Cells with targeted insertion of a promoter

Abstract

The invention relates to improved cells for use in cell therapy and to improved genetic engineering thereof.

Description

[0001] DESCRIPTION

[0002] TITLE: CELLS WITH PROMOTER TARGETED INSERTION

[0003] TECHNICAL FIELD

[0004] The technical field of the present invention is cell therapy, more particularly cell replacement therapy.

[0005] INCORPORATION-BY-REFERENCE OF THE SEQUENCE LISTING

[0006] SEQUENCE LISTING

[0007] The present application is filed with a Sequence Listing in electronic form. The entire content of the sequence listings are hereby incorporated by reference.

[0008] BACKGROUND

[0009] Cellular therapy faces several technical challenges, such as immune rejection of allografts, and a tremendous research effort is being invested to overcome these challenges. It is key to the success of cell therapy that cells prepared for transplantation are safe to host patients and do not get rejected by the immune system of host patients, such that they can produce their beneficial therapeutic effect.

[0010] One approach to protect transplanted cells from rejection by the immune system of host patients is to modify their genome prior to transplantation such as to increase or decrease the expression level of specific genes of interest. This approach implies gene editing in the cells’ genome, such as knock-out or knock-in of specific genes.

[0011] By way of illustration, genetic editing strategies in the field of cellular therapy are provided in WQ / 2020 / 260563 and in WO / 2022 / 129472, where the genome of the cells are subjected to several genes knock-out, such as B2M (Beta-2 microglobulin) and CIITA (Class II major histocompatibility complex transactivator) of the HLA (human leukocyte antigens) family genes, and several genes knock-in, such as fusion genes and suicide switch genes, prior to transplantation.

[0012] Genetic engineering in the field of cell therapy faces technical challenges which are specific to this field. This is particularly due to the complexity of genetic engineering strategies, implying multiple gene knock-outs and knock-ins, and due to the long size of transgenes involved. This is also due to the complexity of the genetic environment and machinery in a mammalian cell as compared to other cell types. And this is due to the high level of quality and safety requirements in force in the cellular therapy field, where the standards are much more stringent than in other fields using genetic manipulations. Regarding the specificity of mammalian cells, it is noted here that mammalian cells differ from bacterial cells in their cellular anatomy, gene expression machinery and regulation. Mammalian cells for instance are much more complex in that they comprise additional cellular organelles involved in the protein expression system e.g., a nucleus, Golgi apparatus and endoplasmic reticulum. Bacterial cells and mammalian cells differ also in their genetic content and transcription control through e.g., transcription factors and promotor length (Perenz and Groisman, 2009). Compared to the procaryotic bacterial cell, eukaryotic mammalian cells and plant cells share preserved mechanisms of controlling gene expression, however plant cells and mammalian cells are separated by a vast evolutionary distance. Due to their wide evolutionary distance, mammalian cells and plant cells differ widely in gene structure and their regulators involved in the gene expression machinery e.g., transcription factors.

[0013] In the field of cell therapy, the targeted insertion of an exogenous gene in a specific locus in the host cell’s genome, also called gene knock-in (KI), is generally performed by homologous directed recombination (HDR) technique. Due to the large molecular size of donor plasmids involved, the genomic insertion efficiency is often low hence successful gene insertion is difficult to achieve. In cellular therapy the size of the donor plasmid often exceeds 12000 base pairs (bp), as it comprises sequences for a promoter, a transgene with molecular size often larger than 6000bp, a terminator sequence, homologous recombination sequences, multiple insulator sequences, as well as the vector backbone with sequences for plasmid amplification and selection in bacteria.

[0014] Furthermore, with strategies involving multiple knock-ins and knock-outs, the number of transgenes further reduces the transfection efficiency and subsequently reduces the amount of plasmids available to HDR in the cell’s nucleus. Multiple knock-ins and knockouts require multiple genetic manipulation steps along with multiple selection steps and plasmids of a large size (e.g., 10 kilo base pairs (kb)). A large sized plasmid compared to a small sized (e.g., 3kb) plasmid with similar molarity, triggers higher DNA toxicity to the cell upon transfection and subsequently further reduces homologous insertion efficiency.

[0015] As regards the high safety and efficacy standards specific to this field, cell therapy products require a stable expression of transgenes of interest in the very long term, for many years in the host patient’s lifetime, which cannot be achieved with transgene expression from vectors or with random transgene integration but requires homologous integration in the cell’s genome. There remains a need to further protect allografts from immune rejection in cell therapy. There also remains a need to simplify the complex genetic manipulation processes involved in preparing cells suited for cellular therapy.

[0016] A purpose of the present invention is to improve protection of transplanted cells from allorejection, and thereby improve the success of cell therapy.

[0017] Another purpose is to improve the success of genetic engineering of cells for the use in cellular transplantation, and thereby to improve the success of cell therapy.

[0018] Yet another purpose is to simplify or otherwise improve genetic engineering strategies in the field of cell therapy, such as solving technical challenges faced with strategies involving manipulation of multiple and / or long transgenes.

[0019] SUMMARY

[0020] The invention provides mammalian cells with improved properties of benefit in cellular therapy. In one aspect, the invention provides an improved genetic editing strategy which eases and increases the success of the engineering steps in mammalian cells for use in cell therapy. Also and alternatively, in a second aspect, the invention provides an engineered mammalian cell with improved immune resistance, i.e. which are less subject to rejection by the immune system of a host patient.

[0021] In a second aspect, the invention provides an engineered mammalian cell comprising overexpression of CD35 gene, of CD55 gene and / or of PD-L1 gene.

[0022] The invention may also solve further problems that will be apparent from the disclosure of the exemplary embodiments.

[0023] In particular embodiments, the cell of the invention is for use in cell therapy; said endogenous gene is under the exclusive control of said exogenous promoter; said exogeneous promoter induces transcription initiation of said endogenous gene at a higher level than the native endogenous promoter for said gene; said exogeneous promoter is a constitutive promoter; said exogeneous promoter is a ubiquitous promoter; said exogeneous promoter is a constitutive and ubiquitous promoter; said exogeneous promoter is a constitutive and ubiquitous promoter and induces transcription initiation of said endogenous gene at a higher level than the native endogenous promoter for said gene; said exogeneous promoter is selected from simian virus 40 early promoter (SV40), cytomegalovirus immediate-early promoter (CMV), human Ubiquitin C promoter (UBC), human elongation factor 1a promoter (EF1A), mouse phosphoglycerate kinase 1 promoter (PGK), and chicken P-Actin promoter coupled with CMV early enhancer (CAG); said exogeneous promoter is located upstream of said endogenous gene of interest; said exogeneous promoter is located upstream of the start codon of said endogenous gene of interest, such as within a region from about 500 nucleotides upstream of the start codon to 0 nucleotide upstream of the start codon; said exogeneous promoter is located upstream of the first exon of said endogenous gene of interest; said exogenous promoter has been inserted by homologous recombination and / or by a RNA-guided nuclease, such as Mad7 or CRISPR, such as CRISPR / Cas9; said endogenous gene of interest encodes for a protein comprising more than 500 amino acids, more than 700 amino acids, more than 800 amino acids, more than 1000 amino acids, more than 1500 amino acids, more than 1800 amino acids or more than 2000 amino acids; said endogenous gene of interest comprises a coding sequence (CDS) wherein said coding sequence comprises more than 3000 nucleotides, such as more than 4500 nucleotides, more than 5400 nucleotides, more than 6000 nucleotides or more than 7000 nucleotides; said endogenous gene of interest is selected from the group consisting of CD35, HLA-G, HLA-E, HLA-F, CD46, CD59, CD47, CD55 and PD-L1; said endogenous gene of interest is CD35; said cell is B2M- / -, is CIITA- / - and / or comprises a B2M-HLA gene; said cell is a mammalian cell, and / or is a stem cell or is at a differentiated stage, such as a pancreatic beta cell, an INS+ and NKX6.1+ double positive cell or a C-peptide+ / NKX6.1+ double positive cell, an insulin producing cell, an in vitro derived beta-like cell, a pancreatic endocrine cell or an endocrine cell, an endocrine progenitor cell or a NGN3+ / NKX2.2+ double positive cell, a neural cell, such as a neuron, an interneuron cell, an oligodendrocyte, an astrocyte, a dopaminergic cell, an exosome cell, an immune cell, such as a T cell, a NK cell, a macrophage, a dendritic cell, a hepatocyte, a stellate cell, a fibroblast, a keratinocyte or a hair cell, an inner ear cell, an intestinal cell or organoid cell, a nephroid cell or another kidney-related cell, a cortical neural progenitor cell, a cardiomyocyte, a retinal cell, a photoreceptor cell, a retinal pigment epithelium cell or a mesenchymal stem cell; said endogenous gene interest is CD35, said exogenous promoter is UbC promoter, and said exogeneous promoter is located within a region from about 500 nucleotides upstream of the start codon up to 0 nucleotide before the start codon of said endogenous gene interest; and / or said cell comprises overexpression of CD35 gene; said cell is for use in the treatment, the cure, or the prevention of a chronic disease or of an acute disease; said endogenous gene interest is CD35, and said exogenous promoter is UbC promoter, and said exogeneous promoter is located within a region from about 500 nucleotides upstream of the start codon up to 0 nucleotide before the start codon of said endogenous gene interest; and / or said cell comprises overexpression of CD35 gene. BRIEF DESCRIPTION OF DRAWINGS

