Microorganism for producing carotenoid or producing material having carotenoid as precursor, comprising geranylgeranyl pyrophosphate synthase derived from dunaliella salina, and carotenoid or retinoid production method using same

Abstract

The present disclosure provides a microorganism expressing Dunaliella salina-derived geranylgeranyl pyrophosphate synthase; and a method of producing carotenoid or a material having carotenoid as a precursor using the microorganism.

Description

TECHNICAL FIELD

[0001] The present disclosure relates to a microorganism of the genus Yarrowia having an ability to produce carotenoid or a material having carotenoid as a precursor, the microorganism expressing Dunaliella salina-derived geranylgeranyl pyrophosphate synthase; a method of producing carotenoid or a material having carotenoid as a precursor using the microorganism; a composition for producing carotenoid or a material having carotenoid as a precursor; and use of the microorganism of the genus Yarrowia or a culture thereof in producing carotenoid or a material having carotenoid as a precursor.BACKGROUND ART

[0002] As carotenoids and retinoids exert various functions in plants and animals, they are used in various industrial fields such as foods, feeds, etc. Among them, carotenoids such as beta-carotene are substances reported to have functions such as eliminating free radicals, acting as precursors for vitamin A in animals, enhancing the immune system of vertebrates, and reducing the risk of lung cancer, and retinoids are a group of materials chemically related to retinol which is vitamin A, and also used in cosmetics, therapeutic agents for skin diseases, etc.

[0003] However, despite these advantages, carotenoids (e.g., beta-carotene) and retinoids (e.g., retinol) are not synthesized in the animal body or are synthesized in insufficient amounts. In addition, even though industrial production is attempted using mutated microorganisms (U.S. Pat. No. 7,745,170), it is still difficult to produce them with high purity.

[0004] For example, during preparation of microorganisms producing carotenoids or retinoids, squalene (C30) may also be produced as a by-product. Therefore, the discovery of geranylgeranyl pyrophosphate synthase, which contributes to the efficient production of carotenoids or retinoids, is essential to increasing their production and to reducing squalene which is produced in a competing pathway.DISCLOSURETechnical Problem

[0005] The problem to be solved in the present disclosure is to provide a microorganism producing carotenoid or a material having carotenoid as a precursor, the microorganism including Dunaliella salina-derived geranylgeranyl pyrophosphate synthase, a method of producing carotenoid or retinoid using the same and use thereof.Technical Solution

[0006] An object of the present disclosure is to provide a microorganism of the genus Yarrowia having an ability to produce carotenoid or a material having carotenoid as a precursor, the microorganism expressing Dunaliella salina-derived geranylgeranyl pyrophosphate synthase.

[0007] Another object of the present disclosure is to provide a method of producing carotenoid or a material having carotenoid as a precursor using the microorganism of the genus Yarrowia.

[0008] Still another object of the present disclosure is to provide a composition for producing carotenoid or a material having carotenoid as a precursor, the composition comprising the microorganism of the genus Yarrowia or a culture thereof.

[0009] Still another object of the present disclosure is to provide use of the microorganism of the genus Yarrowia in producing carotenoid or a material having carotenoid as a precursor.Advantageous Effects

[0010] The present disclosure may effectively increase production of carotenoid and a material having carotenoid as a precursor by introducing a Dunaliella salina-derived geranylgeranyl pyrophosphate synthase gene into a microorganism of the genus Yarrowia. BRIEF DESCRIPTION OF THE DRAWING

[0011] FIG. 1 shows results of flask tests of strains which were introduced with GGPP synthase genes derived from various microorganisms, respectively, and

[0012] FIG. 2 shows results of flask tests of Mb.BCO-introduced strains.DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

[0013] The present disclosure will be described in detail as follows. Meanwhile, each description and embodiment disclosed in this disclosure may also be applied to other descriptions and embodiments. That is, all combinations of various elements disclosed in this disclosure fall within the scope of the present disclosure. Further, the scope of the present disclosure is not limited by the specific description described below. Further, a number of papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to further clarify the level and scope of the subject matter to which the present disclosure pertains.

[0014] An aspect of the present disclosure provides a microorganism of the genus Yarrowia having an ability to produce carotenoid or a material having carotenoid as a precursor, the microorganism expressing Dunaliella salina-derived geranylgeranyl pyrophosphate synthase.

[0015] As used herein, “geranylgeranyl pyrophosphate synthase” is an enzyme capable of catalyzing the synthesis of geranylgeranyl pyrophosphate (GGPP). A substrate of the geranylgeranyl pyrophosphate synthase may be isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). The geranylgeranyl pyrophosphate synthase may also be named ‘GGS’, ‘GGPPS’, ‘GGPS’, or ‘polypeptide having geranylgeranyl pyrophosphate synthase activity’.

[0016] In one embodiment, the microorganism of the present disclosure may be a microorganism of the genus Yarrowia comprising or expressing a Dunaliella salina-derived geranylgeranyl pyrophosphate synthase protein which is a foreign protein, and may have the ability to produce carotenoid or a material having carotenoid as a precursor.

[0017] An amino acid sequence of the GGPPS protein of the present disclosure may be a protein sequence having the geranylgeranyl pyrophosphate synthase activity, which is encoded by the GGPPS gene. The amino acid sequence may be available in various databases, such as the NCBI GenBank, etc., which are known databases, but is not limited thereto.

[0018] In one embodiment, the GGPPS protein of the present disclosure may be derived from Dunaliella salina, and any protein may be included in the present disclosure as long as it has the sequence or activity identical thereto.

[0019] In one embodiment, the GGPPS protein of the present disclosure may comprise, have, or consist of SEQ ID NO: 91 or an amino acid sequence having 80% or more homology or identity thereto, or may essentially consist of the amino acid sequence.

[0020] Further, although one embodiment of the GGPPS protein of the present disclosure is described as the protein comprising SEQ ID NO: 91, such expression does not exclude a mutation that may occur by the addition of a meaningless sequence upstream or downstream of the amino acid sequence of SEQ ID NO: 91, or a naturally-occurring mutation therein, or a silent mutation thereof, and it is obvious to those skilled in the art that any protein may fall within the GGPPS protein of the present disclosure, as long as it has activity identical or corresponding to that of the protein comprising the amino acid sequence.

[0021] Specifically, the GGPPS protein of the present disclosure may comprise the amino acid sequence of SEQ ID NO: 91 or an amino acid sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology or identity to the amino acid sequence of SEQ ID NO: 91. Further, it is apparent that proteins having amino acid sequences in which some sequences are deleted, modified, substituted, or added are also included within the scope of the present disclosure as long as the amino acid sequences have such homology or identity and exhibit the efficacy corresponding to that of the above protein.

[0022] Although described as ‘a polypeptide or protein comprising an amino acid sequence represented by a particular SEQ ID NO.’, ‘a polypeptide or protein consisting of an amino acid sequence represented by a particular SEQ ID NO.’, or ‘a polypeptide or protein having an amino acid sequence represented by a particular SEQ ID NO.’ in the present disclosure, it is obvious that a protein having an amino acid sequence with deletion, modification, substitution, conservative substitution, or addition of some sequence may also be used in the present disclosure, as long as it has activity identical or corresponding to that of the polypeptide consisting of the amino acid sequence of the corresponding SEQ ID NO. Examples thereof comprise those having an addition of a sequence that does not alter the function of the protein at the N-terminus, inside, and / or C-terminus of the amino acid sequence, a naturally occurring mutation, a silent mutation thereof, or a conservative substitution.

[0023] The “conservative substitution” means the substitution of one amino acid with another amino acid having similar structural and / or chemical properties. Such an amino acid substitution may generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Usually, conservative substitution may hardly affect or not affect the activity of polypeptides.

[0024] As used herein, the term ‘homology’ or ‘identity’ refers to the degree of similarity between two given amino acid sequences or nucleotide sequences and may be expressed as a percentage. The terms ‘homology and identity’ may be often used interchangeably.

[0025] The sequence homology or identity of conserved polynucleotides or polypeptides may be determined by a standard alignment algorithm, and default gap penalties established by a program to be used may be used together. Substantially, homologous or identical sequences may generally hybridize with each other along the entire sequence or at least about 50%, 60%, 70%, 80% or 90% of the entire length under moderate or highly stringent conditions. It is obvious that the hybridization also includes hybridization with a polynucleotide containing the usual codons or codons considering codon degeneracy in the polynucleotide.

[0026] Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity may be determined using a known computer algorithm such as the “FASTA” program using a default parameter, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, they may be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) (including the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.][F.,][ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity may be determined using BLAST or ClustalW of the National Center for Biotechnology.

[0027] Homology, similarity, or identity of polynucleotides or polypeptides may be determined by comparing sequence information using a GAP computer program, e.g., Needleman et al. (1970), J Mol Biol. 48:443, for example, as disclosed in Smith and Waterman, Adv. Appl. Math (1981) 2:482. Briefly, the GAP program defines similarity as the number of aligned symbols (i.e., nucleotides or amino acids) which are similar, divided by the total number of symbols in the shorter of the two sequences. The default parameters for the GAP program may include: (1) a binary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix) of Gribskov et al (1986) Nucl. Acids Res. 14: 6745, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or gap open penalty 10, gap extension penalty 0.5); and (3) no penalty for end gaps.

[0028] Further, whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity may be determined by comparing these sequences via Southern hybridization experiments under defined stringent conditions, and the appropriate hybridization conditions to be defined may be within the scope of the technology and may be determined by a method well known to one of ordinary skill in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).

[0029] In the present disclosure, expression of the protein may be achieved by introducing a gene (polynucleotide) encoding the protein into a microorganism or injecting the protein thereinto, but is not limited thereto.

[0030] In one embodiment, the microorganism of the present disclosure may be introduced with the Dunaliella salina-derived geranylgeranyl pyrophosphate synthase gene. Further, introduction of the geranylgeranyl pyrophosphate synthase gene may also additionally comprise enhancing the activity thereof after the introduction.

[0031] As used herein, the ‘geranylgeranyl pyrophosphate synthase gene’ may be used interchangeably with ‘ggs’, ‘ggpps’, ‘ggps’, ‘GGS gene’, ‘GGPPS gene’, ‘GGPS gene’, ‘gene encoding geranylgeranyl pyrophosphate synthase’, ‘polynucleotide encoding geranylgeranyl pyrophosphate synthase’, or ‘polynucleotide encoding the polypeptide having the geranylgeranyl pyrophosphate synthase activity’.

[0032] The sequence of the geranylgeranyl pyrophosphate synthase gene may be available in various databases, such as the NCBI GenBank, etc., which are known databases, but is not limited thereto.

[0033] In one embodiment, the Dunaliella salina-derived geranylgeranyl pyrophosphate synthase gene may comprise, have, or consist of a nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.

[0034] In one embodiment, the geranylgeranyl pyrophosphate synthase gene consisting of the nucleotide sequence of SEQ ID NO: 1 may be codon-optimized for a microorganism of the genus Yarrowia, or more specifically, Yarrowia lipolytica.

[0035] As used herein, the term “polynucleotide”, which is a nucleotide polymer in which nucleotide monomers are covalently bonded in a long chain, refers to a DNA strand having a predetermined length or more.

[0036] Further, the polynucleotide or gene may have various modifications in the coding region within a range that does not change the amino acid sequence of the polypeptide, due to codon degeneracy or considering codons preferred by an organism to express the geranylgeranyl pyrophosphate synthase polypeptide.

[0037] The polynucleotide or gene may comprise, for example, the nucleotide sequence of SEQ ID NO: 1, and may consist of a nucleotide sequence having 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity thereto, but is not limited thereto.

[0038] Further, the polynucleotide or gene of the present disclosure may comprise a probe that may be prepared from a known gene sequence, for example, any sequence without limitation as long as it is a sequence that hybridizes with a complementary sequence to the entirety or a part of the nucleotide sequence under stringent conditions to encode the amino acid sequence of SEQ ID NO: 1. The “stringent conditions” mean conditions that enable specific hybridization between polynucleotides. These conditions are specifically described in documents (e.g., J. Sambrook et al., supra). For example, the stringent conditions may comprise conditions under which polynucleotides having high homology or identity, for example, 40% or higher, specifically 90% or higher, more specifically 95% or higher, 96% or higher, 97% or higher, 98% or higher, much more specifically 99% or higher homology or identity are hybridized with each other and polynucleotides having homology or identity lower than the above homology or identity are not hybridized with each other, or ordinary washing conditions of Southern hybridization, in which washing is performed once, specifically, two to three times at a salt concentration and temperature equivalent to 60° C., 1×SSC, 0.1% SDS, specifically 60° C., 0.1×SSC, 0.1% SDS, more specifically, 68° C., 0.1×SSC, 0.1% SDS.

[0039] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between nucleotides may be possible depending on the stringency of the hybridization. The term “complementary” is used to describe the relationship between mutually hybridizable nucleotides. For example, with respect to DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotide of the present disclosure may also comprise an isolated nucleic acid fragment complementary to the entire sequence as well as a nucleic acid sequence substantially similar thereto.

[0040] Specifically, a polynucleotide having homology or identity may be detected using hybridization conditions comprising a hybridization step at a Tm value of 55° C. and the above-described conditions. Further, the Tm value may be 60° C., 63° C., or 65° C., but is not limited thereto, and may be appropriately adjusted by those skilled in the art according to the purpose.

[0041] The appropriate stringency to hybridize the polynucleotide depends on the length and degree of complementarity of the polynucleotide, and the variables are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

[0042] In one embodiment, the microorganism of the present disclosure may comprise a vector comprising the Dunaliella salina-derived geranylgeranyl pyrophosphate synthase gene of the present disclosure or the polynucleotide encoding the Dunaliella salina-derived geranylgeranyl pyrophosphate synthase.

[0043] The vector of the present disclosure may comprise a DNA construct comprising a nucleotide sequence of a polynucleotide encoding a polypeptide of interest which is operably linked to a suitable expression regulatory region (or expression control sequence) so that the polypeptide of interest may be expressed in a suitable host. The expression regulatory region may comprise a promoter capable of initiating transcription, any operator sequence for controlling the transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling termination of transcription and translation. The vector may be transformed into a suitable host cell, and then replicated or function independently of the host genome, or may be integrated into the genome itself.

[0044] The vector used in the present disclosure is not particularly limited, but any vector known in the art may be used. Examples of commonly used vectors comprise natural or recombinant plasmids, cosmids, viruses, and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. may be used as a phage vector or a cosmid vector, and pDC system, pBR system, pUC system, pBluescript II system, pGEM system, pTZ system, pCL system, pET system, etc. may be used as a plasmid vector. Specifically, pDZ, pDC, pDCM2 (Korean Patent Publication No. 10-2020-0136813), pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pIMR53 vector, etc. may be used.

[0045] For example, a polynucleotide encoding a polypeptide of interest may be inserted into a chromosome through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. The vector may further comprise a selection marker for the confirmation of chromosome insertion. The selection marker is for selecting the cells transformed with vectors, i.e., for confirming the insertion of a nucleic acid molecule of interest, and markers that confer selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of surface polypeptides may be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, and thus transformed cells may be selected.

