Extracellular matrix (ECM) mimetics, compositions thereof, and methods of making and using the same

Abstract

The present disclosure provides extracellular matrix (ECM) mimetics, compositions thereof, and methods of making and using the same. The present disclosure further relates to methods of generating functionally distinct T cell populations suitable for adoptive cell therapy, for example, by selectively tuning the mechanical properties of extracellular matrix (ECM) mimetics.

Description

[0001]Attorney Docket No.: 117823-35320 (HU 9279) EXTRACELLULAR MATRIX (ECM) MIMETICS, COMPOSITIONS THEREOF, AND METHODS OF MAKING AND USING THE SAME RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No.63 / 456,760, filed on April 3, 2023, the contents of which are hereby incorporated by reference in their entirety. GOVERNMENT SUPPORT This invention was made with government support under R01 FD006589 awarded by U.S. Food and Drug Administration (FDA) and under CA214369 and CA223255 awarded by National Institutes of Health (NIH). The government has certain rights in this invention. BACKGROUND T cells play a critical role in the immune response to tumors and are characterized by their antigen specificity and long-term memory potential, which establishes protective immunity (Reddy, S. T. Nature.547:36–38, 2017; Chaplin, D. D. J Allergy Clin Immunol.125:S3-23, 2010; Adu-Berchie, K. et al. Acc. Chem. Res.53:1749–1760, 2020). Adoptive T cell therapy is an emerging area of immunotherapy where T cells are harvested from a patient, manipulated ex vivo, and reinfused into the patient (Met, Ö. et al. Semin Immunopathol.41:49–58, 2019). These T cells can either be tumor infiltrating lymphocytes (TILs), which are isolated from tumors, or more commonly autologous polyclonal T cells isolated from apheresed peripheral blood mononuclear cells (PBMCs) (June, C. H. et al. Science Translational Medicine.7:280ps7-280ps7, 2015). Autologous T cells can be genetically modified into T cell receptor (TCR) T cells or Chimeric Antigen Receptor (CAR) T cells based on whether the antigen being recognized is in the presence or absence of major histocompatibility complex (MHC) respectively (June, C. H. et al. Science Translational Medicine.7:280ps7-280ps7, 2015). While T cell therapy has shown remarkable promise, especially in hematological cancers, the efficacy of T cell therapies can be enhanced by generating T cell populations that provide both immediate and durable long-term protection against cancer (June, C. H. et al. Science Translational Medicine.7:280ps7-280ps7, 2015; Pampusch, M. S. et al. Mol Ther Methods Clin Dev.16:1–10, 2020; Kalos, M. et al. Sci Transl Med.3:95ra73, 2011; Redeker, A. et al. Front. Immunol.7:345, 2016). The generation of CAR T cells and genetically modified TCR T cells involve ex vivo stimulation of isolated T cells prior to genetic manipulation (Redeker, A. et al. Front. Immunol.7:345, 2016; Levine, B. L. et al. Mol Ther Methods Clin Dev.4:92-101, 2017). Approaches to T cell stimulation have evolved from the labor-intensive use of purified autologous antigen presenting cells (APCs) (Adu-Berchie, K. et al. Acc. Chem. Res.53:1749–1760, 2020; Hunder, N. N. et al. N Engl J Med.358(25):2698-2703, 2008) to more efficient artificial APCs presenting aCD3 / aCD28 1 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) monoclonal antibodies, supplemented with growth factors such as IL-2 for T cell expansion (Levine, B. L. et al. Mol Ther Methods Clin Dev.4:92-101, 2017; Cheung, A. S. et al. Nat Biotechnol.36:160– 169, 2018). Activated T cells are incubated with either viral vectors or non-viral transposon systems for stable CAR or TCR expression (McGarrity, G. J. et al. J Gene Med.15:78-82, 2013; Huls, M. H. et al. J Vis Exp.72:e50070, 2013), or mRNA for more transient expression (Beatty, G. L. et al. Cancer Immunol Res.2:112–120, 2014). Most approaches aiming to generate various T cell populations in vitro are limited to altering the strength and duration of T cell stimulation (Redeker, A. et al. Front. Immunol.7:345, 2016; Gett, A. V., Sallusto, F. et al. Nat Immunol.4:355–360, 2003). Thus, there remains a need in the art for new approaches for tuning T cell phenotype for a given stimulation regimen and broadening the repertoire of T cells available for therapy. SUMMARY The present disclosures provides extracellular matrix (ECM) mimetics, compositions thereof, and methods of making and using the same. The present disclosure further relates to methods of generating functionally distinct T cell populations suitable for adoptive cell therapy, e.g., by selectively tuning the mechanical properties of extracellular matrix (ECM) mimetics. The present invention is based, at least in part, on the surprising discovery that the extracellular matrix (ECM) mimetics according to the present disclosure can mimic the mechanical properties of the tissue microenvironment, and can be used to modulate T cell phenotype and function, and the AP-1 pathway, which is an important regulator of T cell activation, differentiation, and exhaustion. The ECM mimetics can be used to generate functionally distinct T cell populations by selectively and independently tuning matrix stiffness and matrix viscoelasticity, e.g., by utilizing a combination of non-covalent crosslinking (e.g., physical crosslinking) and covalent crosslinking (e.g., click crosslinking). Specifically, it was determined that matrix viscoelasticity can act as an important driver of these phenotypic differences. For example, T cells cultured in slow relaxing extracellular matrix (ECM) mimetics were found to have higher expression of activation and inhibitory markers, while T cells cultured in fast relaxing matrices were found to have higher expression of memory markers. Further, in certain embodiments, it was determined that slow relaxing ECM mimetics can be used to generate T cells with a rapid response to antigen, while fast relaxing ECM mimetics can be used to generate T cells with a slower cytotoxic response. It was also surprisingly determined that functionally distinct T cell populations can be generated by tuning matrix viscoelasticity independently of matrix stiffness (e.g., initial elastic modulus) by utilizing a combination of non-covalent (e.g., physical crosslinks) and permanent covalent bonds (e.g., covalent click crosslinks). Specifically, it was determined that adding covalent bonds to regions of the network that are already in close spatial contact (e.g., already crosslinked physically) leads to minimal changes in matrix stiffness (e.g., initial elastic modulus), but dramatic alterations in the viscoelastic properties (e.g., rate of stress relaxation). The sequential crosslinking 2 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) approach described herein, in which non-covalent occurs first, followed by local covalent crosslinking using small biorthogonal crosslinking molecules, was demonstrated to preserve a consistent fibrous protein (e.g., collagen) architecture and pore size distribution. The ECM mimetics described herein utilize a crosslinking mechanism that successfully decouples matrix stiffness from viscoelasticity, in which the crosslinkers themselves were shown to have minimal impact on the phenotype of T cells. Accordingly, the present disclosure provides extracellular matrix (ECM) mimetics, compositions thereof, and methods of using the same for generating functionally distinct T cell populations by selectively tuning ECM viscoelasticity. The present disclosure further provides methods of manufacturing T cell products comprising modulating ECM viscoelasticity to generate desired T cell phenotypes for specific therapeutic applications. Accordingly, in one aspect, the present invention provides an extracellular matrix (ECM) mimetic, comprising a collagen hydrogel, wherein the collagen hydrogel comprises non-covalent crosslinking. In some embodiments, the hydrogel is a fast relaxing hydrogel characterized by being substantially free of covalent crosslinking. In some embodiments, the fast relaxing hydrogel comprises a level of covalent crosslinking of no more than about 5% covalent crosslinking. In some embodiments, the fast relaxing hydrogel comprises a level of covalent crosslinking of no more than about 1%, no more than about 2%, no more than about 3%, no more than about 4%, or no more than about 5% covalent crosslinking. In some embodiments, the fast relaxing hydrogel comprises a level of covalent crosslinking of about 1%, about 2%, about 3%, about 4%, or about 5% covalent crosslinking. In some embodiments, the hydrogel comprises covalent crosslinking. In some embodiments, the covalent crosslinking is between a modified collagen comprising a first click reagent and a bioorthogonal crosslinker comprising a second click reagent. In some embodiments, the hydrogel is a slow relaxing hydrogel characterized by comprises a level of covalent crosslinking of about 5% to about 100%. In some embodiments, the level of covalent crosslinking is about 25% to about 50%. In some embodiments, the level of covalent crosslinking is about 25% to about 75%. In some embodiments, the level of covalent crosslinking is about 50% to about 75%. In some embodiments, the level of covalent crosslinking is about 75% to about 100%. In some embodiments, the level of covalent crosslinking is about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%. In some embodiments, the level of non-covalent crosslinking allows for tuning of matrix stiffness. In some embodiments, the level of covalent crosslinking allows for tuning of matrix viscoelasticity. In some embodiments, the hydrogel is configured to allow for independent tuning of matrix stiffness and matrix viscoelasticity. In some embodiments, the collagen is a modified collagen comprising a first click reagent. In some embodiments, the collagen is present in an amount of about 1 mg / mL to about 10 mg / mL. In 3 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) some embodiments, the collagen is present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 2.5 mg / mL. In other embodiments, the collagen is present in an amount of at least about 3 mg / mL. In some embodiments, the collagen is present in an amount of about 3 mg / mL to about 5 mg / mL. In some embodiments, the hydrogel further comprises a bioorthogonal crosslinker comprising a second click reagent. In some embodiments, the bioorthogonal crosslinker comprises a first end and a second end, wherein each end comprises a second click reagent. In some embodiments, the bioorthogonal crosslinker is a methyltetrazine-(PEG)5-methyltetrazine crosslinker. In some embodiments, the bioorthogonal crosslinker is present in an amount of about 1 µM to about 500 µM. In some embodiments, the bioorthogonal crosslinker is present in an amount of about 1 µM, about 5 µM, about 10 µM, about 15 µM, about 20 µM, about 25 µM, about 30 µM, about 35 µM, about 40 µM, about 45 µM, about 50 µM, about 55 µM, about 60 µM, about 65 µM, about 70 µM, about 75 µM, about 80 µM, about 85 µM, about 90 µM, about 95 µM, about 100 µM, about 105 µM, about 110 µM, about 115 µM, about 120 µM, about 125 µM, about 130 µM, about 135 µM, about 140 µM, about 145 µM, about 150 µM, about 155 µM, about 160 µM, about 165 µM, about 170 µM, about 175 µM, about 180 µM, about 185 µM, about 190 µM, about 195 µM, about 200 µM, about 205 µM, about 210 µM, about 215 µM, about 220 µM, about 225 µM, about 230 µM, about 235 µM, about 240 µM, about 245 µM, about 250 µM, about 255 µM, about 260 µM, about 265 µM, about 270 µM, about 275 µM, about 280 µM, about 285 µM, about 290 µM, about 295 µM, about 300 µM, about 305 µM, about 310 µM, about 315 µM, about 320 µM, about 325 µM, about 330 µM, about 335 µM, about 340 µM, about 345 µM, about 350 µM, about 355 µM, about 360 µM, about 365 µM, about 370 µM, about 375 µM, about 380 µM, about 385 µM, about 390 µM, about 395 µM, about 400 µM, about 405 µM, about 410 µM, about 415 µM, about 420 µM, about 425 µM, about 430 µM, about 435 µM, about 440 µM, about 445 µM, about 450 µM, about 455 µM, about 460 µM, about 465 µM, about 470 µM, about 475 µM, about 480 µM, about 485 µM, about 490 µM, about 495 µM, or about 500 µM. In some embodiments, the bioorthogonal crosslinker is present at a ratio of about 1:1 and about 1:100 crosslinker : collagen. In some embodiments, the first click reagent and the second click reagent are covalently crosslinked. In some embodiments, the first click reagent and the second click reagent are independently selected from the group consisting of an azide moiety, an alkyne moiety, a dibenzocyclooctyne moiety, a tetrazine (Tz) moiety, a trans-cyclooctene moiety, a vinyl moiety, a methylcyclopropene moiety, a norbornene (Nb) moiety, and combinations thereof. In some embodiments, the first click reagent and the second click reagent are covalently crosslink via a click chemistry reaction selected from the group consisting of a Cu(I)-catalyzed azide – alkyne click chemistry reaction (CuAAC), a strain-promoted azide – alkyne click chemistry reaction (SPAAC), a tetrazine – trans-cyclooctene (TCO) ligation, and combinations thereof. In some embodiments, the first click reagent and the second click reagent are covalently crosslink via an inverse electron demand 4 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) Diels-Alder (iEDDA) click reaction between tetrazine (Tz) and norbornene (NB) moieties. In some embodiments, the first click reagent comprises a norbornene (Nb) moiety and the second click reagent comprises a tetrazine (Tz) moiety. In some embodiments, the hydrogel comprises at least one additional polymer. In some embodiments, the additional polymer is selected from the group consisting of a natural polymer, a synthetic polymer, and combinations thereof. In some embodiments, the additional polymer comprises an ECM component. In some embodiments, the additional polymer comprises Matrigel®. In some embodiments, the additional polymer is present in an amount of about 1 mg / mL to about 10 mg / mL. In some embodiments, the additional polymer is present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 2.5 mg / mL. In other embodiments, the additional polymer is present in an amount of about 3 mg / mL to about 5 mg / mL. In some embodiments, the hydrogel is an interpenetrating polymer network (IPN) hydrogel. In some embodiments, the IPN hydrogel comprises interpenetrating networks of collagen and at least one additional polymer. In some embodiments, the collagen is present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 2.5 mg / mL. In other embodiments, the additional polymer is present in an amount of about 3 mg / mL to about 5 mg / mL. In some embodiments, the hydrogel is a soft hydrogel characterized by collagen being present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 2.5 mg / mL. In some embodiments, the hydrogel is a soft-fast relaxing hydrogel characterized by collagen being present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 2.5 mg / mL, and by being substantially free of covalent crosslinking. In some embodiments, the hydrogel is a soft-slow relaxing hydrogel characterized by collagen being present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 2.5 mg / mL, and by comprising a level of covalent crosslinking of at least about 10%. In some embodiments, the hydrogel is a stiff hydrogel characterized by collagen being present in an amount of at least about 3 mg / mL. In some embodiments, the hydrogel is a stiff-fast relaxing hydrogel characterized by collagen being present in an amount of at least about 3 mg / mL and by being substantially free of covalent crosslinking. In some embodiments, the hydrogel is a stiff-slow relaxing hydrogel characterized by collagen being present in an amount of at least about 3 mg / mL and by comprising a level of covalent crosslinking of at least about 10%. In some embodiments, the hydrogel is characterized by (i) an initial elastic modulus of about +* DK ^Y KLY_^ +&*** DK5 #SS$ K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP K^ VOK]^ KLY_^ + ]OMYXN& e.g., about 1 second to about 20,000 seconds or more; (iii) a time value for relaxation to 60% of initially applied stress (60% time) of at least about 1 second, e.g., about 1 second to about 20,000 seconds; (iv) a loss KXQVO #n& NOV^K$ YP KLY_^ +e ^Y KLY_^ ,*e5 #`$ K ]^Y\KQO WYN_V_] #<k$ YP KLY_^ + UDK ^Y KLY_^ / UDK5 (vi) a loss modulus (G”) of about 0.1 kPa to about 3 kPa; (vii) a fiber length of about 0.01 µm to about 20 µm; (viii) a fiber thickness of about 0.01 µm to about 0.1 µm (ix) a fiber angle of about 1° to about 5 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) 100°; (x) a fiber waviness of about 0.05 µm to about 0.5 µm; (xi) a pore diameter of about 0.5 µm to about 10 µm; (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 1 mg / mL to about 10 mg / mL; (xiii) optionally an additional polymer, an additional modified polymer, or a combination thereof in an amount of about 1 mg / mL to about 10 mg / mL; (ixx) optionally a bioorthogonal crosslinker present in an amount of about 1 µM to about 500 µM; and / or (xx) optionally a level of covalent crosslinking of about 5% to about 100%. In some embodiments, the hydrogel is a soft-fast relaxing hydrogel characterized by (i) an SXS^SKV OVK]^SM WYN_V_] YP KLY_^ + / * DK ^Y KLY_^ ,** DK5 #SS$ K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP KLY_^ / second to about 10 seconds; (iii) a time value for relaxation to 60% of initially applied stress (60% ^SWO$ YP KLY_^ / ]OMYXN ^Y KLY_^ +* ]OMYXN]5 #S`$ K VY]] KXQVO #n& NOV^K$ YP KLY_^ / e ^Y KLY_^ + / e5 #`$ K storage modulus (G’) of about 2 kPa to about 3 kPa; (vi) a loss modulus (G”) of about 0.5 kPa to about 2 kPa; and / or (xii) a collagen, a modified collagen, or a combination thereof present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 2.5 mg / mL. In some embodiments, the hydrogel is a soft-slow relaxing hydrogel characterized by (i) an SXS^SKV OVK]^SM WYN_V_] YP KLY_^ + / * DK ^Y KLY_^ ,** DK5 #SS$ K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP KLY_^ 5,000 second to about 15,000 seconds; (iii) a time value for relaxation to 60% of initially applied ]^\O]] #0*" ^SWO$ YP KLY_^ / &*** ]OMYXN ^Y KLY_^ + / &*** ]OMYXN]5 #S`$ K VY]] KXQVO #n& NOV^K$ YP KLY_^ 1° to about 10°; (v) a storage modulus (G’) of about 2 kPa to about 4 kPa; (vi) a loss modulus (G”) of about 0.5 kPa to about 1 kPa; and / or (xii) a collagen, a modified collagen, or a combination thereof present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 2.5 mg / mL. (ixx) a bioorthogonal crosslinker present in an amount of about 250 µM to about 350 µM; and / or (xx) a level of covalent crosslinking of about 25% to about 75%. In some embodiments, the hydrogel is a stiff-fast relaxing hydrogel characterized by (i) an SXS^SKV OVK]^SM WYN_V_] YP KLY_^ / ** DK ^Y KLY_^ 3** DK5 #SS$ K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP KLY_^ , second to about 8 seconds; (iii) a time value for relaxation to 60% of initially applied stress (60% ^SWO$ YP KLY_^ , ]OMYXN ^Y KLY_^ 2 ]OMYXN]5 #S`$ K VY]] KXQVO #n& NOV^K$ YP KLY_^ / e ^Y KLY_^ + / e5 #`$ K storage modulus (G’) of about 3.5 kPa to about 4.5 kPa; (vi) a loss modulus (G”) of about 0.7 kPa to about 1.1 kPa; and / or (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 3 mg / mL to about 5 mg / mL. In some embodiments, the hydrogel is a stiff-slow relaxing hydrogel characterized by (i) an SXS^SKV OVK]^SM WYN_V_] YP KLY_^ / ** DK ^Y KLY_^ 3** DK5 #SS$ K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP KLY_^ / ** second to about 1,500 seconds; (iii) a time value for relaxation to 60% of initially applied stress (60% ^SWO$ YP KLY_^ / ** ]OMYXN ^Y KLY_^ +& / **5 #S`$ K VY]] KXQVO #n& NOV^K$ YP KLY_^ / e ^Y KLY_^ +*e5 #`$ K storage modulus (G’) of about 3.5 kPa to about 4.5 kPa; (vi) a loss modulus (G”) of about 0.5 kPa to about 0.9 kPa; (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 3 mg / mL to about 5 mg / mL. (ixx) a bioorthogonal crosslinker present in an amount of about 250 µM to about 350 µM; and / or (xx) a level of covalent crosslinking of about 25% to about 75%. 6 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) In some embodiments, the hydrogel is a fast relaxing interpenetrating polymer network (IPN) RcN\YQOV MRK\KM^O\SdON Lc #SS$ K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP KLY_^ +** ]OMYXN ^Y KLY_^ ,** ]OMYXN]5 #S`$ K VY]] KXQVO #n& NOV^K$ YP KLY_^ .e ^Y KLY_^ 0e5 #bSS$ K MYVVKQOX& K WYNSPSON MYVVKQOX& Y\ K combination thereof present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 2.5 mg / mL; (xiii) an additional polymer, an additional modified polymer, or a combination thereof in an amount of about 3 mg / mL to about 5 mg / mL. In some embodiments, the hydrogel is a slow relaxing interpenetrating polymer network #>DB$ RcN\YQOV MRK\KM^O\SdON Lc #SS$ K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP KLY_^ / ** ]OMYXN ^Y KLY_^ +& / ** ]OMYXN]5 #S`$ K VY]] KXQVO #n& NOV^K$ YP KLY_^ -e ^Y KLY_^ / e5 #bSS$ K MYVVKQOX& K WYNSPSON MYVVKQOX& Y\ K combination thereof present in an amount of about 1 mg / mL to about 3 mg / mL; (xiii) an additional polymer, an additional modified polymer, or a combination thereof in an amount of about 3 mg / mL to about 5 mg / mL; (ixx) a bioorthogonal crosslinker present in an amount of about 250 µM to about 350 µM; and / or (xx) a level of covalent crosslinking of about 25% to about 75%. In some embodiments, the hydrogel is characterized by a consistent collagen network architecture and pore size distribution. In some embodiments, the covalent crosslinking does not alter collagen network architecture, pore-size distribution, collagen fiber length, collagen fiber waviness, or angle between the fibers of the hydrogel. In some embodiments, the hydrogel further comprises a mammalian cell. In some embodiments, the mammalian cell is an immune cell. In some embodiments, the immune cell comprises an autologous immune cell or an allogeneic immune cell. In some embodiments, the immune cell comprises a phagocyte, a macrophage, a dendritic cell, a monocyte, a B cell, a T cell, a natural killer cell (NK) cell, and combinations thereof. In some embodiments, the immune cell is a T cell. In some embodiments, the T cell is an autologous T cell or an allogeneic T cell. In some embodiments, the T cell is a pan T cell or a T cell with a shared TCR clonotype. In some embodiments, the T cell is selected from the group consisting of a naïve T cell, a helper T cell, a cytotoxic T cell, a memory T cell, a regulatory T cell, an innate-like T cell, a natural killer T cell, a mucosal associated invariant T cell, a gamma delta T cell, and combinations thereof. In some embodiments, the T cell is a genetically modified T cell. In some embodiments, the genetically modified T cell is a T cell receptor (TCR) T cell or a chimeric antigen receptor (CAR) T cell. In some embodiments, the hydrogel further comprises a highly contractile cell. In some embodiments, the hydrogel further comprises a spheroid. In some embodiments, the hydrogel further comprises an extracellular matrix (ECM) component. In some embodiments, the ECM component is selected from the group consisting of a fibrous protein, a glycosaminoglycan (GAG), a proteoglycan (PG), a glycoprotein, a growth factor, a cytokine, a cell adhesion molecule (CAM), and combinations thereof. In some embodiments, the hydrogel further comprises a fibrous protein. In some embodiments, the fibrous protein is selected 7 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) from the group consisting of a collagen, an elastin, a keratin, a fibrin, a laminin, a fibronectin, and combinations thereof. In some embodiments, the collagen is selected from the group consisting of a type I collagen, a type II collagen, a type III collagen, a type IV collagen, a type V collagen, a type VI collagen, a type VII collagen, a type VIII collagen, a type IX collagen, a type X collagen, a type XI collagen, a type XII collagen, a type XIII collagen, a type XIV collagen, a type XV collagen, a type XVI collagen, a type XVII collagen, a type XVIII collagen, a type XIX collagen, a type XX collagen, a type XXI collagen, a type XXII collagen, a type XXIII collagen, a type XXIV collagen, a type XXV collagen, a type XXVI collagen, a type XXVII collagen, a type XXVIII collagen, a type XXIX collagen, and combinations thereof. In some embodiments, the collagen is selected from the group consisting of COL1A1, COL1A2, COL2A1, COL3A1, COL4A1, COL4A2, COL4A3, COL4A4, COL4A5, COL4A6, COL5A1, COL5A2, COL5A3, COL6A1, COL6A2, COL6A3, COL6A5, COL7A1, COL8A1, COL8A2, COL9A1, COL9A2, COL9A3, COL10A1, COL11A1, COL11A2, COL12A1, COL13A1, COL14A1, COL15A1, COL16A1, COL17A1, COL18A1, COL19A1, COL20A1, COL21A1, COL22A1, COL23A1, COL24A1, COL25A1, EMID2, COL27A1, COL28A1, COL29A1, and combinations thereof. In some embodiments, the collagen comprises a type I collagen. In some embodiments, the type I collagen is COL1A1. In some embodiments, the hydrogel further comprises active agent. In one aspect, the present disclosure provides composition comprising the ECM mimetics described herein. In one aspect, the present disclosure provides a pharmaceutical composition comprising the ECM mimetic described herein and a pharmaceutically acceptable carrier. In one aspect, the present disclosure provides an in vitro method for generating a population of immune cells, comprising: contacting a population of immune cells with the ECM mimetic described herein, thereby generating the population of immune cells. In some embodiments, the generated population of immune cells is suitable for use in an adoptive cell therapy and / or is characterized by enhanced efficacy as compared to a population of immune cells generated using conventional plate-culture protocols. In one aspect, the present disclosure provides a method for activating and / or expanding a population of immune cells, comprising: contacting a population of immune cells with the ECM mimetic described herein, thereby activating and / or expanding the population of immune cells. In one aspect, the present disclosure provides a method for modulating immune cell phenotype and / or immune cell function, comprising: contacting a population of immune cells with the ECM mimetic described herein, thereby modulating immune cell phenotype and / or immune cell function. 8 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) In one aspect, the present disclosure provides a method for modulating immune cell differentiation, comprising: contacting a population of immune cells with the ECM mimetic described herein, thereby modulating immune cell differentiation. In one aspect, the present disclosure provides a method of preventing and / or treating cancer in a subject in need thereof, comprising: contacting a population of immune cells with the ECM mimetic of described herein; and administering a therapeutically effective amount of the population of immune cells to the subject, thereby preventing and / or treating cancer in the subject. In some embodiments, the method further comprises contacting the population of immune cells with a T-cell activating molecule and / or a T-cell co-stimulatory molecule. In some embodiments, the T-cell activating molecule and / or the T-cell co-stimulatory molecule comprises CD3 / CD28 or CD3 / CD28 / CD137 dynabeads, optionally activating the immune cells with a predefined strength of antigenic stimulation and / or a predefined duration of antigenic stimulation. In some embodiments, the activating is prior to, concurrently with, and / or subsequent to contacting the population of immune cells with the ECM mimetic. In some embodiments, the predefined strength of antigenic stimulation comprises a bead-to-cell ratio of 0.5:1, 1:1, or 5:1. In some embodiments, the beads comprise CD3 / CD28 dynabeads or CD3 / CD28 / CD137 dynabeads. In some embodiments, the predefined duration of antigenic stimulation comprises a time period of about 1 day to about 10 days. In some embodiments, the time period comprises about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, or about 10 days. In some embodiments, the method further comprises culturing the population of immune cells under conditions and time sufficient for immune cell expansion and / or enrichment to occur, optionally wherein expanding the immune cells comprises contacting the immune cells with a growth factor. In some embodiments, the growth factor is IL-2. In some embodiments, the method further comprises isolating the immune cells from the ECM mimetic and, optionally, subsequently culturing the isolated immune cells in suspension with or without restimulation. In some embodiments, the restimulation comprises contacting the immune cells with CD3 / CD28 dynabeads or CD3 / CD28 / CD137 dynabeads. In some embodiments, the method further comprises phenotypically profiling and / or functionally testing the immune cells for their cytotoxic potential and / or effector cytokine production. In some embodiments, the population of immune cells is characterized by greater cytotoxicity towards cancer cells enhanced efficacy and / or effector cytokine production as compared to a population of immune cells generated using conventional plate-culture protocols. In some embodiments, the adoptive cell therapy is selected from the group consisting of a tumor-infiltrating lymphocyte (TIL) therapy, a engineered T cell receptor (TCR) therapy, a chimeric antigen receptor (CAR) T cell therapy, a natural killer (NK) cell therapy, and combinations thereof. In some embodiments, the immune cell comprises an autologous immune cell or an allogeneic immune cell. In some embodiments, the immune cell comprises a phagocyte, a 9 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) macrophage, a dendritic cell, a monocyte, a B cell, a T cell, a natural killer cell (NK) cell, and combinations thereof. In some embodiments, the immune cell comprises a T cell. In some embodiments, the T cell is an autologous T cell or an allogeneic T cell. In some embodiments, the T cell is a pan T cell or a T cell with a shared TCR clonotype. In some embodiments, the T cell is selected from the group consisting of a naïve T cell, a helper T cell, a cytotoxic T cell, a memory T cell, a regulatory T cell, an innate-like T cell, a natural killer T cell, a mucosal associated invariant T cell, a gamma delta T cell, and combinations thereof. In some embodiments, the method produces a T cell characterized by a T cell signature. In some embodiments, the T cell signature is: (i) a normal tissue and / or blood T cell gene signature; (ii) a tumor T cell gene signature, optionally wherein the tumor T cell gene signature is for non-small cell lung cancer (NSCLC), liver cancer, colorectal cancer, and / or breast cancer; (ii) a T cell gene signature for liver fibrosis; (iii) an activation / inhibitory T cell signature, optionally wherein the activation / inhibitory T cell signature is based on a marker selected from the group consisting of PD1, TIGIT, TIM3, LAG3, OX40, CD39, CD25, CTLA4, and combinations thereof; (iv) a memory T cell signature, optionally wherein the memory T cell signature is based on a marker selected from the group consisting of CD62L, CCR7, CD127, CD45RA, CD27, and combinations thereof; and / or (v) a T cell AP-1 gene signature. In some embodiments, the T cell signature comprises one or more of the genes listed in any one of Tables 2-8. In some embodiments, the T cell signature comprises one or more of the genes listed in Table 2. In some embodiments, the T cell signature comprises one or more of the genes listed in Table 3. In some embodiments, the T cell signature comprises one or more of the genes listed in Table 4. In some embodiments, the T cell signature comprises one or more of the genes listed in Table 5. In some embodiments, the T cell signature comprises one or more of the genes listed in Table 6. In some embodiments, the T cell signature comprises one or more of the genes listed in Table 7. In some embodiments, the T cell signature comprises one or more of the genes listed in Table 8. In some embodiments, the method increases the expression level of an activation / inhibitory T cell marker in T cells contacted with the slow relaxing hydrogel compared to the fast relaxing hydrogel. In some embodiments, the activation / inhibitory T cell marker is selected from the group consisting of IL2RA (CD25), ENTPD1 (CD39), FAS, TNFRSF4 (OX40), LAG3, and combinations thereof. In some embodiments, the method increases the expression level of a transcription factor associated with a T cell effector phenotype in T cells contacted with the slow relaxing hydrogel compared to the fast relaxing hydrogel. In some embodiments, the transcription factor associated with a T cell effector phenotype is selected from the group consisting of PRDM1 (BLIMP-1), ZEB2, and combinations thereof. In some embodiments, the increases the expression level of an AP-1 pathway- associated gene in T cells contacted with the slow relaxing hydrogel compared to the fast relaxing hydrogel. In some embodiments, the AP-1 pathway-associated gene is selected from the group consisting of JUN, ATF3, BATF, FOS, FOSB, JUNB, and combinations thereof. In some 10 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) embodiments, the increases the expression level of a mitogen-activated protein kinase in T cells contacted with the slow relaxing hydrogel compared to the fast relaxing hydrogel. In some embodiments, the mitogen-activated protein kinase is selected from the group consisting of MAPK8, MAPK6, MAPK1, and combinations thereof. In some embodiments, the increases the expression level of a T cell memory marker and / or a T cell memory associated transcription factor in T cells contacted with the fast relaxing hydrogel compared to the slow relaxing hydrogel. In some embodiments, the T cell memory marker and / or the T cell memory associated transcription factor is selected from the group