[0024] Fig. 1 shows a representation of a genetic modification of a cell’s genome as per the invention, whereby endogenous CD35 (also called CR1) gene expression is activated by an exogenous strong promoter inserted before the ATG start codon of CD35 endogenous gene. Fig.1(A) shows a part of a donor plasmid including an exogenous DNA nucleotide sequence for targeted insertion. By way of example, the exogenous DNA nucleotide sequence comprises a ubiquitin C (UbC) promotor (illustrated by dotted arrow) and a Kozak sequence (illustrated by plain back rectangle). The exogenous DNA nucleotide sequence is flanked upstream and downstream thereof (in 5’-3’ direction) by homologous sequences (illustrated by continuous dashes) which ensure homologous recombination with the targeted locus in the cell’s genome, and subsequent targeted insertion therein. (Fig.1(B)) shows the targeted locus in the cell’s genome. The scissors symbol indicates the nuclease CRISPR-MAD7 and is positioned next to its cutting site in host cell’s genome. By way of example, the target site is immediately upstream CD35 signal peptide sequence (illustrated by back arrow with white dots) and / or immediately upstream CD35 start codon and gene sequence (illustrated by white arrow with stripes).

[0025] Fig. 2 shows flow cytometry live cell signals of endogenous CD35 surface staining using two different antibodies, namely anti CD35 monoclonal antibody E11 (Fig.2(A)) and anti CD35 monoclonal antibody 7G9 (Fig.2(B)).

[0026] Fig.3 shows flow cytometry live cell signals of endogenous CD35 surface staining using anti CD35 monoclonal antibody 7G9 in cells of activated CD35 KI clone EST13-F3 (Fig.3(A)) and in cells of activated CD35 KI clone EST15#13 (Fig.3(B)), respectively.

[0027] DEFINITIONS

[0028] As used herein, the term “engineered cell” means a cell that has been subject to genetic engineering, genetic engineering being the artificial edition of genetic material, such as deletion, addition, substitution or other modification of one or more nucleotides in the genome of a cell.

[0029] As used herein, the term “strong promoter” referring to an exogenous promoter means a promoter with one or more of the following properties: i) which is a constitutive promoter, and / or ii) which is an ubiquitous promoter, and / or iii) which induces transcription initiation of a downstream located gene at a higher level than the native endogenous promoter for said gene. For example, this may be measured by real time PCR. Real time PCR allows quantification of the expression of a gene on the mRNA level. The exogenous promoter may additionally be one a promoter that is active at the embryonic cell stage.

[0030] As used herein, the term “constitutive” means continuously. As used herein, the term “constitutive promoter” means a promoter which continuously induces the expression of a downstream located gene and is not subject to regulation.

[0031] As used herein, the term “ubiquitous” means everywhere, i.e. in every cell type, in every part of the body. As used herein, the term “ubiquitous promoter” means a promoter which induces the expression of a downstream located gene in any cell type comprising it, i.e. in every cell comprising it regardless of cell type, of tissue or organ location and of function of said cell.

[0032] As used herein, the term “under the control” when referring to a gene or expression thereof being under the control of a promoter means that said promoter regulates when and where said gene is to be transcribed by the transcription machinery in the cell. In other words, “said endogenous gene is under the control of said exogenous promoter” means the same as “said exogenous promoter controls the translation initiation of said endogenous gene”.

[0033] As used herein, the term “promoter” has same meaning as is well known and described in the field of gene expression: see for example Stark et.al. Nature Reviews Molecular Cell Biology vol.19, pp. 621-637 (2018) Eukaryotic core promoters and the functional basis of transcription initiation. The primary role of a promoter is to recruit the cellular transcription machinery which in turn initiates the transcription of gene(s) under the control of said promoter into a messenger RNA, such as primary messenger RNA.

[0034] As used herein, the term “CDS” or “coding sequence” refers to the portion(s) of a gene sequence that codes for a protein, i.e. that will actually be translated to amino acids. Thus the CDS comprises exons minus the 3’IITR and 5’IITR (untranslated regions) on exons, CDS does not comprise introns and other non-coding sequences. As used herein, the term “expression” in the context of gene expression refers to the process by which a protein product is generated according to the sequence encoded in its gene in a cell comprising said gene, such as transcription, translation, and related processes. Similarly, a gene that is “expressed” is a gene that is used to produce its encoded protein product.

[0035] As used herein, the term “gene” means a DNA nucleotide sequence that encodes information for functional products, such as a protein or a RNA.

[0036] As used herein, the term “endogenous” refers to a nucleotide sequence that is naturally present in the locus under consideration in a cell’s genome. The term “exogenous” refers to a nucleotide sequence that is not naturally present in the locus under consideration, i.e. , that has been inserted in the locus under consideration by genetic engineering. As used herein, the term “start codon” means the “ATG” codon and / or the “AUG” codon, “ATG” being the start codon on a DNA nucleotide sequence and “AUG” being the start codon on a RNA nucleotide sequence.

[0037] As used herein, the terms “upstream” and “downstream” refer to relative positions in a nucleotide sequence. By convention, a nucleotide sequence has a 5’ end and a 3’ end and is typically represented in its 5’ to 3’ orientation. The 5’ to 3’ orientation is the direction in which nucleotide sequence transcription progresses. “Upstream of” a specific locus means towards the 5’ region of said locus, in other words prior to the 5’ end of said locus. If used in the context of a protein sequence, the term “upstream” refers to a region located towards the N-terminal end of the sequence compared to a reference location, and the term “downstream” refers to a region located towards the C-terminal end of the sequence compared to a reference location.

[0038] As used herein, the term “knock-out” (KO) of a specific gene refers to the inactivation of said gene by disruption of its nucleotide sequence, such as by addition, substitution or deletion of nucleotides in its DNA sequence, which results in inactivation of the gene comprising those. The disruption may result from disruption of the open reading frame of said specific gene or from the generation of a stop signal for the transcription and / or translation machinery in its sequence. As a result of the knock-out of a specific gene in the genome of the cell, said gene can no longer express the protein which it normally expresses without the knock-out.

[0039] As used herein, the term “knock-in” (KI) of a specific gene refers to the targeted insertion of said gene into a specific locus. More generally, the term “knock-in” refers to a genetic engineering method whereby a DNA sequence in a specific targeted locus is substituted with another DNA sequence or whereby a DNA sequence is added in a specific targeted locus.

[0040] As used herein, the term “B2M” stands for Beta-2 microglobulin.

[0041] As used herein, the term “CIITA” stands for Class II major histocompatibility complex transactivator.

[0042] As used herein, the term “HLA” stands for human leukocyte antigen(s).

[0043] As used herein, the term “B2M- / -“ referring to a cell means that both alleles of endogenous B2M gene are inactivated in the cell, i.e., both alleles are knock out.

[0044] As used herein, the term “CIITA- / -“ referring to a cell means that both alleles of endogenous CIITA gene are inactivated in the cell, i.e., both alleles are knock out. As used herein, the term “B2M-HLA fusion protein” means a protein comprising at least a B2M protein and a HLA protein. In a B2M-HLA fusion protein, the B2M protein and the HLA protein are parts of one same protein. That means that they are connected by a peptide bond, optionally comprising a linker or a further peptide sequence in between them.

[0045] As used herein, the term “B2M-HLA gene” means a gene encoding a B2M-HLA fusion protein. A B2M-HLA gene is an exogenous gene as, to our knowledge, it does not exist in nature. Definitions and examples of HLA-E, HLA-F, B2M-HLA-E and B2M-HLA-F may be found in WO / 2020 / 260563 and are incorporated herein by reference.