[0046] As used herein, the term “transformation” means that a vector comprising a polynucleotide encoding a target polypeptide is introduced into a host cell or a microorganism so that the polypeptide encoded by the polynucleotide may be expressed in the host cell. The transformed polynucleotide may be located regardless of the position, either by being inserted into the chromosome of the host cell or located outside the chromosome as long as it may be expressed in the host cell. Further, the polynucleotide comprises DNA and / or RNA encoding a polypeptide of interest. The polynucleotide may be introduced in any form as long as it may be introduced into a host cell and expressed. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all elements required for self-expression. The expression cassette may usually comprise a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replicating. Further, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.

[0047] Further, the term “operably linked” means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the desired polypeptide of the present disclosure.

[0048] In one embodiment, the microorganism of the genus Yarrowia expressing the Dunaliella salina-derived GGPPS of the present disclosure may have enhanced geranylgeranyl pyrophosphate synthase activity, as compared to a microorganism of the genus Yarrowia not expressing the same, but is not limited thereto.

[0049] In one embodiment, the microorganism of the genus Yarrowia, into which the Dunaliella salina-derived GGPPS gene of the present disclosure is introduced, may have enhanced geranylgeranyl pyrophosphate synthase activity, as compared to a microorganism of the genus Yarrowia, into which the Dunaliella salina-derived GGPPS gene is not introduced, but is not limited thereto.

[0050] In one embodiment, the microorganism of the genus Yarrowia, into which the geranylgeranyl pyrophosphate synthase encoded by the Dunaliella salina-derived GGPPS gene of the present disclosure is introduced, may have enhanced geranylgeranyl pyrophosphate synthase activity, as compared to a microorganism of the genus Yarrowia, into which a geranylgeranyl pyrophosphate synthase encoded by Xanthophyllomyces dendrorhous-derived crtE or its variant gene crtEM1, Saccharomyces cerevisiae-derived BTS1 gene, or Yarrowia lipolytica-derived GGS1 gene is introduced, but is not limited thereto.

[0051] As used herein, the term “strain of the genus Yarrowia” or “microorganism of the genus Yarrowia” comprises all of wild-type microorganisms of the genus Yarrowia or naturally or artificially genetically modified microorganisms of the genus Yarrowia, and it may be a microorganism of the genus Yarrowia in which a specific mechanism is strengthened due to insertion of a foreign gene or an activity enhancement of an endogenous gene, and it may be a microorganism of the genus Yarrowia comprising the Dunaliella salina-derived GGPPS gene for producing carotenoid or a material having carotenoid as a precursor.

[0052] The microorganism of the present disclosure may be a microorganism comprising any one or more of the GGPPS protein of the present disclosure, the GGPPS gene or polynucleotide encoding the GGPPS protein, and the vector comprising the gene or polynucleotide; a microorganism modified to express the Dunaliella salina-derived GGPPS protein or the GGPPS gene of the present disclosure; a microorganism (e.g., a recombinant strain) expressing the Dunaliella salina-derived GGPPS protein or GGPPS gene of the present disclosure; or a strain (e.g., a recombinant strain) having the activity of the Dunaliella salina-derived GGPPS of the present disclosure, but is not limited thereto.

[0053] The strain of the present disclosure may be a microorganism naturally having the geranylgeranyl pyrophosphate synthase or the ability to produce carotenoid or a material having carotenoid as a precursor; or a microorganism in which the geranylgeranyl pyrophosphate synthase or the ability to produce carotenoid or a material having carotenoid as a precursor is enhanced or provided by introducing the Dunaliella salina-derived GGPPS protein, gene, polynucleotide, or the vector comprising the same of the present disclosure into a parent strain not having the geranylgeranyl pyrophosphate synthase or the ability to produce carotenoid or the material having carotenoid as a precursor, but is not limited thereto.

[0054] For example, the strain of the present disclosure may comprise all of microorganisms which are transformed with the Dunaliella salina-derived GGPPS protein, gene, polynucleotide of the present disclosure, or the vector comprising the same to produce carotenoid or a material having carotenoid as a precursor or to have the enhanced production ability. For example, the strain of the present disclosure may be a recombinant strain having the enhanced ability to produce carotenoid or a material having carotenoid as a precursor by expressing the Dunaliella salina-derived GGPPS of the present disclosure in the natural wild-type microorganism or the microorganism producing carotenoid or a material having carotenoid as a precursor. The recombinant strain having the enhanced ability to produce carotenoid or a material having carotenoid as a precursor may be a microorganism having the enhanced ability to produce carotenoid or a material having carotenoid as a precursor, as compared to a natural wild-type microorganism or a geranylgeranyl pyrophosphate synthase-unmodified microorganism (i.e., a microorganism of the genus Yarrowia comprising the wild-type geranylgeranyl pyrophosphate synthase gene (SEQ ID NO: 10) or a microorganism of the genus Yarrowia into which the Dunaliella salina-derived geranylgeranyl pyrophosphate synthase gene (SEQ ID NO: 1) is not introduced, but is not limited thereto.

[0055] For example, the strain having the enhanced ability to produce carotenoid or a material having carotenoid as a precursor of the present disclosure may be a microorganism having the enhanced ability to produce carotenoid or a material having carotenoid as a precursor, as compared to a microorganism of the genus Yarrowia comprising no Dunaliella salina-derived GGPPS (e.g., SEQ ID NO: 91); or comprising Xanthophyllomyces dendrorhous-derived CrtE or its variant CrtEM1, Saccharomyces cerevisiae-derived BTS1, or Yarrowia lipolytica GGS1, but is not limited thereto. For example, the unmodified microorganism, which is the target strain for comparing whether the ability to produce carotenoid or a material having carotenoid as a precursor is enhanced or not, may be a strain 0008-1023, but is not limited thereto.

[0056] For example, the recombinant strain having the enhanced production ability may have about 0.001% or more or 0.01% or more enhancement of the beta-carotene or retinol-producing ability, as compared to that of the parent strain before modification or the unmodified microorganism. However, as long as the microorganism has an increased ability of + value, as compared to that of the parent strain before modification or the unmodified microorganism, it is not limited thereto. The term “about” refers to a range which includes all of ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all of the values that are equivalent or similar to those following the term “about”, but the range is not limited thereto.

[0057] As used herein, the term “unmodified microorganism” does not exclude strains comprising mutations that may occur naturally in microorganisms, and may be a wild-type strain or a natural strain itself or may be a strain before the trait is changed by genetic variation due to natural or artificial factors. For example, the unmodified microorganism may be a strain in which the Dunaliella salina-derived GGPPS is not expressed, or into which the Dunaliella salina-derived GGPPS has not yet been introduced. The term “unmodified microorganism” may be used interchangeably with “strain before being modified”, “microorganism before being modified”, “unvaried strain”, “unmodified strain”, “unvaried microorganism”, or “reference microorganism”.

[0058] The microorganism of the present disclosure may be a microorganism of the genus Yarrowia, specifically, Yarrowia lipolytica, but is not limited thereto.

[0059] In the microorganism of the present disclosure, partial or entire modification of the polynucleotide may be induced by (a) homologous recombination using a vector for chromosome insertion in the microorganism or genome editing using engineered nuclease (e.g., CRISPR-Cas9) and / or (b) treatment with light such as ultraviolet rays and radiation, and / or chemicals, but is not limited thereto. A method of modifying a part or the entirety of the gene may comprise a method of using a DNA recombination technology. For example, by introducing a nucleotide sequence or vector comprising a nucleotide sequence homologous to the gene of interest into the microorganism to cause homologous recombination, a part or the entirety of the gene may be deleted. The nucleotide sequence or vector to be introduced may comprise a dominant selection marker, but is not limited thereto.

[0060] The microorganism of the present disclosure may be a microorganism which is modified to further comprise polynucleotides encoding lycopene cyclase / phytoene synthase (crtYB) and phytoene desaturase (crtI) proteins, thereby exhibiting the activities of the proteins, or a microorganism in which the activities of the proteins are enhanced. The lycopene cyclase / phytoene synthase or phytoene desaturase may be a protein derived from Xanthophyllomyces dendrorhous, but is not limited thereto. In one embodiment, the polynucleotide encoding the lycopene cyclase / phytoene synthase or phytoene desaturase may have or may comprise a sequence, based on a nucleotide sequence (GenBank: AY177204.1 or GenBank: AY177424.1) registered in the National Center for Biotechnology Information Search database (NCBI), respectively. In one embodiment, the polynucleotide encoding the lycopene cyclase / phytoene synthase or phytoene desaturase may have or comprise SEQ ID NO: 59 or SEQ ID NO: 60, respectively. In the polynucleotide, various modifications may be made in the coding region as long as the amino acid sequence is not changed in consideration of codon degeneracy or codons preferred in microorganisms that are intended to express the polypeptide of the present disclosure. Specifically, the polynucleotide may have or may comprise a nucleotide sequence having 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity to the sequence of SEQ ID NO: 59 or SEQ ID NO: 60, or may consist of or may essentially consist of a nucleotide sequence having 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity to the sequence of SEQ ID NO: 59 or SEQ ID NO: 60, but is not limited thereto.

[0061] The microorganism of the present disclosure may be a microorganism which is modified to further comprise a polynucleotide encoding beta-carotene 15,15′-oxygenase (BLH) protein, thereby exhibiting the activity of the protein, or a microorganism in which the activity of the protein is enhanced, but is not limited thereto. The beta-carotene 15, 15′-oxygenase may be a protein derived from an Uncultured marine bacterium 66A03, but is not limited thereto. In one embodiment, the polynucleotide encoding beta-carotene 15, 15′-oxygenase may have or comprise an amino acid sequence, based on Q4PN10 which is registered in the UniProt Knowledgebase (UniProtKB). In one embodiment, the polynucleotide encoding beta-carotene 15, 15′-oxygenase may have or comprise a sequence of SEQ ID NO: 12. The polynucleotide may undergo various modifications in the coding region within the scope that does not change the amino acid sequence in consideration of codon degeneracy or codons preferred in microorganisms that are intended to express the polypeptide of the present disclosure. Specifically, the polynucleotide may have or comprise a nucleotide sequence having 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity to the sequence of SEQ ID NO: 12, or may consist of or essentially consist of a nucleotide sequence having 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity to the sequence of SEQ ID NO: 12, but is not limited thereto.

[0062] As used herein, the term “enhancement” of polypeptide activity means that the activity of a polypeptide is increased, as compared to the endogenous activity. The enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase, etc. Here, activation, enhancement, up-regulation, overexpression, and increase may comprise both exhibiting activity that was not originally possessed and exhibiting improved activity as compared to the endogenous activity or activity before modification. The “endogenous activity” means the activity of a specific polypeptide originally possessed by a parent strain before the trait is changed or an unmodified microorganism, when the trait is changed by genetic variation due to natural or artificial factors. This may be used interchangeably with “activity before modification”. The fact that the activity of a polypeptide is “enhanced”, “up-regulated”, “overexpressed”, or “increased” as compared to the endogenous activity means that the activity of the polypeptide is improved as compared to the activity and / or concentration (expression level) of a specific polypeptide originally possessed by a parent strain before the trait is changed or an unmodified microorganism.

[0063] The enhancement may be achieved through the introduction of a foreign polypeptide or gene or the enhancement of endogenous activity and / or concentration (expression level) of the polypeptide. The enhancement of the activity of a polypeptide may be confirmed by an increase in the degree of activity and the expression level of the corresponding polypeptide or in the amount of the product produced from the corresponding polypeptide.

[0064] For the enhancement of the activity of the polypeptide, various methods well known in the art may be applied, and the method is not limited as long as the activity of the polypeptide of interest may be enhanced as compared to that of the microorganism before being modified. Specifically, genetic engineering and / or protein engineering well known to those skilled in the art, which are routine methods of molecular biology, may be used, but the method is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0065] Specifically, the enhancement of the polypeptide of the present disclosure may be:

[0066] 1) increase in the intracellular copy number of the polynucleotide encoding the polypeptide;

[0067] 2) replacement of a gene expression regulatory region on a chromosome encoding the polypeptide with a sequence exhibiting strong activity;

[0068] 3) modification of a nucleotide sequence encoding a start codon or 5′-UTR region of the gene transcript encoding the polypeptide;

[0069] 4) modification of the amino acid sequence of the polypeptide to enhance the activity of the polypeptide;

[0070] 5) modification of the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene to encode the polypeptide that has been modified to enhance the activity of the polypeptide);

[0071] 6) introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

[0072] 7) codon optimization of the polynucleotide encoding the polypeptide;

[0073] 8) analysis of the tertiary structure of the polypeptide to select and to modify or chemically modify the exposed site; or

[0074] 9) a combination of two or more selected from 1) to 8), but is not particularly limited thereto.

[0075] More specifically,

[0076] 1) The increase in the intracellular copy number of the polynucleotide encoding the polypeptide may be achieved by the introduction of, into a host cell, a vector which may replicate and function independently of the host and to which the polynucleotide encoding the corresponding polypeptide is operably linked. Alternatively, the increase may be achieved by the introduction of one copy or two or more copies of the polynucleotide encoding the corresponding polypeptide into a chromosome of a host cell. The introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into a chromosome of a host cell into the host cell, but is not limited thereto. The vector is as described above.

[0077] 2) The replacement of a gene expression regulatory region (or expression control sequence) on a chromosome encoding the polypeptide with a sequence exhibiting strong activity may be, for example, the occurrence of variation in a sequence due to deletion, insertion, nonconservative or conservative substitution, or a combination thereof, or the replacement with a sequence exhibiting stronger activity so that the activity of the expression regulatory region is further enhanced. The expression regulatory region may comprise, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence controlling the termination of transcription and translation, etc. For example, the replacement may be to replace the original promoter with a strong promoter, but is not limited thereto.

[0078] Examples of known strong promoters comprise CJ1 to CJ7 promoters (U.S. Pat. No. 7,662,943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (U.S. Pat. No. 10,584,338 B2), O2 promoter (U.S. Pat. No. 10,273,491 B2), tkt promoter, yccA promoter, TEFINt promoter, etc., but is not limited thereto.

[0079] 3) The modification of a nucleotide sequence encoding a start codon or 5′-UTR region of the gene transcript encoding the polypeptide may be, for example, the substitution with a nucleotide sequence encoding another start codon having a higher polypeptide expression rate as compared to an endogenous start codon, but is not limited thereto.

[0080] 4) and 5) The modification of the amino acid sequence or the polynucleotide sequence may be the occurrence of variation in the sequence due to deletion, insertion, nonconservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, or a combination thereof, or the replacement with an amino acid sequence or polynucleotide sequence modified to exhibit stronger activity or an amino acid sequence or polynucleotide sequence modified to be more active so that the activity of the polypeptide is enhanced, but is not limited thereto. The replacement may be specifically performed by inserting a polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used here may further comprise a selection marker for the confirmation of chromosome insertion. The selection marker is as described above.