consisting of CD62L, KLF2, CXCR3, S1PR4, and combinations thereof. In some embodiments, the method further comprises isolating the population of immune cells from a subject. In some embodiments, the method further comprises administering a therapeutically effective amount of the population of immune cells to a subject in need thereof. In some embodiments, the method comprises contacting the population of immune cells with a hydrogel characterized by (i) an initial elastic modulus of about 10 Pa to about 1,000 Pa; (ii) a stress \OVKbK^SYX \K^O #p+),$ YP K^ VOK]^ KLY_^ + ]OMYXN& e.g., about 1 second to about 20,000 seconds; (iii) a time value for relaxation to 60% of initially applied stress (60% time) of at least about 1 second, e.g., KLY_^ + ]OMYXN ^Y KLY_^ ,*&*** ]OMYXN]5 #S`$ K VY]] KXQVO #n& NOV^K$ YP KLY_^ +e ^Y KLY_^ ,*e5 #`$ K storage modulus (G’) of about 1 kPa to about 5 kPa; (vi) a loss modulus (G”) of about 0.1 kPa to about 3 kPa; (vii) a fiber length of about 0.01 µm to about 20 µm; (viii) a fiber thickness of about 0.01 µm to about 0.1 µm (ix) a fiber angle of about 1° to about 100°; (x) a fiber waviness of about 0.05 µm to about 0.5 µm; (xi) a pore diameter of about 0.5 µm to about 10 µm; (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 1 mg / mL to about 10 mg / mL; (xiii) optionally an additional polymer, an additional modified polymer, or a combination thereof in an amount of about 1 mg / mL to about 10 mg / mL; (ixx) optionally a bioorthogonal crosslinker present in an amount of about 1 µM to about 500 µM; and / or (xx) optionally a level of covalent crosslinking of about 5% to about 100% In some embodiments, the method comprises contacting the population of immune cells with a soft-fast relaxing hydrogel characterized by (i) an initial elastic modulus of about 150 Pa to about ,** DK5 #SS$ K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP KLY_^ / ]OMYXN ^Y KLY_^ +* ]OMYXN]5 #SSS$ K ^SWO `KV_O PY\ relaxation to 60% of initially applied stress (60% time) of about 5 second to about 10 seconds; (iv) a VY]] KXQVO #n& NOV^K$ YP KLY_^ / e ^Y KLY_^ + / e5 #`$ K ]^Y\KQO WYN_V_] #<k$ YP KLY_^ , UDK ^Y KLY_^ - kPa; (vi) a loss modulus (G”) of about 0.5 kPa to about 2 kPa; and / or (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 1 mg / mL to about 3 mg / mL. In some embodiments, the method comprises contacting the population of immune cells with a soft-slow relaxing hydrogel characterized by (i) an initial elastic modulus of about 150 Pa to about ,** DK5 #SS$ K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP KLY_^ / &*** ]OMYXN ^Y KLY_^ + / &*** ]OMYXN]5 #SSS$ K ^SWO value for relaxation to 60% of initially applied stress (60% time) of about 5,000 second to about + / &*** ]OMYXN]5 #S`$ K VY]] KXQVO #n& NOV^K$ YP KLY_^ +e ^Y KLY_^ +*e5 #`$ K ]^Y\KQO WYN_V_] #<k$ YP 11 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) about 2 kPa to about 4 kPa; (vi) a loss modulus (G”) of about 0.5 kPa to about 1 kPa; and / or (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 1 mg / mL to about 3 mg / mL. (ixx) a bioorthogonal crosslinker present in an amount of about 250 µM to about 350 µM; and / or (xx) a level of covalent crosslinking of about 25% to about 75%. In some embodiments, the method comprises contacting the population of immune cells with a stiff-fast relaxing hydrogel characterized by (i) an initial elastic modulus of about 500 Pa to about 3** DK5 #SS$ K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP KLY_^ , ]OMYXN ^Y KLY_^ 2 ]OMYXN]5 #SSS$ K ^SWO `KV_O PY\ relaxation to 60% of initially applied stress (60% time) of about 2 second to about 8 seconds; (iv) a VY]] KXQVO #n& NOV^K$ YP KLY_^ / e ^Y KLY_^ + / e5 #`$ K ]^Y\KQO WYN_V_] #<k$ YP KLY_^ -( / UDK ^Y KLY_^ .( / kPa; (vi) a loss modulus (G”) of about 0.7 kPa to about 1.1 kPa; and / or (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 3 mg / mL to about 5 mg / mL. In some embodiments, the method comprises contacting the population of immune cells with a stiff-slow relaxing hydrogel characterized by (i) an initial elastic modulus of about 500 Pa to about 3** DK5 #SS$ K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP KLY_^ / ** ]OMYXN ^Y KLY_^ +& / ** ]OMYXN]5 #SSS$ K ^SWO value for relaxation to 60% of initially applied stress (60% time) of about 500 second to about 1,500; #S`$ K VY]] KXQVO #n& NOV^K$ YP KLY_^ / e ^Y KLY_^ +*e5 #`$ K ]^Y\KQO WYN_V_] #<k$ YP KLY_^ -( / UDK ^Y about 4.5 kPa; (vi) a loss modulus (G”) of about 0.5 kPa to about 0.9 kPa; (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 3 mg / mL to about 5 mg / mL. (ixx) a bioorthogonal crosslinker present in an amount of about 250 µM to about 350 µM; and / or (xx) a level of covalent crosslinking of about 25% to about 75%. In some embodiments, the method comprises contacting the population of immune cells with a fast relaxing interpenetrating polymer network (IPN) hydrogel characterized by (ii) a stress \OVKbK^SYX \K^O #p+),$ YP KLY_^ +** ]OMYXN ^Y KLY_^ ,** ]OMYXN]5 #S`$ K VY]] KXQVO #n& NOV^K$ YP KLY_^ .e to about 6°; (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 1 mg / mL to about 3 mg / mL; (xiii) an additional polymer, an additional modified polymer, or a combination thereof in an amount of about 3 mg / mL to about 5 mg / mL. In some embodiments, the method comprises contacting the population of immune cells with a slow relaxing interpenetrating polymer network (IPN) hydrogel characterized by (ii) a stress \OVKbK^SYX \K^O #p+),$ YP KLY_^ / ** ]OMYXN ^Y KLY_^ +& / ** ]OMYXN]5 #S`$ K VY]] KXQVO #n& NOV^K$ YP KLY_^ 3° to about 5°; (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 1 mg / mL to about 3 mg / mL; (xiii) an additional polymer, an additional modified polymer, or a combination thereof in an amount of about 3 mg / mL to about 5 mg / mL; (ixx) a bioorthogonal crosslinker present in an amount of about 250 µM to about 350 µM; and / or (xx) a level of covalent crosslinking of about 25% to about 75%. In one aspect, the present invention provides an immune cell, such as a T cell, with enhanced function, which is generated using an ECM mimetic described herein. In some embodiments, the enhanced function of the T cell comprises an improved effector function of the T cell. In some 12 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) embodiments, the enhanced function of the T cell comprises an improvement in the proliferation rate of the T cell, an increase in the production amount of cytokine, and / or an improvement in cytotoxicity. In some embodiments, the enhanced function of the T cell involves cancellation and suppression of tolerance of the T cell in the suppressed state such as the anergy (unresponsive) state, or the rest state. For example, the enhanced function reflects transfer of the T cell from the suppressed state into a state where the T cell responds to stimulation from the outside. Other features and advantages of the invention will be apparent from the following detailed description and claims. BRIEF DESCRIPTION OF THE DRAWINGS FIGs.1A-1D show that the tissue microenvironment influences T cell phenotype. FIG.1A shows Umap plots of pan CD8+ T cells from tumors, adjacent normal tissue, and blood for NSCLC, liver cancer, and colorectal cancer. FIGs.1B-1C show violin plots comparing expression levels of tumor T cell gene signatures for T cells located in tumors, normal tissues, and blood for pan T cells (FIG.1B) or T cells with shared TCR clonotypes (FIG. 1C). P-values were determined by performing two-tailed one-way Anova. FIG.1D shows relative expression of collagen type I (COL1A1) and lysyl oxidase (LOX) in normal tissues and tumors from The Cancer Genome Atlas (TCGA) dataset. P-values were determined by performing Wilcoxon signed-rank test. FIGs.2A-2I show material synthesis and characterization. FIG.2A shows collagen modified with norbornene using N-hydroxysuccinimide (NHS) and gelled at 37°C with T cells. A low molecular weight (MW) divalent crosslinker containing two methyltetrazines is diffused into gels at room temperature until equilibrated with the surrounding solution, to achieve even distribution within the gel. Subsequently increasing the temperature allows covalent crosslinks to form between norbornene and methyltetrazine functionalities. FIG.2B shows a comparison of Young’s moduli for soft and stiff gels to those of published different soft tissues. FIG.2C shows stress relaxation profiles of fast relaxing and slow relaxing, soft (left) and stiff (right) collagen matrices. FIG. 2D shows second harmonic generation (SHG) images for 2 mg / ml fast relaxing and slow relaxing collagen gels. FIGs.2E-2G show quantification of fiber length (FIG.2E), waviness (FIG.2F), and angle between fibers (FIG.2G) for fast and slow relaxing matrices. P-values were determined by performing two- tailed unpaired t-test. FIGs.2H-2I show storage and loss moduli determined using nanoindentation on collagen matrices. P-values were determined by performing two-tailed unpaired t-test for n=4 to n=10 indents. FIGs.3A-3H show synthesized collagen-based extracellular matrix (ECM) mimetic with tunable mechanical properties. FIG. 3A depicts a schematic of collagen type I based ECM mimetic showing non-click collagen (fast relaxing) and click collagen (slow relaxing) matrices. FIG.3B shows Young’s moduli (left) and time values for relaxation to 60% of initially applied stress (right) for 2 mg / ml (soft) and 4 mg / ml (stiff) collagen matrices. P-values were determined by performing 13 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) two-tailed unpaired t-test. Data are mean ± s.e.m from n=3-5. Significance threshold: P<0.05 (ns=not significant). FIG. 3C shows loss angle measurements for collagen matrices. P-values were calculated by using two-tailed unpaired t-test for n=3-4 samples. FIG. 3D shows cryo-scanning electron microscopy (Cryo-SEM) images of fiber thickness and, FIG.3E shows pore size estimation for 2 mg / ml fast and slow relaxing matrices showing that collagen architecture is maintained. P-values were determined using two-tailed unpaired t-test. Significance threshold: P<0.05. FIG.3F shows representative flow cytometry plots showing CD62L and CD45RA expression, and FIG.3G shows relative expression levels of various markers, in CD8+ T cells cultured in slow or fast relaxing, soft or stiff collagen matrices. FIG.3H shows principal component analysis (PCA) plots showing that phenotypic differences are driven more by changes in collagen viscoelasticity than by stiffness. Data shows pooled samples for n=3. FIGs.4A-4C show ECM modulation of T cell phenotype using multiple donors and across independent experiments. FIG.4A shows representative flow cytometry plots showing CD62L and CD45RA expression for T cells cultured in soft fast and soft slow relaxing gels after 4 days of activation for multiple donors and across multiple independent studies. For donors used for independent studies, the study number is indicated after the donor number. FIG.4B shows PCA plot showing that ECM viscoelasticity drives phenotypic differences along both principal components 1 and 2. FIG.4C shows PCA loadings for PC1 showing relative importance of input features. Data shows pooled samples n=2-3 for 3 donors across 5 independent experiments. FIGs.5A-5F show collagen modification and crosslinker have minimal effects on T cell adhesion and phenotype. FIG.5A shows adhesion of T cells seeded on top of unmodified collagen or norbornene modified collagen (Collagen-Nb) with or without methyltetrazine linkers (n=4-6 replicates). FIG.5B shows viability of T cells embedded in collagen matrices with or without norbornene modification and crosslinker. FIG.5C shows Umap plots of T cells phenotyped by flow cytometry after embedding in collagen matrices with or without norbornene modification and crosslinker. FIG.5D-5E show K-means clustering was performed on pooled T cells from all experimental conditions. FIG.5D shows heatmap plot showing characteristic markers for each cluster. FIG.5E shows heatmap plot showing the frequencies of cells per condition for each cluster. FIG.5F shows PCA plot showing relative similarities between the different conditions. Data for FIGs.5C-5F show pooled samples for n=3 replicates. FIGs.6A-6E show ECM viscoelasticity modulates T cell phenotype in complex ECM. FIG. 6A shows stress relaxation half time (left) and loss angle (right) measurements of fast relaxing and slow relaxing collagen-matrigel IPNs (Col-Mat IPN). P-values were determined by performing two- tailed unpaired t-test for n=3 replicates. FIG.6B shows Umap plots of phenotyped T cells after embedding in fast and slow relaxing Col-Mat IPNs. Data for FIG. 6B shows pooled samples for n=3 replicates. FIGs.6C-6D shows K-means clustering was performed on pooled T cells from all experimental conditions. FIG.6C shows heatmap plot showing characteristic markers for each 14 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) cluster. FIG.6D shows heatmap plot showing the frequencies of cells per condition for each cluster. FIG.6E shows PCA plot showing relative similarities between the different conditions. FIGs.7A-7I show extracellular matrix (ECM) viscoelasticity modulates T cell transcriptomic profile. FIG.7A shows ScRNA-seq umap plots showing distinct localization of CD8+ T cells cultured in fast relaxing or slow relaxing collagen matrices. FIG.7B shows violin plots comparing expression levels of selected genes. P-values were determined by performing differential gene expression in Seurat using a negative binomial generalized linear model. FIG.7C shows volcano plot showing significant gene modules identified by consensus non-negative matrix factorization (cNMF) for T cells in fast relaxing (FModule, orange) and slow relaxing matrices (SModule, green). Module 5 is the most significantly enriched module in slow relaxing matrices. P-values were determined by performing Wilcoxon Rank Sum test adjusted with FDR. Significance threshold: -log10(Adjusted P- value)>15. FIG.7D shows heatmap of representative genes that characterize FModule (12,13: orange) and SModule (1,2,4,11: green). Unique genes from the 4 SModule programs combined, as well as the 2 FModule programs. FIG. 7E shows Umap overlay of aggregate expression levels of cNMF FModule and SModule showing distinct localizations that map to regions of high T cell density in fast relaxing and slow relaxing matrices respectively. FIG.7F shows comparison of expression profiles of FModule and SModule between plate-cultured T cells (suspension culture; no collagen matrix condition), T cells in cultured in fast-relaxing and slow-relaxing collagen matrices. P-values were determined by performing two-tailed one-way Anova. FIG.7G shows pathway analysis comparing enriched pathways for FModule and SModule, indicating a more activated T cell state in the SModule. FIG. 7H shows violin plots comparing expression levels of SModule and FModule in a published bulk RNA-seq dataset that profiled activated versus non-activated T cells, showing increased relative expression of SModule in activated T cells and vice versa. P-values were determined by performing Wilcoxon Rank Sum test adjusted with FDR. FIG.7I shows violin plots comparing expression levels of SModule for T cells with shared TCR clonotypes in tumors, adjacent normal tissues and blood for NSCLC, liver cancer and colorectal cancer (same dataset used for FIGs. 1A-1C). P-values were determined by performing two-tailed one-way Anova. FIG.8 shows application of in vitro generated modules to pan T cells in tumor patients. Violin plots comparing expression levels of SModule for pan CD8+ T cells tumors, adjacent normal tissues and blood for NSCLC, liver cancer and colorectal cancer. P-values were determined by using two-tailed one-way Anova. FIGs.9A-9E show AP-1 pathway is modulated by matrix mechanics. FIGs.9A-9B show AP-1 pathway analysis was performed on enriched cNMF modules from FIGs.7A-7I. FIG. 9A shows relative significance of AP-1 related genes in cNMF modules, showing significant AP-1 enrichment in Module 5. FIG.9B shows violin plots comparing expression levels of Module 5 (AP-1 Module) for T cells with shared TCR clonotypes in tumors, adjacent normal tissues and blood for NSCLC, liver cancer and colorectal cancer. P-values were determined by performing two-tailed one- 15 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) way Anova. FIG.9C-9D show AP-1 pathway analysis was performed on cNMF modules generated from the indicated fibrosis datasets. FIG.9C shows relative significance of AP-1 related genes in cNMF modules. FIG.9D shows violin plots comparing the expression levels of the top AP-1 module in CD8+ T cells derived from healthy and fibrotic tissues for each fibrosis study. FIG. 9E shows violin plots comparing expression levels of our in vitro generated AP-1 Module in CD8+ T cells derived from healthy and fibrotic tissues for the same datasets. P-values were determined by using the Wilcoxon Rank Sum test. FIGs.10A-10C show phosphorylation