[0046] As used herein the term “CD” as in CD35, CD47, CD46 and CD59, means cluster of differentiation.

[0047] As used herein “a” means “one or more”.

[0048] Allorejection means the rejection of a donor cell or tissue by the immune system of the host.

[0049] Start codon: The start codon AUG is the initiation signal for translation that is found on a messenger RNA (mRNA) strand. On DNA level the start codon is encoded as ATG and is part of a gene.

[0050] Promoter: A promoter, as related to genomics, is a sequence of DNA upstream of a gene where relevant proteins (such as RNA polymerase and transcription factors) bind to initiate transcription of that gene. The resulting transcription produces an RNA molecule (such as mRNA).

[0051] Transgene: A transgene is an engineered gene or segment of DNA that is introduced into the genome of a cell.

[0052] Donor plasmid: A donor plasmid is used to introduce foreign DNA, such as a transgene, into a cell and generally comprises an origin of replication, selection marker(s), and a multiple cloning site. Plasmids may be circular pieces of DNA that replicate independently from the host's chromosomal DNA.

[0053] Unless otherwise indicated in the specification, terms presented in singular form also include the plural situation.

[0054] DESCRIPTION

[0055] In the field of cell therapy, it is beneficial to modulate the expression of genes of interest.

[0056] In the field of cell therapy, gene expression increase is so far performed by insertion of exogeneous copies of the gene of interest in the cell therapy product. However, this approach comes with technical limitations and challenges, especially when it involves long genes. For example, prior to the present invention, increase of CD35 expression level in a cell has been tried, either by transfecting an expression vector comprising a CD35 transgene or by insertion of a CD35 transgene in a cell’s genome. The former option is not suited for cell therapy application due to insufficient guarantee of safety and efficacy in the long term. The latter option has proven challenging. After several attempts, it has been found that the success rate was not satisfactory and it has been hypothesised that this could be due to the large molecular size of CD35 protein, with 2039 amino acids, and / or to the large molecular size of CD35 transgene.

[0057] In contrast, the present invention provides for the first time in the field of cell therapy a robust solution to increase the expression level of large proteins in a cell. As per the invention, an exogenous promoter is inserted in the cell’s genome upstream of the endogenous gene for which overexpression is desired such as to control its expression. This solution is particularly advantageous and adequate to increase the expression of proteins with large genomic or trans-genomic sequences, as its design significantly reduces the size of donor plasmids used in the gene editing steps, such as down to 1 to 2 kilobases in size, which improves the success rate of cell transfection and / or gene insertion.

[0058] To the best of our knowledge, this approach has never been used in the field of cell therapy before.

[0059] In an aspect, the invention provides an engineered mammalian cell, said cell comprising an endogenous gene of interest and an exogenous promoter, wherein said endogenous gene is under the control of said exogenous promoter.

[0060] The invention is particularly beneficial in strategies aiming to increase the expression of a gene in a cell. The invention provides that, rather than inserting a copy of said gene in the form of a transgene, an exogenous promoter is inserted upstream of the endogenous version of said gene in the cell’s genome. The approach of the invention is easier and more efficient because it overcomes the problem of low transfection efficacy and / or low genetic insertion efficacy met with transgene insertion, especially with large transgenes. The use of an exogenous promoter also allows a level of expression more tailored to the need, especially allows to use a promoter selected for its ability to trigger a according to an expression profile of interest, such as a high expression level and / or a constant expression level not subject to down-regulation by external factors.

[0061] The invention can be used to activate any endogenous genes in mammalian cells for cell line engineering. It can be used to increase expression of any proteins such as HLA- G (human leukocyte antigen G), HLA-E (human leukocyte antigen E), CD47 (Cluster of differentiation 47), CD55 (Cluster of differentiation 55), and PD-L1 (Programmed death- ligand 1) to prevent allorejection upon transplantation of engineered cells. This can be done via insertion of an exogeneous promoter of interest upstream of the endogenous gene(s) encoding said protein(s) and to control expression thereof.

[0062] Exogenous promoter

[0063] In an embodiment, the exogenous promoter is a strong promoter.

[0064] In an embodiment, a “strong promoter” is a i) a constitutive promoter, ii) an ubiquitous promoter, and / or iii) promoter which induces transcription initiation of a downstream located gene at a higher level than the native endogenous promoter for said gene.

[0065] In an embodiment, the exogenous promoter is a constitutive promoter. This results in the constitutive production of mRNA transcripts and, subsequently, of proteins.

[0066] In an embodiment, the exogenous promoter is an ubiquitous promoter. This results in the ubiquitous production of mRNA transcripts and, subsequently, of proteins.

[0067] In an embodiment, the exogenous promoter is a promoter which induces transcription initiation of a downstream located gene at a higher level than the native endogenous promoter for said gene. A higher level of transcription initiation results in a higher amount of mRNA transcripts and, subsequently, a higher amount of produced proteins.

[0068] In an embodiment, the exogenous promoter is a constitutive and ubiquitous promoter.

[0069] In an embodiment, the exogenous promoter is a constitutive and ubiquitous promoter which induces transcription initiation of a downstream located gene at a higher level than the native endogenous promoter for said gene.

[0070] In an embodiment, the exogenous promoter is selected from the list consisting of simian virus 40 early promoter (SV40), cytomegalovirus immediate-early promoter (CMV), human Ubiquitin C promoter (UbC), human elongation factor 1a promoter (EF1A), mouse phosphoglycerate kinase 1 promoter (PGK), and chicken p-Actin promoter coupled with CMV early enhancer (CAG). The sequences of these promoters are known in the art. For example, the sequences of these promoters may be as provided by SnapGene®, reported herein in Example 7. The sequences of these promoters may be as defined in Example 7 or may be variants thereof of at least 90% sequence homology, such as at least 92%, 94%, 96%, 98%, 99%, 99,5%, 99,8% or 99,9% homology compared to the sequences of Example 7.

[0071] In an embodiment, the exogeneous promoter is located upstream of the endogenous gene of interest. In a further embodiment, it is located upstream of the start codon of said endogenous gene of interest, such as within a region from about 500 nucleotides upstream of the start codon to 0 nucleotide upstream of the start codon. In a further embodiment, it is located upstream of the first exon of said endogenous gene of interest. In a further embodiment, it is located within the first exon of said endogenous gene of interest. In this case, said exogenous promoter is inserted together with an exogenous version of part of said first exon.

[0072] In an embodiment, the exogeneous promoter replaces the native endogenous promoter of the endogenous gene of interest as regards the control of the expression of said endogenous gene of interest. That means that said endogenous gene of interest is no longer under the control the native endogenous promoter of said endogenous gene of interest. Usually upon said exogenous promoter insertion, the native endogenous promoter plays minimal role to none in the expression of said endogenous gene of interest.

[0073] Endogenous gene

[0074] In an embodiment, the endogenous gene of interest encodes for a protein comprising more than 500 amino acids, such as more than 700 amino acids, more than 800 amino acids, more than 1000 amino acids, more than 1500 amino acids, more than 1800 amino acids or more than 2000 amino acids.

[0075] In an embodiment, the endogenous gene of interest comprises a coding sequence (CDS) wherein said coding sequence comprises more than 3000 nucleotides, such as more than 4500 nucleotides, more than 5400 nucleotides, more than 6000 nucleotides, or more than 7000 nucleotides.

[0076] In an embodiment, the engineered mammalian cell of the invention is a cell comprising an endogenous gene of interest and an exogenous promoter, wherein said endogenous gene is under the control of said exogenous promoter and is overexpressed.

[0077] In an embodiment, the endogenous gene of interest is selected from the group consisting of CD35, HLA-G, HLA-E, HLA-F, CD46, CD59, CD47, CD55 and PD-L1. In a preferred embodiment, said endogenous gene is CD35 gene. In another preferred embodiment, said endogenous gene is CD55 gene.

[0078] In a particular embodiment, the endogenous gene of interest is selected from the group consisting of CD35, HLA-G, HLA-E, HLA-F, CD46, CD59, CD47, CD55 and PD-L1 and the exogeneous promoter is an ubiquitous and constitutive promoter, such as UbC promoter or CAG promoter. This method advantageously avoids the manipulation of CD35, HLA-G, HLA-E, HLA-F, CD46, CD59, CD47, CD55 and PD-L1 transgenes, which are large and difficult to manipulate and to insert in a mammalian cell’s genome.