[0081] 6) The introduction of a foreign polynucleotide exhibiting the activity of the polypeptide may be the introduction of a foreign polynucleotide encoding a polypeptide exhibiting activity identical or similar to that of the polypeptide into a host cell. There is no limitation on its origin or sequence as long as the foreign polynucleotide exhibits activity identical or similar to that of the polypeptide. The method used in the introduction may be performed by appropriately selecting a known transformation method by those skilled in the art. As the introduced polynucleotide is expressed in a host cell, the polypeptide may be produced, and the activity thereof may be increased.

[0082] 7) The codon optimization of the polynucleotide encoding the polypeptide may be the codon optimization of an endogenous polynucleotide so as to increase transcription or translation in a host cell, or the codon optimization of a foreign polynucleotide so as to perform optimized transcription and translation in a host cell.

[0083] 8) The analysis of the tertiary structure of the polypeptide to select and to modify or chemically modify the exposed site may be, for example, to determine a template protein candidate according to the degree of similarity of the sequence by comparing the sequence information of a polypeptide to be analyzed with a database storing the sequence information of known proteins, to confirm the structure based on this, and to modify or chemically modify the exposed site to be modified or chemically modified.

[0084] Such enhancement of the polypeptide activity may be an increase in the activity or concentration expression level of the corresponding polypeptide, based on the activity or concentration of the polypeptide expressed in a wild-type or a microbial strain before being modified, or an increase in the amount of a product produced from the corresponding polypeptide, but is not limited thereto.

[0085] In one embodiment, the microorganism of the present disclosure may have the enhanced GGPPS activity by introducing the Dunaliella salina-derived GGPPS gene, but is not limited thereto.

[0086] The microorganism of the present disclosure may have the ability to produce carotenoid or a material having carotenoid as a precursor.

[0087] As used herein, the term “carotenoid” refers to tetraterpene or a derivative thereof that gives colors such as yellow in fruits and vegetables.

[0088] In one embodiment, the carotenoid may be any one or more selected from the group consisting of xanthophyll, carotene, alpha-carotene, beta-carotene, gamma-carotene, phytoene, phytofluene, neurosporene, lutein, lycopene, zeaxanthin, capsanthin, canthaxanthin, and astaxanthin, but is not limited thereto.

[0089] In one embodiment, the material having carotenoid as a precursor may be retinoid, but is not limited thereto.

[0090] As used herein, the term “retinoid” chemically refers to the vitamin A group or a group of compounds chemically related thereto.

[0091] In one embodiment, the retinoid may be any one selected from the group consisting of retinol, retinal, retinoic acid, and retinyl ester, but is not limited thereto.

[0092] In one embodiment, the microorganism of the present disclosure may have a reduced ability to produce a by-product, but is not limited thereto.

[0093] In the present disclosure, the by-product may refer to any material other than carotenoid or the material having carotenoid as a precursor during production thereof. For example, a representative by-product generated during beta-carotene production may be squalene.

[0094] As used herein, the “squalene” is an unsaturated hydrocarbon (C30H50) and is a material which is also used in the biosynthesis of steroid hormones, vitamin D, etc. The microorganism of the present disclosure may have the reduced by-products which are generated in the beta-carotene production pathway, and specifically, may have the reduced squalene production, but is not limited thereto.

[0095] Another aspect of the present disclosure provides a method of producing carotenoid or the material having carotenoid as a precursor, the method comprising the step of culturing the microorganism of the genus Yarrowia of the present disclosure in a medium.

[0096] The microorganism, carotenoid, and material having carotenoid as a precursor are as described in other aspects.

[0097] As used herein, the term “culturing” refers to growing the microorganism of the genus Yarrowia of the present disclosure in appropriately adjusted environmental conditions. In the present disclosure, the culturing procedure may be performed according to appropriate media or culture conditions known in the art. Such culturing procedure may be easily adjusted according to the selected microorganism by a person skilled in the art. Specifically, the culturing may be in a batch type, a continuous type, and / or a fed-batch type, but is not limited thereto.

[0098] The microorganism of the genus Yarrowia of the present disclosure may be cultured under aerobic conditions in a common medium containing appropriate carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids, and / or vitamins, while controlling the temperature, pH, etc.

[0099] In the culturing of the present disclosure, the culture temperature may be maintained at 20° C. to 35° C., specifically, at 25° C. to 35° C., and the culturing may be performed for about 10 hours to about 160 hours, about 20 hours to about 130 hours, about 24 hours to about 120 hours, about 36 hours to about 120 hours, about 48 hours to about 120 hours, about 48 hours, about 72 hours, or about 120 hours, but is not limited thereto.

[0100] The carotenoid or the material having carotenoid as a precursor which is produced by the culturing of the present disclosure may be released into the medium or may remain in microorganisms.

[0101] The method of producing carotenoid or the material having carotenoid as a precursor of the present disclosure may further comprise the steps of preparing the microorganism of the genus Yarrowia of the present disclosure, preparing a medium for culturing the microorganism, or a combination of these steps (regardless of the order, in any order), for example, before or after the culturing step.

[0102] The method of producing carotenoid or the material having carotenoid as a precursor of the present disclosure may further comprise the step of recovering carotenoid or the material having carotenoid as a precursor from the medium resulting from the culturing of the microorganism of the genus Yarrowia (medium in which culturing has been performed) or from the microorganism of the genus Yarrowia of the present disclosure. The recovering step may be further included after the culturing step.

[0103] The recovering may be collecting the desired retinol by using an appropriate method known in the art according to the method of culturing the microorganism of the present disclosure, for example, a batch, continuous, or fed-batch type culture. For example, centrifugation, filtration, treatment with a crystallized protein precipitating agent (salting-out), extraction, cell disruption, sonication, ultrafiltration, dialysis, various types of chromatography, such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, and affinity chromatography, etc., HPLC, and a combination of these methods may be used, and retinol may be recovered from the medium or microorganism by using an appropriate method known in the art.

[0104] In addition, the method of producing carotenoid or the material having carotenoid as a precursor of the present disclosure may further comprise a purification step. The purification may be performed by using an appropriate method known in the art. In an exemplary embodiment, when the method of producing carotenoid or the material having carotenoid as a precursor of the present disclosure comprises both the recovering step and the purification step, the recovering step and the purification step may be performed discontinuously (or continuously) regardless of the order, or may be performed simultaneously or integrated into one step, but is not limited thereto.

[0105] The method of producing carotenoid of the present disclosure may further comprise the step of converting beta-carotene, which is produced by the microorganism of the genus Yarrowia of the present disclosure, into carotenoids other than beta-carotene. In the method of producing carotenoids of the present disclosure, the converting step may be further included after the culturing step or the recovering step. The converting step may be performed using an appropriate method known in the art. For example, the converting may be performed chemically or using an enzyme, but is not limited thereto.

[0106] The method of producing retinoid of the present disclosure may further comprise the step of converting retinol, which is produced by the microorganism of the present disclosure, into retinoids other than retinol. In the method of producing retinoids of the present disclosure, the converting step may be further included after the culturing step or the recovering step. The converting step may be performed using an appropriate method known in the art. For example, the converting may be performed using retinol acyltransferase, but is not limited thereto.

[0107] In one embodiment, retinoids other than retinol may be any one selected from the group consisting of retinal, retinoic acid, and retinyl ester, but is not limited thereto, as long as it is included in retinoids.

[0108] Still another aspect of the present disclosure provides a composition for producing carotenoid or the material having carotenoid as a precursor, the composition comprising the microorganism of the genus Yarrowia of the present disclosure or a culture thereof.

[0109] The microorganism, carotenoid, or material having carotenoid as a precursor is as described in other aspects.

[0110] The composition of the present disclosure may further comprise any appropriate excipient commonly used, and the excipient may comprise, for example, a preserving agent, a wetting agent, a dispersing agent, a suspending agent, a buffer, a stabilizing agent, an isotonic agent, etc., but are not limited thereto.

[0111] Still another aspect of the present disclosure provides use of the microorganism of the present disclosure or a culture thereof in producing carotenoid or a material having carotenoid as a precursor.

[0112] The microorganism, carotenoid, or material having carotenoid as a precursor are as described in other aspects.MODE FOR CARRYING OUT THE INVENTION

[0113] Hereinafter, the present disclosure will be described in more detail by way of exemplary embodiments. However, the following exemplary embodiments are only preferred embodiments for illustrating the present disclosure, and thus are not intended to limit the scope of the present disclosure thereto. Meanwhile, technical matters not described in the present specification may be sufficiently understood and easily implemented by those skilled in the technical field of the present disclosure or similar technical fields.Example 1. Preparation of Platform Strains for Producing Carotenoid or Material Having Carotenoid as PrecursorExample 1-1. Preparation of X. dendrorhous-Derived crtYB-crtI Inserted Strain

[0114] To prepare platform strains for producing carotenoid or a material having carotenoid as a precursor, lycopene cyclase / phytoene synthase (crtYB) and phytoene desaturase (crtI) genes derived from Xanthophyllomyces dendrorhous were inserted into the genome of a high-fat yeast Yarrowia lipolytica 0008-0125 (Accession No. KCCM12972P) strain.

[0115] With regard to crtYB, a polynucleotide of SEQ ID NO: 59 was obtained, based on a nucleotide sequence (GenBank: AY177204.1) registered in the National Center for Biotechnology Information Search database (NCBI), and with regard to crtI, a polynucleotide of SEQ ID NO: 60 was obtained, based on a nucleotide sequence (GenBank: AY177424.1) registered in the NCBI. The polynucleotide sequences of crtYB and crtI were synthesized by Macrogen in the form of TEFINtp-crtYB-CYC1t (SEQ ID NO: 61), and TEFINtp-crtI-CYC1t (SEQ ID NO: 62), respectively. A cassette to be inserted into the MHY1(YALIOB21582g) gene site was designed using a URA3 gene (SEQ ID NO: 63) of Y. lipolytica as a selection marker. Each PCR was performed using the synthesized crtYB and crtI genes and KCCM12972P genomic DNA as templates, and primers of SEQ ID NO: 64 and SEQ ID NO: 65, SEQ ID NO: 66 and SEQ ID NO: 67, SEQ ID NO: 68 and SEQ ID NO: 69, SEQ ID NO: 70 and SEQ ID NO: 71, SEQ ID NO: 72 and SEQ ID NO: 73, and SEQ ID NO: 74 and SEQ ID NO: 75. PCR was performed by 35 cycles consisting of denaturation at 95° C. for 1 min; annealing at 55° C. for 1 min; and polymerization reaction at 72° C. for 3 min. The resulting DNA fragments were prepared as a single cassette through overlap extension PCR.

[0116] The cassette thus prepared was introduced into KCCM12972P strain by a heat shock method (D.-C. Chen et al., Appl Microbiol Biotechnol, 1997), and then colonies were obtained, which were formed on a solid medium (YLMM1) without uracil. Colonies in which cassette insertion into the genome was confirmed using primers of SEQ ID NO: 76 and SEQ ID NO: 77 were spotted on a 5-FOA solid medium and cultured at 30° C. for 3 days, and colonies grown on the 5-FOA solid medium were obtained to recover the URA3 marker.TABLE 1SEQ IDNO.Sequence (5′-3′)PCR product64GTGCGCTTCTCTCGTCTCGGTAACCCTGTCHomology left65ATGCGCCGCCAACCCGGTCTCTGGGGTGTGGTGGATGGGGTGTGarm66CACACCCCATCCACCACACCCCAGAGACCGGGTTGGCGGCGCATTEFINtp-crtYB-67CGCCGCCAACCCGGTCTCTTGAAGACGAAAGGGCCTCCGCYC1t68CGGAGGCCCTTTCGTCTTCAAGAGACCGGGTTGGCGGCGTEFINtp-crtl-69GACGAGTCAGACAGGAGGCATCAGACAGATACTCGTCGCGCYC1t70CGCGACGAGTATCTGTCTGATGCCTCCTGTCTGACTCGTCURA371ATGACGAGTCAGACAGGAGGCATGGTGGTATTGTGACTGGGGAT72ATCCCCAGTCACAATACCACCATGCCTCCTGTCTGACTCGTCATRepeat region73CGGCGTCCTTCTCGTAGTCCGCTTTTGGTGGTGAAGAGGAGACT74AGTCTCCTCTTCACCACCAAAAGCGGACTACGAGAAGGACGCCGHomology right75CCACTCGTCACCAACAGTGCCGTGTGTTGCarm76TCGTACGTCTATACCAACAGATGGForward77CGCATACACACACACTGCCGGGGGReverseExample 1-2. Preparation of HMGR-Enhanced Strain

[0117] A cassette for replacement of a native promoter (SEQ ID NO: 78) region of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) gene of the strain which was prepared through Example 1-1 with a TEFINt promoter was designed, and each PCR was performed using genomic DNA of KCCM12972P as a template, and primers of SEQ ID NO: 79 and SEQ ID NO: 80, SEQ ID NO: 81 and SEQ ID NO: 82, SEQ ID NO: 83 and SEQ ID NO: 84, SEQ ID NO: 85 and SEQ ID NO: 86, and SEQ ID NO: 87 and SEQ ID NO: 88. PCR was performed by 35 cycles consisting of denaturation at 95° C. for 1 min; annealing at 55° C. for 1 min; and polymerization reaction at 72° C. for 1 min and 30 sec. The resulting five DNA fragments were prepared as a single cassette through overlap extension PCR.

[0118] The cassette thus prepared was introduced into the strain prepared in Example 1-1 by a heat shock method, and then colonies were obtained, which were formed on a solid medium (YLMM1) without uracil. Colonies in which cassette insertion was confirmed using primers of SEQ ID NO: 89 and SEQ ID NO: 90 were spotted on a 5-FOA solid medium and cultured at 30° C. for 3 days, and colonies grown on the 5-FOA solid medium were obtained to recover the URA3 marker. Thus, the platform strain finally prepared was named 0008-1023.<Yarrowia lipolytica Minimal Medial (YLMM1)>

[0119] 20 g / L of glucose, 6.7 g / L of yeast nitrogen base without amino acids, 2 g / L of yeast synthetic drop-out medium supplements without uracil, 15 g / L of agar<5-Fluoroorotic Acid (5-FOA)>

[0120] 20 g / L of glucose, 6.7 g / L of yeast nitrogen base without amino acids, 2 g / L of yeast synthetic drop-out medium supplements without uracil, 50 μg / mL of uracil, 1 g / L of 5-fluoroorotic acid (5-FOA), 15 g / L of agarTABLE 2SEQID NO.Sequence (5′-3′)PCR product79GACAATGCCTCGAGGAGGTTTAAAAGTAACTHomology80GCGCCGCCAACCCGGTCTCTCTGTGTTAGTCGGATGATAGGleft arm81CCTATCATCCGACTAACACAGAGAGACCGGGTTGGCGGCGCTEFINt82GACGAGTCAGACAGGAGGCACTGCGGTTAGTACTGCAAAAAGpromoter83CTTTTTGCAGTACTAACCGCAGTGCCTCCTGTCTGACTCGTCURA384ATGCGCCGCCAACCCGGTCTCTTGGTGGTATTGTGACTGGGGAT85ATCCCCAGTCACAATACCACCAAGAGACCGGGTTGGCGGCGCATRepeat region86CTTTCCAATAGCTGCTTGTAGCTGCGGTTAGTACTGCAAAA87TTTTGCAGTACTAACCGCAGCTACAAGCAGCTATTGGAAAGHomology88GCTTAATGTGATTGATCTCAAACTTGATAGright arm89GCTGTCTCTGCGAGAGCACGTCGAForward90GGTTCGCACAACTTCTCGGGTGGCReverseExample 2. Preparation of Dunaliella Salina-Derived Geranylgeranyl Pyrophosphate Synthase (GGPP Synthase) Gene-Inserted Strain

[0121] Four types of GGPP synthase genes (hereinafter, referred to as GGPPS genes) derived from different origins were introduced into the genome of the strain 0008-1023 prepared in Example 1 as follows.Example 2-1. Preparation of Dunaliella salina-Derived GGPPS-Inserted Strain

[0122] To insert the Dunaliella salina-derived GGPPS gene (hereinbelow, referred to as Ds.GGPPS) into the chromosome of Yarrowia lipolytica, codon optimization (SEQ ID NO: 1) of Ds.GGPPS was performed to be suitable for Y. lipolytica through http: / / atgme.org, based on a nucleotide sequence (GenBank: APW83741.1) registered in National Center for Biotechnology Information Search database (NCBI), and the gene (SEQ ID NO: 4) was synthesized by Macrogen in the form of TEFINtp-codon optimized GGPPS-TDH3t. A cassette to be inserted into the LIG4(YALIOD21384g) gene site was designed using the URA3 gene (SEQ ID NO: 5) of Y. lipolytica as a selection marker.