states of transcription factors and kinases known to impact or be impacted by AP-1. FIG.10A shows heatmap plots comparing expression and phosphorylation levels of different transcription factors and kinases for the different gel conditions. FIG.10B shows PCA plots comparing the relative similarities between the different collagen conditions. FIG.10C shows PCA loadings for PC1 showing the relative significance of features that drive the observations in FIG.10B. Data shows pooled samples for n=3. FIGs.11A-11G show T cell populations generated from ECM with different viscoelasticity have different patterns of AP-1 protein expression that can be abrogated by inhibitors. FIG.11A shows representative flow cytometry histograms showing relative expression of c-Jun for T cells cultured in fast relaxing and slow relaxing, soft and stiff matrices after acute activation. FIG.11B shows heatmap plot showing relative expression of indicated AP-1 proteins for T cells cultured in the different collagen conditions. FIG. 11C shows c-Jun co-immunoprecipitation was performed to probe for c-Jun binding partners. Western blots compare relative amounts of indicated proteins bound to c- Jun as a function of the different mechanical conditions. Data shows pooled samples n=2-4. FIG.11D shows Umap plots of plate-cultured T cells and T cells cultured in fast or slow relaxing matrices with or without the SP600125 Jun N-terminal kinase inhibitor. FIGs.11E-11G shows K-means clustering was performed on pooled T cells from all experimental conditions. FIG. 11E shows heatmap plot showing characteristic markers for each cluster. FIG.11F shows heatmap plot showing the frequencies of cells per condition for each cluster. FIG.11G shows PCA plot showing the relative similarities between the different conditions. FIGs.12A-12J show ECM viscoelasticity does not select for specific T cell clones. FIG.12A shows ScRNA-seq umap plots showing distinct localization of plate-cultured T cells, T cells cultured in fast relaxing or slow relaxing collagen matrices for a different donor. FIG.12B shows violin plot comparing the expression levels of the Slow-Relaxing Module (SModule) generated in FIGs. 7A-7I for the different matrix conditions. P-values were determined by performing two-tailed one-way Anova. FIG.12C ]RYa] RS]^YQ\KW] ]RYaSXQ G8Er 89E- VOXQ^R NS]^\SL_^SYX]( D\O'<OV MYXNS^SYX refers to the parent T cell population before they were embedded in the matrices. FIG.12D shows Shannon entropy plot comparing clonotypic diversity between the different conditions. FIG.12E shows plot showing the proportions of combined T cells from all experimental conditions with unique TCRs and various degrees of clonality. FIG.12F shows venn diagrams showing the distribution of 16 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) dominant clones across the different conditions, and FIG.12G shows violin plot comparing the expression levels of SModule for T cells with shared TCRs. P-values were determined by performing two-tailed one-way Anova. FIGs.12H-12I show Pearson correlation plots for individual T cell clones before and after their culture in fast relaxing (FIG. 12H) or slow relaxing (FIG.12I) collagen matrices. FIGs.13A-13C ]RYa G MOVV \OMOZ^Y\ r #GEr$ Z\YPSVO S] XY^ ]UOaON Lc :8A `S]MYOVK]^SMS^c( FIG.13A ]RYa] P\O[_OXMc NS]^\SL_^SYX YP ^RO NSPPO\OX^ GErI QOXO] PY\ ZVK^O'M_V^_\ON G MOVV]& G MOVV] embedded in fast-relaxing and slow relaxing matrices. FIG.13B shows venn diagram showing the NS]^\SL_^SYX YP GErI QOXO] KM\Y]] ^RO NSPPO\OX^ MYXNS^SYX]( FIG.13C shows Shannon entropy to O]^SWK^O GErI QOXO NS`O\]S^c( FIG. 13D shows plot comparing the mean expression levels of the FVYa'EOVKbSXQ AYN_VO #FAYN_VO$ PY\ G MOVV] P\YW ^RO SXNSMK^ON MYXNS^SYX] Q\Y_ZON Lc GErI QOXO]( FIGs.14A-14E show T cell phenotypes persist after they are harvested from matrices. T cells were first cultured on plates or in fast relaxing or slow relaxing collagen matrices, after which they were harvested and subsequently cultured in suspension with or without dynabead restimulation. FIGs.14A-14E show T cell phenotyping without dynabead restimulation. FIG.14A shows expansion fold (left) and viability (right) of T cells cultured in suspension after they were harvested from their indicated matrices. FIG.14B shows Umap plots of phenotyped T cells. FIGs.14C-14D show K- means clustering was performed on pooled T cells from all experimental conditions. FIG. 14C show heatmap plot showing characteristic markers for each cluster. FIG.14D shows heatmap plot showing the frequencies of cells per condition for each cluster. FIG.14E shows PCA plot showing relative similarities between the different conditions. Data for FIGs.14B-14D show pooled samples for n=3 replicates. FIGs.14F-14J show similar analyses as FIGs.14A-14E but for T cells cultured with dynabead restimulation. FIGs.15A-15F show prior matrix condition influences the phenotype of serially passaged T cells. FIG.15A shows schematic of serial passaging experiment. T cells were either cultured in fast relaxing or slow relaxing matrices for 3 days, after which the cells were harvested and serially passaged as follows: fast relaxing to fast relaxing matrices (Fast-Fast), fast relaxing to slow relaxing matrices (Fast-Slow), slow relaxing to fast relaxing matrices (Slow-Fast) and slow relaxing to slow relaxing matrices (Slow-Slow) for an additional 4 days before analysis. FIG.15B shows Umap plots after performing flow cytometry on serially passaged T cells. FIGs.15C-15D show K-means clustering was performed on pooled T cells from all experimental conditions. FIG.15C shows heatmap plot showing characteristic markers for each cluster. FIG.15D shows heatmap plot showing the frequencies of cells per condition for each cluster. FIG.15E shows PCA plot showing the relative similarities between the different conditions. FIG.15F shows plot comparing the estimated Euclidean distances between the indicated conditions. P-values were determined by performing two-tailed unpaired t test with Welch's correction, with 9 pair-wise measurements from n=3 replicates. 17 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) FIGs.16A-16F show extended profiling and long-term imprinting of T cell Phenotype. FIG. 16A shows CD4 / CD8 ratios of T cells cultured in fast relaxing and slow relaxing, soft and stiff collagen gels for 3 days and 7 days. P-values were determined by performing two-tailed one-way Anova with Tukey post-hoc test. Data shows n=3 samples. FIG.16B shows CD62L and CD45RA expression profiles for CD4+ and CD8+ T cells cultured in different collagen conditions for 3 days and 7 days. FIGs.16C-16D show heatmaps for CD8+ T cells (FIG.16C) and CD4+ T cells (FIG. 16D) showing relative marker expression levels between the different gel conditions. FIG.16E shows PCA plots showing relative similarities between the different collagen conditions for CD4+ and CD8+ T cells. FIG.16F shows imprinting of T cell phenotype: T cells were harvested from collagen gels after 3-day and 7-day gel culture and further cultured in suspension for 7 days. The plot shows pairwise distances between T cells harvested from fast relaxing and slow relaxing collagen gels after suspension culture, showing greater differences between T cells cultured in collagen gels for 7 days. Data shows pooled samples n=3. FIGs.17A-17H show ECM viscoelasticity modulates the phenotypes of T cells subjected to different modes of prior activation. FIG.17A shows Umap plots of phenotyped T cells after stimulation with aCD3 / aCD28 dynabeads. FIGs.17B-17C show K-means clustering was performed on pooled T cells from all experimental conditions. FIG.17B shows heatmap plot showing the frequencies of cells per condition for each cluster. FIG.17C shows heatmap plot showing characteristic markers for each cluster. FIG.17D shows PCA plot showing relative similarities between the different conditions. Data for FIGs.17A-17D show pooled samples for n=3 replicates. FIGs.17E-17H shows similar analyses as FIGs.17A-17D but for T cells stimulated with aCD3 / aCD28 / aCD137 dynabeads. FIGs.18A-18H show tuning ECM viscoelasticity results in the generation of functionally distinct T cells. FIGs.18A-18E show T cells were activated for 4 days using different dynabead to T cell ratios and subsequently cultured in fast relaxing or slow relaxing matrices. FIG.18A shows representative umap plots of CD8+ T cells showing expression of CD62L (left) and CD45RA (center), as well as localization of T cells cultured in either fast relaxing or slow relaxing matrices (right). FIG.18B depicts a heatmap plot showing relative marker expression as a function of fast relaxing (orange) and slow relaxing (green) matrices for the different dynabead to T cell ratios. FIG. 18C shows a plot comparing memory (CD62L, CCR7, CD127, CD45RA, CD27) and activation / inhibitory (PD1, TIGIT, TIM3, LAG3, OX40, CD39, CD25, CTLA4) signatures for T cells cultured in fast relaxing and slow relaxing matrices. Data shows pooled samples n=3. FIG.18D shows differential levels of anti-CD19 CAR T cell killing of Raji cells after culturing in different collagen conditions. P-values were calculated by using two-tailed one-way Anova for n=3-4 samples. FIG.18E depicts a heatmap plot showing production of different cytokines and effector molecules by anti-CD19 CAR T cells after co-culture with Raji cells. FIGs.18F-H show luciferized Raji xenograft lymphoma model. f-g. IVIS images (FIG. 18F) and total flux (FIG.18G) of Raji tumor burden in 18 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) NSG mice for the indicated conditions. FIG.18H shows Kaplan-Meier survival curves of mice from the indicated treatment groups. P-values were determined by Log-rank (Mantel-Cox) test. Data are n=6 or 7 mice per condition FIGs.19A-19C show characterizing T cell phenotype and AP-1 correlation with T cell cytotoxicity. FIG.19A shows representative umap plots of CD8+ T cells showing expression of CD62L (left) and CD45RA (right), as well as localization of T cells (bottom) cultured in either fast relaxing or slow relaxing gels, after T cells are activated with different dynabead to T cell ratios. FIG. 19B shows representative umap plots showing expression of CD25 (left), CD39 (right) and T cell localization (bottom) of the same collagen conditions used in FIG. 19A. Data shows pooled samples n=3. FIG. 19C shows correlation analyses showing how the expression of indicated AP-1 proteins for T cells cultured in the different mechanical conditions correlate with their observed killing of Raji cells. FIGs.20A-20G show T cells from different matrix conditions are functionally distinct against different tumor types. FIGs.20A-20E show human anti-CD19 CAR T cells were first activated using different dynabead to T cell ratios, subsequently cultured in fast relaxing, slow relaxing matrices or plate-culture and then co-cultured with Raji tumor cells. FIG.20A shows umap plots of anti-CD19 CAR T cells phenotyped for their intracellular cytokine profiles after co-culture with Raji tumor cells. FIGs.20B-20D shows K-means clustering was performed on pooled T cells from all experimental conditions FIG.20B. Umap plot of T cells overlaid with corresponding K- means clusters. FIG.20C shows heatmap plot showing characteristic markers for each cluster. FIG. 20D shows heatmap plot showing the frequencies of cells per condition for each cluster. FIG.20E shows PCA plot showing relative similarities between the different conditions. Data shows pooled samples n=3. FIG. 20F shows differential levels of anti-CD19 CAR T cell killing of Raji cells after plate-culture or culturing in different matrix conditions. P-values were calculated by using two-way Anova for n=3 samples per dynabead stimulation level. FIG.20G shows mouse Pmel-1 T cells were cultured in fast relaxing, slow relaxing matrices or plate-culture and subsequently co-cultured with B16-F10 melanoma cells. Plot shows differential killing of B16-F10 tumor cells by Pmel-1 T cells. P- values were determined by performing two-tailed one-way ANOVA for n=6, 2 independent experiments. FIGs.21A-21I shows ECM viscoelasticity modulates the phenotype and function of T cells undergoing chronic stimulation. FIGs.21A-21D shows determination of AP-1 protein expression and interactions after chronic stimulation in matrices. FIG.21A shows representative flow cytometry histograms showing relative expression of c-Jun for T cells cultured in fast relaxing and slow relaxing, soft and stiff matrices after chronic stimulation. FIG.21B shows heatmap plot showing relative expression of indicated AP-1 proteins for T cells cultured in the different collagen conditions after chronic stimulation. FIG.21C shows c-Jun co-immunoprecipitation was performed to probe for c-Jun binding partners. Western blots compare relative amounts of indicated proteins bound to c-Jun 19 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) as a function of the different mechanical conditions. FIG. 21D shows comparison of the extent to which the individual AP-1 proteins changed between T cells with and without chronic stimulation for the different gel conditions. Data shows pooled samples n=2-4. FIGs.21E-21F shows T cell phenotyping after chronic stimulation in collagen matrices. FIG.21E shows heatmap plot comparing marker expression for the different collagen conditions. f. Plot showing memory and activation / inhibitory signatures for T cells cultured in the different gel conditions receiving chronic stimulation. Data shows pooled samples n=2-4. FIG.21G shows differential levels of anti-CD19 CAR T cell killing of Raji cells after chronic stimulation in collagen matrices. P-values were calculated by using two-tailed one-way Anova for n=3-4 samples. FIG. 21H shows heatmap plot showing production of different cytokines and effector molecules by chronically stimulated anti- CD19 CAR T cells after co-culture with Raji cells. FIG.21I shows correlation analyses showing how the expression of indicated AP-1 proteins for T cells cultured in the different mechanical conditions correlate with their observed killing of Raji cells after chronic stimulation. FIG.22 shows flow cytometry gating strategy. Representative flow cytometry gating strategy showing steps from ungated population to CD62L and CD4RA populations. FIGs.23A-23B show tuning collagen matrix viscoelasticity preserves structure and integrity of collagen matrices used to encapsulate highly contractile fibroblasts. Fibroblasts were encapsulated in either fast relaxing or slow relaxing collagen matrices and imaged after 1 week of culture. FIG. 23A shows a representative image showing significant contraction of fast relaxing collagen gels that were used to encapsulate fibroblasts. FIG.23B shows a representative image of intact slow relaxing collagen matrices with encapsulated fibroblasts extensively spread out throughout the gel. Few of these fibroblasts are circled. FIGs.24A-24B shows studying the branching of spheroids as a function of ECM viscoelasticity. MDCK spheroids were encapsulated in either fast relaxing or slow relaxing collagen matrices for 3 days. Spheroids were imaged to look at branching. Images show significantly more branching in fast relaxing matrices (FIG.24A), than in slow relaxing matrices (FIG.24B). DETAILED DESCRIPTION The present disclosures provides extracellular matrix (ECM) mimetics, compositions thereof, and methods of making and using the same. The present disclosure further relates to methods of generating functionally distinct T cell populations suitable for adoptive cell therapy, e.g., by selectively tuning the mechanical properties of extracellular matrix (ECM) mimetics. The extracellular matrix (ECM) mimetics described herein offer significant advantages over conventional approaches aiming to generate various T cell populations in vitro, which are limited to altering the strength and duration of T cell stimulation. The extracellular matrix (ECM) mimetics described herein can be advantageously used tune T cell phenotype for a given stimulation regimen and broadening the repertoire of T cells available for therapy. 