[0079] In a preferred embodiment, the exogenous promoter in control of the exogenous gene allows for overexpression of said exogenous gene. In an embodiment, said overexpression means a more constitutive expression than with the endogenous promoter, a more ubiquitous expression than expression than with the endogenous promoter and / or a higher level of transcription initiation than with the endogenous promoter.

[0080] The cell of the invention may comprise overexpression of one or more of CD35 gene, CD55 gene and / or of PD-L1 endogenous gene, such as overexpression of CD35 and CD55 genes; of CD35 and PD-L1 genes; of CD55 and PD-L1 genes or of CD35, CD55 and PD-L1 genes.

[0081] CD35

[0082] CD35 protein, also known as complement receptor type 1 (CR1), is a cell surface protein. In the context of immune response mechanisms, CD35 mediates cellular binding to immune complexes having activated complement. CD35 can act as a negative regulator of the complement cascade at an early stage and inhibit complement pathways.

[0083] A purpose of the invention is to provide improved cells for use in cell therapy, and it has been surprisingly found that overexpression of CD35 improves cell protection against allorejection.

[0084] In an aspect, the invention relates to an engineered mammalian cell, said cell comprising overexpression of CD35. In a particular embodiment, said cell comprises an exogenous CD35 gene inserted in the cell’s genome in a locus under the control of an endogenous promoter or inserted along with an exogenous promoter and placed under the control thereof.

[0085] A purpose of the invention is to provide a robust method to engineer mammalian cells, including stem cell, that are protected from complement-dependent cytotoxicity in a host patient upon transplantation therein.

[0086] In an aspect, the invention relates to an engineered mammalian cell, said cell comprising an endogenous CD35 gene and an exogenous promoter, wherein said endogenous CD35 gene is under the control of said exogenous promoter. In said alternative aspect, increased expression of CD35 is obtained by inserting a strong exogenous promoter downstream of CD35 endogenous gene to control expression of said endogenous CD35 gene. This method advantageously avoids the manipulation of CD35 transgene, which is very large and difficult to manipulate and to insert in a mammalian cell’s genome. The invention aims at providing an improved cell for use in cellular therapy that is protected from the risk of rejection by the immune system. It is further proposed that engineered cells with CD35 overexpression can be used in cell therapy for example for the treatment of type 1 diabetes, chronic heart failure, Parkinson’s disease and other chronic and severe diseases.

[0087] CD55

[0088] In another aspect, the invention relates to an engineered mammalian cell, said cell comprising overexpression of CD55.

[0089] PD-L1

[0090] In another aspect, the invention relates to an engineered mammalian cell, said cell comprising overexpression of PD-L1.

[0091] The cell of the invention may comprise overexpression of one or more of CD35 gene, CD55 gene and / or of PD-L1 endogenous gene, such as overexpression of CD35 and CD55 genes; of CD35 and PD-L1 genes; of CD55 and PD-L1 genes or of CD35, CD55 and PD-L1 genes.

[0092] Cell

[0093] The cell(s) of the invention is an engineered mammalian cell.

[0094] In a preferred embodiment, the cell(s) is a human cell.

[0095] In an embodiment, the cell(s) of the invention is a stem cell. In an embodiment, said stem cell is an embryonic stem cell (ESC) or a pluripotent stem cell (PSC). In another embodiment, said stem cell is an induced pluripotent stem cell (iPSC). In an embodiment, said cell is a human ESC (hESC), a human PSC (hPSC) or a human iPSC (hiPSC).

[0096] In an embodiment, the cell of the invention is derived from a stem cell.

[0097] In another embodiment, the cell(s) of the invention is at a differentiated stage beyond the stem cell stage, such as is a differentiated cell or mature cell. In an embodiment, the cell(s) of the invention is derived from a stem cell. In an embodiment, the cell of the invention is a differentiated cell obtained from a donor, such as cell of any type. In an embodiment, the cell of the invention is a differentiated cell derived from a cell obtained from a donor, such as a stem cell or a progenitor cell obtained from a donor. In an embodiment, the cell of the invention is a differentiated cell derived from an iPSC.

[0098] In an embodiment, the cell of the invention is a pancreatic beta cell such as an INS+ (insulin secreting) and NKX6.1+ double positive cell, a C-peptide+ / NKX6.1+ double positive cell, an insulin producing cell, an in vitro derived pancreatic beta-like cell, or a pancreatic endocrine cell; an endocrine cell, an endocrine progenitor cell, or a NGN3+ / NKX2.2+ double positive cell; a cortical neural progenitor cell, a neural cell such as a neuron, an interneuron, or a dopaminergic cell; a glia cell such as a oligodendrocyte, an astrocyte, or microglia; an exosome cell; an immune cell such as a T cell, a natural killer cell (NK cell), a macrophage, or a dendritic cell; a hepatocyte, a stellate cell, a fibroblast, a keratinocyte or a hair cell, an inner ear cell, an intestinal cell or organoid cell, a nephroid cell or another kidney-related cell, a cardiomyocyte, a retinal cell, a photoreceptor cell, a retinal pigment epithelium cell, or a mesenchymal stem cell.

[0099] Different cell types are used for different therapeutic indications, as known in the art. For example: a beta cell, an INS+ and NKX6.1+ double positive cell or a C- peptide+ / NKX6.1+ double positive cell, an insulin producing cell, an in vitro derived beta-like cell, a pancreatic endocrine cell or an endocrine cell, an endocrine progenitor cell or a NGN3+ / NKX2.2+ double positive cell are suitable for the treatment of type 1 diabetes or type 2 diabetes; a neural cell, such as a neuron, an interneuron cell, an oligodendrocyte, an astrocyte, a stellate cell or a neural progenitor cell are suitable for the treatment of neurological diseases; a dopaminergic cell, such as a dopaminergic ventral midbrain neural cell, is suitable for the treatment of Parkinson’s disease; an immune cell, such as a T cell, a NK cell, a macrophage, a dendritic cell are suitable for the treatment of cancer; a nephroid cell or another kidney-related cell are suitable for the treatment of chronic kidney disease; a cardiomyocyte or a mesenchymal stem cell are suitable for the treatment of heart disease, stroke and / or chronic heart failure; a hepatocyte is suitable for the treatment of cirrhosis and / or liver diseases e.g., NASH; a retinal cell, a photoreceptor cell or a retinal pigment epithelium cell are suitable for the treatment of dry macular degeneration, retinitis pigmentosa and / or corneal blindness; a fibroblast, a keratinocyte, a hair cell, or a mesenchymal stem cell are suitable for the treatment of tissue fibrosis; an inner ear cell is suitable for the treatment of hearing loss; an endocrine cell, an endocrine progenitor cell is suitable for the treatment of endocrine disorders; a myocyte is suitable for the treatment of muscle disorders; a cardiomyocyte is suitable for the treatment of , cardiovascular diseases, a macrophage is suitable for the treatment of hematopoietic disorders.

[0100] In an embodiment, the cell comprises further genetic modifications to improve its properties, such as its stealth property. The term “stealth” means protected from immune rejection, i.e. protected from rejection by the immune system of a host upon allogeneic transplantation. This may be achieved by decreasing the expression of some proteins and / or increasing the expression of other proteins, depending on their respective roles in the recognition and / or rejection mechanisms by the immune system.

[0101] The cell may comprise a decreased expression of H LA-class I and II proteins.

[0102] In an embodiment, the cell is a B2M- / - cell. In an embodiment, the cell of the invention is CIITA- / -. In a particular embodiment, the cell is a B2M- / - and CIITA- / - cell.

[0103] In an embodiment, the cell expresses a B2M-HLA fusion protein. In an embodiment, the cell comprises an exogenous B2M-HLA gene. The B2M-HLA protein may be a B2M- HLA-E fusion protein or a B2M-HLA-G fusion protein. The B2M-HLA gene may be a B2M- HLA-E gene or a B2M-HLA-G gene. In an embodiment, the cell comprises an exogenous B2M-HLA-E gene and / or an exogenous B2M-HLA-G gene. The exogenous B2M-HLA gene may be inserted into the cell’s genome.

[0104] In a preferred embodiment, the cell is B2M- / -, CIITA- / - and further comprises an exogenous B2M-HLA gene such as B2M-HLA-E gene and / or B2M-HLA-G gene.