[0123] PCR was performed for left homologous region, TEFINt promoter, Ds.GGPPS ORF, TDH3 terminator, URA3, repeat region, and right homologous region fragments using the synthesized Ds.GGP gene and genomic DNA of KCCM12972P as templates, and primers of SEQ ID NO: 15 and SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26, and SEQ ID NO: 27 and SEQ ID NO: 28, as shown in Table 3, respectively. PCR was performed by 35 cycles consisting of denaturation at 95° C. for 1 min; annealing at 55° C. for 1 min; and polymerization reaction at 72° C. for 2 min. The resulting DNA fragments were prepared as a single cassette through overlap extension PCR.

[0124] The cassette thus prepared was introduced into the 0008-1023 strain by a heat shock method, and then colonies were obtained, which were formed on a solid medium (YLMM1) without uracil. Colonies in which cassette insertion into the genome was confirmed using primers of SEQ ID NO: 29 and SEQ ID NO: 30 were plated on a 5-FOA solid medium and cultured at 30° C. for 3 days, and colonies grown on the 5-FOA solid medium were obtained to remove the URA3 marker.TABLE 3SEQ ID NO.Sequence (5′-3′)15CATCATTTCAAAAGAGGGAACAGC16CGCCGCCAACCCGGTCTCTGTGTTTGGCGGTGTGAGTTGTC17GACAACTCACACCGCCAAACACAGAGACCGGGTTGGCGGCG18AGCTGCATCTGGTGGGCAGCCTGCGGTTAGTACTGCAAAAAGTGC19GCACTTTTTGCAGTACTAACCGCAGGCTGCCCACCAGATGCAGCT20CGCTCTTGATCTTCGGATAGTCAGTTCTGTCGGTATCCGA21TCGGATACCGACAGAACTGACTATCCGAAGATCAAGAGCG22GACGAGTCAGACAGGAGGCAGTCTTGGAACGGTGAAAAAGCCTGC23GCAGGCTTTTTCACCGTTCCAAGACTGCCTCCTGTCTGACTCGTC24CGCTCTTGATCTTCGGATAGTGGTGGTATTGTGACTGGGGA25TCCCCAGTCACAATACCACCACTATCCGAAGATCAAGAGCG26CATATGGAGTGTTATTTGAAGGGGTCTTGGAACGGTGAAAAAGCCTGC27GCAGGCTTTTTCACCGTTCCAAGACCCCTTCAAATAACACTCCATATG28CCGATACAGTGTCCAAGTACG29GAGTGTCTGAAGACAAGGCTTC30GACGACAATGCTGAGCTCCGExample 2-2. Preparation of Xanthophyllomyces Dendrorhous-Derived crtE Variant Gene-Inserted Strain

[0125] To insert the Xanthophyllomyces dendrorhous-derived crtE variant gene crtEM1 (SEQ ID NO: 6, Hong et al., Applied Microbiology and Biotechnology, 2019 January; 103(1):211-223) into the chromosome of Yarrowia lipolytica, the gene (SEQ ID NO: 7) was synthesized by Macrogen in the form of TEFINtp-crtEM1-TDH3t. A cassette to be inserted into the LIG4(YAL10D21384g) gene site was designed using the URA3 gene (SEQ ID NO: 5) of Y. lipolytica as a selection marker.

[0126] PCR was performed for left homologous region, TEFINt promoter, crtEM1 ORF, TDH3 terminator, URA3, repeat region, and right homologous region fragments using the synthesized crtEM1 DNA and genomic DNA of KCCM12972P as templates, and primers of SEQ ID NO: 15 and SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 33, SEQ ID NO: 34 and SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26, and SEQ ID NO: 27 and SEQ ID NO: 28, as shown in Table 4, respectively.

[0127] PCR was performed by 35 cycles consisting of denaturation at 95° C. for 1 min; annealing at 55° C. for 1 min; and polymerization reaction at 72° C. for 2 min. The resulting DNA fragments were prepared as a single cassette through overlap extension PCR.

[0128] The cassette thus prepared was introduced into the 0008-1023 strain by a heat shock method, and then colonies were obtained, which were formed on a solid medium (YLMM1) without uracil. Colonies in which cassette insertion into the genome was confirmed using primers of SEQ ID NO: 29 and SEQ ID NO: 30 were plated on a 5-FOA solid medium and cultured at 30° C. for 3 days, and colonies grown on the 5-FOA solid medium were obtained to remove the URA3 marker.TABLE 4SEQ ID NO.Sequence (5′-3′)31CTGTGAGGATGTTCGCGTAATCCTGCGGTTAGTACTGCAAAAAGTGC32GCACTTTTTGCAGTACTAACCGCAGGATTACGCGAACATCCTCACAG33CTTCGCTCTTGATCTTCGGATAGTCACAGAGGGATATCGGCTAG34CTAGCCGATATCCCTCTGTGACTATCCGAAGATCAAGAGCGAAGExample 2-3. Preparation of Saccharomyces cerevisiae-Derived BTS1-Inserted Strain

[0129] To insert the Saccharomyces cerevisiae-derived BTS1 gene (hereinbelow, referred to as Sc.BTS1) into the chromosome of Yarrowia lipolytica, a polynucleotide of SEQ ID NO: 8 of BTS1 was obtained, based on a nucleotide sequence (YPL069C) registered in the Kyoto Encyclopedia of Genes and Genomes (KEGG). The gene was synthesized using the polynucleotide of BTS1 by Macrogen in the form of TEFINtp-Sc.BTS1-TDH3t (SEQ ID NO: 9). A cassette to be inserted into the LIG4(YALIOD21384g) gene site was designed using the URA3 gene (SEQ ID NO: 5) of Y. lipolytica as a selection marker.

[0130] PCR was performed for left homologous region, TEFINt promoter, Sc.BTS1 ORF, TDH3 terminator, URA3, repeat region, and right homologous region fragments using the synthesized Sc.BTS1 DNA and genomic DNA of KCCM12972P as templates, and primers of SEQ ID NO: 15 and SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 35, SEQ ID NO: 36 and SEQ ID NO: 37, SEQ ID NO: 38 and SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26, and SEQ ID NO: 27 and SEQ ID NO: 28, as shown in Table 5, respectively. PCR was performed by 35 cycles consisting of denaturation at 95° C. for 1 min; annealing at 55° C. for 1 min; and polymerization reaction at 72° C. for 2 min. The resulting DNA fragments were prepared as a single cassette through overlap extension PCR.

[0131] The cassette thus prepared was introduced into the 0008-1023 strain by a heat shock method, and then colonies were obtained, which were formed on a solid medium (YLMM1) without uracil. Colonies in which cassette insertion into the genome was confirmed using primers of SEQ ID NO: 29 and SEQ ID NO: 30 were plated on a 5-FOA solid medium and cultured at 30° C. for 3 days, and colonies grown on the 5-FOA solid medium were obtained to remove the URA3 marker.TABLE 5SEQ IDNO.Sequence (5′-3′)35CAGCTCATCTATCTTGGCCTCCTGCGGTTAGTACTGCAAAAAGTGC36GCACTTTTTGCAGTACTAACCGCAGGAGGCCAAGATAGATGAGCTG37CTTCGCTCTTGATCTTCGGATAGTCACAATTCGGATAAGTGGTCTATTATATATAAC38GTTATATATAATAGACCACTTATCCGAATTGTGACTATCCGAAGATCAAGAGCGAAGExample 2-4. Preparation of Yarrowia lipolytica-Derived GGS1-Inserted Strain

[0132] To insert the Yarrowia lipolytica-derived GGS1 gene (hereinbelow, referred to as Yl.GGS1) into the chromosome of Yarrowia lipolytica, a polynucleotide of SEQ ID NO: 10 of GGS1 was obtained, based on a nucleotide sequence (YALIOD17050g) registered in the Kyoto Encyclopedia of Genes and Genomes (KEGG). The gene was synthesized using the polynucleotide of Yl.GGS1 in the form of TEFINtp-Yl.GGS1-TDH3t (SEQ ID NO: 11). A cassette to be inserted into the LIG4(YALIOD21384g) gene site was designed using the URA3 gene (SEQ ID NO: 5) of Y. lipolytica as a selection marker.

[0133] PCR was performed for left homologous region, TEFINt promoter, Yl.GGS1 ORF, TDH3 terminator, URA3, repeat region, and right homologous region fragments using the synthesized Yl.GGS1 gene and genomic DNA of KCCM12972P as templates, and primers of SEQ ID NO: 15 and SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 39, SEQ ID NO: 40 and SEQ ID NO: 41, SEQ ID NO: 42 and SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26, and SEQ ID NO: 27 and SEQ ID NO: 28, as shown in Table 6, respectively. PCR was performed by 35 cycles consisting of denaturation at 95° C. for 1 min; annealing at 55° C. for 1 min; and polymerization reaction at 72° C. for 2 min. The resulting DNA fragments were prepared as a single cassette through overlap extension PCR.

[0134] The cassette thus prepared was introduced into the 0008-1023 strain by a heat shock method, and then colonies were obtained, which were formed on a solid medium (YLMM1) without uracil. Colonies in which cassette insertion into the genome was confirmed using primers of SEQ ID NO: 29 and SEQ ID NO: 30 were plated on a 5-FOA solid medium and cultured at 30° C. for 3 days, and colonies grown on the 5-FOA solid medium were obtained to remove the URA3 marker.TABLE 6SEQ IDNO.Sequence (5′-3′)39CTTGAAATCCGCGCTGTTATAATCCTGCGGTTAGTACTGCAAAAAGTGC40GCACTTTTTGCAGTACTAACCGCAGGATTATAACAGCGCGGATTTCAAG41CTTCGCTCTTGATCTTCGGATAGTCACTGCGCATCCTCAAAGTAC42GTACTTTGAGGATGCGCAGTGACTATCCGAAGATCAAGAGCGAAGExample 3. Comparative Evaluation of Beta-Carotene Production Ability, Based on GGPP Synthase-Introduced Strain

[0135] A flask test was performed on a total of 5 species, comprising the strains obtained in Examples 2-1 to 2-4 and the parent strain 0008-1023 obtained in Example 1. The strains were each inoculated at an initial OD of 2 in a 250 ml corner-baffle flask containing 20 ml of Yeast extract-Peptone-Dextrose (YPD) medium and cultured at 30° C. for 48 hours with agitation at 200 rpm. After completion of the culture, 1 ml of the culture broth was centrifuged and the supernatant was removed. The composition of the YPD medium is as follows.<YPD Liquid Media>

[0136] 4% glucose, 1% yeast extract, and 2% peptone dissolved in 0.1 M phosphate buffer (sodium phosphate buffer) (pH 7.0).

[0137] Next, 0.5 ml of dimethyl sulfoxide (DMSO, Sigma, CAS number 67-68-5) was added, and the cells were disrupted by agitation (2,000 rpm) for 10 minutes at 55° C. Additionally, 0.5 ml of acetone (Sigma, CAS number 67-64-1) was added and agitated (2,000 rpm) at 45° C. for 15 minutes to extract beta-carotene and squalene, and concentrations thereof were analyzed using HPLC equipment. The results of measuring the analyzed beta-carotene and squalene concentrations are shown in FIG. 1.

[0138] As a result, as shown in FIG. 1, the beta-carotene concentrations in 0008-1023 (parent strain), Ds.GGPPS-introduced strain, crtEM1-introduced strain, Sc.BTS1-introduced strain, and Yl.GGS1-introduced strain were 5.49 mg / L, 54.74 mg / L, 40.58 mg / L, 5.21 mg / L, and 49.22 mg / L, respectively. In particular, when Ds.GGPPS was introduced, beta-carotene was increased by 49.25 mg / L, as compared to the parent strain, indicating the most excellent effect of increasing beta-carotene carotene.

[0139] Additionally, the squalene concentration was 313.24 mg / L, 211.86 mg / L, 235.27 mg / L, 253.28 mg / L, and 221.22 mg / L, respectively. Similarly, when Ds.GGPPS was introduced, squalene was reduced by 101.38 mg / L, as compared to the 0008-1023 strain, indicating the most excellent effect of reducing squalene.

[0140] Based on these results, it was confirmed that Ds.GGPPS is the most effective as GGPP synthase in microorganisms of the genus Yarrowia. Surprisingly, when the geranylgeranyl pyrophosphate synthase derived from the closely related Saccharomyces cerevisiae, Yarrowia lipolytica, and Xanthophyllomyces dendrorhous was introduced, the effect was insignificant, whereas when the geranylgeranyl pyrophosphate synthase derived from the relatively unrelated Dunaliella salina was introduced, the effect was remarkable.Example 4. Preparation of Beta-Carotene 15,15′Oxygenase(BCO) Gene-Introduced Strain

[0141] To insert the Uncultured marine bacterium 66A03-derived beta-carotene 15,15′oxygenase (hereinbelow, referred to as Mb.BCO) gene into the chromosome of Yarrowia lipolytica, a polynucleotide sequence (SEQ ID NO: 12) was obtained by codon optimization of Mb.BCO to be suitable for Y. lipolytica through http: / / atgme.org, based on an amino acid sequence (Q4PN10) registered in UniProt Knowledgebase (UniProtKB). The gene was synthesized using the polynucleotide of Mb.BCO in the form of TEFINtp-codon optimized Mb.BCO-CYC1t (SEQ ID NO: 13). A cassette to be inserted into the KU70(YALI0C08701g) gene site was designed using the URA3 gene (SEQ ID NO: 5) of Y. lipolytica as a selection marker.