20 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) Definitions Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains. As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural references unless the content clearly dictates otherwise. The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements. The use of the alternative (e.g., “or”) should be understood to mean either one, both, or any combination thereof of the alternatives. The term “or” is used herein to mean, and is used interchangeably with, the term “and / or,” unless context clearly indicates otherwise. As used herein, the term “about,” when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20%, or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods. As used herein, any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated. As used herein, “comprise,” “comprising,” “comprises,” and “comprised of” are meant to be synonymous with “include,” “including,” “includes,” or “contain,” “containing,” “contains” and are inclusive or open-ended terms that specifies the presence of what follows, e.g., component and do not exclude or preclude the presence of additional, non-recited components, features, element, members, steps, known in the art or disclosed therein. By way of example, the term “including” is used herein to mean, and is used interchangeably with, the phrase “including but not limited to.” As used herein, the terms “such as,” “for example,” and the like are intended to refer to exemplary embodiments and not to limit the scope of the present disclosure. Compositions The composition of the present disclosure can comprise a device, such as an extracellular matrix (ECM) mimetic, e.g., a scaffold, e.g., a polymer scaffold, e.g., a hydrogel. The scaffold can comprise one or more biomaterials. In some embodiments, the biomaterial is a biocompatible material that is non-toxic and / or non-immunogenic. The scaffold can comprise biomaterials that are non-biodegradable or biodegradable. In certain embodiments, the biomaterial can be a non-biodegradable material. Exemplary non- biodegradable materials include, but are not limited to, plastic polymers, such as polyethylene, polypropylene, polystyrene, poly(vinyl chloride), and poly(ethylene terephthalate). In certain 21 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) embodiments, the polymer scaffold comprises a biodegradable material. The biodegradable material may be degraded by physical or chemical action, e.g., level of hydration, heat, oxidation, or ion exchange or by cellular action, e.g., elaboration of enzyme, peptides, or other compounds by nearby or resident cells. In certain embodiments, the polymer scaffold comprises both non-degradable and degradable materials. In some embodiments, the scaffold composition can degrade at a predetermined rate based on a physical parameter selected from the group consisting of temperature, pH, hydration status, porosity, crosslink density, type, chemistry, and / or the susceptibility of main chain linkages to degradation. Alternatively, the scaffold composition degrades at a predetermined rate based on a ratio of chemical polymers. For example, a high molecular weight polymer comprised of solely lactide degrades over a period of years, e.g., 1-2 years, while a low molecular weight polymer comprised of a 50:50 mixture of lactide and glycolide degrades in a matter of weeks, e.g., 1, 2, 3, 4, 6, or 10 weeks. A calcium cross-linked gels composed of high molecular weight, high guluronic acid alginate degrade over several months (e.g., 1, 2, 4, 6, 8, 10, or 12 months) to years (e.g., 1, 2, 3, 4, or 5 years) in vivo, while a gel comprised of low molecular weight alginate, and / or alginate that has been partially oxidized, will degrade in a matter of weeks. In some embodiments, a hydrogel described herein degrades over days (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days), weeks (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks), months (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months), or years (e.g., 1, 2, 3, 4, or 5 years) in vivo and / or in vitro. In some embodiments, a collagen hydrogel will degrade in a matter of days (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days), weeks (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks), months (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months), or years (e.g., 1, 2, 3, 4, or 5 years) in vivo and / or in vitro. In certain embodiments, one or more compounds disclosed herein are covalently or non- covalently linked or attached to the scaffold composition. In various embodiments, one or more compounds disclosed herein is incorporated on, into, or present within the structure or pores of, the scaffold composition. In some embodiments, one or more compounds disclosed herein is embedded in and / or encapsulated within the scaffold composition. In some embodiments, one or more biorthogonal crosslinkers and / or click chemistry crosslinking reagents disclosed herein are covalently or non-covalently linked or attached to the scaffold composition. In various embodiments, one or more biorthogonal crosslinkers and / or click chemistry crosslinking reagents disclosed herein is incorporated on, into, or present within the structure or pores of, the scaffold composition. In some embodiments, one or more biorthogonal crosslinkers and / or click chemistry crosslinking reagents disclosed herein is embedded in and / or encapsulated within the scaffold composition. In some embodiments, one or more active agents disclosed herein are covalently or non- covalently linked or attached to the scaffold composition. In various embodiments, one or more active 22 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) agents disclosed herein is incorporated on, into, or present within the structure or pores of, the scaffold composition. In some embodiments, one or more active agents disclosed herein is embedded in and / or encapsulated within the scaffold composition. In certain embodiments, one or more cells (e.g., immune cells, e.g., T cells) disclosed herein are covalently or non-covalently linked or attached to the scaffold composition. In various embodiments, one or more cells (e.g., immune cells, e.g., T cells) disclosed herein is incorporated on, into, or present within the structure or pores of, the scaffold composition. In some embodiments, one or more cells (e.g., immune cells, e.g., T cells) disclosed herein is embedded in and / or encapsulated within the scaffold composition. In some embodiments, the scaffolds comprise biomaterials that are modified, e.g., contain one or more functional groups, e.g., one or more functional groups useful in a click chemistry reaction. In some embodiments, the scaffold compositions are covalently crosslinked. In some embodiments, a monomer polymer may be first modified to contain one or more functional groups. A covalent bond forms between the functional group to crosslink the polymers under appropriate condition. Exemplary functional groups include, but are not limited to, acrylate, methacrylate, amino, vinyl, aldehyde, thiol, silane, carboxyl, azide, alkyne. In some particular embodiments, the scaffold composition is made from covalently crosslinking collagen. Covalently crosslinked hydrogels were known in the art and have been described in US Patent 9,675,561, the contents of which are incorporated herein by reference. In certain embodiments, a polymer may interact with a crosslinking agent, which may include two or more functional groups to interact with the polymer molecule. For example, glutaraldehyde is such a crosslinking agent, including two carbonyl group which can condenses amines via Mannich reactions. In certain embodiments, the scaffold composition is crosslinked using click chemistry, with these materials referred to as click-hydrogels and / or click-cryogels. A click hydrogel or cryogel is a gel in which cross-linking between hydrogel or cryogel polymers is facilitated by click reactions between the polymers. Each polymer may contain one of more functional groups useful in a click reaction. Given the high level of specificity of the functional group pairs in a click reaction, active compounds can be added to the preformed device prior to and / or contemporaneously with formation of the hydrogel device by click chemistry. Non-limiting examples of click reactions that may be used to form click-hydrogels include Copper I catalyzed azide-alkyne cycloaddition, strain- promoted assize-alkyne cycloaddition, thiol-ene photocoupling, Diels-Alder reactions, inverse electron demand Diels-Alder reactions, tetrazole-alkene photo-click reactions, oxime reactions, thiol- Michael addition, and aldehydehydrazide coupling. Non-limiting aspects of click hydrogels are described in Jiang et al. (2014) Biomaterials, 35:4969-4985, the entire content of which is incorporated herein by reference. The degree of modification, such as covalent crosslinking, e.g., covalent click chemistry crosslinking, can be varied from about 1% to about 100%. In some embodiments, the degree (level) of covalent crosslinking means the percentage of the sites on the 23 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) biomaterial (e.g., sites on the biomaterial that are modified with a functional group) that are covalently crosslinked, e.g., covalently click chemistry crosslinked. For example, the degree (level) of covalent crosslinking can be about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. It is intended that values and ranges intermediate to the recited values are part of this disclosure. Exemplary modified biomaterials, e.g., hydrogels, include, but not limited to, modified collagen. In some embodiments, the scaffolds comprise biomaterials that are modified, e.g., oxidized or reduced. The degree of modification, such as oxidation, can be varied from about 1% to about 100%. As used herein, the degree of modification means the molar percentage of the sites on the biomaterial that are modified with a functional group. For example, the degree of modification can be about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. It is intended that values and ranges intermediate to the recited values are part of this disclosure. Exemplary biomaterials suitable for use as scaffolds in the present disclosure include, without limitation, glycosaminoglycan, silk, fibrin, MATRIGEL®, poly-ethyleneglycol (PEG), polyhydroxy ethyl methacrylate, polyacrylamide, poly (N-vinyl pyrolidone), (PGA), poly lactic-co-glycolic acid (PLGA), poly e-carpolactone (PCL), polyethylene oxide, poly propylene fumarate (PPF), poly acrylic acid (PAA), polyhydroxybutyric acid, hydrolysed polyacrylonitrile, polymethacrylic acid, polyethylene amine, esters of alginic acid; pectinic acid; and alginate, fully or partially oxidized alginate, hyaluronic acid, carboxy methyl cellulose, heparin, heparin sulfate, chitosan, carboxymethyl chitosan, chitin, pullulan, gellan, xanthan, collagen, gelatin, carboxymethyl starch, carboxymethyl dextran, chondroitin sulfate, cationic guar, cationic starch, and combinations thereof. In certain embodiments, the biomaterial is selected from the group consisting of alginate, fully or partially oxidized alginate, and combinations thereof. In certain embodiments, the biomaterial is selected from the group consisting of collagen, MATRIGEL®, and combinations thereof. Exemplary polymers suitable or use in the scaffolds, e.g., hydrogels, of the disclosure include natural polymers and synthetic polymers. In some embodiments, the natural polymer comprises a 24 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) fibrous protein. Exemplary fibrous proteins include, without limitation, a collagen, an elastin, a keratin, a fibrin, a laminin, a fibronectin, and combinations thereof. The scaffolds, e.g., hydrogels, can fabricated from a variety of synthetic polymers and naturally-occurring polymers such as, but not limited to, collagen, fibrin, hyaluronic acid, agarose, and laminin-rich gels. One preferred material for the scaffold, e.g., hydrogel, is collagen or modified collagen material. In a some embodiments, the collagen is present in an amount of about 1 mg / mL to about 10 mg / mL (e.g., about 1 mg / mL, about 1.5 mg / mL, about 2 mg / mL, about 2.5 mg / mL, about 3 mg / mL, about 3.5 mg / mL, about 4 mg / mL, about 4.5 mg / mL, about 5 mg / mL, about 5.5 mg / mL, about 6 mg / mL, about 6.5 mg / mL, about 7 mg / mL, about 7.5 mg / mL, about 8 mg / mL, about 8.5 mg / mL, about 9 mg / mL, about 9.5 mg / mL, or about 10 mg / mL). In a some embodiments, the collagen is a modified collagen comprising a click reagent (e.g., a first click reagent). In a some embodiments, the collagen is selected from the group consisting of a type I collagen, a type II collagen, a type III collagen, a type IV collagen, a type V collagen, a type VI collagen, a type VII collagen, a type VIII collagen, a type IX collagen, a type X collagen, a type XI collagen, a type XII collagen, a type XIII collagen, a type XIV collagen, a type XV collagen, a type XVI collagen, a type XVII collagen, a type XVIII collagen, a type XIX collagen, a type XX collagen, a type XXI collagen, a type XXII collagen, a type XXIII collagen, a type XXIV collagen, a type XXV collagen, a type XXVI collagen, a type XXVII collagen, a type XXVIII collagen, a type XXIX collagen, and combinations thereof. In a some embodiments, the collagen is selected from the group consisting of COL1A1, COL1A2, COL2A1, COL3A1, COL4A1, COL4A2, COL4A3, COL4A4, COL4A5, COL4A6, COL5A1, COL5A2, COL5A3, COL6A1, COL6A2, COL6A3, COL6A5, COL7A1, COL8A1, COL8A2, COL9A1, COL9A2, COL9A3, COL10A1, COL11A1, COL11A2, COL12A1, COL13A1, COL14A1, COL15A1, COL16A1, COL17A1, COL18A1, COL19A1, COL20A1, COL21A1, COL22A1, COL23A1, COL24A1, COL25A1, EMID2, COL27A1, COL28A1, COL29A1, and combinations thereof. In a some embodiments, the collagen comprises a type I collagen, optionally wherein the type I collagen is COL1A1. In a some embodiments, the hydrogel comprises interpenetrating networks (IPNs) of collagen and at least one additional polymer, optionally wherein the additional polymer is selected from the group consisting of a natural polymer, a synthetic polymer, and combinations thereof, optionally wherein the additional polymer comprises Matrigel®. The scaffolds of the present disclosure may comprise an external surface. Alternatively, or in addition, the scaffolds may comprise an internal surface. External or internal surfaces of the scaffolds of the present disclosure may be solid or porous. Pore size of the scaffolds can be less than about 10 XW& LO^aOOX KLY_^ +** XW ^Y KLY_^ ,* wW& Y\ Q\OK^O\ ^RKX KLY_^ ,* wW& e.g., up to and including +*** wW SX NSKWO^O\( ;Y\ ObKWZVO& ^RO ZY\O] WKc LO XKXYZY\Y_]& WSM\YZY\Y_]& Y\ WKM\YZY\Y_]( ;Y\ example, the diameter of nanopores is less than about 10 nm; the diameter of micropores is in the 25 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) \KXQO YP KLY_^ +** XW ^Y KLY_^ ,* wW5 KXN& ^RO NSKWO^O\ YP WKM\YZY\O] S] Q\OK^O\ ^RKX KLY_^ ,* wW& e.g., greater than about 50 µm, e.g., Q\OK^O\ ^RKX KLY_^ +** wW& e.g., Q\OK^O\ ^RKX KLY_^ .** wW& e.g., Q\OK^O\ ^RKX 0** wW Y\ Q\OK^O\ ^RKX 2** wW( >X ]YWO OWLYNSWOX^ ^RO NSKWO^O\ YP ^RO ZY\O S] LO^aOOX about 50 µm and about 80 µm. In some embodiments, the pore diameter can be about 0.5 µm to about 10 µm (e.g., about 0.5 µm, about 1 µm, about 1.5 µm, about 2 µm, about 2.5 µm, about 3 µm, about 3.5 µm, about 4 µm, about 4.5 µm, about 5 µm, about 5.5 µm, about 6 µm, about 6.5 µm, about 7 µm, about 7.5 µm, about 8 µm, about 8.5 µm, about 9 µm, about 9.5 µm, or about 10 µm). In some embodiments, the scaffolds of the present disclosure are organized in a variety of geometric shapes (e.g., discs, beads, pellets), niches, planar layers (e.g., thin sheets). For example, discs can be about 0.1 to about 100 millimeters in diameter, e.g., about 0.1 mm, about 0.2 mm, about 0.3 mm, about 0.4 mm, about 0.5 mm, about 0.6 mm, about 0.7 mm, about 0.8 mm, about 0.9 mm, about 1 mm, about 2 mm, about 3 mm, about 4 mm, about 5 mm, about 6 mm, about 7 mm, about 8 mm, about 9 mm, about 10 mm, about 11 mm, about 12 mm, about 13 mm, about 14 mm, about 15 mm, about 16 mm, about 17 mm, about 18 mm, about 19 mm, about 20 mm, about 21 mm, about 22 mm, about 23 mm, about 24 mm, about 25 mm, about 26 mm, about 27 mm, about 28 mm, about 29 mm, about 30 mm, about 31 mm, about 32 mm, about 33 mm, about 34 mm, about 35 mm, about 36 mm, about 37 mm, about 38 mm, about 39 mm, about 40 mm, about 41 mm, about 42 mm, about 43 mm, about 44 mm, about 45 mm, about 46 mm, about 47 mm, about 48 mm, about 49 mm, about 50 mm, about 51 mm, about 52 mm, about 53 mm, about 54 mm, about 55 mm, about 56 mm, about 57 mm, about 58 mm, about 59 mm, about 60 mm, about 61 mm, about 62 mm, about 63 mm, about 64 mm, about 65 mm, about 66 mm, about 67 mm, about 68 mm, about 69 mm, about 70 mm, about 71 mm, about 72 mm, about 73 mm, about 74 mm, about 75 mm, about 76 mm, about 77 mm, about 78 mm, about 79 mm, about 80 mm, about 81 mm, about 82 mm, about 83 mm, about 84 mm, about 85 mm, about 86 mm, about 87 mm, about 88 mm, about 89 mm, about 90 mm, about 91 mm, about 92 mm, about 93 mm, about 94 mm, about 95 mm, about 96 mm, about 97 mm, about 98 mm, about 99 mm, or about 100 mm. The disc may have a thickness of 0.1 to 10 millimeters, e.g., about 0.1 mm, about 0.2 mm, about 0.3 mm, about 0.4 mm, about 0.5 mm, about 0.6 mm, about 0.7 mm, about 0.8 mm, about 0.9 mm, about 1 mm, about 2 mm, about 3 mm, about 4 mm, about 5 mm, about 6 mm, about 7 mm, about 8 mm, about 9 mm, or about 10 mm. In some embodiments, the scaffolds of the present disclosure have a size and shape suitable for use in a cell culture dish and / or a cell culture plate. In an exemplary embodiment, the extracellular matrix (ECM) mimetic of the present disclosure comprises a collagen hydrogel, wherein the collagen hydrogel comprises non-covalent crosslinking. Additional embodiments and features of the ECM mimetic are described below. 