[0105] In an embodiment, the cell of the invention further comprises overexpression of one or more further genes. Overexpression is an increased expression of a gene or transgene regulated by a strong promotor's high frequency of transcription initiation. Said further gene overexpression may be obtained by insertion of a further exogenous promoter as defined herein such as placing said further endogenous gene under the control of said further exogenous promoter. Alternatively, said further gene overexpression may be obtained by insertion of an exogenous copy of said further gene along with an exogenous promoter in control thereof, or by insertion of an exogenous copy of said further gene in a locus under the control of an endogenous promoter.

[0106] In an embodiment, said one or more further genes is selected from the list consisting of HLA-G, HLA-E, HLA-F, CD46, CD59, CD47, CD55, CD35 and / or PD-L1 genes.

[0107] Gene editing tool

[0108] The cells of the invention may be genetically engineered using any available gene editing tool, such as any gene editing tool allowing targeted gene editing such as homologous recombination. In an embodiment, the cell of the invention is genetically engineered by a RNA-guided nuclease, such as MAD7 or CRISPR, such as CRISPR / Cas9, and preferably MAD7.

[0109] Cell composition and pharmaceutical products

[0110] In another aspect, the invention provides a cell composition, said composition comprises cells as defined herein in a pharmaceutically acceptable medium. In another aspect, the invention provides a pharmaceutical product comprising cell(s) or a cell composition as defined herein. In an embodiment, said pharmaceutical product is a cell therapy product.

[0111] Use, medical indication and method of treatment

[0112] In another aspect, the invention provides a cell(s), a cell composition or a pharmaceutical product as defined herein for use as a medicament.

[0113] In another aspect, the invention provides a cell(s), a cell composition or a pharmaceutical product as defined herein for use in cell therapy, such as for use in allogenic cell therapy.

[0114] In another aspect, the invention provides a cell(s), a cell composition or a pharmaceutical product as defined herein for use in the treatment, the cure, or the prevention of a chronic disease or of an acute disease.

[0115] In one embodiment said chronic disease comprises or is selected from the group consisting of diabetes, type 1 diabetes, type 2 diabetes, dry macular degeneration, retinitis pigmentosa, neurological disease, Parkinson’s disease, heart disease, tissue fibrosis, cirrhosis, hearing loss, corneal blindness, stroke, chronic heart failure, chronic kidney disease, liver diseases (e.g., NASH), muscle disorders, rare disorders, cardiovascular diseases, hematopoietic disorders, endocrine disorders, Alzheimer’s disease and cancer.

[0116] In one embodiment, said acute disease comprises bacterial lung infections, such as ventilator acquired bacterial pneumonia and hospital acquired bacterial pneumonia.

[0117] In another aspect, the invention provides a method of treatment, cure or prevention, wherein patients in need thereof are administered a cell, a cell composition or a pharmaceutical product as defined herein. In an embodiment, said method is a method of treatment, cure or prevention by cell therapy. In an embodiment, said method is a method of treatment, cure or prevention of a chronic disease or of an acute disease.

[0118] In another aspect, the invention provides a method for the preparation of a medicament for the treatment, cure or prevention of a chronic disease or of an acute disease, wherein patients in need thereof are administered a cell, a cell composition or a pharmaceutical product of the invention as defined herein.

[0119] Embodiments

[0120] 1. An engineered mammalian cell, said cell comprising an endogenous gene of interest and an exogenous promoter, wherein said endogenous gene is under the control of said exogenous promoter. 2. An engineered cell of embodiment 1 , for use in cell therapy.

[0121] 3. An engineered cell of any of previous embodiments, wherein said endogenous gene is under the exclusive control of said exogenous promoter.

[0122] 4. An engineered cell of any of previous embodiments, wherein said exogeneous promoter induces transcription initiation of said endogenous gene at a higher level than the native endogenous promoter for said endogenous gene.

[0123] 5. An engineered cell of any of previous embodiments, wherein said exogeneous promoter is a constitutive promoter.

[0124] 6. An engineered cell of any of previous embodiments, wherein said exogeneous promoter is a ubiquitous promoter.

[0125] 7. An engineered cell of any of previous embodiments, wherein said exogeneous promoter is a constitutive and ubiquitous promoter.

[0126] 8. An engineered cell of any of previous embodiments, wherein said exogeneous promoter is a constitutive and ubiquitous promoter and induces transcription initiation of said endogenous gene at a higher level than the native endogenous promoter for said gene.

[0127] 9. An engineered cell of any of previous embodiments, wherein said exogeneous promoter is selected from simian virus 40 early promoter (SV40), cytomegalovirus immediate-early promoter (CMV), human Ubiquitin C promoter (UBC), human elongation factor 1a promoter (EF1A), mouse phosphoglycerate kinase 1 promoter (PGK), and chicken P-Actin promoter coupled with CMV early enhancer (CAG).

[0128] 10. An engineered cell of any of previous embodiments, wherein said exogeneous promoter is located upstream of said endogenous gene of interest.

[0129] 11. An engineered cell of any of previous embodiments, wherein said exogeneous promoter is located upstream of the start codon of said endogenous gene of interest, such as within a region from about 500 nucleotides upstream of the start codon to 0 nucleotide upstream of the start codon.

[0130] 12. An engineered cell of any of previous embodiments, wherein said exogeneous promoter is located upstream of the first exon of said endogenous gene of interest.

[0131] 13. An engineered cell of any of embodiments 1 to 9, wherein said exogeneous promoter is located within the first exon of said endogenous gene of interest and wherein said exogenous promoter is inserted together with an exogenous version of part of said first exon.

[0132] 14. An engineered cell of any of previous embodiments, wherein said exogenous promoter has been inserted by a RNA-guided nuclease, such as Mad7 or other CRISPR nucleases, such as CRISPR-Cas9. 15. An engineered cell of any of previous embodiments, wherein said exogeneous promoter replaces the native endogenous promoter of said endogenous gene of interest as regards the control of the expression of said endogenous gene of interest.

[0133] 16. An engineered cell of any of previous embodiments, wherein said endogenous gene of interest is not under the control the native endogenous promoter of said endogenous gene of interest.

[0134] 17. An engineered cell of any of previous claims, wherein said exogenous promoter has been inserted by homologous recombination and / or by a RNA-guided nuclease, such as Mad7 or other CRISPR nucleases, such as CRISPR-Cas9.

[0135] 18. An engineered cell of any of previous embodiments, wherein said endogenous gene of interest encodes for a protein comprising more than 500 amino acids, more than 700 amino acids, more than 800 amino acids, more than 1000 amino acids, more than 1500 amino acids, more than 1800 amino acids or more than 2000 amino acids.

[0136] 19. An engineered cell of any of previous embodiments, wherein said endogenous gene of interest comprises a coding sequence (CDS) wherein said coding sequence comprises more than 3000 nucleotides, such as more than 4500 nucleotides, more than 5400 nucleotides, or more than 6000 nucleotides.

[0137] 20. An engineered cell of any of previous embodiments, wherein said endogenous gene of interest is selected from the group consisting of CD35, HLA-G, HLA-E, HLA-F, CD46, CD59, CD47, CD55 and PD-L1.

[0138] 21. An engineered cell of any of previous embodiments, wherein said endogenous gene of interest is selected from the group consisting of CD35, HLA-G, HLA-E, HLA-F, CD46, CD59, CD47, CD55 and PD-L1 and said exogeneous promoter is a ubiquitous and constitutive promoter, such as UbC promoter.

[0139] 22. An engineered cell of any of previous embodiments, wherein said endogenous gene of interest is CD35.

[0140] 23. An engineered cell of any of previous embodiments, wherein said endogenous gene of interest is CD55.

[0141] 24. An engineered cell according to any one of previous embodiments, wherein said cell further comprises overexpression of one or more further genes.

[0142] 25. An engineered cell according to embodiment 23, wherein said one or more further genes is selected from the list consisting of HLA-G, HLA-E, HLA-F, CD46, CD59, CD47, CD55, CD35 and / or PD-L1 genes 26. An engineered cell of embodiment 21 , wherein said cell further comprises overexpression one or more of HLA-G, HLA-E, HLA-F, CD46, CD59, CD47, CD55 and PD- L1.

[0143] 27. An engineered cell of embodiment 22, wherein said cell further comprises overexpression of one or more of HLA-G, HLA-E, HLA-F, CD46, CD59, CD47, CD35 and PD-L1.

[0144] 28. An engineered cell of any of previous embodiments, wherein said cell is a B2M- / - cell.

[0145] 29. An engineered cell of any of previous embodiments, wherein said cell is a CIITA- / - cell.

[0146] 30. An engineered cell of any of previous embodiments, wherein said cell comprises a B2M-HLA gene.