[0142] PCR was performed for left homologous region, TEFINt promoter, Mb.BCO ORF, CYC1 terminator, URA3, repeat region, and right homologous region using the synthesized Mb.BCO and genomic DNA of KCCM12972P as templates, and primers of SEQ ID NO: 43 and SEQ ID NO: 44, SEQ ID NO: 45 and SEQ ID NO: 46, SEQ ID NO: 47 and SEQ ID NO: 48, SEQ ID NO: 49 and SEQ ID NO: 50, SEQ ID NO: 51 and SEQ ID NO: 52, SEQ ID NO: 53 and SEQ ID NO: 54, and SEQ ID NO: 55 and SEQ ID NO: 56, as shown in Table 7, respectively. PCR was performed by 35 cycles consisting of denaturation at 95° C. for 1 min; annealing at 55° C. for 1 min; and polymerization reaction at 72° C. for 2 min. The resulting DNA fragments were prepared as a single cassette through overlap extension PCR.

[0143] The cassette thus prepared was introduced into each of the strains prepared in Examples 2-1 to 2-4 by a heat shock method, and then colonies were obtained, which were formed on a solid medium (YLMM1) without uracil. Colonies in which cassette insertion into the genome was confirmed using primers of SEQ ID NO: 57 and SEQ ID NO: 58 were plated on a 5-FOA solid medium and cultured at 30° C. for 3 days, and colonies grown on the 5-FOA solid medium were obtained to remove the URA3 marker.TABLE 7SEQ ID NO.Sequence (5′-3′)43GGCGTTTCAGGTGGTTGCGTGAGTG44GACACAAATGCGCCGCCAACCCGGTCTCTGCGGCGGTTCGTGGTTCGTGTTTC45GAAACACGAACCACGAACCGCCGCAGAGACCGGGTTGGCGGCGCATTTGTGTC46CAGTCGATCAGCATCAGGCCCTGCGGTTAGTACTGCAAAA47TTTTGCAGTACTAACCGCAGGGCCTGATGCTGATCGACTG48AACTAATTACATGACTCGAGCTAGTTCTTGATCTTGATTC49GAATCAAGATCAAGAACTAGCTCGAGTCATGTAATTAGTT50GACGAGTCAGACAGGAGGCAGCAAATTAAAGCCTTCGAGCGTCCC51GGGACGCTCGAAGGCTTTAATTTGCTGCCTCCTGTCTGACTCGTC52AACTAATTACATGACTCGAGTGGTGGTATTGTGACTGGGG53CCCCAGTCACAATACCACCACTCGAGTCATGTAATTAGTT54GCAGCAGTCATACATGTTCTGAGGCAAATTAAAGCCTTCGAGCGTCCC55GGGACGCTCGAAGGCTTTAATTTGCCTCAGAACATGTATGACTGCTGC56CTACTTTGTGCAGATTGAGGCCAAG57GTCGTCTGTCTTCTCTTCAG58CCACCAAGATGGGCAAGAAGExample 5. Comparative Evaluation of Retinol Production Ability of Beta-Carotene 15,15′Oxygenase(BCO) Gene-Introduced Strain

[0144] A flask test was performed on a total of 5 species, comprising the strain obtained in Example 4 and the parent strain 0008-1023 obtained in Example 1. The strains were each inoculated at an initial OD of 2 in a 250 ml corner-baffle flask containing 20 ml of Yeast extract-Peptone-Dextrose (YPD) medium and 0.05% butylated hydroxytoluene, and cultured at 30° C. for 48 hours with agitation at 200 rpm. After completion of the culture, 1 ml of the culture medium was centrifuged and the supernatant was removed. Next, 0.5 ml of dimethyl sulfoxide (DMSO, Sigma) was added, and the cells were disrupted by agitation (2,000 rpm) for 10 minutes at 55° C. Additionally, 0.5 ml of acetone (Sigma) was added and agitated (2,000 rpm) at 45° C. for 15 minutes to extract retinol, retinal, beta-carotene, and squalene, and concentrations thereof were analyzed using HPLC equipment. The results of measuring the analyzed retinol, retinal, beta-carotene, and squalene concentrations are shown in FIG. 2.

[0145] As a result, as shown in FIG. 2, retinol was not measured in the strain prepared by introducing Mb.BCO into the 0008-1023 strain. In contrast, the retinol concentrations in four types of strains into which Mb.BCO was introduced after introducing each of Ds.GGPPS, crtEM1, Sc.BTS1, and Yl,GGS1, based on 0008-1023, were 5.88 mg / L, 2.78 mg / L, 0 mg / L, and 4.35 mg / L, respectively.

[0146] The beta-carotene concentrations in the five types of strains were 3.68 mg / L, 0.63 mg / L, 2.47 mg / L, 3.58 mg / L, and 0.98 mg / L, respectively, indicating that beta-carotene was converted to retinol, resulting in the low beta-carotene concentration. In addition, the squalene concentrations in the five types of strains were 309.88 mg / L, 233.52 mg / L, 282.19 mg / L, 306.34 mg / L, and 269.18 mg / L, respectively.

[0147] These results confirmed that the enhancement of GGPP biosynthesis had a positive effect on increasing the retinol productivity.

[0148] The above results also verified that Ds.GGGPS has the excellent effects on beta-carotene production, squalene reduction, and retinol production.

[0149] Based on the above description, it will be understood by those skilled in the art that the present disclosure may be implemented in a different specific form without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the above embodiment is not limitative, but illustrative in all aspects. The scope of the disclosure is defined by the appended claims rather than by the description preceding them, and therefore all changes and modifications that fall within metes and bounds of the claims, or equivalents of such metes and bounds are therefore intended to be embraced by the claims.