26 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) Hydrogels In certain embodiments, the scaffolds of the present disclosure comprises one or more hydrogels. A hydrogel is a polymer gel comprising a network of crosslinked polymer chains. The hydrogels described herein can be used to generate functionally distinct immune cell, e.g., T cell, populations by selectively and independently tuning matrix stiffness and matrix viscoelasticity, e.g., by utilizing a combination of non-covalent crosslinking (e.g., physical crosslinking) and covalent crosslinking (e.g., chemical crosslinking, e.g., click crosslinking). A hydrogel is usually a composition comprising polymer chains that are hydrophilic. In some embodiments, crosslinking can be physical crosslinking. Physically crosslinked hydrogels can be formed by molecular entanglements, and / or secondary forces including hydrophobic association, hydrogen bonding, electrostatic interaction, and / or van der Waals forces. In some embodiments, crosslinking can be chemical crosslinking. Chemically crosslinked hydrogels can be formed by covalent crosslinking, e.g., functional groups, such as -OH, -COOH, and / or -NH2. Chemical crosslinking can also be mediated, e.g., by click chemistry. The network structure of hydrogels allows them to absorb significant amounts of water. Some hydrogels are highly stretchable and elastic; others are viscoelastic. Hydrogel are sometimes found as a colloidal gel in which water is the dispersion medium. In certain embodiments, hydrogels are highly absorbent (they can contain over 99% water) natural or synthetic polymers that possess a degree of flexibility very similar to natural tissue, due to their significant water content. In certain embodiments, a hydrogel may have a property that, when an appropriate shear stress is applied, the deformable hydrogel is dramatically and reversibly compressed (up to 95% of its volume), resulting in injectable macroporous preformed scaffolds. Hydrogels have been used for cell culture and therapeutic applications, e.g., as vehicles for in vitro and / or in vivo delivery of therapeutic agents, such as small molecules, cells and biologics. Hydrogels can be produced from extracellular matrix components, e.g., fibrous proteins, e.g., collagen. The extracellular matrix components, e.g., fibrous proteins, e.g., collagen may be chemically manipulated to modulate their properties and properties of the resulting hydrogels. The hydrogels of the present disclosure are porous or non-porous. For example, the hydrogels are nanoporous having a diameter of less than about 10 nm; microporous wherein the diameter of the pores are preferably in the range of about 100 nm to about 20 µm; or macroporous wherein the diameter of the pores are greater than about 20 µm, more preferably greater than about 100 µm and even more preferably greater than about 400 µm. In certain embodiments, the hydrogel is macroporous with aligned pores of about 400 to about 500 µm in diameter. In some embodiment the diameter of the pore is between about 50 µm and about 80 µm. In some embodiments, the pore diameter can be about 0.5 µm to about 10 µm (e.g., about 0.5 µm, about 1 µm, about 1.5 µm, about 2 µm, about 2.5 µm, about 3 µm, about 3.5 µm, about 4 µm, about 4.5 µm, about 5 µm, about 5.5 µm, 27 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) about 6 µm, about 6.5 µm, about 7 µm, about 7.5 µm, about 8 µm, about 8.5 µm, about 9 µm, about 9.5 µm, or about 10 µm). Methods of preparing porous hydrogel products are known in the art. (See, e.g., U.S. Pat. No.6,511,650, incorporated herein by reference). The hydrogel may be constructed out of a number of different rigid, semi-rigid, flexible, gel, self-assembling, liquid crystalline, or fluid compositions such as peptide polymers, polysaccharides, synthetic polymers, natural polymers (e.g., collagen) ceramics (e.g., calcium phosphate or hydroxyapatite), proteins, glycoproteins, proteoglycans, metals and metal alloys. The compositions are assembled into hydrogels using methods known in the art, e.g., injection molding, lyophillization of preformed structures, printing, self-assembly, phase inversion, solvent casting, melt processing, gas foaming, fiber forming / processing, polymerization, particulate leaching or a combination thereof. In some embodiments, the scaffold, e.g., hydrogels can be used in vitro, e.g., as cell culture systems. In some embodiments, the scaffolds of the present disclosure can have a size and shape suitable for use in a cell culture dish and / or a cell culture plate. In certain embodiments, exemplary hydrogels are comprised of materials that are compatible with encapsulation of materials including polymers, nanoparticles, polypeptides, and cells. Exemplary hydrogels are fabricated from as alginate, polyethylene glycol (PEG), PEG-acrylate, agarose, or synthetic protein (e.g., collagen or engineered proteins (i.e., self-assembly peptide-based hydrogels)). For example, a commercially available hydrogel includes BD™ PuraMatrix™. BD™ PuraMatrix™ Peptide Hydrogel is a synthetic matrix that is used to create defined three dimensional (3D) micro- environments for cell culture. In certain embodiments, exemplary hydrogels comprise collagen and / or MATRIGEL®. In some embodiments, the hydrogel is a biocompatible polymer matrix that is biodegradable in whole or in part. Examples of materials which can form hydrogels include alginates and alginate derivatives, polylactic acid, polyglycolic acid, poly(lactic-co-glycolic acid) (PLGA) polymers, gelatin, collagen, agarose, natural and synthetic polysaccharides, polyamino acids such as polypeptides particularly poly(lysine), polyesters such as polyhydroxybutyrate and poly-epsilon-caprolactone, polyanhydrides; polyphosphazines, poly(vinyl alcohols), poly(alkylene oxides) particularly poly(ethylene oxides), poly(allylamines)(PAM), poly(acrylates), modified styrene polymers such as poly(4-aminomethylstyrene), pluronic polyols, polyoxamers, poly(uronic acids), poly(vinylpyrrolidone), and copolymers of the above, including graft copolymers. Synthetic polymers and naturally-occurring polymers such as, but not limited to, collagen, fibrin, hyaluronic acid, agarose, and laminin-rich gels may also be used. In some embodiments, the hydrogel is a collagen hydrogel. In some embodiments, the hydrogel is a modified collagen hydrogel. Exemplary polymers suitable or use in the hydrogels of the disclosure include natural polymers and synthetic polymers. In some embodiments, the natural polymer comprises a fibrous protein. Exemplary fibrous proteins include, without limitation, a collagen, an elastin, a keratin, a fibrin, a laminin, a fibronectin, and combinations thereof. 28 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) The hydrogels can fabricated from a variety of synthetic polymers and naturally-occurring polymers such as, but not limited to, collagen, fibrin, hyaluronic acid, agarose, and laminin-rich gels. One preferred material for the hydrogel is collagen or modified collagen material. In a some embodiments, the collagen is present in an amount of about 1 mg / mL to about 10 mg / mL (e.g., about 1 mg / mL, about 1.5 mg / mL, about 2 mg / mL, about 2.5 mg / mL, about 3 mg / mL, about 3.5 mg / mL, about 4 mg / mL, about 4.5 mg / mL, about 5 mg / mL, about 5.5 mg / mL, about 6 mg / mL, about 6.5 mg / mL, about 7 mg / mL, about 7.5 mg / mL, about 8 mg / mL, about 8.5 mg / mL, about 9 mg / mL, about 9.5 mg / mL, or about 10 mg / mL). In a some embodiments, the collagen is a modified collagen comprising a click reagent (e.g., a first click reagent). In a some embodiments, the collagen is selected from the group consisting of a type I collagen, a type II collagen, a type III collagen, a type IV collagen, a type V collagen, a type VI collagen, a type VII collagen, a type VIII collagen, a type IX collagen, a type X collagen, a type XI collagen, a type XII collagen, a type XIII collagen, a type XIV collagen, a type XV collagen, a type XVI collagen, a type XVII collagen, a type XVIII collagen, a type XIX collagen, a type XX collagen, a type XXI collagen, a type XXII collagen, a type XXIII collagen, a type XXIV collagen, a type XXV collagen, a type XXVI collagen, a type XXVII collagen, a type XXVIII collagen, a type XXIX collagen, and combinations thereof. In a some embodiments, the collagen is selected from the group consisting of COL1A1, COL1A2, COL2A1, COL3A1, COL4A1, COL4A2, COL4A3, COL4A4, COL4A5, COL4A6, COL5A1, COL5A2, COL5A3, COL6A1, COL6A2, COL6A3, COL6A5, COL7A1, COL8A1, COL8A2, COL9A1, COL9A2, COL9A3, COL10A1, COL11A1, COL11A2, COL12A1, COL13A1, COL14A1, COL15A1, COL16A1, COL17A1, COL18A1, COL19A1, COL20A1, COL21A1, COL22A1, COL23A1, COL24A1, COL25A1, EMID2, COL27A1, COL28A1, COL29A1, and combinations thereof. In a some embodiments, the collagen comprises a type I collagen, optionally wherein the type I collagen is COL1A1. In a some embodiments, the hydrogel comprises interpenetrating networks (IPNs) of collagen and at least one additional polymer, optionally wherein the additional polymer is selected from the group consisting of a natural polymer, a synthetic polymer, and combinations thereof, optionally wherein the additional polymer comprises Matrigel®. The device can have virtually any regular or irregular shape including, but not limited to, spheroid, cubic, polyhedron, prism, cylinder, rod, disc, or other geometric shape. Accordingly, in some embodiments, the hydrogel is of cylindrical form from about 0.5 to about 10 mm in diameter and from about 0.5 to about 10 cm in length. Preferably, its diameter is from about 1 to about 5 mm and length from about 1 to about 5 cm. In some embodiments, the devices of the disclosure are of spherical form. When the device is in a spherical form, its diameter can range, in some embodiments, from about 0.5 to about 50 mm in diameter. In some embodiments, a spherical implant’s diameter is from about 5 to about 30 mm. In an exemplary embodiment, the diameter is from about 10 to about 25 mm. 29 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) In some embodiments, the hydrogel is a cryogel. Cryogels are a class of materials with a highly porous interconnected structure that are produced using a cryotropic gelation (or cryogelation) technique. Cryogels also have a highly porous structure. Typically, active compounds are added to the cryogel device after the freeze formation of the pore / wall structure of the cryogel. Cryogels are characterized by high porosity, e.g., at least about 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95% pores with thin pore walls that are characterized by high density of polymer crosslinking. The walls of cryogels are typically dense and highly cross-linked, enabling them to be compressed through a needle into a subject without permanent deformation or substantial structural damage. In various embodiments, the pore walls comprise at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50% or more polymer. In some embodiments, a polymer concentration of about 0.5 to about 4% (before the cryogelation) is used, and the concentration increases substantially by the completion of cryogelation. Non-limiting aspects of cryogel gelation and the increase of polymer concentration after cryogelation are discussed in Beduer et al. (2015) Advanced Healthcare Materials Volume 4, Issue 2, pages 301-312, the entire content of which is incorporated herein by reference. In certain embodiments, cryogelation comprises a technique in which polymerization- crosslinking reactions are conducted in quasi-frozen reaction solution. Non-limiting examples of cryogelation techniques are described in U.S. Patent Application Publication No.201410227327, published August 14, 2014, the entire content of which is incorporated herein by reference. An advantage of cryogels compared to conventional macroporous hydrogels obtained by phase separation is their high reversible deformability. Cryogels may be extremely soft but can be deformed and reform their shape. In certain embodiments, cyrogels can be very tough, and can withstand high levels of deformations, such as elongation and torsion and can also be squeezed under mechanical force to drain out their solvent content. In certain embodiments, improved deformability properties of alginate cryogels originate from the high crosslinking density of the unfrozen liquid channels of the reaction system. In certain embodiments, the scaffold comprises click-hydrogels and / or click-cryogels. A click hydrogel or cryogel is a gel in which cross-linking between hydrogel or cryogel polymers is facilitated by click reactions between the polymers. Each polymer may contain one of more functional groups useful in a click reaction. Given the high level of specificity of the functional group pairs in a click reaction, active compounds can be added to the preformed device prior to or contemporaneously with formation of the hydrogel device by click chemistry. Non-limiting examples of click reactions that may be used to form click-hydrogels include Copper I catalyzed azide-alkyne cycloaddition, strain-promoted assize-alkyne cycloaddition, thiol-ene photocoupling, Diels-Alder reactions, inverse electron demand Diels-Alder reactions, tetrazole-alkene photo-click reactions, oxime reactions, thiol- Michael addition, and aldehyde-hydrazide coupling. Non-limiting aspects of click hydrogels are described in Jiang et al. (2014) Biomaterials, 35:4969-4985, the entire content of which is 30 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) incorporated herein by reference. Preferably, the click reagent of the present disclosure for metabolic labeling of cells infiltrating the scaffold is not reactive with the click hydrogel or cryogel. In various embodiments, a click collagen is utilized. In some embodiments, the concentration of crosslinks (e.g., noncovalent and / or covalent crosslinks) per hydrogel is at least about 10% (w / w), e.g., at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% (w / w). In some embodiments, the concentration of crosslinks per hydrogel is about 10% to about 100% (w / w), e.g., about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% (w / w). In some embodiments, the concentration of crosslinks per hydrogel is about 25% to about 50% (w / w). In some embodiments, the concentration of crosslinks per hydrogel is about 25% to about 75% (w / w). In some embodiments, the concentration of crosslinks per hydrogel is about 50% to about 75% (w / w). In some embodiments, the concentration of crosslinks per hydrogel is about 75% to about 100% (w / w). In some embodiments, the click-hydrogel devices and scaffold materials include a hydrogel comprising a first polymer and a second polymer. The first polymer and the second polymer can be the same or different. In some embodiments, the first polymer and the second polymer are the same type of polymer. In some embodiments, the first polymer and / or the second polymer are independently selected from the group consisting of alginate, chitosan, polyethylene glycol (PEG), gelatin, hyaluronic acid, collagen, MATRIGEL®, chondroitin, agarose, polyacrylamide, and heparin. In some embodiments, the first polymer and the second polymer are the same polymer independently selected from the group consisting of alginate, chitosan, polyethylene glycol (PEG), gelatin, hyaluronic acid, collagen, MATRIGEL®, chondroitin, agarose, polyacrylamide, and heparin. In some embodiments, the hydrogel is an interpenetrating polymer network (IPN) hydrogel. Such scaffolds and scaffold materials, as well as methods for producing such scaffolds, are described in PCT International Patent Application Publication No. WO 2015 / 154078 published October 8, 2015, the entire content of which is incorporated herein by reference. For example, a click hydrogel may be prepared in a process: a) providing a first polymer comprising a first click reaction moiety and a second polymer comprising a second click reaction moiety. In non-limiting examples, the first click reaction moiety and the second click reaction moiety may be react with each other in a copper I catalyzed azide-alkyne cycloaddition, strain-promoted assize-alkyne cycloaddition, thiol-ene photo coupling, a Diels-Alder reaction, an inverse electron demand Diels-Alder reaction, a tetrazole- alkene photo-click reaction, a oxime reaction, a thiol-Michael addition, or via aldehyde-hydrazide coupling. In an embodiment, the first click reaction moiety is a diene moiety and the second click reaction moiety is a dienophile moiety. In an embodiment, the first click reaction moiety is a tetrazine moiety and the second click reaction moiety is a norbornene moiety. As used herein, the terms 31 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) "tetrazine" and "tetrazine moiety" include molecules that comprise 1,2,4,5-tetrazine substituted with suitable spacer for linking to the polymer (e.g., alkylamines like methylamine or pentylamine), and optionally further substituted with one or more substituents at any available position. Exemplary tetrazine moieties suitable for the compositions and methods of the disclosure are described in Karver et al. Bioconjugate Chem. 22(2011):2263-2270, and WO 2014 / 065860, both incorporated herein by reference). As used herein, the terms "norbornene" and "norbornene moieties" include but are not limited to norbornadiene and norbornene groups further comprising suitable spacer for linking to the polymer (e.g., alkylamines like methylamine or pentylamine), and optionally further substituted with one or more substituents at any available position. Such moieties include, for example, norbornene-S- methylamine and norbomadienemethylamine. Accordingly, some embodiments feature a cell-compatible and optionally, cell-adhesive, highly crosslinked hydrogel polymer composition comprising open interconnected pores, wherein the hydrogel is characterized by shape memory following deformation by compression or dehydration. The device has a high density of open interconnected pores. Also, the hydrogel comprises a crosslinked collagen polymer. In some embodiments, the hydrogel comprises polymers that are modified, e.g., sites on the polymer molecule are modified with a bioorthogonal crosslinker. In some embodiments, the hydrogels can be functionalized by addition of a functional group chosen from the group consisting of: amino, vinyl, aldehyde, thiol, silane, carboxyl, azide, alkyne. Alternatively or in addition, the cryogel is further functionalized by the addition of a crosslinker agent (e.g. multiple arms polymers, salts, aldehydes, etc.). The solvent can be aqueous, and in particular acidic or alkaline. The aqueous solvent can comprise a water-miscible solvent (e.g. methanol, ethanol, DMF, DMSO, acetone, dioxane, etc). In various embodiments, a device or scaffold is loaded (e.g., soaked with) with one or more bioorthogonal crosslinkers after polymerization. In certain embodiments, device or scaffold polymer forming material is mixed with one or more bioorthogonal crosslinkers before polymerization. In some embodiments, a device or scaffold polymer forming material is mixed with bioorthogonal crosslinker before polymerization, and then is loaded with more of the same or one or more additional active compounds after polymerization. In some embodiments, a device or scaffold polymer forming material is mixed with one or more cells, e.g., immune cells, before polymerization, and then is loaded (e.g., soaked with) with one or more bioorthogonal crosslinkers after polymerization. In various embodiments, a device or scaffold is loaded (e.g., soaked with) with one or more active compounds after polymerization. In certain embodiments, device or scaffold polymer forming material is mixed with one or more active compounds before polymerization. In some embodiments, a device or scaffold polymer forming material is mixed with one or more active compounds before polymerization, and then is loaded with more of the same or one or more additional active compounds after polymerization. 32 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) In some embodiments, pore size or total pore volume of a device or scaffold is selected to influence the release of compounds from the device or scaffold. Exemplary porosities (e.g., nanoporous, microporous, and macroporous scaffolds and devices) and total pore volumes (e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more) are described herein. Increased pore size and total pore volume increases the amount of compounds that can be delivered by the device or scaffold. In some embodiments, a pore size or total pore volume is selected to increase the speed at which active ingredients exit the device or scaffold. In various embodiments, an active ingredient may be incorporated into the scaffold material of a hydrogel or cryogel, e.g., to achieve continuous release of the active ingredient from the scaffold or device over a longer period of time compared to active ingredient that may diffuse from a pore cavity. Porosity influences recruitment of cells into devices and scaffolds, growth of cells embedded in devices and scaffolds, and / or the release of substances from devices and scaffolds. Pores may be, e.g., nanoporous, microporous, or macroporous. For example, the diameter of nanopores is less than about 10 nm. Micropores are in the range of about 100 nm to about 20 µm in diameter. Macropores are greater than about 20 µm (e.g., greater than about 100 µm or greater than about 400 µm). Exemplary macropore sizes include about 50 µm, about 100 µm, about 150 µm, about 200 µm, about 250 µm, about 300 µm, about 350 µm, about 400 µm, about 450 µm, about 500 µm, about 550 µm, and about 600 µm. Macropores are those of a size that permit a eukaryotic cell to traverse into or out of the composition. In one example, a macroporous composition has pores of about 400 µm to about 500 µm in diameter. In some embodiments, the pore diameter can be about 0.5 µm to about 10 µm (e.g., about 0.5 µm, about 1 µm, about 1.5 µm, about 2 µm, about 2.5 µm, about 3 µm, about 3.5 µm, about 4 µm, about 4.5 µm, about 5 µm, about 5.5 µm, about 6 µm, about 6.5 µm, about 7 µm, about 7.5 µm, about 8 µm, about 8.5 µm, about 9 µm, about 9.5 µm, or about 10 µm). The preferred pore size depends on the application. In some embodiments, one or more compounds is added to the scaffold compositions using a known method including surface absorption, physical immobilization, e.g., using a phase change to entrap the substance in the scaffold material. For example, one or more compounds and / or cells is mixed with the scaffold composition while it is in an aqueous or liquid phase, and after a change in environmental conditions (e.g., pH, temperature, ion concentration), the liquid gels or solidifies thereby entrapping the bioactive substance. In some embodiments, covalent coupling, e.g., using alkylating or acylating agents, is used to provide a stable, long term presentation of a compound on the scaffold in a defined conformation. 33 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) Fast relaxing and slow relaxing hydrogels In one aspect, the present disclosure provides an extracellular matrix (ECM) mimetic, comprising a hydrogel (e.g., collagen hydrogel), wherein the hydrogel (e.g., collagen hydrogel) comprises non-covalent crosslinking. In certain embodiments, the scaffold of the present disclosure comprises fast relaxing hydrogels. As used herein, the term “fast relaxing hydrogel” refers to a hydrogel that exhibits a fast relaxation behavior when stress is applied to the hydrogel. The fast relaxing hydrogel can be MRK\KM^O\SdON Lc K ]^\O]] \OVKbK^SYX \K^O #p1 / 2) and / or a time value for relaxation to 60% of initially applied stress (also referred to as “60% time”) of 100 seconds or less, e.g., 100, 80, 60, 40, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 seconds or less. The fast relaxing hydrogel may be characterized by a stress \OVKbK^SYX \K^O #p1 / 2) and / or 60% time of about 0.5 to about 100 seconds, e.g., about 0.5 seconds, about 1 seconds, about 1.5 seconds, about 2 seconds, about 2.5 seconds, about 3 seconds, about 3.5 seconds, about 4 seconds, about 4.5 seconds, about 5 seconds, about 5.5 seconds, about 6 seconds, about 6.5 seconds, about 7 seconds, about 7.5 seconds, about 8 seconds, about 8.5 seconds, about 9 seconds, about 9.5 seconds, about 10 seconds, about 15 seconds, about 20 seconds, about 25 seconds, about 30 seconds, about 35 seconds, about 40 seconds, about 45 seconds, about 50 seconds, about 55 seconds, about 60 seconds, about 65 seconds, about 70 seconds, about 75 seconds, about 80 seconds, about 85 seconds, about 90 seconds, about 95 seconds, or about 100 seconds. In certain embodiments, the hydrogel is a fast relaxing hydrogel characterized by being substantially free of covalent crosslinking. In some embodiments, the fast relaxing hydrogel comprises a level of covalent crosslinking of no more than about 5% covalent crosslinking. In some embodiments, the fast relaxing hydrogel comprises a level of covalent crosslinking of no more than about 1%, no more than about 2%, no more than about 3%, no more than about 4%, or no more than about 5% covalent crosslinking. In some embodiments, the fast relaxing hydrogel comprises a level of covalent crosslinking of about 1%, about 2%, about 3%, about 4%, or about 5% covalent crosslinking. As used herein, the term “soft hydrogel” refers to a hydrogel characterized by collagen being present in an amount of up to about 3 mg / mL, e.g., about 0.001 mg / mL to about 3 mg / mL, about 1 mg / mL to about 3 mg / mL or about 1 mg / mL to about 2.5 mg / mL. In particular embodiments, the collagen is present at about 0.001 mg / mL, about 0.01 mg / mL, about 0.1 mg / mL, about 0.2 mg / mL, about 0.3 mg / mL, about 0.4 mg / mL, about 0.5 mg / mL, about 0.6 mg / mL, about 0.7 mg / mL, about 0.8 mg / mL, about 0.9 mg / mL, about 1 mg / mL, about 1.1 mg / mL, about 1.2 mg / mL, about 1.3 mg / mL, about 1.4 mg / mL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL, about 1.8 mg / mL, about 1.9 mg / mL, about 2 mg / mL, about 2.1 mg / mL, about 2.2 mg / mL, about 2.3 mg / mL, about 2.4 mg / mL, about 2.5 mg / mL, about 2.6 mg / mL, about 2.7 mg / mL, about 2.8 mg / mL, about 2.9 mg / mL, or about 3.0 mg / mL. In certain embodiments, the hydrogel is a soft-fast relaxing hydrogel characterized by collagen being present in an amount of up to about 3 mg / mL and by being substantially free of 34 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) covalent crosslinking. In certain embodiments, the hydrogel is a soft-fast relaxing hydrogel characterized by collagen being present in an amount of less than about 3 mg / mL and by being substantially free of covalent crosslinking. In certain embodiments, the hydrogel is a soft-fast relaxing hydrogel characterized by collagen being present in an amount of no greater than about 3 mg / mL (e.g., no greater than about 0.001 mg / mL, about 0.01 mg / mL, about 0.1 mg / mL, about 0.2 mg / mL, about 0.3 mg / mL, about 0.4 mg / mL, about 0.5 mg / mL, about 0.6 mg / mL, about 0.7 mg / mL, about 0.8 mg / mL, about 0.9 mg / mL, about 1 mg / mL, about 1.1 mg / mL, about 1.2 mg / mL, about 1.3 mg / mL, about 1.4 mg / mL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL, about 1.8 mg / mL, about 1.9 mg / mL, about 2 mg / mL, about 2.1 mg / mL, about 2.2 mg / mL, about 2.3 mg / mL, about 2.4 mg / mL, about 2.5 mg / mL, about 2.6 mg / mL, about 2.7 mg / mL, about 2.8 mg / mL, or about 2.9 mg / mL) and by being substantially free of covalent crosslinking. In certain embodiments, the hydrogel is a soft-fast relaxing hydrogel characterized by collagen being present in an amount of about 0.001 mg / mL to about 2.9 mg / mL and by being substantially free of covalent crosslinking. In certain embodiments, the hydrogel is a soft-fast relaxing hydrogel characterized by collagen being present in an amount of about 1 mg / mL to about 2.5 mg / mL and by being substantially free of covalent crosslinking. In certain embodiments, the hydrogel is a soft-slow relaxing hydrogel characterized by collagen being present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 3 mg / mL or about 1 mg / mL to about 2.5 mg / mL, and by comprising a level of covalent crosslinking of at least about 10%. As used herein, the term “stiff hydrogel” refers to a hydrogel characterized by collagen being present in an amount of at least about 3 mg / mL, e.g., about 3 mg / mL. In certain embodiments, the collagen is present at greater than about 3 mg / mL, greater than about 3.5 mg / mL, greater than about 4 mg / mL, greater than about 4.5 mg / mL, greater than about 5 mg / mL, greater than about 5.5 mg / mL, greater than about 6 mg / mL, greater than about 6.5 mg / mL, greater than about 7 mg / mL, greater than about 7.5 mg / mL, greater than about 8 mg / mL, greater than about 8.5 mg / mL, greater than about 9 mg / mL, greater than about 9.5 mg / mL, or greater than about 10 mg / mL, e.g., about 3 mg / mL to about 10 mg / mL, e.g., about 3 mg / mL to about 5 mg / mL, e.g., about 3 mg / mL, about 3.1 mg / mL, about 3.2 mg / mL, about 3.3 mg / mL, about 3.4 mg / mL, about 3.5 mg / mL, about 3.6 mg / mL, about 3.7 mg / mL, about 3.8 mg / mL, about 3.9 mg / mL, about 4 mg / mL, about 4.1 mg / mL, about 4.2 mg / mL, about 4.3 mg / mL, about 4.4 mg / mL, about 4.5 mg / mL, about 4.6 mg / mL, about 4.7 mg / mL, about 4.8 mg / mL, about 4.9 mg / mL, about 5 mg / mL, about 5.1 mg / mL, about 5.2 mg / mL, about 5.3 mg / mL, about 5.4 mg / mL, about 5.5 mg / mL, about 5.6 mg / mL, about 5.7 mg / mL, about 5.8 mg / mL, about 5.9 mg / mL, about 6 mg / mL, about 6.1 mg / mL, about 6.2 mg / mL, about 6.3 mg / mL, about 6.4 mg / mL, about 6.5 mg / mL, about 6.6 mg / mL, about 6.7 mg / mL, about 6.8 mg / mL, about 6.9 mg / mL, about 7 mg / mL, about 7.1 mg / mL, about 7.2 mg / mL, about 7.3 mg / mL, about 7.4 mg / mL, about 7.5 mg / mL, about 7.6 mg / mL, about 7.7 mg / mL, about 7.8 mg / mL, about 7.9 mg / mL, about 8 mg / mL, about 8.1 mg / mL, about 8.2 mg / mL, about 8.3 mg / mL, about 8.4 mg / mL, about 8.5 mg / mL, about 8.6 mg / mL, about 8.7 mg / mL, about 8.8 mg / mL, about 8.9 mg / mL, about 9 mg / mL, about 9.1 mg / mL, about 9.2 mg / mL, 35 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) about 9.3 mg / mL, about 9.4 mg / mL, about 9.5 mg / mL, about 9.6 mg / mL, about 9.7 mg / mL, about 9.8 mg / mL, about 9.9 mg / mL, about 10 mg / mL or more. In certain embodiments, the hydrogel is a stiff- fast relaxing hydrogel characterized by collagen being present in an amount of at least about 3 mg / mL, e.g., about 3 mg / mL to about 5 mg / mL, and by being substantially free of covalent crosslinking. In certain embodiments, the hydrogel is a stiff-slow relaxing hydrogel characterized by collagen being present in an amount of at least about 3 mg / mL and by comprising a level of covalent crosslinking of at least about 10%. In some embodiments, the hydrogel (e.g., collagen hydrogel) comprises covalent crosslinking. In certain embodiments, the covalent crosslinking is between a modified collagen comprising a first click reagent and a bioorthogonal crosslinker comprising a second click reagent. In certain embodiments, the scaffold of the present disclosure comprises slow relaxing hydrogels. As used herein, the term “slow relaxing hydrogel” refers to a hydrogel that is characterized by K ]^\O]] \OVKbK^SYX \K^O #p1 / 2) and / or a time value for relaxation to 60% of initially applied stress (also referred to as “60% time”) of greater than about 500 seconds (e.g., greater than about 500 seconds, greater than about 1000 seconds, greater than about 1500 seconds, greater than about 2000 seconds, greater than about 2500 seconds, greater than about 3000 seconds, greater than about 3500 seconds, greater than about 4000 seconds, greater than about 4500 seconds, greater than about 5000 seconds, greater than about 5500 seconds, greater than about 6000 seconds, greater than about 6500 seconds, greater than about 7000 seconds, greater than about 7500 seconds, greater than about 8000 seconds, greater than about 8500 seconds, greater than about 9000 seconds, greater than about 9500 seconds, greater than about 10000 seconds, greater than about 10500 seconds, greater than about 11000 seconds, greater than about 11500 seconds, greater than about 12000 seconds, greater than about 12500 seconds, greater than about 13000 seconds, greater than about 13500 seconds, greater than about 14000 seconds, greater than about 14500 seconds, greater than about 15000 seconds, greater than about 15500 seconds, greater than about 16000 seconds, greater than about 16500 seconds, greater than about 17000 seconds, greater than about 17500 seconds, greater than about 18000 seconds, greater than about 18500 seconds, greater than about 19000 seconds, greater than about 19500 seconds, greater than about 20000 seconds, greater than about 30000 seconds, greater than about 40000 seconds, greater than about 50000 seconds, greater than about 60000 seconds, greater than about 70000 seconds, greater than about 80000 seconds, greater than about 90000 seconds, greater than about 100000 seconds, greater than about 110000 seconds, greater than about 120000 seconds, greater than about 130000 seconds, greater than about 140000 seconds, greater than about 150000 seconds, greater than about 160000 seconds, greater than about 170000 seconds, greater than about 180000 seconds, greater than about 190000 seconds, or greater than about 200000 seconds). GRO ]VYa \OVKbSXQ RcN\YQOV WKc LO MRK\KM^O\SdON Lc K ]^\O]] \OVKbK^SYX \K^O #p1 / 2) and / or 60% time of about 500 to about 20,000 seconds, e.g., about 500 to about 1500, e.g., about 1000 to about 1500, e.g., 36 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) about 10000 to about 15000, e.g., about 500, about 