[0147] 31. An engineered cell according to any one of previous embodiments, wherein said cell is B2M- / -, is CIITA- / - and / or comprises a B2M-HLA gene.

[0148] 32. An engineered cell according to any one of embodiments 29 to 30, wherein said B2M-HLA gene is one or more of B2M-HLA-E, B2M-HLA-F and B2M-HLA-G genes.

[0149] 33. An engineered cell of any of previous claims, wherein said endogenous gene is CD35, said exogenous promoter is UbC promotor and is located upstream of the start codon of said endogenous gene interest, and said cell is B2M- / -, CIITA- / - and comprises a B2M- HLA gene.

[0150] 34. An engineered cell of any of previous claims, wherein said endogenous gene interest is CD35, said exogenous promoter is UbC promoter, and said exogeneous promoter is located within a region from about 500 nucleotides upstream of the start codon up to 0 nucleotide before the start codon of said endogenous gene interest.

[0151] 35. An engineered cell according to any one of previous embodiments, wherein said cell is a mammalian cell, and / or is a stem cell or is at a differentiated stage, such as a pancreatic beta cell, an INS+ and NKX6.1+ double positive cell or a C-peptide+ / NKX6.1+ double positive cell, an insulin producing cell, an in vitro derived beta-like cell, a pancreatic endocrine cell or an endocrine cell, an endocrine progenitor cell or a NGN3+ / NKX2.2+ double positive cell, a neural cell, such as a neuron, an interneuron cell, an oligodendrocyte, an astrocyte, a dopaminergic cell, an exosome cell, an immune cell, such as a T cell, a NK cell, a macrophage, a dendritic cell, a hepatocyte, a stellate cell, a fibroblast, a keratinocyte or a hair cell, an inner ear cell, an intestinal cell or organoid cell, a nephroid cell or another kidney-related cell, a cortical neural progenitor cell, a cardiomyocyte, a retinal cell, a photoreceptor cell, a retinal pigment epithelium cell, or a mesenchymal stem cell. 36. An engineered cell according to any one of previous embodiments, for use in cell therapy.

[0152] 37. An engineered cell according to embodiment 36, for use in the treatment, the cure, or the prevention of a chronic disease or of an acute disease.

[0153] 38. An engineered cell according to embodiment 37, wherein said chronic disease is selected from the group consisting of diabetes, type 1 diabetes, type 2 diabetes, dry macular degeneration, retinitis pigmentosa, neurological disease, Parkinson’s disease, heart disease, tissue fibrosis, cirrhosis, hearing loss, corneal blindness, stroke, chronic heart failure, chronic kidney disease, liver diseases (e.g., NASH), muscle disorders, rare disorders, cardiovascular diseases, hematopoietic disorders, endocrine disorders, Alzheimer’s disease and cancer.

[0154] 39. An engineered cell according to embodiment 37, wherein said acute disease comprises bacterial lung infections, such as ventilator acquired bacterial pneumonia and hospital acquired bacterial pneumonia.

[0155] 40. An engineered cell according to embodiment 37, wherein said cell is a beta cell, an INS+ and NKX6.1+ double positive cell or a C-peptide+ / NKX6.1+ double positive cell, an insulin producing cell, an in vitro derived beta-like cell, a pancreatic endocrine cell or an endocrine cell, an endocrine progenitor cell or a NGN3+ / NKX2.2+ double positive cell and is for use in the treatment of type 1 diabetes or type 2 diabetes; or said cell is a neural cell, such as a neuron, an interneuron cell, an oligodendrocyte, an astrocyte, a stellate cell or a neural progenitor cell are suitable for the treatment of neurological diseases; a dopaminergic cell, such as a dopaminergic ventral midbrain neural cell, and is for use in the treatment of Parkinson’s disease; or said cell is an immune cell, such as a T cell, a NK cell, a macrophage, a dendritic cell and is for use in the treatment of cancer; or said cell is a nephroid cell or another kidney-related cell and is for use in the treatment of chronic kidney disease; or said cell is a cardiomyocyte or a mesenchymal stem cell and is for use in the treatment of heart disease, stroke and / or chronic heart failure; or said cell is a hepatocyte and is for use in the treatment of cirrhosis and / or liver diseases e.g., NASH; or said cell is a retinal cell, a photoreceptor cell or a retinal pigment epithelium cell and is for use in the treatment of dry macular degeneration, retinitis pigmentosa and / or corneal blindness; or said cell is a fibroblast, a keratinocyte, a hair cell, or a mesenchymal stem cell and is for use in the treatment of tissue fibrosis; or said cell is an inner ear cell and is for use in the treatment of hearing loss; or said cell is an endocrine cell, an endocrine progenitor cell and is for use in the treatment of endocrine disorders; or said cell is a myocyte and is for use in the treatment of muscle disorders; or said cell is a cardiomyocyte and is for use in the treatment of cardiovascular diseases; or said cell is a macrophage and is for use in the treatment of hematopoietic disorders

[0156] 41. An engineered cell of any of previous embodiments, wherein: said endogenous gene interest is CD35, and said exogenous promoter has been inserted using a RNA-guided nuclease, preferably MAD7, and a pair of guide RNAs.

[0157] 42. An engineered cell of embodiment 41 , wherein one of said gRNAs comprises the sequence ACCACAGCUUCCCCUUCAUGGG (gRNA1), and the other gRNA comprises the sequence GGGAGAAUGGGGGCCUCUUCUC (gRNA4).

[0158] 43. An engineered cell of embodiment 41 or 42, wherein one of said gRNAs targets a DNA sequence comprising ACCACAGCTTCCCCTTCATGGG sequence (gRNA1), and the other gRNA targets a DNA sequence comprising GGGAGAATGGGGGCCTCTTCTC sequence (gRNA4).

[0159] 44. An engineered cell of embodiment 41 , 42 or 43, wherein said exogeneous promoter is UbC promoter, and said exogeneous promoter is located within a region from about 500 nucleotides upstream of the start codon up to 0 nucleotide before the start codon of said endogenous gene interest.

[0160] 45. An engineered mammalian cell according to any of the previous embodiments, wherein said cell comprises overexpression of CD35 gene, of CD55 gene, of PD-L1 gene, of CD35 and CD55 genes, of CD35 and PD-L1 genes, of CD55 and PD-L1 genes or of CD35, CD55 and PD-L1 genes.

[0161] 46. An engineered mammalian cell comprising overexpression of CD35 gene.

[0162] 47. An engineered mammalian cell comprising overexpression of CD55 gene.

[0163] 48. An engineered mammalian cell comprising overexpression of PD-L1 gene.

[0164] 49. An engineered mammalian cell comprising overexpression of CD35 and CD55 genes.

[0165] 50. An engineered mammalian cell comprising overexpression of CD35 and PD-L1 genes.

[0166] 51. An engineered mammalian cell comprising overexpression of CD55 and PD-L1 genes.

[0167] 52. An engineered mammalian cell comprising overexpression of CD35, CD55 and PD- L1 genes.

[0168] Examples Example 1 : Generation of E1C3 cells with a continuously activated CD35 expression and gRNA screening to activate CD35

[0169] For the generation of a human embryonic stem cell line with a continuously activated CD35 gene expression, in other words, a constitutive expression of CD35, cells from the human embryonic stem cell line E1C3 (Sidhu K.S., Ryan J.P., Tuch B.E. Derivation of a new human embryonic stem cell line, Endeavour-1 , and its clonal propagation. Stem Cells Dev. 17:41-51(2008)) together with the CRISPR-MAD7 nuclease and associated guide RNA (gRNA) molecules were used for the targeted insertion of an exogenous promoter UbC upstream of the CD35 start codon. Five gRNAs were designed to target the region located 500bp upstream of the CD35 start codon (Table 1).