[0150] Each sequence according to SEQ ID NO. of the present disclosure is shown in Table 8 below.TABLE 8SEQIDNO.NameSequenceType 1codonatggctgccc accagatgca gctcctaaac tcccagcgat tgtgctctac ctcgacgcgt60DNAoptimizedagtattagac ctgctgtcag caaccgaccc caggtgccac gcaggcctgc caacgtgaga120Ds.GGPPScgggggcgtt accaggcctg ccgaaccatg gccatcgcca ctgcagatga ggccaagcag180ORFtctacttcgt ccttcgattt ccagggctac atgatggagc gggccgtgat ggtcaatgat240gccctcgaca aggctcttcc gcaaagacac cctgaggttt tactggacgc catgcgttat300tcacttctcg ctggaggcaa aagagttcgg ccggctctca cactcgccgc ttgtgagttg360gtgggcggcg atattgcatg tgccatgccc accgcatgcg ctatggaagt cgtgcatacc420atgtctttga tccacgatga tctgccctcc atggataatg acgactttcg gcgaggtcga480ccaacaaacc acaaggtcta cggagaggat attgcgatat tagccggcga cgcgctattg540tcgtttgcct ttgagcacgt agcacgcgct accaccggta ctagccctga acgagtactc600cgagtgattc ttgagctcgg caaggccgtt ggtgcagacg ggctgactgg tggacaggtg660gtggacatca agtctgagaa cgaggaagtg ggcctggagg ttctgcaata catccatgag720cataaaacag cggccctgct cgaagcctca gtcgtttgtg gagcactggt cggtggagcg780gacgatgtga ctgttgagaa actgcgaaag tacgctcgaa acattggcct ggccttccaa840gttgtcgacg acatccttga ctgcacccag acgaccgaga tgctgggaaa gacggcggga900aaggacattg acgtcaacaa aaccacgtac cccaagctgc tgggtctcga aaagtccaag960caggcagctg aagacctcat tgctgaggct atccagcagc tggacggctt cccccccgag1020aagcgaactc ctcttgtggc tcttgctaag tatatcggat accgacagaa ctga 2TEFINtpagagaccggg ttggcggcgc atttgtgtcc caaaaaacag ccccaattgc cccaattgac60DNAcccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttctcc ccacatatca120aacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta180cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac240gcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa300aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca360cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaaatgg tgagtttcag420aggcagcagc aattgccacg ggctttgagc acacggccgg gtgtggtccc attcccatcg480acacaagacg ccacgtcatc cgaccagcac tttttgcagt actaaccgca g 3TDH3tctatccgaag atcaagagcg aagcaagttg taagtccagg acatgtttcc cgcccacgcg60DNAagtgatttat aacacctctc ttttttgaca cccgctcgcc ttgaaattca tgtcacataa120attatagtca acgacgtttg aataacttgt cttgtagttc gatgatgatc atatgattac180attaatagta attactgtat ttgatatata tactaattac aatagtacat attagaacat240acaatagtta gtgccgtgaa gtggcttaaa ataccgcgag tcgattacgt aatattatat300ataatgtcaa agtggggtcc cagagccgaa gaaaatgttg ttcttgaaga tcccagtgta360ttggacaagt atatctgtct ctatgattgt ttttccaggt gaaggtgctt aacaaagtgt420ctactggagt ttgtaagcgc tggtgcgact ggggccactt ttaaaacccg ccttagcagg480ctttttcacc gttccaagac 4TEFINtp-agagaccggg ttggcggcgc atttgtgtcc caaaaaacag ccccaattgc cccaattgac60DNAcodoncccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttctcc ccacatatca120optimizedaacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta180Ds.GGPPS-cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac240TDH3tgcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa300aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca360cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaaatgg tgagtttcag420aggcagcagc aattgccacg ggctttgagc acacggccgg gtgtggtccc attcccatcg480acacaagacg ccacgtcatc cgaccagcac tttttgcagt actaaccgca ggctgcccac540cagatgcagc tcctaaactc ccagcgattg tgctctacct cgacgcgtag tattagacct600gctgtcagca accgacccca ggtgccacgc aggcctgcca acgtgagacg ggggcgttac660caggcctgcc gaaccatggc catcgccact gcagatgagg ccaagcagtc tacttcgtcc720ttcgatttcc agggctacat gatggagcgg gccgtgatgg tcaatgatgc cctcgacaag780gctcttccgc aaagacaccc tgaggtttta ctggacgcca tgcgttattc acttctcgct840ggaggcaaaa gagttcggcc ggctctcaca ctcgccgctt gtgagttggt gggcggcgat900attgcatgtg ccatgcccac cgcatgcgct atggaagtcg tgcataccat gtctttgatc960cacgatgatc tgccctccat ggataatgac gactttcggc gaggtcgacc aacaaaccac1020aaggtctacg gagaggatat tgcgatatta gccggcgacg cgctattgtc gtttgccttt1080gagcacgtag cacgcgctac caccggtact agccctgaac gagtactccg agtgattctt1140gagctcggca aggccgttgg tgcagacggg ctgactggtg gacaggtggt ggacatcaag1200tctgagaacg aggaagtggg cctggaggtt ctgcaataca tccatgagca taaaacagcg1260gccctgctcg aagcctcagt cgtttgtgga gcactggtcg gtggagcgga cgatgtgact1320gttgagaaac tgcgaaagta cgctcgaaac attggcctgg ccttccaagt tgtcgacgac1380atccttgact gcacccagac gaccgagatg ctgggaaaga cggcgggaaa ggacattgac1440gtcaacaaaa ccacgtaccc caagctgctg ggtctcgaaa agtccaagca ggcagctgaa1500gacctcattg ctgaggctat ccagcagctg gacggcttcc cccccgagaa gcgaactcct1560cttgtggctc ttgctaagta tatcggatac cgacagaact gactatccga agatcaagag1620cgaagcaagt tgtaagtcca ggacatgttt cccgcccacg cgagtgattt ataacacctc1680tcttttttga cacccgctcg ccttgaaatt catgtcacat aaattatagt caacgacgtt1740tgaataactt gtcttgtagt tcgatgatga tcatatgatt acattaatag taattactgt1800atttgatata tatactaatt acaatagtac atattagaac atacaatagt tagtgccgtg1860aagtggctta aaataccgcg agtcgattac gtaatattat atataatgtc aaagtggggt1920cccagagccg aagaaggtgc ttttcttgaa gatcccagtg tattggacaa gtatatctgt1980ctctatgatt gtttttccag gtgaaaatgt tgaacaaagt gtctactgga gtttgtaagc2040gctggtgcga ctggggccac ttttaaaacc cgccttagca ggctttttca ccgttccaag2100ac 5URA3tgcctcctgt ctgactcgtc attgccgcct ttggagtacg actccaacta tgagtgtgct60DNAtggatcactt tgacgataca ttcttcgttg gaggctgtgg gtctgacagc tgcgttttcg120gcgcggttgg ccgacaacaa tatcagctgc aacgtcattg ctggctttca tcatgatcac180atttttgtcg gcaaaggcga cgcccagaga gccattgacg ttctttctaa tttggaccga240tagccgtata gtccagtcta tctataagtt caactaactc gtaactatta ccataacata300tacttcactg ccccagataa ggttccgata aaaagttctg cagactaaat ttatttcagt360ctcctcttca ccaccaaaat gccctcctac gaagctcgag ctaacgtcca caagtccgcc420tttgccgctc gagtgctcaa gctcgtggca gccaagaaaa ccaacctgtg tgcttctctg480gatgttacca ccaccaagga gctcattgag cttgccgata aggtcggacc ttatgtgtgc540atgatcaaga cccatatcga catcattgac gacttcacct acgccggcac tgtgctcccc600ctcaaggaac ttgctcttaa gcacggtttc ttcctgttcg aggacagaaa gttcgcagat660attggcaaca ctgtcaagca ccagtacaag aacggtgtct accgaatcgc cgagtggtcc720gatatcacca acgcccacgg tgtacccgga accggaatca ttgctggcct gcgagctggt780gccgaggaaa ctgtctctga acagaagaag gaggacgtct ctgactacga gaactcccag840tacaaggagt tcctggtccc ctctcccaac gagaagctgg ccagaggtct gctcatgctg900gccgagctgt cttgcaaggg ctctctggcc actggcgagt actccaagca gaccattgag960cttgcccgat ccgaccccga gtttgtggtt ggcttcattg cccagaaccg acctaagggc1020gactctgagg actggcttat tctgaccccc ggggtgggtc ttgacgacaa gggagacgct1080ctcggacagc agtaccgaac tgttgaggat gtcatgtcta ccggaacgga tatcataatt1140gtcggccgag gtctgtacgg ccagaaccga gatcctattg aggaggccaa gcgataccag1200aaggctggct gggaggctta ccagaagatt aactgttaga ggttagacta tggatatgtc1260atttaactgt gtatatagag agcgtgcaag tatggagcgc ttgttcagct tgtatgatgg1320tcagacgacc tgtctgatcg agtatgtatg atactgcaca acctgtgtat ccgcatgatc1380tgtccaatgg ggcatgttgt tgtgtttctc gatacggaga tgctgggtac aagtagctaa1440tacgattgaa ctacttatac ttatatgagg cttgaagaaa gctgacttgt gtatgactta1500ttctcaacta catccccagt cacaatacca cca 6Codonatggattacg cgaacatcct cacagcaatt ccactcgagt ttactcctca ggatgatatc60DNAoptimizedgtgctccttg aaccgtatca ctacctagga aagaaccctg gaaaagaaat tcgatcacaa120crtEM1ctcatcgagg ctttcaacta ttggttggat gtcaagaagg aggatctcga ggtcatccag180ORFaacgttgttg gcatgctaca taccgctagc ttattaatgg acgatgtgga ggattcatcg240gtcctcaggc gtgggtcgcc tgtagcccat ctaatttacg ggattccgca gacaataaac300actgcaaact acgtctactt tctggcttat caagagatct tcaagcttcg cccaacaccg360atacccatgc ctgtaattcc tccttcatct gcttcgcttc aatcaaccgt ctcctctgca420tcctcctcct cctcggcctc gtctgaaaac gggggcacgt catctcctaa ttcgcagatt480ccgttctcga aagatacgta tcttgataaa gtgatcacag acgagatgct ttccctccat540agagggcaag gcctggagct attctggaga gatagtctga cgtgtcctag cgaagaggaa600tatgtgaaaa tggttcttgg aaagacggga ggtttgttcc gtatagcggt cagattgatg660atggcaaagt cagaatgtga catagacttt gtccagcttg tcaacttgat ctcaatatac720ttccagatca gggatgacta tatgaacctt cagtcttctg agtatgccca tattaagaat780tttgcagagg acctcacaga aggaaaattc agttttccca ctatccactc gattcgtgcc840aacccctcat cgagactcgt catcaatacg ttgcagaaga aatcgacctc tcctgagatc900cttcaccact gtgtaaacta catgcgcaca gaaacccact cattcgaata tactcaggaa960gtcctcaaca ccttgtcagg tgcactcgag agagaactag gaaggcttca aggagagttc1020gcagaagcta actcaaagat tgatcttgga gacgtagagt cggaaggaag aacggggaag1080aacgtcaaat tggaagcgat cctgaaaaag ctagccgata tccctctgtg a 7TEFINtp-agagaccggg ttggcggcgc atttgtgtcc caaaaaacag ccccaattgc cccaattgac60DNAcodoncccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttctcc ccacatatca120optimizedaacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta180crtEM1-cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac240TDH3tgcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa300aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca360cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaaatgg tgagtttcag420aggcagcagc aattgccacg ggctttgagc acacggccgg gtgtggtccc attcccatcg480acacaagacg ccacgtcatc cgaccagcac tttttgcagt actaaccgca ggattacgcg540aacatcctca cagcaattcc actcgagttt actcctcagg atgatatcgt gctccttgaa600ccgtatcact acctaggaaa gaaccctgga aaagaaattc gatcacaact catcgaggct660ttcaactatt ggttggatgt caagaaggag gatctcgagg tcatccagaa cgttgttggc720atgctacata ccgctagctt attaatggac gatgtggagg attcatcggt cctcaggcgt780gggtcgcctg tagcccatct aatttacggg attccgcaga caataaacac tgcaaactac840gtctactttc tggcttatca agagatcttc aagcttcgcc caacaccgat acccatgcct900gtaattcctc cttcatctgc ttcgcttcaa tcaaccgtct cctctgcatc ctcctcctcc960tcggcctcgt ctgaaaacgg gggcacgtca tctcctaatt cgcagattcc gttctcgaaa1020gatacgtatc ttgataaagt gatcacagac gagatgcttt ccctccatag agggcaaggc1080ctggagctat tctggagaga tagtctgacg tgtcctagcg aagaggaata tgtgaaaatg1140gttcttggaa agacgggagg tttgttccgt atagcggtca gattgatgat ggcaaagtca1200gaatgtgaca tagactttgt ccagcttgtc aacttgatct caatatactt ccagatcagg1260gatgactata tgaaccttca gtcttctgag tatgcccata ttaagaattt tgcagaggac1320ctcacagaag gaaaattcag ttttcccact atccactcga ttcgtgccaa cccctcatcg1380agactcgtca tcaatacgtt gcagaagaaa tcgacctctc ctgagatcct tcaccactgt1440gtaaactaca tgcgcacaga aacccactca ttcgaatata ctcaggaagt cctcaacacc1500ttgtcaggtg cactcgagag agaactagga aggcttcaag gagagttcgc agaagctaac1560tcaaagattg atcttggaga cgtagagtcg gaaggaagaa cggggaagaa cgtcaaattg1620gaagcgatcc tgaaaaagct agccgatatc cctctgtgac tatccgaaga tcaagagcga1680agcaagttgt aagtccagga catgtttccc gcccacgcga gtgatttata acacctctct1740tttttgacac ccgctcgcct tgaaattcat gtcacataaa ttatagtcaa cgacgtttga1800ataacttgtc ttgtagttcg atgatgatca tatgattaca ttaatagtaa ttactgtatt1860tgatatatat actaattaca atagtacata ttagaacata caatagttag tgccgtgaag1920tggcttaaaa taccgcgagt cgattacgta atattatata taatgtcaaa gtggggtccc1980agagccgaag aaggtgcttt tcttgaagat cccagtgtat tggacaagta tatctgtctc2040tatgattgtt tttccaggtg aaaatgttga acaaagtgtc tactggagtt tgtaagcgct2100ggtgcgactg gggccacttt taaaacccgc cttagcaggc tttttcaccg ttccaagac 8Sc.BTS1atggaggcca agatagatga gctgatcaat aatgatcctg tttggtccag ccaaaatgaa60DNAORFagcttgattt caaaacctta taatcacatc cttttgaaac ctggcaagaa ctttagacta120aatttaatag ttcaaattaa cagagttatg aatttgccca aagaccagct ggccatagtt180tcgcaaattg ttgagctctt gcataattcc agccttttaa tcgacgatat agaagataat240gctcccttga gaaggggaca gaccacttct cacttaatct tcggtgtacc ctccactata300aacaccgcaa attatatgta tttcagagcc atgcaacttg tatcgcagct aaccacaaaa360gagcctttgt atcataattt gattacgatt ttcaacgaag aattgatcaa tctacatagg420ggacaaggct tggatatata ctggagagac tttctgcctg aaatcatacc tactcaggag480atgtatttga atatggttat gaataaaaca ggcggccttt tcagattaac gttgagactc540atggaagcgc tgtctccttc ctcacaccac ggccattcgt tggttccttt cataaatctt600ctgggtatta tttatcagat tagagatgat tacttgaatt tgaaagattt ccaaatgtcc660agcgaaaaag gctttgctga ggacattaca gaggggaagt tatcttttcc catcgtccac720gcccttaact tcactaaaac gaaaggtcaa actgagcaac acaatgaaat tctaagaatt780ctcctgttga ggacaagtga taaagatata aaactaaagc tgattcaaat actggaattc840gacaccaatt cattggccta caccaaaaat tttattaatc aattagtgaa tatgataaaa900aatgataatg aaaataagta tttacctgat ttggcttcgc attccgacac cgccaccaat960ttacatgacg aattgttata tataatagac cacttatccg aattgtga 9TEFINtp-agagaccggg ttggcggcgc atttgtgtcc caaaaaacag ccccaattgc cccaattgac60DNASc.BTS1-cccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttctcc ccacatatca120TDH3taacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta180cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac240gcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa300aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca360cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaaatgg tgagtttcag420aggcagcagc aattgccacg ggctttgagc acacggccgg gtgtggtccc attcccatcg480acacaagacg ccacgtcatc cgaccagcac tttttgcagt actaaccgca ggaggccaag540atagatgagc tgatcaataa tgatcctgtt tggtccagcc aaaatgaaag cttgatttca600aaaccttata atcacatcct tttgaaacct ggcaagaact ttagactaaa tttaatagtt660caaattaaca gagttatgaa tttgcccaaa gaccagctgg ccatagtttc gcaaattgtt720gagctcttgc ataattccag ccttttaatc gacgatatag aagataatgc tcccttgaga780aggggacaga ccacttctca cttaatcttc ggtgtaccct ccactataaa caccgcaaat840tatatgtatt tcagagccat gcaacttgta tcgcagctaa ccacaaaaga gcctttgtat900cataatttga ttacgatttt caacgaagaa ttgatcaatc tacatagggg acaaggcttg960gatatatact ggagagactt tctgcctgaa atcataccta ctcaggagat gtatttgaat1020atggttatga ataaaacagg cggccttttc agattaacgt tgagactcat ggaagcgctg1080tctccttcct cacaccacgg ccattcgttg gttcctttca taaatcttct gggtattatt1140tatcagatta gagatgatta cttgaatttg aaagatttcc aaatgtccag cgaaaaaggc1200tttgctgagg acattacaga ggggaagtta tcttttccca tcgtccacgc ccttaacttc1260actaaaacga aaggtcaaac tgagcaacac aatgaaattc taagaattct cctgttgagg1320acaagtgata aagatataaa actaaagctg attcaaatac tggaattcga caccaattca1380ttggcctaca ccaaaaattt tattaatcaa ttagtgaata tgataaaaaa tgataatgaa1440aataagtatt tacctgattt ggcttcgcat tccgacaccg ccaccaattt acatgacgaa1500ttgttatata taatagacca cttatccgaa ttgtgactat ccgaagatca agagcgaagc1560aagttgtaag tccaggacat gtttcccgcc cacgcgagtg atttataaca cctctctttt1620ttgacacccg ctcgccttga aattcatgtc acataaatta tagtcaacga cgtttgaata1680acttgtcttg tagttcgatg atgatcatat gattacatta atagtaatta ctgtatttga1740tatatatact aattacaata gtacatatta gaacatacaa tagttagtgc cgtgaagtgg1800cttaaaatac cgcgagtcga ttacgtaata ttatatataa tgtcaaagtg gggtcccaga1860gccgaagaag gtgcttttct tgaagatccc agtgtattgg acaagtatat ctgtctctat1920gattgttttt ccaggtgaaa atgttgaaca aagtgtctac tggagtttgt aagcgctggt1980gcgactgggg ccacttttaa aacccgcctt agcaggcttt ttcaccgttc caagac10YI.GGS1atggattata acagcgcgga tttcaaggag atatggggca aggccgccga caccgcgctg60DNAORFctgggaccgt acaactacct cgccaacaac cggggccaca acatcagaga acacttgatc120gcagcgttcg gagcggttat caaggtggac aagagcgatc tcgagaccat ttcgcacatc180accaagattt tgcataactc gtcgctgctt gttgatgacg tggaagacaa ctcgatgctc240cgacgaggcc tgccggcagc ccattgtctg tttggagtcc cccaaaccat caactccgcc300aactacatgt actttgtggc tctgcaggag gtgctcaagc tcaagtctta tgatgccgtc360tccattttca ccgaggaaat gatcaacttg catagaggtc agggtatgga tctctactgg420agagaaacac tcacttgccc ctcggaagac gagtatctgg agatggtggt gcacaagacc480ggtggactgt ttcggctggc tctgagactt atgctgtcgg tggcatcgaa acggaattga540catgaaaaga tcaactttga tctcacacac cttaccgaca cactgggagt catttaccag600attctggatg attacctcaa cctgcagtcc acaggaggac ccgagaacaa gggattctgc660gaagatatca gcgaaggaaa gttttcgttt ccgctgattc acagcatacg caccaacccg720gataaccacg agattctcaa cattctcaaa cagcgaacaa gcgacgcttc actcaaaaag780tacgccgtgg actacatgag aacagaaacc aagagtttcg actactgcct caagaggata840caggccatgt cactcaaggc aagttcgtac attgatgatc tagcagcagc tggccacgat900gtctccaagc tacgagccat tttgcattat tttgtgtcca cctctgactg tgaggagaga960aagtactttg aggatgcgca gtga11TEFINtp-agagaccggg ttggcggcgc atttgtgtcc caaaaaacag ccccaattgc cccaattgac60DNAYI.GGS1-cccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttctcc ccacatatca120TDH3taacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta180cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac240gcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa300aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca360cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaaatgg tgagtttcag420aggcagcagc aattgccacg ggctttgagc acacggccgg gtgtggtccc attcccatcg480acacaagacg ccacgtcatc cgaccagcac tttttgcagt actaaccgca ggattataac540agcgcggatt tcaaggagat atggggcaag gccgccgaca ccgcgctgct gggaccgtac600aactacctcg ccaacaaccg gggccacaac atcagagaac acttgatcgc agcgttcgga660gcggttatca aggtggacaa gagcgatctc gagaccattt cgcacatcac caagattttg720cataactcgt cgctgcttgt tgatgacgtg gaagacaact cgatgctccg acgaggcctg780ccggcagccc attgtctgtt tggagtcccc caaaccatca actccgccaa ctacatgtac840tttgtggctc tgcaggaggt gctcaagctc aagtcttatg atgccgtctc cattttcacc 900gaggaaatga tcaacttgca tagaggtcag ggtatggatc tctactggag agaaacactc960acttgcccct cggaagacga gtatctggag atggtggtgc acaagaccgg tggactgttt1020cggctggctc tgagacttat gctgtcggtg gcatcgaaac aggaggacca tgaaaagatc1080aactttgatc tcacacacct taccgacaca ctgggagtca tttaccagat tctggatgat1140tacctcaacc tgcagtccac ggaattgacc gagaacaagg gattctgcga agatatcagc1200gaaggaaagt tttcgtttcc gctgattcac agcatacgca ccaacccgga taaccacgag1260attctcaaca ttctcaaaca gcgaacaagc gacgcttcac tcaaaaagta cgccgtggac1320tacatgagaa cagaaaccaa gagtttcgac tactgcctca agaggataca ggccatgtca1380ctcaaggcaa gttcgtacat tgatgatcta gcagcagctg gccacgatgt ctccaagcta1440cgagccattt tgcattattt tgtgtccacc tctgactgtg aggagagaaa gtactttgag1500gatgcgcagt gactatccga agatcaagag cgaagcaagt tgtaagtcca ggacatgttt1560cccgcccacg cgagtgattt ataacacctc tcttttttga cacccgctcg ccttgaaatt1620catgtcacat aaattatagt caacgacgtt tgaataactt gtcttgtagt tcgatgatga1680tcatatgatt acattaatag taattactgt atttgatata tatactaatt acaatagtac1740atattagaac atacaatagt tagtgccgtg aagtggctta aaataccgcg agtcgattac1800gtaatattat atataatgtc aaagtggggt cccagagccg aagaaggtgc ttttcttgaa1860gatcccagtg tattggacaa gtatatctgt ctctatgatt gtttttccag gtgaaaatgt1920tgaacaaagt gtctactgga gtttgtaagc gctggtgcga ctggggccac ttttaaaacc1980cgccttagca ggctttttca ccgttccaag ac12Codonatgggcctga tgctgatcga ctggtgtgcc ctggccctgg tggtgttcat cggcctgccc60DNAoptimizedcacggcgccc tggacgccgc catctctttc tctatgatct cttctgccaa gcgaatcgcc120Mb.BCOcgactggccg gcatcctgct gatctacctg ctgctggcca ccgccttctt cctgatctgg180ORFtaccagctgc ccgccttctc tctgctgatc ttcctgctga tctctatcat ccacttcggc240atggccgact tcaacgcctc tccctctaag ctgaagtggc cccacatcat cgcccacggc300gcccctgatc ggcgtggtga ccgtgtggct cagaagaacg aggtgaccaa gctgttctct360atcctgacca acggccccac ccccatcctg tgggacatcc tgctgatctt cttcctgtgt420tggtctatcg gcgtgtgtct gcacacctac gagaccctgc gatctaagca ctacaacatc480gccttcgagc tgatcggcct gatcttcctg gcctggtacg ccccccccct ggtgaccttc540gccacctact tctgtttcat ccactctcga cgacacttct ctttcgtgtg gaagcagctg600cagcacatgt cttctaagaa gatgatgatc ggctctgcca tcatcctgtc ttgtacctct660tggctgatcg gcggcggcat ctacttcttc ctgaactcta agatgatcgc ctctgaggcc720gccctgcaga ccgtgttcat cggcctggcc gccctgaccg tgccccacat gatcctgatc780gacttcatct tccgacccca ctcttctcga atcaagatca agaactag13CYC1tctcgagtcat gtaattagtt atgtcacgct tacattcacg ccctcccccc acatccgctc60DNAtaaccgaaaa ggaaggagtt agacaacctg aagtctaggt ccctatttat ttttttatag120ttatgttagt attaagaacg ttatttatat ttcaaatttt tctttttttt ctgtacaga180gcgtgtacgc atgtaacatt atactgaaaa ccttgcttga gaaggttttg ggacgctcga 240aggctttaat ttgc14TEFINtp-agagaccggg ttggcggcgc atttgtgtcc caaaaaacag ccccaattgc