, the cell suspension was diluted in growth medium and distributed into 96 wells at the density listed under cells / time point. Format Separation size Cell count RNA [pg] RNA [pmol] cells / time point V Impulse hiDCs Test tube 4mm 1.00E+06 10 5.00E+04 300 1x12ms HFF 96 concavities 4mm 7.00E+04 2 1.00E+04 200 1x24ms CD8+ 4mm test tube 2.50E-K)6 10 1.67E-K)5 500 1x3ms CD4+ 4mm test tube 2.50E+06 10 1.67E+05 500 1x3ms MEF 96 concavities 4mm 7.00E+04 2 1.00E+04 200 5x6ms / 400ms C2C12 96 concavities 4mm 7.00E+04 2 1.00E+04 240 5x5ms / 400ms bmDCs Specimen 4mm 1.00E+06 10 5.00E+04 400 1x5ms Table 16 Half-lives and fetal protein of Fl element at 2hBgUTR containing modified and unmodified mRNA in electroporation and unmodified RNA in lipofection. Plasmids encoding the firefly luciferase gene containing either Fl or 2hBg as 3' UTR were linearized downstream of the poly(dA:dT) with a US class restriction enzyme thereby generating a template. without any additional nucleotides beyond poly(dA:dT). Linearized plasmid DNA was purified using carboxylated magnetic beads (Invitrogen), quantified spectrophotometrically, and subjected to in vitro transcriptions. For in vitro transcripts, laboratory-made T7RNA-polymerase supplemented with RNase and pyrophosphatase inhibitors was used with 7.5 mM NTP in 125 mM HEPES buffer pH 8.35, 34 mM MgOAc2, 10 mM DTT, and 2 mM spermidine. For efficient RNA capping, 6 mM β-S-ARCA (D2) was added to the reaction and the initial GTP concentration was decreased to 1.5 mM, which was adjusted to 7.5 mM in a fed-batch process for 2.5h at 37 °C RNA was purified by carboxylated magnetic beads (Invitrogen) and RNA concentration and quality were assessed by spectrophotometry and analysis on a 2100 Bioanalyzer (Agilent). A) Shows that the half-lives of the unmodified mRNAs containing the Fl element are greater than or comparable to those containing the 2hBg 3' UTR in various murine and human cell lines. The amount of human fibroblasts (HFF), CD8+ and CD4+ T cells, murine embryonic fibroblast (MEF), myoblastoma cells (C2C12) and murine DC as listed in Table 15 were mixed with the respective amount of RNA (Table 15). ) in X-VIVO15 medium (Lonza) and electroporated. The indicated number of cells were plated in 96-well dishes in 100 μΙ of appropriate growth medium with additives. At 2, 6, 24, 48, 72 and 96 hours after seeding, firefly luciferase activities were determined by the addition of Luciferin (Promega) in a fluorescence reader (TECAN). B) Shows that the half-lives of m1Y-modified mRNAs containing the Fl element are greater than or comparable to those of the 2hBg 3' UTR in different human and murine cell lines. The amount of human immature dendritic cells (¡DC), fibroblasts (HFF), CD8+ and CD4+ T cells, murine embryonic fibroblast (MEF), myoblastoma cells (C2C12) and murine DC as listed in Table 15 were mixed with the respective amount of m1Y-modified RNA (Table 15) into X-VIVO15 medium (Lonza) and electroporated. The indicated number of cells were plated in 96-well dishes in 100 μΙ of appropriate concentration medium with additives. At 2, 6, 24, 48, 72 and 96 hours after seeding, firefly luciferase activities were determined by the addition of Luciferin (Promega) in a fluorescence reader (TECAN). C) Shows that the half-lives of the modified NO mRNAs containing the Fl element are longer or comparable to those containing the 2hBg 3' UTR in different cell lines also when the RNA was transfected by lipofection. 50 ng of RNA was incubated for 15-30 min with 0.2 μΙ RNAÍMAX and given to 1E04 HFF, MEF, or C2C12 cells in 96 wells. Luciferase levels were measured at 3, 6, 12, 24, 48, 72 and 96h by adding Luciferin (Promega) in a fluorescence reader (TECAN). ncznnn / i znz / R / v A B C Unmodified mRNA Modified mRNA with m1Y Lipofection Relative to 2hBg Relative to 2hBg Relative to 2hBg Half-life Total Protein Half-life Total Protein Half-life Total Protein hiDC 1.29 2.24 C2C12 1.64 2.24 1.58 2.32 1.09 1.82 HFF 1.69 2.45 1.83 2.21 1.14 2.22 MEF 1.39 2.15 1.18 1.52 1.11 2.24 CD4+ 1, 04 1.32 1.02 1.46 CD8' 0.96 1.29 1.05 1.33 bmDC 0.87 1.98 1.09 1.34 Table 17: 10 pg of RNA encoding firefly luciferase containing either the Fl element or variations of the Fl element with homology designated to the original Fl sequence as 3' UTR were electroporated into hiDC in a 96-well format . Luciferase expression was followed over time at 3, 6, 24, 48, and 72h, and from the resulting expression curve, the mRNA half-life and the amount of total protein translated from the RNA were calculated. ncznnn / i znz / R / v In relation to sequence Fl Half-life Total Protein % Homology 97.54 1.0- / -0.1 1.3+ / -0.2 95.0 1.0- / -0.0 1.2+ / -0.2 92.5 1.1 - / -0.1 1.4+ / -0.1 90.0 0.9- / -0.1 1.1 + / -0.2 Table 18: 10 pg of RNA encoding firefly luciferase containing either the Fl element or variations of the Fl element containing the mutation-retaining or destroying structure and with the homology designated to the original Fl sequence as 3' UTR were subjected to hiDC electroporation in a 96-well format. Luciferase expression was followed over time at 34, 6, 24, 48, and 72h, and the mRNA half-life and total protein amount were calculated from the resulting expression curve. A B Structure that retains modifications Structure that destabilizes modifications Relative to Fl sequence Relative to Fl sequence Half-life Total protein Half-life Total protein 25 % of Homology % of Homology 97.5 98.75 95.0 1.2+ / -0.1 16+ / -0.3 97.50 1.1+ / -0.1 1.5+ / -0.1 92.5 1.1+ / -0.1 1.7+ / -0.3 96.25 1.1+ / -0.1 1.4+ / -0.1 90.0 1.1+ / -0.1 1.5+ / -0.3 95.00 1.0+ / -0.1 1.5+ / -0.1 30 1.1+ / -0.2 1.4+ / -0.1 8nm mutation 1.0+ / -0.0 1.1+ / -0.2 0.9+ / -0.0 1.3+ / -0.4 The sequences described herein are as follows: 35Group B >Rn5-2pl-A4 For2 CAUCCUGCUGCUGCUGCUGCUGCUGCUGCUGCGGGUCUUCCUGGAAUCUGACCAUUCGUUGUC UGCUAUGCCCGUCCCUCACCAAGACUGACUGCCUGCUGCUGCUUUGCUACUGCGCGGGCCCAUG AGACUGACUUCCCACUGCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUG CCGCUGCUGAUCCAUUGCCGGUGUGACC-3-2Forpl_3 Rn5C5 UUCCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCGGGUCUUCCUAGAAUCUGACCAUUCGUUG UCUGCUAUGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUGCUUUUGCUACUGCCCGGGCCCA UGAGACUGACUUCCCACUGCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCU UGCCGCUGCUGAUCCAUUG >RCGGUGAGACC_For2n UGCUGCUGCUGCUGCGGGUCUUCCUGGAAUCUGACCAUUCGUUGUCUGCUAUGCCCGUCC UCACCAAGACUGACUGCCUGCUGCUUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCA CUGCUCUGCCUGCCUCUCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCA UUGCCGGCGGACA >Rn6_For2WoC3 GCUGCUGCGGGUCUUCCUGGAAUCUGACAUUCGUUGUGCUGCUAUGCCCGUCCUCACCAA GACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCU GCCUGCCUCCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGG CGUACC >Rn6-1WoB12_For2 CUGGAAUCUGACCAUUCGUUGUGCUGCUAUGCCCGUCCCUCACCAAGACUGACUGCCUGCLJG CUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUCUCCCCAC UGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGCGGACC >Rn6-1WoB1_For2 UCCUGCUGCUGCUGCUGCUGCUGCUGCGGGUCUUCCUGGAAUCUGACCAUUCGUUGUCUG CUAUGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACLJGCCCGGGCCCAUGAG ACUGACUUCCCACUGCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCC GCUGCUGAUCCAUUGCCGGUGGGACC >Rn6-1WoF3_For2 ncznnn / ι ζηζ / Β / γ CUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGC CUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUAGAAC O >Rn6-1Wo_H11_b UCCUGCUGCUGCUGCUGCUGCUGCUGCUGCGGGUCUUCCUGGAAUCUGACCAUUUUGUUGUCUG CUAUGCCCGUCCCUCACCAAGACUGACUGCCUGCUGCUGCUUUGCUACUGCUGCCGGGCCCAUGAG ACUGACUUCCCACUGCUCUGCCUGCCUCUCCCACUGCACUGGCACAGCCCCGCCUUGCC GCUGCUGAUCCAUUGCCGGUGGGACCo >8_b >Rn5-2pl-B3 UCUGGCCUCACUGAGUCUGAAGAGCUGUUAACUACCAUGGCCAGUCCUCCCUGAGUCUGA CCAUCUUCCAUCCUGCUGCUGCUGCUGCUGCUGCUGCGGGUCUUCCUGGAAUCUGACCAU UCGUUGUCUGCUAUGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCG GGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCC CCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >Rn5_F5_b UCUGGCCUCACUGAGUCUGAAGAGCUGUUAACUACCAUGGCCAGUCCUCCCUGAGUCUGA CCAUCUUCCAUCCUGCUGCUGCUGCUGCUGCUGCUGCGGGUCUUCCUGGAAUCUGACCAU UCGUUGUCUGCUAUGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCG GGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCC CCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >Rn5B8_For2 CUACCAUGGCCAGUCCUCCCUGAGUCUGACCAUCUUCCAUCCUGCUGCUGCUGCUGCUGC UGCUGCGGGUCUUCCUGGAAUCUGACCAUUCGUUGUCUGCUAUGCCCGUCCUCACCAAGA CUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGC CUGCCUUUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUG UGACC >Rn6-1WoH9_For2 GUCCUCCCUGAGUCUGACCAUCUUCCAUCCUGCUGCUGCUGCUGCUGCUGCUGCGGGUCU UCCUGGAAUCUGACAUUCGUUGUCUGCUAUGCCCGUCCUCCACCAAGACUGACUGCCUGC UGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUCUCCCC ncznnn / ι ζπζ / β / β ACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUCUGACA >Rn6-2WoC11_For2 GUCCUCCCUGAGUCUGACCAUCUUCCAUCCUGCUGCUGCUGCUGCUGCUGCUGCGGGUCU UCCUGGAAUCUGACCAUUUGUUGUCUGCUAUGCCCCUCCUCACCAAGACUGACUGCCUGC UGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUUCCCCA CUGCACUGGCACAGCCCCGCCUGAGUCAGAUUGCUGCUC_3_5b CCAUCCUGCUGCUGCUGCUGCUGCUGCUGCUGCGGGUCUUCCUGGAAUCUGACCAUUCGUUGU