[0170] The five gRNAs were synthesised by the company Integrated DNA Technologies® (IDT) and screened for efficiency in E1C3 cells using the electroporation protocol Neon Transfection system recommended by the manufacturer Thermo Fischer Scientific®. In brief, MAD7 gRNAs and MAD7 nuclease were diluted to an end concentration of 75pM and 10 pg / pl in IDTE buffer (Nuclease Free Duplex buffer from IDT), respectively. To form the RNP (ribonucleoprotein) complex, 1 l gRNA and 1 pl MAD7 were mixed in sterile Eppendorf® tubes, incubated for 20min at room temperature (RT), and stored on ice after, if not proceeded directly with the transfection. For the transfection, cultivated E1C3 cells were harvested and washed. In total, 300,000 of these cells were resuspended in 9pl buffer R (Neon Transfection® system kit) and mixed with 1 pl UbC promotor DNA fragment (PCR generated DNA fragment, 200 ng / pl in IDTE buffer), and 2pl of the RNP complex. Immediately after, cells were electroporated using the Neon Transfection® system with the setting of program P13 (2 pulses of 1100V and 20ms pulse width) and let to regenerate for 10 minutes in the electroporation needle. Cells were released from the needle into a 15 ml tube after and left to rest for another 10 minutes at RT to continue cell regeneration. For cultivation, cells were transferred to a 12-well dish and incubated with a ROCK kinase inhibitor and iMatrix (Neon Transfection® system kit) added to the cultivating medium (3 mL NutriStem medium + 6 pL ROCK-inhibitor Y2763+ 5 pL iMatrix 511). A medium change was performed 2 hours after transfection using the same medium as before. After 48h posttransfection, cells were harvested to analyse the cutting efficiency of the five gRNAs by using the IDAA method (Indel Detection by Amplicon Analysis). The results of the cutting efficiency are reported in Table 1.

[0171] Table 1. Sequence of gRNAs designed to target the region 500bp upstream of CD35 start codon and their cutting efficiency analysed by IDAA method after transfection.

[0172]

[0173] Cells transfected with the guide RNAs CD35acti.gRNA1 and CD35acti.gRNA4 were selected for further analyses due to their high cutting efficiency (>20%). In the first step to generate single-cell clones, cells transfected with both gRNAs were sorted using the flow cytometry technique fluorescence-activated cell sorting (FACS) and anti-CD35 monoclonal antibody E11 and 7G9, respectively. Both monoclonal antibodies are validated for cell surface CD35 detection. This step allowed to bulk-sort cells that overexpress endogenous CD35 due to a successful integration of exogenous UbC promotor 500bp upstream of the CD35 start codon. Bulk-sorted cells were cultivated, and on day 10, single-cell sorted into 96 well plates using a Sony Sorter SH800® and anti-CD35 monoclonal antibody E11 and 7G9, respectively. Surviving clones were further cultivated in duplicates, and cells of one duplicate were collected for Next-Generation Sequencing analysis (Azenta company) to confirm a biallelic integration of UbC promoter at the target site. Three positive clones (EST 14#9, EST13-F3, and EST15#13) were selected and further expanded to confirm constitutive cell surface expression of CD35 by using the FACS method and anti-CD35 monoclonal antibody E11 and 7G9, respectively. The analysis confirmed in all three positive clones an increased CD35 protein cell surface expression as a result of the expression of CD35 endogenous gene under the control of the integrated exogenous UbC promoter. Cells expressing endogenous CD35 under the control of the endogenous CD35 promoter were used as control. These cells were transfected with the same gRNAs and MAD7 except without the UbC DNA fragment and cultivated and analysed under the same protocol. The control cell population is indicated as “WT” (wildtype) in the graphs of Fig.2 and Fig.3, respectively. As can be seen in Fig.2, both antibody staining signals, anti-CD35 monoclonal antibody E11 (Fig2A) and anti-CD35 monoclonal antibody 7G9 (Fig.2B), indicate an increased endogenous CD35 cell surface expression under the control of the exogenous UbC promoter in EST14#9 clone cells compared to the endogenous CD35 cell surface expression in control cells (WT). These results performed on living cells confirm that the endogenous CD35 gene expression was highly activated under the control of the exogenous UbC promoter in cells of EST14#9 clone compared to the CD35 gene expression under the activity of the native CD35 gene promotor in control cells (WT).

[0174] As can be seen in Fig.3, cells of the two other clones, EST13-F3 (Fig.3A) and EST15#13 (Fig.3B), showed an increased cell surface expression of endogenous CD35 under the activity of the exogenous UbC promotor compared to the expression of endogenous CD35 under its native promotor activity in control cells (WT). For the detection of endogenous CD35 cell surface expression cells of both clones, EST13-F3 and EST15#13, and control cells the anti-CD35 monoclonal antibody 7G9 was used.

[0175] These results performed on living cells confirm that the endogenous CD35 gene expression was highly activated under the control of the exogenous UbC promotor in cells of all three clones, EST14#9 clone, EST13-F3, and EST15#13, compared to the CD35 gene expression under the activity of the native CD35 gene promotor in control cells (WT). Thereby showed cells of clone EST14#9 the highest expression compared to the other two clones EST13-F3 and EST15#13.

[0176] Example 2: gRNA screening to activate PDL1

[0177] For the generation of E1C3 cells with constitutive PDL1 gene expression, the CRISPR-MAD7 nuclease and associated gRNAs have been used for the targeted insertion of an exogenous promoter UbC upstream of the PDL1 start codon. Four gRNAs were designed to target the region located 500bp upstream of the PDL1 start codon (Table 2). gRNA generation, cell transfection and cutting efficiency analysis were as described in Example 1 . The cutting efficiency data are reported in Table 2.

[0178] Table 2. gRNA sequences targeting the region 500bp upstream of PDL1 start codon and cutting efficiency analysed by IDAA method after transfection.

[0179]

[0180] Example 3: gRNA screening to activate CD55

[0181] For the generation of E1C3 cells with constitutive CD55 gene expression, the CRISPR- MAD7 nuclease and associated gRNAs have been used for the targeted insertion of an exogenous promoter UbC upstream of the CD55 start codon. Five gRNAs were designed to target the region located 500bp upstream of the CD55 start codon (Table 3). gRNA generation, cell transfection and cutting efficiency analysis were as described in Example 1 . The cutting efficiency data are reported in Table 3.

[0182] Table 3. gRNA sequences targeting upstream 500bp region of CD55 start codon and cutting efficiency analysed by IDAA method after transfection.

[0183] Example 4: gRNA screening to activate CD47

[0184] For the generation of E1C3 cells with constitutive CD47 gene expression, the CRISPR- MAD7 nuclease and associated gRNAs have been used for the targeted insertion of an exogenous promoter UbC upstream of the CD47 start codon. Seven gRNAs were designed to target the region located 500bp upstream of the CD47 start codon (Table 4). gRNA generation, cell transfection and cutting efficiency analysis were as described in Example 1 .

[0185] The cutting efficiency data are reported in Table 4.

[0186] Table 4. gRNA sequences targeting upstream 500bp region of CD47 start codon and cutting efficiency analysed by IDAA method after transfection.

[0187] Example 5: gRNA screening to activate HLA-G

[0188] For the generation of E1C3 cells with constitutive HLA-G gene expression, the CRISPR- MAD7 nuclease and associated gRNAs have been used for the targeted insertion of an exogenous promoter UbC upstream of the HLA-G start codon. Five gRNAs were designed to target the region located 500bp upstream of the HLA-G start codon (Table 5). gRNA generation, cell transfection and cutting efficiency analysis were as described in Example 1 . The cutting efficiency data are reported in Table 5.

[0189] Table 5. gRNA sequences targeting upstream 500bp region of HLA-G start codon and cutting efficiency analysed by IDAA method after transfection.

[0190]

[0191] Example 6: gRNA screening to activate HLA-E

[0192] For the generation of E1C3 cells with constitutive HLA-E gene expression, the CRISPR- MAD7 nuclease and associated gRNAs have been used for the targeted insertion of an exogenous promoter UbC upstream of the HLA-E start codon. Six gRNAs were designed to target the region located 500bp upstream of the HLA-E start codon (Table 6). gRNA generation, cell transfection and cutting efficiency analysis were as described in Example 1 . The cutting efficiency data are reported in Table 6.

[0193] Table 6. gRNA sequence targeting upstream 500bp region of HLA-E start codon and cutting efficiency analysed by IDAA method after transfection.