cccaattgac60DNAcodoncccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttctcc ccacatatca120optimizedaacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta180Mb.BCO-cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac240CYC1tgcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa300aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca360cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaaatgg tgagtttcag420aggcagcagc aattgccacg ggctttgagc acacggccgg gtgtggtccc attcccatcg480acacaagacg ccacgtcatc cgaccagcac tttttgcagt actaaccgca gggcctgatg540ctgatcgact ggtgtgccct ggccctggtg gtgttcatcg gcctgcccca cggcgccctg600gacgccgcca tctctttctc tatgatctct tctgccaagc gaatcgcccg actggccggc660atcctgctga tctacctgct gctggccacc gccttcttcc tgatctggta ccagctgccc720gccttctctc tgctgatctt cctgctgatc tctatcatcc acttcggcat ggccgacttc780aacgcctctc cctctaagct gaagtggccc cacatcatcg cccacggcgg cgtggtgacc840gtgtggctgc ccctgatcca gaagaacgag gtgaccaagc tgttctctat cctgaccaac900ggccccaccc ccatcctgtg ggacatcctg ctgatcttct tcctgtgttg gtctatcggc960gtgtgtctgc acacctacga gaccctgcga tctaagcact acaacatcgc cttcgagctg1020atcggcctga tcttcctggc ctggtacgcc ccccccctgg tgaccttcgc cacctacttc1080tgtttcatcc actctcgacg acacttctct ttcgtgtgga agcagctgca gcacatgtct1140tctaagaaga tgatgatcgg ctctgccatc atcctgtctt gtacctcttg gctgatcggc1200ggcggcatct acttcttcct gaactctaag atgatcgcct ctgaggccgc cctgcagacc1260gtgttcatcg gcctggccgc cctgaccgtg ccccacatga tcctgatcga cttcatcttc1320cgaccccact cttctcgaat caagatcaag aactagctcg agtcatgtaa ttagttatgt1380cacgcttaca ttcacgccct ccccccacat ccgctctaac cgaaaaggaa ggagttagac1440aacctgaagt ctaggtccct atttattttt ttatagttat gttagtatta agaacgttat1500ttatatttca aatttttctt ttttttctgt acagacgcgt gtacgcatgt aacattatac1560tgaaaacctt gcttgagaag gttttgggac gctcgaaggc tttaatttgc15primercatcatttca aaagagggaa cagcDNA16primercgccgccaac ccggtctctg tgtttggcgg tgtgagttgt cDNA17primergacaactcac accgccaaac acagagaccg ggttggcggc gDNA18primeragctgcatct ggtgggcagc ctgcggttag tactgcaaaa agtgcDNA19primergcactttttg cagtactaac cgcaggctgc ccaccagatg cagctDNA20primercgctcttgat cttcggatag tcagttctgt cggtatccgaDNA21primertcggataccg acagaactga ctatccgaag atcaagagcgDNA22primergacgagtcag acaggaggca gtcttggaac ggtgaaaaag cctgcDNA23primergcaggctttt tcaccgttcc aagactgcct cctgtctgac tcgtcDNA24primercgctcttgat cttcggatag tggtggtatt gtgactgggg aDNA25primertccccagtca caataccacc actatccgaa gatcaagagc gDNA26primercatatggagt gttatttgaa ggggtcttgg aacggtgaaa aagcctgcDNA27primergcaggctttt tcaccgttcc aagacccctt caaataacac tccatatgDNA28primerccgatacagt gtccaagtac gDNA29primergagtgtctga agacaaggct tcDNA30primergacgacaatg ctgagctccgDNA31primerctgtgaggat gttcgcgtaa tcctgcggtt agtactgcaa aaagtgcDNA32primergcactttttg cagtactaac cgcaggatta cgcgaacatc ctcacagDNA33primercttcgctctt gatcttcgga tagtcacaga gggatatcgg ctagDNA34primerctagccgata tccctctgtg actatccgaa gatcaagagc gaagDNA35primercagctcatct atcttggcct cctgcggtta gtactgcaaa aagtgcDNA36primergcactttttg cagtactaac cgcaggaggc caagatagat gagctgDNA37primercttcgctctt gatcttcgga tagtcacaat tcggataagt ggtctattatDNAatataac38primergttatatata atagaccact tatccgaatt gtgactatcc gaagatcaagDNAagcgaag39primercttgaaatcc gcgctgttat aatcctgcgg ttagtactgc aaaaagtgcDNA40primergcactttttg cagtactaac cgcaggatta taacagcgcg gatttcaagDNA41primercttcgctctt gatcttcgga tagtcactgc gcatcctcaa agtacDNA42primergtactttgag gatgcgcagt gactatccga agatcaagag cgaagDNA43primerggcgtttcag gtggttgcgt gagtgDNA44primergacacaaatg cgccgccaac ccggtctctg cggcggttcgDNAtggttcgtgt ttc45primergaaacacgaa ccacgaaccg ccgcagagac cgggttggcgDNAgcgcatttgt gtc46primercagtcgatca gcatcaggcc ctgcggttag tactgcaaaaDNA47primerttttgcagta ctaaccgcag ggcctgatgc tgatcgactgDNA48primeraactaattac atgactcgag ctagttcttg atcttgattcDNA49primergaatcaagat caagaactag ctcgagtcat gtaattagttDNA50primergacgagtcag acaggaggca gcaaattaaa gccttcgagc gtcccDNA51primergggacgctcg aaggctttaa tttgctgcct cctgtctgac tcgtcDNA52primeraactaattac atgactcgag tggtggtatt gtgactggggDNA53primerccccagtcac aataccacca ctcgagtcat gtaattagttDNA54primergcagcagtca tacatgttct gaggcaaatt aaagccttcg agcgtcccDNA55primergggacgctcg aaggctttaa tttgcctcag aacatgtatg actgctgcDNA56primerctactttgtg cagattgagg ccaagDNA57primergtcgtctgtc ttctcttcagDNA58primerccaccaagat gggcaagaagDNA59crtYBatgacggctc tcgcatatta ccagatccat ctgatctata ctctcccaat tcttggtctt60DNActcggcctgc tcacttcccc gattttgaca aaatttgaca tctacaaaat atcgatcctc120gtatttattg cgtttagtgc aaccacacca tgggactcat ggatcatcag aaatggcgca180tggacatatc catcagcgga gagtggccaa ggcgtgtttg gaacgtttct agatgttcca240tatgaagagt acgctttctt tgtcattcaa accgtaatca ccggcttggt ctacgtcttg300gcaactaggc accttctccc atctctcgcg cttcccaaga ctagatcgtc cgccctttct360ctcgcgctca aggcgctcat ccctctgccc attatctacc tatttaccgc tcaccccagc420ccatcgcccg acccgctcgt gacagatcac tacttctaca tgcgggcact ctccttactc480atcaccccac ctaccatgct cttggcagca ttatcaggcg aatatgcttt cgattggaaa540agtggccgag caaagtcaac tattgcagca atcatgatcc cgacggtgta tctgatttgg600gtagattatg ttgctgtcgg tcaagactct tggtcgatca acgatgagaa gattgtaggg660tggaggcttg gaggtgtact acccattgag gaagctatgt tcttcttact gacgaatcta720atgattgttc tgggtctgtc tgcctgcgat catactcagg ccctatacct gctacacggt780cgaactattt atggcaacaa aaagatgcca tcttcatttc ccctcattac accgcctgtg840ctctccctgt tttttagcag ccgaccatac tcttctcagc caaaacgtga cttggaactg900gcagtcaagt tgttggagga aaagagccgg agcttttttg ttgcctcggc tggatttcct960agcgaagtta gggagaggct ggttggacta tacgcattct gccgggtgac tgatgatctt1020atcgactctc ctgaagtatc ttccaacccg catgccacaa ttgacatggt ctccgatttt1080cttaccctac tatttgggcc cccgctacac ccttcgcaac ctgacaagat cctttcttcg1140cctttacttc ctccttcgca cccttcccga cccacgggaa tgtatcccct cccgcctcct1200ccttcgctct cgcctgccga gctcgttcaa ttccttaccg aaagggttcc cgttcaatac1260catttcgcct tcaggttgct cgctaagttg caagggctga tccctcgata cccactcgac1320gaactcctta gaggatacac cactgatctt atctttccct tatcgacaga ggcagtccag1380gctcggaaga cgcctatcga gaccacagct gacttgctgg actatggtct atgtgtagca1440ggctcagtcg ccgagctatt ggtctatgtc tcttgggcaa gtgcaccaag tcaggtccct1500gccaccatag aagaaagaga agctgtgtta gtggcaagcc gagagatggg aactgccctt1560cagttggtga acattgctag ggacattaaa ggggacgcaa cagaagggag attttaccta1620ccactctcat tctttggtct tcgggatgaa tcaaagcttg cgatcccgac tgattggacg1680gaacctcggc ctcaagattt cgacaaactc ctcagtctat ctccttcgtc cacattacca1740tcttcaaacg cctcagaaag cttccggttc gaatggaaga cgtactcgct tccattagtc1800gcctacgcag aggatcttgc caaacattct tataagggaa ttgaccgact tcctaccgag1860gttcaagcgg gaatgcgagc ggcttgcgcg agctacctac tgatcggccg agagatcaaa1920gtcgtttgga aaggagacgt cggagagaga aggacagttg ccggatggag gagagtacgg1980aaagtcttga gtgtggtcat gagcggatgg gaagggcagt aa60crtlatgggaaaag aacaagatca ggataaaccc acagctatca tcgtgggatg tggtatcggt60DNAggaatcgcca ctgccgctcg tcttgctaaa gaaggtttcc aggtcacggt gttcgagaag120aacgactact ccggaggtcg atgctcttta atcgagcgag atggttatcg attcgatcag180gggcccagtt tgctgctctt gccagatctc ttcaagcaga cattcgaaga tttgggagag240aagatggaag attgggtcga tctcatcaag tgtgaaccca actatgtttg ccacttccac300gatgaagaga ctttcactct ttcaaccgac atggcgttgc tcaagcggga agtcgagcgt360tttgaaggca aagatggatt tgatcggttc ttgtcgttta tccaagaagc ccacagacat420tacgagcttg ctgtcgttca cgtcctgcag aagaacttcc ctggcttcgc agcattctta480cggctacagt tcattggcca aatcctggct cttcacccct tcgagtctat ctggacaaga540gtttgtcgat atttcaagac cgacagatta cgaagagtct tctcgtttgc agtgatgtac600atgggtcaaa gcccatacag tgcgcccgga acatattcct tgctccaata caccgaattg660accgagggca tctggtatcc gagaggaggc ttttggcagg ttcctaatac tcttcttcag720atcgtcaagc gcaacaatcc ctcagccaag ttcaatttca acgctccagt ttcccaggtt780cttctctctc ctgccaagga ccgagcgact ggtgttcgac ttgaatccgg cgaggaacat840cacgccgatg ttgtgattgt caatgctgac ctcgtttacg cctccgagca cttgattcct900gacgatgcca gaaacaagat tggccaactg ggtgaagtca agagaagttg gtgggctgac960ttagttggtg gaaagaagct caagggaagt tgcagtagtt tgagcttcta ctggagcatg1020gaccgaatcg tggacggtct gggcggacac aatatcttct tggccgagga cttcaaggga1080tcattcgaca caatcttcga ggagttgggt ctcccagccg atccttcctt ttacgtgaac1140gttccctcgc gaatcgatcc ttctgccgct cccgaaggca aagatgctat cgtcattctt1200gtgccgtgtg gccatatcga cgcttcgaac cctcaagatt acaacaagct tgttgctcgg1260gcaaggaagt ttgtgatcca cacgctttcc gccaagcttg gacttcccga ctttgaaaaa1320atgattgtgg cagagaaggt tcacgatgct ccctcttggg agaaagaatt caacctcaag1380gacggaagca tcttgggact ggctcacaac tttatgcaag ttcttggttt caggccgagc1440accagacatc ccaagtatga caagttgttc tttgtcgggg cttcgactca tcccggaact1500ggggttccca tcgtcttggc tggagccaag ttaactgcca accaagttct cgaatccttt1560gaccgatccc cagctccaga tcccaatatg tcactctccg taccatatgg aaaacctctc1620aaatcaaatg gaacgggtat cgattctcag gtccagctga agttcatgga tttggagaga1680tgggtatacc ttttggtgtt gttgattggg gccgtgatcg ctcgatccgt tggtgttctt1740gctttctga61TEFINtp-agagaccggg ttggcggcgc atttgtgtcc caaaaaacag ccccaattgc cccaattgac60DNAcrtYB-cccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttctcc ccacatatca120CYC1taacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta180cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac240gcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa300aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca360cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaaatgg tgagtttcag420aggcagcagc aattgccacg ggctttgagc acacggccgg gtgtggtccc attcccatcg480acacaagacg ccacgtcatc cgaccagcac tttttgcagt actaaccgca gacggctctc540gcatattacc agatccatct gatctatact ctcccaattc ttggtcttct cggtctgctc600acttccccga ttttgacaaa atttgacatc tacaaaatat cgatcctcgt atttattgcg660tttagtgcaa ccacaccatg ggactcatgg atcatcagaa atggcgcatg gacatatcca720tcagcggaga gtggccaagg cgtgtttgga acgtttctag atgttccata tgaagagtac780gctttctttg tcattcaaac cgtaatcacc ggcttggtct acgtcttggc aactaggcac840cttctcccat ctctcgcgct tcccaagact agatcgtccg ccctttctct cgcgctcaag900gcgctcatcc ctctgcccat tatctaccta tttaccgctc accccagccc atcgcccgac960ccgctcgtga cagatcacta cttctacatg cgggcactct ccttactcat caccccacct1020accatgctct tggcagcatt atcaggcgaa tatgctttcg attggaaaag tggccgagca1080aagtcaacta ttgcagcaat catgatcccg acggtgtatc tgatttgggt agattatgtt1140gctgtcggtc aagactcttg gtcgatcaac gatgagaaga ttgtagggtg gaggcttgga1200ggtgtactac ccattgagga agctatgttc ttcttactga cgaatctaat gattgttctg1260ggtctgtctg cctgcgatca tactcaggcc ctatacctgc tacacggtcg aactatttat1320ggcaacaaaa agatgccatc ttcatttccc ctcattacac cgcctgtgct ctccctgttt1380tttagcagcc gaccatactc ttctcagcca aaacgtgact tggaactggc agtcaagttg1440ttggaggaaa agagccggag cttttttgtt gcctcggctg gatttcctag cgaagttagg1500gagaggctgg ttggactata cgcattctgc cgggtgactg atgatcttat cgactctcct1560gaagtatctt ccaacccgca tgccacaatt gacatggtct ccgattttct taccctacta1620tttgggcccc cgctacaccc ttcgcaacct gacaagatcc tttcttcgcc tttacttcct1680ccttcgcacc cttcccgacc cacgggaatg tatcccctcc cgcctcctcc ttcgctctcg1740cctgccgagc tcgttcaatt ccttaccgaa agggttcccg ttcaatacca tttcgccttc1800aggttgctcg ctaagttgca agggctgatc cctcgatacc cactcgacga actccttaga1860ggatacacca ctgatcttat ctttccttta tcgacagagg cagtccaggc tcggaagacg1920cctatcgaga ccacagctga cttgctggac tatggtctat gtgtagcagg ctcagtcgcc1980gagctattgg tctatgtctc ttgggcaagt gcaccaagtc aggtccctgc caccatagaa2040gaaagagaag ctgtgttagt ggcaagccga gagatgggaa ctgcccttca gttggtgaac2100attgctaggg acattaaagg ggacgcaaca gaagggagat tttacctacc actctcattc2160tttggtcttc gggatgaatc aaagcttgcg atcccgactg attggacgga acctcggcct2220caagatttcg acaaactcct cagtctatct ccttcgtcca cattaccatc ttcaaacgcc2280tcagaaagct tccggttcga atggaagacg tactcgcttc cattagtcgc ctacgcagag2340gatcttgcca aacattctta taagggaatt gaccgacttc ctaccgaggt tcaagcggga2400atgcgagcgg cttgcgcgag ctacctactg atcggccgag agatcaaagt cgtttggaaa2460ggagacgtcg gagagagaag gacagttgcc ggatggagga gagtacggaa agtcttgagt2520gtggtcatga gcggatggga agggcagtaa ctcgagtcat gtaattagtt atgtcacgct2580tacattcacg ccctcccccc acatccgctc taaccgaaaa ggaaggagtt agacaacctg2640aagtctaggt ccctatttat ttttttatag ttatgttagt attaagaacg ttatttatat2700ttcaaatttt tctttttttt ctgtacagac gcgtgtacgc atgtaacatt atactgaaaa2760ccttgcttga gaaggttttg ggacgctcga aggctttaat ttgc62TEFINtp-agagaccggg ttggcggcgc atttgtgtcc caaaaaacag ccccaattgc cccaattgac60DNAcrtl-cccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttctcc ccacatatca120CYC1taacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta180cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac240gcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa300aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca360cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaaatgg tgagtttcag420aggcagcagc aattgccacg ggctttgagc acacggccgg gtgtggtccc attcccatcg480acacaagacg ccacgtcatc cgaccagcac tttttgcagt actaaccgca gggaaaagaa540caagatcagg ataaacccac agctatcatc gtgggatgtg gtatcggtgg aatcgccact600gccgctcgtc ttgctaaaga aggtttccag gtcacggtgt tcgagaagaa cgactactcc660ggaggtcgat gctctttaat cgagcgagat ggttatcgat tcgatcaggg gcccagtttg720ctgctcttgc cagatctctt caagcagaca ttcgaagatt tgggagagaa gatggaagat780tgggtcgatc tcatcaagtg tgaacccaac tatgtttgcc acttccacga tgaagagact840ttcactcttt caaccgacat ggcgttgctc aagcgggaag tcgagcgttt tgaaggcaaa900gatggatttg atcggttctt gtcgtttatc caagaagccc acagacatta cgagcttgct960gtcgttcacg tcctgcagaa gaacttccct ggcttcgcag cattcttacg gctacagttc1020attggccaaa tcctggctct tcaccccttc gagtctatct ggacaagagt ttgtcgatat1080ttcaagaccg acagattacg aagagtcttc tcgtttgcag tgatgtacat gggtcaaagc1140ccatacagtg cgcccggaac atattccttg ctccaataca ccgaattgac cgagggcatc1200tggtatccga gaggaggctt ttggcaggtt cctaatactc ttcttcagat cgtcaagcgc1260aacaatccct cagccaagtt caatttcaac gctccagttt cccaggttct tctctctcct1320gccaaggacc gagcgactgg tgttcgactt gaatccggcg aggaacatca cgccgatgtt1380gtgattgtca atgctgacct cgtttacgcc tccgagcact tgattcctga cgatgccaga1440aacaagattg gccaactggg tgaagtcaag agaagttggt gggctgactt agttggtgga1500cagtagtttg aagaagctca agggaagttg agcttctact ggagcatgga ccgaatcgtg1560tatcttcttg gacggtctgg gcggacacaa gccgaggact tcaagggatc attcgacaca1620atcttcgagg agttgggtct cccagccgat ccttcctttt acgtgaacgt tccctcgcga1680atcgatcctt ctgccgctcc cgaaggcaaa gatgctatcg tcattcttgt gccgtgtggc1740catatcgacg cttcgaaccc tcaagattac aacaagcttg ttgctcgggc aaggaagttt1800gtgatccaca cgctttccgc caagcttgga cttcccgact ttgaaaaaat gattgtggca1860gagaaggttc acgatgctcc ctcttgggag aaagaattca acctcaagga cggaagcatc1920ttgggactgg ctcacaactt tatgcaagtt cttggtttca ggccgagcac cagacatccc1980aagtatgaca agttgttctt tgtcggggct tcgactcatc ccggaactgg ggttcccatc2040gtcttggctg gagccaagtt aactgccaac caagttctcg aatcctttga ccgatcccca2100gctccagatc ccaatatgtc actctccgta ccatatggaa aacctctcaa atcaaatgga2160acgggtatcg attctcaggt ccagctgaag ttcatggatt tggagagatg ggtatacctt2220ttggtattgt tgattggggc cgtgatcgct cgatccgttg gtgttcttgc tttctgactc2280gagtcatgta attagttatg tcacgcttac attcacgccc tccccccaca tccgctctaa2340ccgaaaagga aggagttaga caacctgaag tctaggtccc tatttatttt tttatagtta2400tgttagtatt aagaacgtta tttatatttc aaatttttct tttttttctg tacagacgcg2460tgtacgcatg taacattata ctgaaaacct tgcttgagaa ggttttggga cgctcgaagg2520ctttaatttg c63URA3tgcctcctgt ctgactcgtc attgccgcct ttggagtacg actccaacta tgagtgtgct60DNAtggatcactt tgacgataca ttcttcgttg gaggctgtgg gtctgacagc tgcgttttcg120gcgcggttgg ccgacaacaa tatcagctgc aacgtcattg ctggctttca tcatgatcac180atttttgtcg gcaaaggcga cgcccagaga gccattgacg ttctttctaa tttggaccga240tagccgtata gtccagtcta tctataagtt caactaactc gtaactatta ccataacata300tacttcactg ccccagataa ggttccgata aaaagttctg cagactaaat ttatttcagt360ctcctcttca ccaccaaaat gccctcctac gaagctcgag ctaacgtcca caagtccgcc420tttgccgctc gagtgctcaa gctcgtggca gccaagaaaa ccaacctgtg tgcttctctg480gatgttacca ccaccaagga gctcattgag cttgccgata aggtcggacc ttatgtgtgc540atgatcaaga cccatatcga catcattgac gacttcacct acgccggcac tgtgctcccc600ctcaaggaac ttgctcttaa gcacggtttc ttcctgttcg aggacagaaa gttcgcagat660attggcaaca ctgtcaagca ccagtacaag aacggtgtct accgaatcgc cgagtggtcc720gatatcacca acgcccacgg tgtacccgga accggaatca ttgctggcct gcgagctggt780gccgaggaaa ctgtctctga acagaagaag gaggacgtct ctgactacga gaactcccag840tacaaggagt tcctggtccc ctctcccaac gagaagctgg ccagaggtct gctcatgctg900gccgagctgt cttgcaaggg ctctctggcc actggcgagt actccaagca gaccattgag960cttgcccgat ccgaccccga gtttgtggtt ggcttcattg cccagaaccg acctaagggc1020gactctgagg actggcttat tctgaccccc ggggtgggtc ttgacgacaa gggagacgct1080ctcggacagc agtaccgaac tgttgaggat gtcatgtcta ccggaacgga tatcataatt1140gtcggccgag gtctgtacgg ccagaaccga gatcctattg aggaggccaa gcgataccag1200aaggctggct gggaggctta ccagaagatt aactgttaga ggttagacta tggatatgtc1260atttaactgt gtatatagag agcgtgcaag tatggagcgc ttgttcagct tgtatgatgg1320tcagacgacc tgtctgatcg agtatgtatg atactgcaca acctgtgtat ccgcatgatc1380tgtccaatgg ggcatgttgt tgtgtttctc gatacggaga tgctgggtac aagtagctaa1440tacgattgaa ctacttatac ttatatgagg cttgaagaaa gctgacttgt gtatgactta1500ttctcaacta catccccagt cacaatacca cca64primergtgcgcttct ctcgtctcgg taaccctgtcDNA65primeratgcgccgcc aacccggtct ctggggtgtg gtggatgggg tgtgDNA66primercacaccccat ccaccacacc ccagagaccg ggttggcggc gcatDNA67primercgccgccaac ccggtctctt gaagacgaaa gggcctccgDNA68primercggaggccct ttcgtcttca agagaccggg ttggcggcgDNA69primergacgagtcag acaggaggca tcagacagat actcgtcgcgDNA70primercgcgacgagt atctgtctga tgcctcctgt ctgactcgtcDNA71primeratgacgagtc agacaggagg catggtggta ttgtgactgg ggatDNA72primeratccccagtc acaataccac catgcctcct gtctgactcg tcatDNA73primercggcgtcctt ctcgtagtcc gcttttggtg gtgaagagga gactDNA74primeragtctcctct tcaccaccaa aagcggacta cgagaaggac gccgDNA75primerccactcgtca ccaacagtgc cgtgtgttgcDNA76primertcgtacgtct ataccaacag atggDNA77primercgcatacaca cacactgccg ggggDNA78HMGRtccacacgtc gttctttttt ccttagcctt ttttgcagtg cgcgtgtccc aaaccccagc60DNAnativetctacacacc agcacaaaca aagttaagct cagggttgtc gttgaggtcg cttactgtag120promotertcagtgctcg tatggttcgt tcaattttcg ccaaaaatcg ttttgccttt gtatcttggg180aataacatca actgtggttc ttcaacaggc ctaaggaacg aaacaagccg gaccaagatc240aggttcaagg tgagtactga gaaggaatag aaggcctaaa ggcgcaaacc gacaggtggc300aacagctcca caccgaccac gaaggccacg aaatcaaggg gtcctaaagt tagtctttgt360ggcctcgacg gtcagcgaaa acgcgagacc acaacgcgat cagaaccagg acctaaacaa420cacaggacgg ggtcacaata ggcttgaaca gcaagtacaa gctgtgatct ctctatattt480gattctcaaa ccacccctga ctacttcagc gcctctgtga cacagccccc ctatcatccg540actaacacag79primergacaatgcct cgaggaggtt taaaagtaac tDNA80primergcgccgccaa cccggtctct ctgtgttagt cggatgatag gDNA81primercctatcatcc gactaacaca gagagaccgg gttggcggcg cDNA82primergacgagtcag acaggaggca ctgcggttag tactgcaaaa agDNA83primerctttttgcag tactaaccgc agtgcctcct gtctgactcg tcDNA84primeratgcgccgcc aacccggtct cttggtggta ttgtgactgg ggatDNA85primeratccccagtc acaataccac caagagaccg ggttggcggc gcatDNA86primerctttccaata gctgcttgta gctgcggtta gtactgcaaa aDNA87primerttttgcagta ctaaccgcag ctacaagcag ctattggaaa gDNA88primergcttaatgtg attgatctca aacttgatagDNA89primergctgtctctg cgagagcacg tcgaDNA90primerggttcgcaca acttctcggg tggcDNA91Ds. GGPPSMAAHQMQLLN SQRLCSTSTR SIRPAVSNRP QVPRRPANVR RGRYQACRTM AIATADEAKQ60Pro-STSSFDFQGY MMERAVMVND ALDKALPQRH PEVLLDAMRY SLLAGGKRVR PALTLAACEL120teinVGGDIACAMP TACAMEVVHT MSLIHDDLPS MDNDDFRRGR PTNHKVYGED IAILAGDALL180SFAFEHVARA TTGTSPERVL RVILELGKAV GADGLTGGQV VDIKSENEEV GLEVLQYIHE240HKTAALLEAS VVCGALVGGA DDVTVEKLRK YARNIGLAFQ VVDDILDCTQ TTEMLGKTAG300KDIDVNKTTY PKLLGLEKSK QAAEDLIAEA IQQLDGFPPE KRTPLVALAK YIGYRQN