CUGCUAUGCCCGUCCCUCACCAAGACUGACUGCCUGCUGCUGCUUGCUACUGCGCGGGCCCAUG AGACUGACUUCCCACUGCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGH CCGCUGCUGAUCCAUUGCCGGUGUGACCForo_5-2WO > GCCAGUCCUCCCUGAGUCUGACCAUCUUCCAUCCUGCUGCUGCUGCUGCUGCUGCUGCGG GUCUUCCUGGAAUCUGACCAUUCGUUGUCUGCUAUGCCCGUCCUCACCAAGACUGACUGC CUGCUGAUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUCU CCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >Rn6-96hE12_For2 UGCCUUCCGUCUCCUGCUGCUUCUGGCCUCACUGAGUCUGAAGAGCUGUUAACUACCAUG GCCAGUCCUCCCUGAGUCUGACCAUCUUCCAUCCUGCUGCUGCUGCUGCUGCUGCUGCGG GUCUUCCUGGAAUCUGACCAUUCGUUGUCUGCUAUGCCCGUCCUCACCAAGACUGACUGC CUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUCU CCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >Rn6-96h-2pl-E9_F GGCCAGUCCUCCCUGAGUCUGACCAUCUUCCAUCCUGCUGCUGCUGCUGCUGCUGCUGCG GGUCUUCCUGGAAUCUGACCAUUCGUUGUCUGCUAUGCCCGUCCUCACCAAGACUGACLJG CCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUC UCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >Rn6-96h-2pl-H10_ GGCCAGUCCUCCCUGAGUCUGACCAUCUUCCAUCCUGCUGCUGCUGCUGCUGCUGCUGCG GGUCUUCCUGGAAUCUGACCAUUCGUUGUCUGCUAUGCCCGUCCUCACCAAGACUGACUG CCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUC UCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >Rn6-1WoB11_For2 UGACCAUCUUCCAUCCUGCUGCUGCUGCUGCUGCUGCUGCUGCGGGUCUUCCUGGAAUCUGAC CAUUCGUUGUCUGCUAUGCCCGUCCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGC ncznnn / ι ζηζ / Β / γ CCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUCUCCCCACUGCACUGGCACA GCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >Rn6-1WoF7_For2 CCAGUCCUCCCUGAGUCUGACCAUCUUCCAUCCUGCUGCUGCUGCUGCUGCUGCUGCGGG UCUUCCUGGAAUCUGACCAUUCGUUGUCUGCUAUGCCCGUCCUCACCAAGACUGACUGCC UGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCUCUGCUCUGCCUGCCUCUC CCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCUGUGUGACCA >Rn6-1WoA7_For2 > GACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCU GCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGG UGUGACCC >Rn6-2WoG3_For2 CUCCCUGAGUCUGACCAUCUUCCAUCCUGCUGCUGCUGCUGCUGCUGCUGCGGGUCUUCC UGGAAUCUGACCAUUCGUUGUCUGCUAUGCCCGUCCUCACCAAGACUGACUGCCUGCUGC UUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUCUCCCCACU GCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >Rn6-2WoC2_For2 UUCCAUCCUGCUGCUGCUGCUGCUGCUGCUGCUGCGGGUCUUCCUGGAAUCUGACCAUUCGUUGUCUGCUAUGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUGCUUUGCUACUGCCCGGGCCC AUGAGACUGACUUCCCACUGCUCUGCCUGCCUCUCCCCCACUGCACUGGCACAGCCCCGCC UUGCCGCUGCUGAUCCAUUG >RCGGUGUGA-For6D2CCo UGCCCGUCCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACU GACUUUCCCACUGCUCUGCCUGCCUCUCCCCACUGCAUGGCACAGCCCCGCCUUGCCGCU GCUGAUCCAUUGCCGGUGUGACC >Rn6-1WoD10_For2 UGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACU GACUUUCCCACUGCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCU GCUGAUCCAUUGCCGGUGUGACC >Rn6-2WoG5_For2 ncznnn / ι znz / B / v GCGGGUCUUCCUGGAAUCUGAACAUUCGUUGUGUCUGCUAUGCCCGUCCUCACCAAGACUGA CUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGC CUCUCCCACUGCCUUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGAC C >Rn6-96h-2pl-G8_F GUUGUCUGCUAUGCCCGUCCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGG CCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUCUCCCCCACUGCACUGGCACAGCCCC GCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >Rn6-1WoE7_For2 CAAGACUGACUGCCUGCUGCUUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGC UCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGC CGGUGUGACC >Rn6-1Wo_A12_b CCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGACCAUGAGACUGACUUCC CACUGCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUC CAUUGCCGGUGUGACUGC >Rn6-1WoG11_For2 CUUCCAUCCUGCUGCUGCUGCUGCUGCUGCUGCUGCGGGUCUUCCUGGAAUCUGACCAUUCGU UGUCUGCUAUGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUGCUUUGCUACUGCCCGGGCC CAUGAGACUGACUUCCCACUGCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGC CUUGCCGCUGCUGAUCCAUUGCCGGUGUGA-15Hn5CCW CUCACCAAGACUGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCC ACUGCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCC AUUGCCGGUGUGACC >Rn6-1WoH4_For2 AAGACUGACUGCCUGCUGCUUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCU CUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCC GGUGUGACC >Rn6-2WoB4_For2 CUCCAGCUCGCUUCCALJUUGCUUGCAGAAGUUCUCGCUGUGCUCACGAAGCUUGCGCUCC UUGGAGGCCUCAGCAACAGCAUCAUCAAGCUGAGCUUCCAGCUCUUUCCUGAGCUUCUCA GCUCUCCGCAUUUCCUGCCGCAUGGCGUCCACCUUCUGCGUGGCCACCUCCAUCUCCUCC UCCUUGUCUCGCAGCUGCCGGGACACCUUCUGCGCUAAGAUGGGAUACGGCAUUGAGGGA UCAAUGUGUAAGGAUCCGAUCUGCUUCUGGCCUCACUGAGUCUGAAGAGCUGUUAACUAC ncznnn / ι ζηζ / Β / γ CAUGGCCAGUCCUCCCUGAGUCUGACCAUCUUCCAUCCUGCUGCUGCUGCUGCUGCUGCU GCGGGUCUUCCUGGAAUCUGACCAUUCGUUGUCUGCUAUGUCCGUCCUCACCAAGACUGA CUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGC CUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGAC C >Rn6-96h-2pl-A5_F CUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGC CUGCCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUG UGACC >Rn6-1WoC8_For2 CCAAGACUGACUGCCUGCUGCUUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUG CUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUG ACGGUGUGACC >Rn5D1_For2 UAACUACCAUGGCCAGUCCUCCCUGAGUCUGACCAUCUUCCAUCCUGCUGCUGCUGCUGC UGCUGCGGGUCUUCCUGGAAUCUGACCAUUCGUUGUCUGCUAUGCCCGUCCUCACCAAGA CUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGC CUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGUUGAUCCAUUGCCGGUG UGACC >Rn6-2WoG10_For2 CCAAGACUGACUGCCUGCUGCUUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUG CUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGUUGAUCCAUUG UCGGUGUGACC >Rn6-1Wo_E4_b CCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUG CUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUG CCGGUGUGACC >Rn6-2WoF3_For2 CUGCUAUGCCUGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAU GAGACUGACUUCCCACUGCUCUGCCUGCCUCUCCCCAAUGCACUGGCACAGCCCCGCCUU GCCGCUGCUGAUCCAUUGCCGGUGUGACC >Rn6-96h-2pl-B10 CUGCUAUGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUUGCUACUGCCCGGGCCCAU GAGACUGACUUCCCACUGCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUU GCCGCUGCUGAUCCAUUGCCGGUGUGACC ncznnn / ι ζπζ / β / υ >Rn6-96h-2pl-C10 GCUAUGCCCGUCCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGA GACUGACUUCCCACUGCUCUGCCUGCCUCUCCCACUGCUGCUGGCACAGCCCCGCCUUGC CGCUGCUGAUCCAUUGCCGGUGUGACC >Rn6-1WoB6_For2 UCUUCCUGGAAUCUGACCAUUCGUUGUGCUGCUAUGCCCGUCCUCACCAAGACUGACUGCC UGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUGCCUCUCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >Rn6-96h-2pl-D6_F CUGGAAUCUGACCAUUCGUUGUGCUGCUAUGCCCGUCCCUCACCAAGACUGACUGCCUGCUG CUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUGCCUCUCCCCAC UGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >Rn6-96h-2pl-E6_F CUGGAAUCUGACCAUUCGUUGUGCUGCUAUGCCCGUCCCUCACCAAGACUGACUGCCUGCUG CUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUGCCUCUCCCCAC UGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >Rn6-2WoF10_For2 GGAAUCUGACCAUUCGUUGUGCUGCUAUGCCCGUCCCUCACCAAGACUGACUGCCUGCUGCU UUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUGCCUCCCCCACUG CACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >Rn6-1WoG9_For2 CCAAGACUGACUGCCUGCUGCUUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUG CUCUGCCUGCCUCUCCCCACUGCACUGGCAUAGCCCCGCCUUGCCGCUGCUGAUCCAUUG CCGGUGUGACC >Rn6-96hC12_For2 CUUCCUGGAAUCUGACCAUUCGUUGUGCUGCUAUGCCCGUCCUCACCAAGACUGACUGCCU GCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGCCUGCCUCUCC CCACUGCACUGGCAUAGCCCCGCCUUGCCGCUGCUGAUCCAUUUCCGGUGUGACC Group D >Rn6-1WoF2_For2 CAGACACCCGCCCCCCGGCCCUGGCUAAGAAUUUGCUUCCUGUUGCCAGCAUGACCUACC CUCGCCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUUGCUCCUGGACCCUUUAGCCUCUC UGCCCUUCCACUCUCUGACC >Rn6-2WoD8_For2 ncznnn / ι ζηζ / Β / γ UUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUG ACCUACCCUCGCCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUUGCUCCUGGACCCUULJA GCCUCUCUGCCCUUCCACUCUCUGACCCC >Rn6-1WoD5_For2 CUCGCUUCCUGGGUCUGCAGGUCCAGCCGGCUGGCACCCUCCAUGUACCCAGGGGAGAUU CCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGAC CUACCCUCGCCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUUGCUCCUGGACCCUUUAGC CUCUCUGCCCUUCCACUCUCUGACCACCGCCC-D35_2pl UCCAGCCAGACCCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGA CCUACCCUCGCCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUUGCUCCUGGACCCUUUAG CUUCUCUGCCCUUCCACUCUCUGG >Rn6-2WoA8_For2 CGCUUCCUGGGUCUGCAGGUCCAGCCGGCUGGCACCCUCCACGUACCCAGGGGAGAUUCC AGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCU ACCCUCGCCUCUUUUGAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCU CUCUGCCCUUCCACUCUCUGACCACCGoD7_For2 CAUGUACCCAGGGGAGAUUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGC UUCCUGUUGCCAGCAUGACCUACCCUCGCCUCUUUGAUGCCAUCCGCUGCCACCUCCULJU UGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACUCG >Rn6-2WoB8_For2 CUCGCUUCCUGGGUCUGCAGGUCCAGCCGGCUGGCACCCUCCAUGUACCCAGGGGAGAUU CCAGCCAGACCCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGAC CUACCCUCGCCUCUUUUGAUGCCAUCCGCUGCCACCUCCUUUUUGCUCCUGGACCCUUUAGC CUCUCUGCCCCCCCCGAU >Rn6-96_h-2pl-H CCCAGCUCCCUAGGCGUCCCAUCUCGCUUCCUGGGUCUGCAGGUCCAGCCGGCUGGCACC CUCCAUGUACCCAGGGGAGAUUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGU UGCUUCCUGUUGCCAGCAUGACCUACCCUCGCCUCUUUGAUGCCAUCCGCUGCCACCUCC UUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACUCUUUGACCCCCAUCUUA >Rn6-96h-2pl-F10 GGCCACCGGGCAUGGGAAGUAUGAGAAGGUGCUUGUGGAAGGGGGCCCGGCUCCCUAGGC GUCCCAUCUCGCUUCCUGGGUCUGCAGGUCCAGCCGGCUGGCACCCUCCAUGUACCCAGGGAGAUUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAG ncznnn / ι znz / E / v CAUGACCUACCCUCGCCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUUGCUCCUGGACCC UUUAGCCUCUCUCUGCCCUUCCACUCUCUGACCCC >Rn5H3_For2 UGUACCCAGGGGAGAAUUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUU CCUGUUGCCAGCAUGACCUACCCUCGCCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUUG CUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACUCUCUGACCACCCACCCCC >Rn5G7_For2 CCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUCGCCUCUUUGAU GCCAUCCGCUGCCACCUCCUUUUUGCUCCUGGACCCUUUAGCCCUCUCUGCCCUUCCACUCU CUGACCACAGCCCC >Rn6-1WoG5_For2 CCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUCGCCUCUUUG AUGCCAUCCGCUGCCACCUCCUUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACU CUCUGACCACCGCCCCCGCC >Rn6-1WoA8_For2 CCGGCUGGCACCCUCCAUGUACCCAGGGGAGAUUCCAGCCAGACACCCGCCCCCCGGCCC UGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUCGCCUCUUUGAUGCCAUCC GCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCCUCUGCCCUUCCACUCUCUGACCA CCGCCCCC >Rn6-96h_D3_b GCCGGCUGGCACCCUCCAUGUACCCAGGGGAGAUUCCAGCCAGACACCCGCCCCCCGGCC CUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUAGCCUCUUUGAUGCCAUC CGCUGCCACCUCCUUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACUCUCUGAC CACCGCCCCC >Rn6-96hC11_For2 UCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGA CCUACCCUCGCCUCUULJGAUGCCAUCCGCUGCCACCUCCUUUUUGCUCCUGGACCCUUUAG CCUCUCUGCCCUUCCACUCUCUGACCACCACCCC >Rn5H1_For2 GCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUA CCCUCGCCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUUGCUCCUGGACCCUUUAGCCUC UCUGCCCUUCCACUCUCUGACCCCCC >Rn6-1WoG2_For2 UCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGA CCUACCCUCGCCUCUULJGAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAG ncznnn / ι ζηζ / Β / γ CCUCUCUGCCCUUCCACUCUCUGACCCCCC >Rn6-1WoG7_For2 CGGCUCCCUAGGCGUCCCAUCUCGCUUCCUGGGUCUGCAGGUCCAGCCGGCUGGCACCCU CCAUGUACCCAGGGGAGAUUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUG CUUCCUGUUGCCAGCAUGACCUACCCUCGCCUCUUUGAUGCCAUCCGCUGCCACCUCCUU UUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACUCUCUGACCACUGCCCC >Rn6-96hB11_For2 UGCAGGUCCAGCCGGCUGGCACCCUCCAUGUACCCAGGGGAGAUUCCAGCCAGACACCCA CCCCCCGGCCCUGGCUAAGAAGUUGCUCCUGUUGCCAGCAUGACCUACCCUCGCCUCUUU GAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCAC UCUCUGACCACUACCCC >Rn6_2WoF8 UUCCAGCCAGACCCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUG ACCUACCCUCGCCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUUGCUCCUGGACCCUULJA GCCUCUCUGCCCUUCCACUCUCUGACCACUGCCCC >Rn6-96h_A9_b CCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUCGCC UCUUUGAUGCCAUCCGCUGCCACCUCCUUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCU UCCACUCUCUGACC >Rn6-1WoH3_For2 CAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACC UACCCUCGCCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUUGCUCCUGGACCCUUUAGCC UCUCUGCCCUUCCACUCUCUGAACACC Group E >Rn6-2WoE2_For2 GAGCCUACUCUGAUGACCGUGGCCUUGGCUCCUCCCAGGAAGGCUCAGGAGCCCUACCUCC CUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCUGUGCCAACUCUCUGCAUUCCCUGAUCUC CUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACUGCCAUCUCCCCCCUGACCCCUC GAACCCAUCCUA >Rn6-1WoD3_For2 GAGCCUACUCUGAUGACCGUGGCCULJGGCUCCUCCCAGGAAGGCUCAGGCGCCCUACCUCC CUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCUGUGCCAACUCUCUGCAUUCCCUGAUCUC CAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACUGCCAUCUCCCCCCUGAC CCCUCUAACCC ncznnn / ι / ζ6W_π2R2 GCCUACUCUGAUGACCGUGGCCUUGGCUCCUCCCAGGAAGGCUCAGGAGCCCUACCUCCCU GCCAUUAUAGCUGCUCCCCGCCAGAAGCCUGUGCCAACUCUCUGCAUUCCCUGAUCUCCA UCCCUGUGGCUGUCACCCUUGGUCCACUGCCAUCUCCCCCCC >Rn6-2WoH2_For2 GAGCCUACUCUGAUGACCGUGGCCUUGGCUCCUCCCAGGAAGGCUCAGGAGCCCUACCUCC CUGCCAUUAUAGCUGCLJCCCCGCCAGAAGCCUGUGCCAACUCUCUGCAUUCCCUGAUCUC CAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGLJUACUGCCAUCUCCCCCCUGAC CCC >Rn6-2WoC1_For2 GAAGAGCCUACUCUGAUGACCGUGGCCUUGGCUCCUCCAGGAAGGCUCAGGAGCCCUACC UCCCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCUGUGCCAACUCUCUGCAUUCCCUGAU CUCCAUCCCUGUGGCUGUCAUCCUUGGUCACCUCCGUGCUGUCACUGCCAUCUCCCCCCU GACCCCUCUAACCCAUCCUCUGCCUCCCUCCCUGCAGUCAGAGGGUCCUGUUCCCAACCA >Rn6-1Wo_C12_b UGUGGCCUUGGCUCCUCCCAGGAAGGCUAAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCU CCCCGCCAGAAGCCUGUGCCAACUCUCUGCAUUCCCUGAUCUCCAUCCCUGUGGCUGUCA CCCUUGGUCACCUCCGUGCUGUCACUGCCAUCUCCCCCCUGACCCC >Rn6-1WoE12_For2 GCCUUGGCUCCUCCCAGGAAGGCUCAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCUCCCC GCCAGAAGCCUGUGCCAACUCUCUGCAUUCCCUGAUCUCCAUCCCUGUGGCUGUCACCCU UGGUCACCUCCGUGCUGUCACUGCCAUCUCCCCCC >Rn6-2WoF5_For2 AGAGCCUACUCUGAUGACCGUGGCCUUGGCUCCUCCAGGAAGGCUCAGGAGCCCUACCUC CCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCUGUGCCAACUCUCUGCAUUCCCUGAUCU CCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACUGCCAUCUCCCCCCUGA CCCCUCUAACCCAUCCUCUGCCUCCCUCCCUGCAGUCAGAGGGUCCUGUUCCCAUCAGCG AUUCCCCUGCUUAAACCCUUCCAUGACUCCCCACUGCCCUAAGCUGAGGUCAGUCUCCCA AGCCUGACAU >Rn5-2pl-H3_For2 UAUAGCUGCUCCCCGCCAGAAGCCUGUGCCAACUCUCUGCAUUCCCUGAUCUCCAUCCCU GUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACUGCCAUCUCCCCCCUGACCCCUCUA ACCCAUCCUCUGCCUCCCUCCCUGCAGUCAGAGGGUCCUGUUCCCAUCAGCGAUUCCCCU GCUUAAACCCUUCCAUGACAGCCC >Rn6-2WoA3_For2 ncznnn / ι ζηζ / Β / γ UCUGCAUUCCCUGAUCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCAC UGCCAUCUCCCCCCUGACCCCUCUAACCCAUCCUCUGCCUCCCUCCCUGCAGUCAGAGGG UCCUGUUCCCAUCAGCGAUUCCCCUGCUUAAGCCCUUCCAUGACUCCCC >Rn6-96hF12_For2 CUCCCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCUGUGCCAACUCUCUGCAUUCCCUGA UCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACUGCCAUCUCCCCCC UGACCCCUCUAACCCAUCCUCUGCCUCCCUCCCUGCAGUCAGAGGGUCCUGUUCCCAUCA GCGAUUCCCCUGCUUAAACCCUUCCAUGACUCCCCAA >Rn61-For GCCUACUCUGAUGACCGUGGCCUUGGGUCCUCCAGGAAGGCUCAGGAGCCCUACCUCCCU GCCAUUAUAGCUGCUCCCCGCCAGAAGUCUGUGCCAACUCUCUGCAUUCCCUGAUCUCCA UCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACUGCCAUCUCCCCCCUGACCC CUCUAACCCAUCCUCUGCCUCCCUCCCUGCAGUCAGAGGGUCCUGUUCCCAUCAGCGAUU CCCCUGCUUAAACCCUUCCAUGACUCCCCUCU >Rn6-96h-2pl-A11 CUACCUCCCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCUGUGCCAACUCUCUGCAUUCC CUGAUCUCCAUCCCUGLJGGCUGUCACCCCUUGGUCACCUCCGUGCUGUCACUGCCAUCUCC CCCCUGACCCC Group F >Rn6-1WoB5_For2 CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCCGAGUCUC CCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCCUCUGCU AGUUCCAGACACCUCC >Rn6-2WoE11_a CCGGCCCUUCCCCCGUUUUGAACAUGUGUAACCGACAGUCUGCCUGGGCCACAGCCCUCU CACCCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGGCACCCCGAG UCUCCCCCGACCCCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUC UGCUAGUUCCAGACCCCCCCGCG >Rn6-96h_E3 CCUUCCCCCGUUUUGAACAUGUGUAACCGACAGUCUGCCUGGGCCACAGCCCUCUCACCC UGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGCCCUGGGCACCCCGAGUCUCC CCCGACCCCGGGUCCCAGGUAUGCLJCCCACCUCCACCUGCCCCACUCACCACCUCUGCUA GUUCCAGACACCUCCAC >Rn6-96h-2pl-B6_F ncznnn / ι ζηζ / Β / γ UCUGCCUGGGCCACAGCCCUCUCACCCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCU UUCCCGUCCUGGGCACCCCGAGUCUCCCCCGACCCCGGGUCCCAGGUAUGCUCCCACCUC CACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCACGCCCACCUGGUCCUCU CCCAUCGCCCACAAAAGGGGGGGCACGAGGGACGAGCUUAGCUGAGCUGGGAGGAGCAGG GUGAGGGUGGGCGACCCAGGAUUCCCCCACCCC Group G >Rn5_D5_b UGACACCUCAGCUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUG GGCAGGCCAAGGCCUGCUGGGCCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUC CCCGCACCCCCGCUUCUGUCUGCCCCAUUGUGGCUCCUCAGGCUCUCUCCCCUGCUCUCC CACCUCUACCUCCACCCCA >Rn5B2 CUCAGCUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGG CCAAGGCCUGCUGGGCCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCA CCCCCGCUUCUGUCUGCCCCAUUGUGGCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUC UACCUCCACUCCC >Rn5G3_For2 UCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGGGCCCCCGCGGACCCAGGUGCU CUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCCCAUUGUGGCUCCUCAG GCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCCC >Rn6-96hF11_For2 GGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGGGCCCCCGCGGACCCAGGUGCUCUGGG UCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCCCAUUGUGGCUCCUCAGGCUCU CUCCCUGCUCUCCCACCUCUACCUCCACCCCC >Rn6-96h-2pl-D8_F GCCUGCUGGGCCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCC GCUUCUGUCUGCCCCAUUGUGGCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCU CCGCCCCC >Rn5C4_For2 CGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCC CAUUGUGGCUCCUUAGGCUCUCUCCCCCLIGCUCUCCCACCUUUAUACCUCCACCCCUAC >Rn6-2WoD3_For2 CUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAG GCCUGCUGGGCCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCC ncznnn / i ζπζ / β / υ GCUUCUGUCUGCCCCAUUGUGGCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCU CCACCCCCAC >Rn6-96h-2pl-C6_F CUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAG GCCUGCUGGGCCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCC GCUUCUGUCUGCCCCAUUGUGGCUCCUCAGGCUCUCUCCCUGCUCUCCCACCUCUACCU CCACCCCCAAC >Rn6-97h_F-2pl CUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAG GCCUGCUGGGCCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCC GCUUCUGUCUGCCCCAUUGUGGCUCCUCAGGCUCUCUCCCUGCUCUCCCACCUCUACCU CCACCCCCAAC >Rn6-98h_F-2pl CGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCU GGGCCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUG UCUGCCCCAUUGUGGCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCA CACC >Rn6-96hH9_For2 UCCUGAGGGACUGGGACUCCCCUUACAGCCAUGACCUUGACACCLJCAGCUGACAGCGUGG GCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGGGCC CCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGC CCCAUUGUGGCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACGCCCAC >Rn5_F10_b CUGAGGGACUGGGACUCCCCUUACAGCCAUGACCUUGACACCUCAGCUGACAGCGUGGGC AACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGGGCCCC CGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCC CAUUGUGGCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACACCU >Rn6-2WoF11_For2 UGCGGAGCCAGCUGGAGGCCAUUUUCCUGAGGGACUGGGACUCCCCUUACAGCCAUGACC UUGACACCUCAGCUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGU GGGCAGGCCAAGGCCUGCUGGGCCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGU CCCCGCACCCCCGCUUCUGUCUGCCCCAUUGUGGCUCCUCAGGCUCUCUCCCCUGCUCUC CCACCUCUACCUCCACCC >Rn6-1WoA9_For2 CUGGAGGCCAUUUUCCUGAGGGACUGGGACUCCCCUUACAGCCAUGACCUUGACACCUCA ncznnn / ι ζηζ / Β / γ GCUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAA GGCCUGCUGGGCCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCC CGCUUCUGUCUGCCCCAUUGUGGCLJCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACC UCCCCCCAC >Rn9_2WoFo CUGGGACUCCCCUUACAGCCAUGACCUUGACCUCAGCUGACAGCGUGGGCAACGCCUG CCGCCUGCUCUGAGGCCCAAUCCAGUGGGCAGGCCAAGGCCUGCUGGGCCCCCGCGGACC CAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCCCAUUGUGC CUCCUUAGGCUCUCUCCCCUGCUCUCCCCACCC Group I >Rn5_A7_b GCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGUAAACAGCAGUGAUU AACUUUUAGCAAUAAACGAAAGUUUAACLJAAGCUAUACUAACCCCAGGGUUGGUCAAUUU CGUGCCAGCCACC >Rn5_B6_b CUUUCUAUUAGCUCUUAGUAAGAUUACACAUGCAAGCAUCCCCGUUCCAGUGAGUUCACC CUCUAAAUCACCACGAUAAAAAGGGACAAGCAUCAAGCACGCAGCAAUGCAGCUCAAAAC GCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAA AGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUG4D5>For GUUCCAGUGAGUUCACCCUCUAAAUCACCACGAUCAAAAGGGACAAGCAUCAAGCACGCA GCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAAC CUUUAGCAAUAAACGAAAGUUUAACLJAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGU GCCAGCCACC >Rn5D2_For2 AAAGGGACAAGCAUCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCC CCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACU AACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACC >Rn6-1Wo_D7_b UCAAAAGGGACAAGCAUCAAGCACGCAACAAUGCAGCUCAAAAACGCUUAGCCUAGCCAC ACCCCCACGGGAAACAGCAGU GAU UAACCU U U AGCAAU AAACGAAAGU U UAAC UAAGCUA CACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACC >Rn6-96h-2pl-A9_F UACACAUGCAAGCAUCCCCGUUCCAGUGAGUUCACCCUCUAAAUCACCACGAUCAAAAGG ncznnn / ι ζπζ / β / υ GACAAGCAUCAAGCACGCAGCAAUGCAGCUCAAAAACGCUUAGCCUAGCCACACCCCCAC GGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGLJUUAACUAAGCUAUACUAACC CCAGGGUUGGUCAAUUUCGUGCCAGCCACC >Rn6-2WoH3_For2 CAUCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAAC AGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUUAACUAAGCUAUACUAACCCCAGGGU UGGUCAAUUUCGUGCCAACCACC >Rn6-96hG11_For2 AAAGGGACAAGCAUCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCC CCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACU AACCCCAGGGUUGGUCAAUUUCGUGCCAACCACC >Rn5E1_For2 CAAGCACGCAACAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGC AGUGAUUAACCUUUAGCAAUAAACGAAAGUUUUAACUAAGCUAUACUAACCCCAGGGUUGG UCAAUUUCGUGCCAACCACC >Rn6-1WoA11_For2 CAUCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCAUGGGAAAC AGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUUAACUAAGCUAUACUAACCCCAGGGU UGGUCAAUUUCGUGCCAGCUCACC >Rn6-2WoE7_For2 CAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGC AGUGAUUAACCUUUAGCAAUAAACGAAAGUUUUAACUAAGCUAUACUAACCCCAGGGUUGG UCAAUUUCGUGCCAGCCACACC >Rn6-96h-2pl-B5_F CAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGC AGUGAUUAACCUUUAGCAAUAAACGAAAGUUUUAACUAAGCUAUACUAACCCCAGGGUUGG UCAAUUUCGUGCCAGCCACC >Rn5H2_For2 CACGAUCAAAGGGACAAGCAUCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAG CCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUUAACUAA GCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACC >Rn6-1WoF11_For2 UAAAUCACCACGAUCAAAAGGGACAAGCAUCAAGCACGCAGCAAUGCAGCUCAAAACGCU UAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGU UUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACC ncznnn / ι ζηζ / Β / γ 100 >Rn6-2WoB11 For2 AGCCUUUUCUAUUAGCUCUUAGUAAGAUUACAUGCAAGCAUCCCCGUUCCAGUGAGUUC ACCCUCUAAAUCACCACGAUCAAAAGGGACAAGCAUCAAGCACGCAGCAAUGCAGCUCAA AACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAAC GAAAGUUUAACUAAGCUAUACUACCCCAGGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAAC GAAAGUUUAACUAAGCUAUACUACCCCAGGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAAC GAAAGUUUAACUAAGCUAUACUACCCCAGGGGAAACAGCAGUUUAACCUUUAGCAAUAAAC GAAAGUUUAACUAAGCUAUACUACCCCAGGGGAAACAGCAGUUUAACCUUUAGCAAUAAAC GAAAGUUUAACUAAGCUAUACUACCCCAGGGGUUGCCAGAn_For6 Rn6-1Wo_D2_b GGGACAAGCAUCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCCA CGGG AAAC AGCAG U G AU U AACC U U U AGC AAU AAACGAAAG U UU AAC U AAGC UAUAC U AAC CCCAGGGUUGGUCAAUUUCGUGCCAGCCACC Group J >Rn5A1_For2 UUCUGCCCCAGCUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGA GAGACCUUUCUCCGGACCUGGUUGCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCUCCC CUGUGGCUGCCUCAGCUCAUGCCUUUGGCCUGAAGUCCCAGCAUUGAUGGCAGCCCCUCA UCUUCCAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCCCAUGCAUCUGUACUC CUUCUGUGCCACU >Rn5B1_For2 UUCUGCCCCAGCUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGA GAGACCUUUCUCCGGACCUGGUUGCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCUCCC CUGUGGCUGCCUCAGCUCAUGCCUUUGGCCUGAAGUCCCAGCAUUGAUGGCAGCCCCUCA UCUUCCAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCCCAUGCAUCUGUACUC CUUCUGUGCCACU >Rn5_A10_b CCCCAGCUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGAC CUUUCUCCGGACCUGGUUGCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCUCCCCUGUG GCUGCCUCAGCUCAUGCCUUUGGCCUGAAGUCCCAGCAUUGAUGGCAGCCCCUCAUCUUC CAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCCCAUGCAUCUGUACUCCUCCU GUGCCACAAA >Rn5_G1_b CCCCAGCUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCAAGAGAGAC ncznnn / ι znz / B / v 101 CUUUCUCCGGACCUGGUUGCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCCCCUGLJG GCUGCCUCAGCUCAUGCCUUUGGCCUGAAGUCCCAGCAUUGAUGGCAGCCCCUCAUCUUC CAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCCCAUGCAUCUGUACUCCUCCU GUGCCACAAA >Rn6-1WoF5_For2 CUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCAGAGAGACCUUUCU CCGGACCUGGUUGCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCCCCCCUGUGGCUGCC UCAGCUCAUGCCUUUUGGCCUGAAGUCCCAGCAUUGAUGGCAGCCCCUCAUCUUCCAAGUU UUGUGCUCCCCUUUACCCUAACGCUUCCUGCCGUACCUCAUGCAUUGGCAU5For2ACUUUUUGCUCCCCUUUACUAACGCUUCCUGCCGUACCUCUn_2A > > GUGAAGAUGACCACAUUCAAGGAAGAACCUUCUGCCCCAGCUUUGCAGGAUGAAACACUU CCCCGCUUGGCUCUCCUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUUGCUACUGG UUCAGCAGCUCUGCAGAAAAUGUCCUCCCUUGUGGCUGCCUCAGCUCGUACCUUUGGCCU GAAGUCCCAGCAUUAAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAA UGCUUCCUGCCUCCCAUGCAUCUGUACUCCUGCUGUGCCA >Rn6-2WoG2_For2 UCCACAAGAGAGACCUUUCUCCGGACCUGGCUGCUACUGGUUCAGCAGCUCUGCAGAAAA UGUCCUCCCUUGUGGCUGCCUCAGCUCGUACCUUUGGCCUGAAGUCCCAGCAUUAAUGGC AGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAAUGCUUCCUGCCUCCCAUGCA UCUGUACUCCUGCUGUGCCACAAACAC >Rn6-2W2o UCCACAAGAGAGACCUUUCUCCGGACCUGGCUGCUACUGGUUCAGCAGCUCUGCAGAAAA UGUCCUCCCUUGUGGCUGCCUCAGCUCGUACCUUUGGCCUGAAGUCCCAGCAUUAAUGGC AGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAAUGCUUCCUGCCUCCCAUGCA UCUGUACUCCUGCUGUGCCACAAACAC_Rn6pl-96h-G7h GCUACUGGUUCAGCAGCUCUGCAGAAAAUGUCCCUCCCUUGUGGCUGCCUCAGCUCGUACC UUUGGCCUGAAGUCCCAGCAUUAAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCU UUACCUAAUGCUUCCUGCCUCCCAUGCAUCUGUACUCCUGCGU >Rn5-2pl-B2_For2 ncznnn / ι ζ / Βγ / Β 102 AGAACCUUCUGCCCCAGCUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCC ACAAGAGAGACCUUUCUCCGGACCUGGUUGCUACUGGUUCAGCAGCUCUGCAGAAAAUGU CCUCCCUUGUGGCUGCCUCAGCUCGUACCUUUGGCCUGAAGUCCCAGCAUUAAUGGCAGC CCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAAUGCUUCCUGCCUCCCAUGCAUCU GUACUCCUG >Rn5-2pl-D1_For2 AGAACCUUCUGCCCCAGCUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCC ACAAGAGAGACCUUUCUCCGGACCUGGUUGCUACUGGUUCAGCAGCUCUGCAGAAAAUGU CCUCCCUUGUGGCUGCCUCAGCUCGUACCUUUGGCCUGAAGUCCCAGCAUUAAUGGCAGC CCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAAUGCUUCCUGCCUCCCAUGCAUCU GUACUCCUG >Rn6-1WoA5_For2 UGAAGAUGACCACAUUCAAGGAAGAACCUUCUGCCCCAGCUUUGCAGGAUGAAACACUUC CCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUUGUUCAGCAG CUCUGCAGAAAAUGUCCUCCCUUGUGGCUGCCUCAGCUCGUACCUUUGGCCUGAAGUCCC AGCAUUAAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAAUGCUUCCU GCCUCCCAUGCAUCUGUACUCCUG >Rn6-1Wo_G10_b UGAAGAUGACCACAUUCAAGGAAGAACCUUCUGCCCCAGCUUUGCAGGAUGAAACACUUC CCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUUGCUACUGGU UCAGCAGCUCUGCAGAAAAUGUCCUCCCUUGUGGCUGCCUCAGCUCGUACCUUUGGCCUG AAGUCCCAGCAUUAAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAAU GCUUCCUGCCUCCCAUGCAUCUGUACUCCC >Rn6-2WoE4_For2 CCACAUUCAAGGAAGAACCUUCUGCCCCAGCUUUGCAGGAUGAAACACUUCCCCGCUUGG CUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUUGCUACUGGUUCAGCAGCU CUGCAGAAAAUGUCCUCCCUUGUGGCUGCCUCAGCUCGUACCUUUGGCCUGAAGUCCCAG CAUUAAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAAUGCUUCCUGC CCCCC >Rn6-96hG12_For2 GUGAAGAUGACCACAUUCAAGGAAGAACCUUCUGCCCCAGCUUUGCAGGAUGAAACACUU CCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUUGCUACUGG UUCAGCAGCUCUGCAGAAAAUGUCCUCCCUUGUGGCUGCCUCAGCUCGUACCUUUGGCCU GAAGUCCCAGCAUUAAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAA UGCUUCCUGCCCCCCAU ncznnn / ι ζπζ / β / υ 103 >Rn6-96h-2pl-C12 AGAACCUUCUGCCCCAGCUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCC ACAAGAGAGACCUUUCUCCGGACCUGGUUGCUACUGGUUCAGCAGCUCUGCAGAAAAUGU CCUCCCUUGUGGCUGCCUCAGCUCGUACCUUUGGCCUGAAGUCCCAGCAUUAAUGGCAGC CCCUCAUCUUCCAAGUUUUGUGCUCCCCC >Rn2pl-9A6h_F CUGAAGUGAAGAUGACCACAUUCAAGGAAGAACCUUCUGCCCCAGCUUUGCAGGAUGAAA CACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUUGCU ACUGGUUCAGCAGCUCUGCAGAAAAUGUCCUCCCUUGUGGCUGCCUCAGCUCGUACCUUU GGCCUGAAGUCCCAGCAUUAAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUA CCUAAUGCUUCCUGCCUCCCAUGCAUCUGUACUCCU >Rn6-96h-2pl-H5_F CUGAAGUGAAGAUGACCACAUUCAAGGAAGAACCUUCUGCCCCAGCUUUGCAGGAUGAAA CACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUUGCU ACUGGUUCAGCAGCUCUGCAGAAAAUGUCCUCCCUUGUGGCUGCCUCAGCUCGUACCUUU GGCCUGAAGUCCCAGCAUUAAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUA CCUAAUGCUUCCUGCCUCCCAUGCAUCUGUACUCCU >Rn6-2WoG1_For2 AAGAUGACCACAUUCAAGGAAGAACCUUCUGCCCCAGCUUUGCAGGAUGAAACACUUCCC CGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUUGCUACUGGUUC AGCAGCUCUGCAGAAAAUGUCCUCCCUUGUGGCUGCCUCAGCUCGUACCUUUGGCCUGAA GUCCCAGCAUUAAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAAUGC UUCCUGCCUCCCAUGCAUCUGUACUCCUGC >Rn6-96h-2pl-D11 CCCCGCUUGGCUCUCAUUCUUCCAGAGAGAGACCUUUCUCCGGACCUGGUUGCUACUGG UUCAGCAGCUCUGCAGAAAAUGUCCUCCCUUGUGGCUGCCUCAGCUCGUACCUUUUGGCCU GAAGUCCCAGCAUUAAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAA UGCUUCCUGCCUCCCAUGCAUCUGUACUCCU >Rn6F-9F9 CCCCGCUUGGCUCUCAUUCUUCCAGAGAGAGACCUUUCUCCGGACCUGGUUGCUACUGG UUCAGCAGCUCUGCAGAAAAUGUCCUCCCUUUGUGGCUGCCUCAGCUCGUACCUUUUGGCCU GAAGUCCCAGCAUUAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAA UGCUUCCUGCCUCCCAUGCAUCUGUACUCCU >hBg ncznnn / i ζπζ / β / υ 104 GAGAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUGG GGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAAACAUUUAUUUUUCAUUGCUGCGUC noUTR: > >BB UGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACU GCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGAC CUGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCAC UGCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGA CC >BD UGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACU GCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGAC CUUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUC GCCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACUCU CUGACCCC >BE UGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACU GCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGAC CGCCUUGGCUCCUCCAGGAAGGCUCAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCC UGUGCCAACUCUCUGCAUUCCCUGAUCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCAC UGCCAUCUCCCCCC >BF UGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACU GCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGAC CCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUC GGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCC >BG UGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACU GCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGAC CCUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGG GCCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCCCAUUGU GGCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCCCAC >BhBg UGCCCGUCCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACU ncznnn / ι znz / B / v 105 GCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGAC CGAGAGCUCGCUUUCUUUGCUGUCCAAUUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUG GGGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAAACAUUUAUUUUCABICUGCGCAUUG UGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACU GCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGAC CCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACC UUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC >BJ UGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACU GCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGAC CCUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGU UGCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCUCCCCUGUGGCUGCCUCAGCUCAUGCCUUUGGCCUGA AGUCCCAGCAUUGAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCC CAUGCAUCUGUACUCCUCC >DB UUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUCG CCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACUCUCU GACCCCUGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUU CCCACUGCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGG UGUGACC >DD UUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUCG CCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACUCUCU GACCCCUUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUAC CCUCGCCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCA CUCUCUGACCCC >DE UUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUCG CCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACUCUCU GACCCCGCCUUGGCUCCUCCAGGAAGGCUCAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCUCCCCGCCAG AAGCCUGUGCCAACUCUCUGCAUUCCCUGAUCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCU GUCACUGCCAUCUCCCCCC >DF UUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUCG ncznnn / ι ζπζ / β / υ 106 DG UUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUCG CCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACUCUCU GACCCCCUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUG CUGGGCCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCCCA UUGUGGCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCCCAC >DhBg UUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUCG CCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACUCUCU GACCCCGAGAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUA AACUGGGGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGCUG CGUC >DI UUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUCG CCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACUCUCU GACCCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAU UAACCUUUAGCAAUAAACGAAAGUULJAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCAC ACC >DJ UUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUCG CCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACUCUCU GACCCCCUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGAC CUGGUUGCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCUCCCCUGUGGCUGCCUCAGCUCAUGCCUUUGG CCUGAAGUCCCAGCAUUGAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUG CCUCCCAUGCAUCUGUACUCCUCC >EB GCCUUGGCUCCUCCAGGAAGGCUCAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCU GUGCCAACUCUCUGCALJUCCCUGAUCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACU GCCAUCUCCCCCCUGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGA CUGACUUCCCACUGCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCA UUGCCGGUGUGACC >ED ncznnn / ι ζηζ / Β / γ 107 GCCUUGGCUCCUCCAGGAAGGCUCAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCU GUGCCAACUCUCUGCAUUCCCUGAUCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACU GCCAUCUCCCCCCUUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCA UGACCUACCCUCGCCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCUCUCUG CCCUUCCACUCUCUGACCCC >EE GCCUUGGCUCCUCCAGGAAGGCUCAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCU GUGCCAACUCUCUGCAUUCCCUGAUCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACU GCCAUCUCCCCCCGCCUUGGCUCCUCCAGGAAGGCUCAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCUCC CCGCCAGAAGCCUGUGCCAACUCUCUGCAUUCCCUGAUCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCU CCGUGCUGUCACUGCCAUCUCCCCCC >EF GCCUUGGCUCCUCCAGGAAGGCUCAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCU GUGCCAACUCUCUGCAUUCCCUGAUCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACU GCCAUCUCCCCCCCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUC UCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGAC ACCUCC >EG >GCCUUGGCUCCUCCAGGAAGGCUCAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCU GUGCCAACUCUCUGCAUUCCCUGAUCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACU GCCAUCUCCCCCCCUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCA AGGCCUGCUGGGCCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGU CUGCCCCAUUGUGGCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCCCAC >EhBg GCCUUGGCUCCUCCAGGAAGGCUCAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCU GUGCCAACUCUCUGCAUUCCCUGAUCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACU GCCAUCUCCCCCCGAGAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCA ACUACUAAACUGGGGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUC AUUGCUGCGUC >EI GCCUUGGCUCCUCCAGGAAGGCUCAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCU GUGCCAACUCUCUGCALJUCCCUGAUCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACU GCCAUCUCCCCCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAG CAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGC CAGCCACACC ncznnn / ι ζηζ / Β / γ 108 >EJ GCCUUGGCUCCUCCAGGAAGGCUCAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCU GUGCCAACUCUCUGCALJUCCCUGAUCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACU GCCAUCUCCCCCCCUULJGCAGGAUGAAACACUUCCCCGCUUGGCLJCUCAUUCUUCCACAAGAGAGACCUUUC UCCGGACCUGGUUGCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCUCCCCUGUGGCUGCCUCAGCUCALJG CCUUUGGCCUGAAGUCCCAGCAUUGAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAACG CUUCCUGCCUCCCAUGCAUCUGUACUCCUCC >FB CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCG GGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCUGCCCGU CCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCUGC CUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >FD CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCG GGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCUUCCAGC CAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUCGCCUCUUU GAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCULJCCACUCUCUGACCCC >FE CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCG GGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCGCCUUGG CUCCUCCAGGAAGGCUCAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCUGUGCCAAC UCUCUGCAUUCCCUGALJCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACUGCCAUCUC CCCCC >FF CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCG GGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCUGGUAC UGCAUGCACGCAAUGCLJAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCA GGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCC >FG CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCG GGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCUGACAG CGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGGGCCCCCGC GGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCCCAUUGUGGCUCCUC AGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCCCAC >FhBg ncznnn / ι ζηζ / Β / γ 109 CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCG GGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCGAGAGCU CGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUGGGGGAUAU UAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGCUGCGUC >FI CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCG GGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCAC GCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAA UAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC >FJ CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCG GGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCUUUGCA GGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUUGCUACUG GUUCAGCAACUCUGCAGAAAAUGUCCUCCCCUGLJGGCUGCCUCAGCUCAUGCCUUUGGCCUGAAGUCCCAG CAUUGAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCCCAUGCAUC UGUACUCCUCC >GB CUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGGG CCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCCCAUUGUG GCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCCCACUGCCCGUCCUCACCAAGACUGAC UGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGCUCLJGCCUGCCUCUCCCCACUG CACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >GD CUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGGG CCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCCCAUUGUG GCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCCCACUUCCAGCCAGACACCCGCCCCCC GGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUCGCCUCUUUGAUGCCAUCCGCUGCC ACCUCCUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACUCUCUGACCCC >GE CUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGGG CCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCLJGUCCCCGCACCCCCGCUUCUGUCUGCCCCAUUGUG GCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCCCACGCCUUGGCUCCUCCAGGAAGGC UCAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCUGUGCCAACUCUCUGCAUUCCCUG AUCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACUGCCAUCUCCCCCC >GF ncznnn / ι ζηζ / Β / γ 110 CUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGGG CCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCCCAUUGUG GCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCCCACCUGGUACUGCAUGCACGCAAUGC UAGCUGCCCCUUUCCCGUCCUGGGLJACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUC CACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCC >GG CUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGGG CCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCCCAUUGUG GCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCCCACCUGACAGCGUGGGCAACGCCUG CCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGGGCCCCCGCGGACCCAGGUGCUCU GGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCCCAUUGUGGCUCCUCAGGCUCUCUCCCCUG CUCUCCCACCUCUACCUCCACCCCCAC >GhBg CUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGGG CCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCCCAUUGUG GCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCCCACGAGAGCUCGCUUUCUUGCUGUCC AAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUGGGGGAUAUUAUGAAGGGCCUUGAG CAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGCUGCGUC >GI CUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGGG CCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCCCAUUGUG GCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCCCACCAAGCACGCAGCAAUGCAGCUCA AAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACU AAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC >GJ CUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGGG CCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCCCAUUGUG GCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCCCACCUUUGCAGGAUGAAACACUUCCC CGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUUGCUACUGGUUCAGCAACUCUGCA GAAAAUGUCCUCCCCUGUGGCUGCCUCAGCUCAUGCCUUUGGCCUGAAGUCCCAGCAUUGAUGGCAGCCCC UCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCCCAUGCAUCUGUACUCCUCC >hBgB GAGAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACLJACUAAACUGG GGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGCUGCGUCUG CCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGC ncznnn / ι znz / E / v 111 UCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >hBgD GAGAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUGG GGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGCUGCGUCUU CCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUCGCC UCUUUGAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACUCUCUGA CCCC >hBgE GAGAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUGG GGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGCUGCGUCGC CUUGGCUCCUCCAGGAAGGCUCAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCUGU GCCAACUCUCUGCAUUCCCUGAUCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACUGC CAUCUCCCCCC >hBgF GAGAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUGG GGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGCUGCGUCCU GGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGG UCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCC >hBgG GAGAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUGG GGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGCUGCGUCCU GACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGGGCC CCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCCCAUUGUGGC UCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCCCAC >hBghBg GAGAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUGG GGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGCUGCGUCGA GAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGLJUCCCUAAGUCCAACUACUAAACLJGGGG GAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGCUGCGUC >hBgl GAGAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUGG GGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUULJCAUUGCUGCGUCCA AGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUU AGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC >hBgJ ncznnn / ι znz / B / v 112 GAGAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUGG GGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGCUGCGUCCU UUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUUGC UACUGGUUCAGCAACUCUGCAGAAAAUGUCCUCCCCUGUGGCUGCCUCAGCUCAUGCCLJUUGGCCUGAAGU CCCAGCAUUGAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCCCAU GCAUCUGUACUCCUCC >IB CAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCU UUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCUG CCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCAUGAGACUGACUUCCCACUGC UCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUGAUCCAUUGCCGGUGUGACC >ID CAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCU UUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCUUC CAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGCCAGCAUGACCUACCCUCGCCU CUUUGAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCUCUCUGCCCUUCCACUCUCUGAC CCC >IE CAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCU UUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCGC CUUGGCUCCUCCAGGAAGGCUCAGGAGCCCUACCUCCCUGCCAUUAUAGCUGCUCCCCGCCAGAAGCCUGU GCCAACUCUCUGCAUUCCCUGAUCUCCAUCCCUGUGGCUGUCACCCUUGGUCACCUCCGUGCUGUCACUGC CAUCUCCCCCC >IF CAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCU UUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCCU GGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGG UCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCC >IG CAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCU UUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCCU GACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCAGGCCAAGGCCUGCUGGGCC CCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCUUCUGUCUGCCCCAUUGUGGC UCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCCCAC >lhBg ncznnn / ι ζηζ / Β / γ 113 CAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCU UUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCGA GAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGLJUCCCUAAGUCCAACUACUAAACLJGGGG GAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGCUGCGUC >11 CAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCU UUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCCAA GCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUA GCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC >IJ CAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCU UUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCCUU UGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUUGCU ACUGGUUCAGCAACUCUGCAGAAAAUGUCCUCCCCUGUGGCUGCCUCAGCUCAUGCCULJUGGCCUGAAGUC CCAGCAUUGAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCCCAUG CAUCUGUACUCCUCC >JB CUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUU GCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCUCCCCUGUGGCUGCCUCAGCUCAUGCCUUUGGCCUGAA GUCCCAGCAUUGAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCCC AUGCAUCUGUACUCCUCCUGCCCGUCCUCACCAAGACUGACUGCCUGCUGCUUUGCUACUGCCCGGGCCCA UGAGACUGACUUCCCACUGCUCUGCCUGCCUCUCCCCACUGCACUGGCACAGCCCCGCCUUGCCGCUGCUG AUCCAUUGCCGGUGUGACC >JD CUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUU GCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCUCCCCUGUGGCUGCCUCAGCUCAUGCCUUUGGCCUGAA GUCCCAGCAUUGAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCCC AUGCAUCUGUACUCCUCCUUCCAGCCAGACACCCGCCCCCCGGCCCUGGCUAAGAAGUUGCUUCCUGUUGC CAGCAUGACCUACCCUCGCCUCUUUGAUGCCAUCCGCUGCCACCUCCUUUUGCUCCUGGACCCUUUAGCCUC UCUGCCCUUCCACUCUCUGACCCC >JE CUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUU GCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCLJCCCCUGUGGCLJGCCUCAGCUCAUGCCUUUGGCCUGAA GUCCCAGCAUUGAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCCC AUGCAUCUGUACUCCUCCGCCUUGGCUCCUCCAGGAAGGCUCAGGAGCCCUACCUCCCUGCCAUUAUAGCU ncznnn / ι ζηζ / Β / γ 114 >JF CUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUU GCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCLJCCCCUGUGGCUGCCUCAGCUCAUGCCUUUGGCCUGAA GUCCCAGCAUUGAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCCC AUGCAUCUGUACUCCUCCCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCC GAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUC CAGACACCUCC >JG CUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUU GCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCLJCCCCUGUGGCUGCCUCAGCUCAUGCCUUUGGCCUGAA GUCCCAGCAUUGAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCCC AUGCAUCUGUACUCCUCCCUGACAGCGUGGGCAACGCCUGCCGCCUGCUCUGAGGCCCGAUCCAGUGGGCA GGCCAAGGCCUGCUGGGCCCCCGCGGACCCAGGUGCUCUGGGUCACGGUCCCUGUCCCCGCACCCCCGCU UCUGUCUGCCCCAUUGUGGCUCCUCAGGCUCUCUCCCCUGCUCUCCCACCUCUACCUCCACCCCCAC >JhBg CUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUU GCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCUCCCCUGUGGCUGCCUCAGCUCAUGCCUUUGGCCUGAA GUCCCAGCAUUGAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCCC AUGCAUCUGUACUCCUCCGAGAGCUCGCUUUCUUGCUGUCCAAULJUCUAUUAAAGGUUCCULJUGUUCCCUAA GUCCAACUACUAAACUGGGGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUA UUUUCAUUGCUGCGUC >JI CUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUU GCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCLJCCCCUGUGGCUGCCUCAGCUCAUGCCUUUGGCCUGAA GUCCCAGCAUUGAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCCC AUGCAUCUGUACUCCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGA AACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUU CGUGCCAGCCACACC >JJ CUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGACCUUUCUCCGGACCUGGUU GCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCLJCCCCUGUGGCLJGCCUCAGCUCAUGCCUUUGGCCUGAA GUCCCAGCAUUGAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACCUAACGCUUCCUGCCUCCC AUGCAUCUGUACUCCUCCCUUUGCAGGAUGAAACACUUCCCCGCUUGGCUCUCAUUCUUCCACAAGAGAGAC ncznnn / ι ζπζ / β / υ 115 CUUUCUCCGGACCUGGUUGCUACUGGUUCAGCAACUCUGCAGAAAAUGUCCUCCCUGLJGGCUGCCUCAGC UCAUGCCUUUGGCCUGAAGUCCCAGCAUUGAUGGCAGCCCCUCAUCUUCCAAGUUUUGUGCUCCCCUUUACC UAACGCUUCCUGCCUCCCAUGCAUCUGUACUCCUCC > FI UTR 97.5% homology (random modifications) CUGGUACUGCAUGGACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCACCCCCGACCUCG GGUCCCAGGUAUCGUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCAC GCAGCAAUGCAGCUCAAAACGCUUAGCAUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAU AAUCGAAUGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC > FI UTR 95% homología (modificaciones aleatorias) CUCGUACUGCAUGGACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCACCACCGACCUCG GGUCCCAGGUAUCGUCCCACCUCCACGUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCAC GCAGCAAUGCAGCUCAAAACGCUUAGCAUAGCCACACCCCCACGGGAAACAGUAGUGAUUAACCUUUAGCAAU AAUCGAAUGUCUAACUAAGCUAUACUAACCCCAGGGUUGAUCAAUUACGUGCCAGCCACACC > FI UTR 92,5% homología (modificaciones aleatorias) CUCGUACUGCAUGGACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCACCACCGACCUCG GGUCCCAGGUAUCGUCCCACCUCCACGUGCCCCACUCACCACCUUUGCUAGUUCCAGACACCUCCCAUGCAC GCAGCAAUGCAGAUCAAAACGCUUAGCAUAGCCACACCCCCACGGGAAACAGUAGUGAUUAACCUUUAGCAAU AAUCGAAUGUCUAACUAAGCUAUACUAACCCCAGGGUUGAUCAAUUACGUGCCAGCCACACC > FI UTR 90% homología (modificaciones aleatorias) GUCGUACUGCAUGGACGCAAUGCUAGCAGCACCUUUCCCGUCCUGGGUACCCCGAGUCACCACCGACCUCG GGUCCCAGGUAUCGUCCCACCUCCACGUGCCCCACCCACCACCUUUGCUAGUUCCAGAGACCUCCCAUGCAC GCAGCAAUGCAGAUCAAAACGCUUAGCAUAGCCACACCGCCACGGGAAACAGUAGUGAUCAACCUUUAGCUA UAAUCGAAUGUCUAACUAAGCUAUUCUAACCACAGGGUUGAUCAAUUACGUGCCAGCCAGACC > FI 8nt mutación CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCAAAGGGCUCCUGGGUACCCCGAGUCUCCCCCGACCUCG GGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCAC GCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAA UAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC ncznnn / ι znz / R / v >FI UTR 98.75% homología (modificaciones desestabilizadoras de estructura) 116 CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUGGUCCGUACCCCGAGUCUCCCCCGACCUCG GGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCAC GCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAA UAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC > FI UTR 97.5% homología (modificaciones desestabilizadoras de estructura) CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUGGACCGUACGGCGAGUCUCCCCCGACCUCG GGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCAC GCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAA UAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC > FI UTR 96.25% homología (modificaciones desestabilizadoras de estructura) CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUGCCGUGGACCGUACGGGCUGUCUCCCCCGACCUCG GGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCAC GCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAA UAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC > FI UTR 95% homología (modificaciones desestabilizadoras de estructura) CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUGGGCUGGACCGUACGGGCUGUCUCCCCCGACCUCG GGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCAC GCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAA UAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC > FI UTR 97,5% homología (modificaciones retenedoras de estructura) CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUGGUCCGUACCCCGAGUCUCCCCCGACCUCG GGUCGGACCUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCAC GCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAA UAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC > FI UTR 95% (modificaciones retenedoras de estructura) CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUGGACCGUACGGCGAGUCUCCCCCGACCUCG CCUCGGUCCUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCAC GCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAA UAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC nc7nnn / i 7Π7 / Β / Υ 117 > FI UTR 92.5% (structure retention modifications) CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUGCCGUGGACCGUACGGGCUGUCUCCCCCGACCAGC CCUCGGUCCUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCAC GCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGCAAACAGCAGUGAUUAACCUUUAGCAAU AAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC > FI UTR 90% (modificaciones retenedoras de estructura) CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUGGGCUGGACCGUACGGGCUGUCUCCCCCGACCAGC CCUCGGUCCUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCAC GCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCAGCCCAAACAGCAGUGAUUAACCUUUAGCAAU AAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC ncznnn / ι znz / R / v