[0194] Example 7

[0195] Promoter sequences as provided by SnapGene®:

[0196] • Simian virus 40 early promoter (SV40):

[0197] GGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAA

[0198] TTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAA

[0199] AGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCC

[0200] CCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTA

[0201] TGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTT

[0202] TTTGGAGGCCTAGGCTTTTGCAAA (SEQ ID NO 33)

[0203] • cytomegalovirus immediate-early promoter (CMV):

[0204] GTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGAT

[0205] TTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGG

[0206] GACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGT

[0207] ACGGTGGGAGGTCTATATAAGCAGAGCT (SEQ ID NO 34)

[0208] • human Ubiquitin C promoter (UbC):

[0209] GGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGGGCGCCCCCCTCCTCACGGCGAGC

[0210] GCTGCCACGTCAGACGAAGGGCGCAGGAGCGTTCCTGATCCTTCCGCCCGGACGCTC

[0211] AGGACAGCGGCCCGCTGCTCATAAGACTCGGCCTTAGAACCCCAGTATCAGCAGAAGG

[0212] ACATTTTAGGACGGGACTTGGGTGACTCTAGGGCACTGGTTTTCTTTCCAGAGAGCGGA

[0213] ACAGGCGAGGAAAAGTAGTCCCTTCTCGGCGATTCTGCGGAGGGATCTCCGTGGGGC

[0214] GGTGAACGCCGATGATTATATAAGGACGCGCCGGGTGTGGCACAGCTAGTTCCGTCGC

[0215] AGCCGGGATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCGTCACTTGGTGAGT

[0216] TGCGGGCTGCTGGGCTGGCCGGGGCTTTCGTGGCCGCCGGGCCGCTCGGTGGGACG

[0217] GAAGCGTGTGGAGAGACCGCCAAGGGCTGTAGTCTGGGTCCGCGAGCAAGGTTGCCC

[0218] TGAACTGGGGGTTGGGGGGAGCGCACAAAATGGCGGCTGTTCCCGAGTCTTGAATGGA

[0219] AGACGCTTGTAAGGCGGGCTGTGAGGTCGTTGAAACAAGGTGGGGGGCATGGTGGGC

[0220] GGCAAGAACCCAAGGTCTTGAGGCCTTCGCTAATGCGGGAAAGCTCTTATTCGGGTGA

[0221] GATGGGCTGGGGCACCATCTGGGGACCCTGACGTGAAGTTTGTCACTGACTGGAGAAC

[0222] TCGGGTTTGTCGTCTGGTTGCGGGGGCGGCAGTTATGCGGTGCCGTTGGGCAGTGCA

[0223] CCCGTACCTTTGGGAGCGCGCGCCTCGTCGTGTCGTGACGTCACCCGTTCTGTTGGCT

[0224] TATAATGCAGGGTGGGGCCACCTGCCGGTAGGTGTGCGGTAGGCTTTTCTCCGTCGCA

[0225] GGACGCAGGGTTCGGGCCTAGGGTAGGCTCTCCTGAATCGACAGGCGCCGGACCTCT GGTGAGGGGAGGGATAAGTGAGGCGTCAGTTTCTTTGGTCGGTTTTATGTACCTATCTT CTTAAGTAGCTGAAGCTCCGGTTTTGAACTATGCGCTCGGGGTTGGCGAGTGTGTTTTG TGAAGTTTTTTAGGCACCTTTTGAAATGTAATCATTTGGGTCAATATGTAATTTTCAGTGT TAGACTAGTAAATTGTCCGCTAAATTCTGGCCGTTTTTGG CTTTTTTGTTAGAC (SEQ ID NO 35)

[0226] • human elongation factor 1a promoter (EF1A):

[0227] (GCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTG

[0228] GGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGG

[0229] GAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATA

[0230] TAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAG

[0231] GTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCG

[0232] TGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTT GGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTT GAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTC

[0233] GCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTG

[0234] CGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGT

[0235] ATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGT

[0236] TCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCA

[0237] AGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTG GGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCC CGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGG

[0238] GTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGA

[0239] CTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGT

[0240] ACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGT GGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCC CTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTC

[0241] TTCCATTTCAGGTGTCGTGA (SEQ ID NO 36)

[0242] • mouse phosphoglycerate kinase 1 promoter (PGK):

[0243] GGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCT

[0244] GGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCGGT

[0245] AGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCC TAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGA

[0246] AGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGG GTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGA GGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGC GGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTC TGCCGCGCTGTTCTCCTCTT CCTCATCTCCGGGCCTTTCG (SEQ ID NO 37)

[0247] • chicken p-Actin promoter coupled with CMV early enhancer (CAG): GCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCC ATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACG TCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATAT GCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCC CAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCT ATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTC CCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGG GGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGG GGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCC TTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGC G (SEQ ID NO 38)

[0248] While certain features of the invention have been illustrated and described herein, many modifications, substitutions, changes, and equivalents will now occur to those of ordinary skill in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention.

Claims

AMENDED CLAIMS received by the International Bureau on 23 September 2024 (23.09.2024)I. An engineered mammalian cell, said cell comprising an endogenous gene of interest and an exogenous promoter, wherein said endogenous gene is under the control of said exogenous promoter.

2. An engineered cell of claim 1 , for use in cell therapy.

3. An engineered cell of any of previous claims, wherein said exogeneous promoter induces transcription initiation of said endogenous gene at a higher level than the native endogenous promoter for said endogenous gene.

4. An engineered cell of any of previous claims, wherein said exogeneous promoter is a constitutive and / or a ubiquitous promoter.

5. An engineered cell of any of previous claims, wherein said exogeneous promoter is selected from simian virus 40 early promoter (SV40), cytomegalovirus immediate-early promoter (CMV), human Ubiquitin C promoter (UBC), human elongation factor 1a promoter (EF1A), mouse phosphoglycerate kinase 1 promoter (PGK), and chicken p-Actin promoter coupled with CMV early enhancer (CAG).

6. An engineered cell of any of previous claims, wherein said exogeneous promoter is located upstream of said endogenous gene of interest.

7. An engineered cell of any of previous claims, wherein said exogenous promoter has been inserted by homologous recombination and / or by a RNA-guided nuclease, such as Mad7 or CRISPR, such as CRISPR / Cas9.

8. An engineered cell of any of previous claims, wherein said endogenous gene of interest encodes for a protein comprising more than 500 amino acids, more than 700 amino acids, more than 800 amino acids, more than 1000 amino acids, more than 1500 amino acids, more than 1800 amino acids or more than 2000 amino acids, and / or said endogenous gene of interest comprises a coding sequence (CDS) wherein said coding sequence comprises more than 3000 nucleotides, such as more than 4500 nucleotides, more than 5400 nucleotides, more than 6000 nucleotides or more than 7000 nucleotides.

9. An engineered cell of any of previous claims, wherein said endogenous gene of interest is selected from the group consisting of CD35, HLA-G, HLA-E, HLA-F, CD46, CD59, CD47, CD55 and PD-L1.

10. An engineered cell of any of previous claims, wherein said endogenous gene of interest is CD35.I I . An engineered cell of any of previous embodiments, wherein: said endogenous gene interest is CD35,33AMENDED SHEET (ARTICLE 19)and said exogenous promoter has been inserted using a RNA- guided nuclease, preferably MAD7, and a pair of guide RNAs.

12. An engineered cell of embodiment 41 , wherein one of said gRNAs comprises the sequence ACCACAGCUUCCCCUUCAUGGG (gRNA1), and the other gRNA comprises the sequence GGGAGAAUGGGGGCCUCUUCUC (gRNA4).

13. An engineered cell of embodiment 41 or 42, wherein one of said gRNAs targets a DNA sequence comprising ACCACAGCTTCCCCTTCATGGG sequence (gRNA1), and the other gRNA targets a DNA sequence comprising GGGAGAATGGGGGCCTCTTCTC sequence (gRNA4).

14. An engineered cell according to any one of previous claims, wherein said cell is a mammalian cell, and / or is a stem cell or is at a differentiated stage, such as a pancreatic beta cell, an INS+ and NKX6.1+ double positive cell or a C- peptide+ / NKX6.1+ double positive cell, an insulin producing cell, an in vitro derived beta-like cell, a pancreatic endocrine cell or an endocrine cell, an endocrine progenitor cell or a NGN3+ / NKX2.2+ double positive cell, a neural cell, such as a neuron, an interneuron cell, an oligodendrocyte, an astrocyte, a dopaminergic cell, an exosome cell, an immune cell, such as a T cell, a NK cell, a macrophage, a dendritic cell, a hepatocyte, a stellate cell, a fibroblast, a keratinocyte or a hair cell, an inner ear cell, an intestinal cell or organoid cell, a nephroid cell or another kidney-related cell, a cortical neural progenitor cell, a cardiomyocyte, a retinal cell, a photoreceptor cell, a retinal pigment epithelium cell, or a mesenchymal stem cell.

15. An engineered cell of any of previous claims, wherein: said endogenous gene interest is CD35, and said exogenous promoter is UbC promoter, and said exogeneous promoter is located within a region from about 500 nucleotides upstream of the start codon up to 0 nucleotide before the start codon of said endogenous gene interest.34AMENDED SHEET (ARTICLE 19)