Claims

1. A microorganism of the genus Yarrowia having an ability to produce carotenoid or a material having carotenoid as a precursor, the microorganism expressing Dunaliella salina-derived geranylgeranyl pyrophosphate synthase.

2. The microorganism of claim 1, wherein the geranylgeranyl pyrophosphate synthase consists of an amino acid sequence of SEQ ID NO: 91.

3. The microorganism of claim 1, wherein the geranylgeranyl pyrophosphate synthase is encoded by a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 1.

4. The microorganism of claim 1, wherein the microorganism of the genus Yarrowia is Yarrowia lipolytica.

5. The microorganism of claim 1, wherein the material having carotenoid as a precursor is retinoid.

6. The microorganism of claim 1, wherein the carotenoid is beta-carotene.

7. The microorganism of claim 5, wherein the retinoid is retinol.

8. The microorganism of claim 1, wherein the microorganism of the genus Yarrowia has a reduced ability to produce a by-product.

9. The microorganism of claim 8, wherein the by-product is squalene.

10. A method of producing carotenoid or a material having carotenoid as a precursor, the method comprising the steps of:culturing the microorganism of the genus Yarrowia of claim 1 in a medium; andrecovering carotenoid or the material having carotenoid as a precursor from the microorganism of the genus Yarrowia or the medium.

11. The method of claim 10, further comprising the step of:converting beta-carotene, which is produced by the microorganism of the genus Yarrowia, into carotenoids other than beta-carotene; orconverting retinol, which is produced by the microorganism of the genus Yarrowia, into retinoids other than retinol.

12. A composition for producing carotenoid or a material having carotenoid as a precursor, the composition comprising the microorganism of the genus Yarrowia of claim 1, or a culture thereof.

13. (canceled)

Images