Claims

CLAIMS 1. A composition comprising a nucleic acid molecule comprising in the 5' —> 3' transcription direction: (a) a promoter; (b) a transcribable nucleic acid sequence comprising a nucleic acid sequence encoding a peptide or protein; and (c) a nucleic acid sequence which, when transcribed under the control of promoter (a), encodes for a 3'-untranslated region in the transcript, said 3'-untranslated region comprising a combination of a nucleic acid sequence from the 3'-untranslated region of Amino-Terminal Cleavage Enhancer (AES) and a nucleic acid sequence from the Mitochondrially Encoded RNA 12S non-coding RNA (MT-RNR1),wherein the nucleic acid sequence of the 3'-untranslated region of AES comprises or consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 86 to 89 or a nucleic acid sequence that is at least 90% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 86 to 89, and wherein the nucleic acid sequence of the non-coding RNA of MT-RNR1 comprises or consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 105 to 121 or a nucleic acid sequence that is at least 90% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 105 to 121.

2. The composition as claimed in claim 1, wherein the nucleic acid sequence of the 3'-untranslated region of AES comprises or consists of the nucleic acid sequence of SEQ ID NO: 86 or a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:

86.

3. The composition as claimed in claim 1 or 2, wherein the nucleic acid sequence of the MT-RNR1 non-coding RNA comprises or consists of the nucleic acid sequence of SEQ ID NO: 115 or a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:

115.

4. The composition as claimed in any of claims 1 to 3, wherein the nucleic acid sequence of the 3'-untranslated region of AES is located at 5' to the nucleic acid sequence of the non-coding RNA of MT-RNR1.

5. The composition as claimed in any of claims 1 to 4, wherein the 3'-untranslated region comprises a combination of the nucleic acid sequence of the 3'-untranslated region of AES and the nucleic acid sequence of the non-coding RNA of MT-RNR1 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 174 or a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:

174.

6. The composition as claimed in any of claims 1 to 5, wherein the nucleic acid molecule further comprises (d) a nucleic acid sequence which, when transcribed under the control of promoter (a), encodes a nucleic acid sequence which is a polyadenyl sequence, wherein, optionally, the polyadenyl sequence comprises within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than nucleotide A.

7. The composition as claimed in claim 6, wherein the nucleic acid molecule has one or more of the following characteristics: (i) said polyadenyl sequence comprises at least 20 A nucleotides, preferably at least 40, at least 80, at least 100 or at least 120 A nucleotides, preferably consecutive A nucleotides; (ii) said sequence of one or more consecutive nucleotides containing nucleotides that are not A nucleotides is a sequence of two or more consecutive nucleotides, wherein the first and last nucleotide of said sequence of two or more consecutive nucleotides is a nucleotide that is not an A nucleotide; (iii) said polyadenyl sequence comprises at least 80 nucleotides, preferably at least 90 or 100 nucleotides;(iv) said sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides is located within a region from position 21 to position 80, preferably from position 21 to position 60, and better from position 31 to position 50 of said polyadenyl sequence; (v) said sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides is preceded by at least 20 A residues in said polyadenyl sequence and / or is followed by at least 20 A residues in said polyadenyl sequence; (vi) said sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides has a length of at least 3, at least 4, at least 5, at least 6, at least 8, preferably at least 10, and better at least 15 nucleotides;(vii) said sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides is not longer than 50, preferably not longer than 30, and better not longer than 20 nucleotides; (viii) said sequence of one or more consecutive nucleotides containing nucleotides other than A nucleotides comprises no more than 3, preferably no more than 2, and better does not contain consecutive A residues; (ix) in the transcript, said polyadenyl sequence is located at the 3' end; (x) in the transcript, said polyadenyl sequence is an unmasked polyadenyl sequence.

8. The composition as claimed in any of claims 1 to 7, wherein said peptide or protein is a disease-associated antigen, wherein, preferably, said disease-associated antigen is selected from the group consisting of a tumor-associated antigen, a viral antigen, and a bacterial antigen, wherein, preferably, the tumor-associated antigen is not expressed in normal tissues or is mutated in tumor cells.

9. RNA obtainable by transcription, preferably in vitro transcription, using a nucleic acid molecule as claimed in any of claims 1 to 8 as a template. ncznnn / i znz / R / v 120 10. An RNA composition comprising in the 5' -> 3' direction: (a) a 5' untranslated region; (b) a nucleic acid sequence encoding a peptide or protein; and (c) a 3' untranslated region, said 3' untranslated region comprising a combination of a nucleic acid sequence from the Amino-Terminal Cleavage Enhancer (AES) and a nucleic acid sequence from Mitochondrially Encoded RNA 12S non-coding RNA (MT-RNR1), wherein the nucleic acid sequence of the 3' untranslated region of AES comprises or consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 86 to 89 or a nucleic acid sequence that is at least 90% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 86 to 89.and wherein the MT-RNR1 non-coding RNA nucleic acid sequence comprises or consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 105 to 121 or a nucleic acid sequence that is at least 90% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 105 to 121.

11. The composition as claimed in claim 10, wherein the nucleic acid sequence of the MT-RNR1 non-coding RNA further comprises (d) a nucleic acid sequence that is a polyadenyl sequence, wherein, optionally, the polyadenyl sequence comprises within the polyadenyl sequence a sequence of one or more consecutive nucleotides containing nucleotides other than the A nucleotides, wherein, preferably, said nucleic acid sequence (d) is located at the 3' end of said RNA.

12. The composition as claimed in claim 10 or 11, wherein the RNA further comprises (e) a 5'-terminate or 5'-terminate analogue.

13. The composition as claimed in any of claims 10 to 12, wherein said peptide or protein is a disease-associated antigen, wherein, preferably, said disease-associated antigen is selected from the group consisting of a tumor-associated antigen, a viral antigen, and a bacterial antigen, wherein, preferably, the tumor-associated antigen is not expressed in normal tissues or is mutated in tumor cells.

14. The composition as claimed in any of claims 9 to 13 for use in a method for transfecting a host cell, wherein, preferably, said host cell is an antigen-presenting cell, in particular a dendritic cell, a monocyte, or a macrophage.

15. The composition as claimed in any of claims 10 to 13 for use in a vaccination method.

16. A pharmaceutical composition comprising the RNA as claimed in claim 9 or the composition as claimed in any of claims 10 to 13.

17. The pharmaceutical composition as claimed in claim 16, wherein the pharmaceutical composition is a vaccine composition.