1000, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 5500, about 6000, about 6500, about 7000, about 7500, about 8000, about 8500, about 9000, about 9500, about 10000, about 10500, about 11000, about 11500, about 12000, about 12500, about 13000, about 13500, about 14000, about 14500, about 15000, about 15500, about 16000, about 16500, about 17000, about 17500, about 18000, about 18500, about 19000, about 19500, or about 20000 seconds. Methods for measuring ]^\O]] \OVKbK^SYX \K^O #p1 / 2) and 60% time of a hydrogel are well known in the art and described herein. In certain embodiments, the hydrogel is a slow relaxing hydrogel characterized by comprises a level of covalent crosslinking of about 5% to about 100%, e.g., about 25% to about 50%, e.g., about 25% to about 75%, e.g., about 50% to about 75%, e.g., about 75% to about 100%. In some embodiments, the hydrogel is a slow relaxing hydrogel characterized by comprises a level of covalent crosslinking of at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or more. In some embodiments, the hydrogel is a slow relaxing hydrogel characterized by comprises a level of covalent crosslinking of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%. In some embodiments, the hydrogel is a slow relaxing hydrogel characterized by comprises a level of covalent crosslinking of greater than about 10%, greater than about 15%, greater than about 20%, greater than about 25%, greater than about 30%, greater than about 35%, greater than about 40%, greater than about 45%, greater than about 50%, greater than about 55%, greater than about 60%, greater than about 65%, greater than about 70%, greater than about 75%, greater than about 80%, greater than about 85%, greater than about 90%, greater than about 95%, or greater than about 99%. In some embodiments, the level of non-covalent crosslinking in the hydrogel allows for tuning of matrix stiffness. In some embodiments, the level of covalent crosslinking in the hydrogel allows for tuning of matrix viscoelasticity. In some embodiments, the hydrogel is configured to allow for independent tuning of matrix stiffness and matrix viscoelasticity. The stress relaxation of a material determines how polymers in the material relieve stress _XNO\ MYX]^KX^ ]^\KSX( >X ]YWO ObKWZVO]& ^RO RcN\YQOV S] MRK\KM^O\SdON Lc K ]^\O]] \OVKbK^SYX \K^O #p1 / 2) of about 100,000 seconds or less, e.g., about 100000, about 95000, about 90000, about 85000, about 80000, about 75000, about 70000, about 65000, about 60000, about 55000, about 50000, about 45000, about 40000, about 35000, about 30000, about 25000, about 20000, about 15000, about 10000, about 9000, about 8000, about 7000, about 6000, about 5000, about 4000, about 3000, about 2000, about 1000, about 900, about 800, about 700, about 600, about 500, about 400, about 300, about 37 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) 200, about 100, about 80, about 60, about 40, about 20, about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, about 1 seconds or less). In one example, the hydrogel is MRK\KM^O\SdON Lc K ]^\O]] \OVKbK^SYX \K^O #p1 / 2) of less than about 1 min. In one example, the hydrogel is MRK\KM^O\SdON Lc K ]^\O]] \OVKbK^SYX \K^O #p1 / 2) of about 1 min. In one example, the hydrogel is MRK\KM^O\SdON Lc K ]^\O]] \OVKbK^SYX \K^O #p1 / 2) of greater than about 1 min. The stress relaxation behavior of the hydrogel may be adjusted to mimic what is similar in natural biological tissues, e.g., tumors and / or normal tissues and / or blood. In some embodiments, the hydrogel is characterized by an initial elastic modulus of about 10 Pa to about 1,000 Pa (e.g., about 10 Pa, about 20 Pa, about 30 Pa, about 40 Pa, about 50 Pa, about 60 Pa, about 70 Pa, about 80 Pa, about 90 Pa, about 100 Pa, about 110 Pa, about 120 Pa, about 130 Pa, about 140 Pa, about 150 Pa, about 160 Pa, about 170 Pa, about 180 Pa, about 190 Pa, about 200 Pa, about 210 Pa, about 220 Pa, about 230 Pa, about 240 Pa, about 250 Pa, about 260 Pa, about 270 Pa, about 280 Pa, about 290 Pa, about 300 Pa, about 310 Pa, about 320 Pa, about 330 Pa, about 340 Pa, about 350 Pa, about 360 Pa, about 370 Pa, about 380 Pa, about 390 Pa, about 400 Pa, about 410 Pa, about 420 Pa, about 430 Pa, about 440 Pa, about 450 Pa, about 460 Pa, about 470 Pa, about 480 Pa, about 490 Pa, about 500 Pa, about 510 Pa, about 520 Pa, about 530 Pa, about 540 Pa, about 550 Pa, about 560 Pa, about 570 Pa, about 580 Pa, about 590 Pa, about 600 Pa, about 610 Pa, about 620 Pa, about 630 Pa, about 640 Pa, about 650 Pa, about 660 Pa, about 670 Pa, about 680 Pa, about 690 Pa, about 700 Pa, about 710 Pa, about 720 Pa, about 730 Pa, about 740 Pa, about 750 Pa, about 760 Pa, about 770 Pa, about 780 Pa, about 790 Pa, about 800 Pa, about 810 Pa, about 820 Pa, about 830 Pa, about 840 Pa, about 850 Pa, about 860 Pa, about 870 Pa, about 880 Pa, about 890 Pa, about 900 Pa, about 910 Pa, about 920 Pa, about 930 Pa, about 940 Pa, about 950 Pa, about 960 Pa, about 970 Pa, about 980 Pa, about 990 Pa, or about 1000 Pa). >X ]YWO OWLYNSWOX^]& ^RO RcN\YQOV S] MRK\KM^O\SdON Lc K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP K^ least about 1 second, e.g., about 1 second to about 20,000 seconds (e.g., about 1, about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 200, about 300, about 400, about 500, about 600, about 700, about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 1600, about 1700, about 1800, about 1900, about 2000, about 2100, about 2200, about 2300, about 2400, about 2500, about 2600, about 2700, about 2800, about 2900, about 3000, about 3100, about 3200, about 3300, about 3400, about 3500, about 3600, about 3700, about 3800, about 3900, about 4000, about 4100, about 4200, about 4300, about 4400, about 4500, about 4600, about 4700, about 4800, about 4900, about 5000, about 5100, about 5200, about 5300, about 5400, about 5500, about 5600, about 5700, about 5800, about 5900, about 6000, about 6100, about 6200, about 6300, about 6400, about 6500, about 6600, about 6700, about 6800, about 6900, about 7000, about 7100, about 7200, about 7300, about 7400, about 7500, about 7600, about 7700, about 7800, about 7900, about 8000, about 8100, about 8200, about 8300, about 38 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) 8400, about 8500, about 8600, about 8700, about 8800, about 8900, about 9000, about 9100, about 9200, about 9300, about 9400, about 9500, about 9600, about 9700, about 9800, about 9900, about 10000, about 10100, about 10200, about 10300, about 10400, about 10500, about 10600, about 10700, about 10800, about 10900, about 11000, about 11100, about 11200, about 11300, about 11400, about 11500, about 11600, about 11700, about 11800, about 11900, about 12000, about 12100, about 12200, about 12300, about 12400, about 12500, about 12600, about 12700, about 12800, about 12900, about 13000, about 13100, about 13200, about 13300, about 13400, about 13500, about 13600, about 13700, about 13800, about 13900, about 14000, about 14100, about 14200, about 14300, about 14400, about 14500, about 14600, about 14700, about 14800, about 14900, about 15000, about 15100, about 15200, about 15300, about 15400, about 15500, about 15600, about 15700, about 15800, about 15900, about 16000, about 16100, about 16200, about 16300, about 16400, about 16500, about 16600, about 16700, about 16800, about 16900, about 17000, about 17100, about 17200, about 17300, about 17400, about 17500, about 17600, about 17700, about 17800, about 17900, about 18000, about 18100, about 18200, about 18300, about 18400, about 18500, about 18600, about 18700, about 18800, about 18900, about 19000, about 19100, about 19200, about 19300, about 19400, about 19500, about 19600, about 19700, about 19800, about 19900, or about 20000 seconds). In some embodiments, the hydrogel is characterized by a time value for relaxation to 60% of initially applied stress (60% time) of at least about 1 second, e.g., about 1 second to about 20,000 seconds (e.g., about 1, about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 200, about 300, about 400, about 500, about 600, about 700, about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 1600, about 1700, about 1800, about 1900, about 2000, about 2100, about 2200, about 2300, about 2400, about 2500, about 2600, about 2700, about 2800, about 2900, about 3000, about 3100, about 3200, about 3300, about 3400, about 3500, about 3600, about 3700, about 3800, about 3900, about 4000, about 4100, about 4200, about 4300, about 4400, about 4500, about 4600, about 4700, about 4800, about 4900, about 5000, about 5100, about 5200, about 5300, about 5400, about 5500, about 5600, about 5700, about 5800, about 5900, about 6000, about 6100, about 6200, about 6300, about 6400, about 6500, about 6600, about 6700, about 6800, about 6900, about 7000, about 7100, about 7200, about 7300, about 7400, about 7500, about 7600, about 7700, about 7800, about 7900, about 8000, about 8100, about 8200, about 8300, about 8400, about 8500, about 8600, about 8700, about 8800, about 8900, about 9000, about 9100, about 9200, about 9300, about 9400, about 9500, about 9600, about 9700, about 9800, about 9900, about 10000, about 10100, about 10200, about 10300, about 10400, about 10500, about 10600, about 10700, about 10800, about 10900, about 11000, about 11100, about 11200, about 11300, about 11400, about 11500, about 11600, about 11700, about 11800, about 11900, about 12000, about 12100, about 12200, about 12300, about 12400, about 39 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) 12500, about 12600, about 12700, about 12800, about 12900, about 13000, about 13100, about 13200, about 13300, about 13400, about 13500, about 13600, about 13700, about 13800, about 13900, about 14000, about 14100, about 14200, about 14300, about 14400, about 14500, about 14600, about 14700, about 14800, about 14900, about 15000, about 15100, about 15200, about 15300, about 15400, about 15500, about 15600, about 15700, about 15800, about 15900, about 16000, about 16100, about 16200, about 16300, about 16400, about 16500, about 16600, about 16700, about 16800, about 16900, about 17000, about 17100, about 17200, about 17300, about 17400, about 17500, about 17600, about 17700, about 17800, about 17900, about 18000, about 18100, about 18200, about 18300, about 18400, about 18500, about 18600, about 18700, about 18800, about 18900, about 19000, about 19100, about 19200, about 19300, about 19400, about 19500, about 19600, about 19700, about 19800, about 19900, or about 20000 seconds). >X ]YWO OWLYNSWOX^]& ^RO RcN\YQOV S] MRK\KM^O\SdON Lc K VY]] KXQVO #n& NOV^K$ YP KLY_^ +e ^Y about 20° (e.g., about 0.5°, about 1°, about 1.5°, about 2°, about 2.5°, about 3°, about 3.5°, about 4°, about 4.5°, about 5°, about 5.5°, about 6°, about 6.5°, about 7°, about 7.5°, about 8°, about 8.5°, about 9°, about 9.5°, about 10°, about 10.5°, about 11°, about 11.5°, about 12°, about 12.5°, about 13°, about 13.5°, about 14°, about 14.5°, about 15°, about 15.5°, about 16°, about 16.5°, about 17°, about 17.5°, about 18°, about 18.5°, about 19°, about 19.5°, or about 20°). In some embodiments, the hydrogel is characterized by a storage modulus (G’) of about 1 kPa to about 5 kPa (e.g., about 0.1 kPa, about 0.2 kPa, about 0.3 kPa, about 0.4 kPa, about 0.5 kPa, about 0.6 kPa, about 0.7 kPa, about 0.8 kPa, about 0.9 kPa, about 1 kPa, about 1.1 kPa, about 1.2 kPa, about 1.3 kPa, about 1.4 kPa, about 1.5 kPa, about 1.6 kPa, about 1.7 kPa, about 1.8 kPa, about 1.9 kPa, about 2 kPa, about 2.1 kPa, about 2.2 kPa, about 2.3 kPa, about 2.4 kPa, about 2.5 kPa, about 2.6 kPa, about 2.7 kPa, about 2.8 kPa, about 2.9 kPa, about 3 kPa, about 3.1 kPa, about 3.2 kPa, about 3.3 kPa, about 3.4 kPa, about 3.5 kPa, about 3.6 kPa, about 3.7 kPa, about 3.8 kPa, about 3.9 kPa, about 4 kPa, about 4.1 kPa, about 4.2 kPa, about 4.3 kPa, about 4.4 kPa, about 4.5 kPa, about 4.6 kPa, about 4.7 kPa, about 4.8 kPa, about 4.9 kPa, or about 5 kPa). In some embodiments, the hydrogel is characterized by a loss modulus (G”) of about 0.1 kPa to about 3 kPa (e.g., about 0.1 kPa, about 0.2 kPa, about 0.3 kPa, about 0.4 kPa, about 0.5 kPa, about 0.6 kPa, about 0.7 kPa, about 0.8 kPa, about 0.9 kPa, about 1 kPa, about 1.1 kPa, about 1.2 kPa, about 1.3 kPa, about 1.4 kPa, about 1.5 kPa, about 1.6 kPa, about 1.7 kPa, about 1.8 kPa, about 1.9 kPa, about 2 kPa, about 2.1 kPa, about 2.2 kPa, about 2.3 kPa, about 2.4 kPa, about 2.5 kPa, about 2.6 kPa, about 2.7 kPa, about 2.8 kPa, about 2.9 kPa, or about 3 kPa). In some embodiments, the hydrogel is characterized by a fiber length of about 0.01 µm to about 20 µm (e.g., about 0.01 µm, about 0.5 µm, about 1 µm, about 1.5 µm, about 2 µm, about 2.5 µm, about 3 µm, about 3.5 µm, about 4 µm, about 4.5 µm, about 5 µm, about 5.5 µm, about 6 µm, about 6.5 µm, about 7 µm, about 7.5 µm, about 8 µm, about 8.5 µm, about 9 µm, about 9.5 µm, about 10 µm, about 10.5 µm, about 11 µm, about 11.5 µm, about 12 µm, about 12.5 µm, about 13 µm, 40 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) about 13.5 µm, about 14 µm, about 14.5 µm, about 15 µm, about 15.5 µm, about 16 µm, about 16.5 µm, about 17 µm, about 17.5 µm, about 18 µm, about 18.5 µm, about 19 µm, about 19.5 µm, or about 20 µm). In some embodiments, the hydrogel is characterized by a fiber thickness of about 0.01 µm to about 0.1 µm (e.g., about 0.01 µm, about 0.02 µm, about 0.03 µm, about 0.04 µm, about 0.05 µm, about 0.06 µm, about 0.07 µm, about 0.08 µm, about 0.09 µm, or about 0.1 µm). In some embodiments, the hydrogel is characterized by a fiber angle of about 1° to about 100° (e.g., about 1°, about 5°, about 10°, about 15°, about 20°, about 25°, about 30°, about 35°, about 40°, about 45°, about 50°, about 55°, about 60°, about 65°, about 70°, about 75°, about 80°, about 85°, about 90°, about 95°, or about 100°). In some embodiments, the hydrogel is characterized by a fiber waviness of about 0.05 µm to about 0.5 µm (e.g., about 0.05 µm, about 0.06 µm, about 0.07 µm, about 0.08 µm, about 0.09 µm, about 0.1 µm, about 0.11 µm, about 0.12 µm, about 0.13 µm, about 0.14 µm, about 0.15 µm, about 0.16 µm, about 0.17 µm, about 0.18 µm, about 0.19 µm, about 0.2 µm, about 0.21 µm, about 0.22 µm, about 0.23 µm, about 0.24 µm, about 0.25 µm, about 0.26 µm, about 0.27 µm, about 0.28 µm, about 0.29 µm, about 0.3 µm, about 0.31 µm, about 0.32 µm, about 0.33 µm, about 0.34 µm, about 0.35 µm, about 0.36 µm, about 0.37 µm, about 0.38 µm, about 0.39 µm, about 0.4 µm, about 0.41 µm, about 0.42 µm, about 0.43 µm, about 0.44 µm, about 0.45 µm, about 0.46 µm, about 0.47 µm, about 0.48 µm, about 0.49 µm, about, or about 0.5 µm). In some embodiments, the hydrogel is characterized by a pore diameter of about 0.5 µm to about 10 µm (e.g., about 0.5 µm, about 1 µm, about 1.5 µm, about 2 µm, about 2.5 µm, about 3 µm, about 3.5 µm, about 4 µm, about 4.5 µm, about 5 µm, about 5.5 µm, about 6 µm, about 6.5 µm, about 7 µm, about 7.5 µm, about 8 µm, about 8.5 µm, about 9 µm, about 9.5 µm, or about 10 µm). In some embodiments, the hydrogel is characterized by a collagen, a modified collagen, or a combination thereof present in an amount of about 1 mg / mL to about 10 mg / mL (e.g., about 1 mg / mL, about 1.5 mg / mL, about 2 mg / mL, about 2.5 mg / mL, about 3 mg / mL, about 3.5 mg / mL, about 4 mg / mL, about 4.5 mg / mL, about 5 mg / mL, about 5.5 mg / mL, about 6 mg / mL, about 6.5 mg / mL, about 7 mg / mL, about 7.5 mg / mL, about 8 mg / mL, about 8.5 mg / mL, about 9 mg / mL, about 9.5 mg / mL, or about 10 mg / mL). In some embodiments, the hydrogel is characterized by optionally an additional polymer, an additional modified polymer, or a combination thereof in an amount of about 1 mg / mL to about 10 mg / mL (e.g., about 1 mg / mL, about 1.5 mg / mL, about 2 mg / mL, about 2.5 mg / mL, about 3 mg / mL, about 3.5 mg / mL, about 4 mg / mL, about 4.5 mg / mL, about 5 mg / mL, about 5.5 mg / mL, about 6 mg / mL, about 6.5 mg / mL, about 7 mg / mL, about 7.5 mg / mL, about 8 mg / mL, about 8.5 mg / mL, about 9 mg / mL, about 9.5 mg / mL, or about 10 mg / mL). In some embodiments, the hydrogel is characterized by optionally a bioorthogonal crosslinker present in an amount of about 1 µM to about 500 µM (e.g., about 5 µM, about 10 µM, about 15 µM, 41 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) about 20 µM, about 25 µM, about 30 µM, about 35 µM, about 40 µM, about 45 µM, about 50 µM, about 55 µM, about 60 µM, about 65 µM, about 70 µM, about 75 µM, about 80 µM, about 85 µM, about 90 µM, about 95 µM, about 100 µM, about 105 µM, about 110 µM, about 115 µM, about 120 µM, about 125 µM, about 130 µM, about 135 µM, about 140 µM, about 145 µM, about 150 µM, about 155 µM, about 160 µM, about 165 µM, about 170 µM, about 175 µM, about 180 µM, about 185 µM, about 190 µM, about 195 µM, about 200 µM, about 205 µM, about 210 µM, about 215 µM, about 220 µM, about 225 µM, about 230 µM, about 235 µM, about 240 µM, about 245 µM, about 250 µM, about 255 µM, about 260 µM, about 265 µM, about 270 µM, about 275 µM, about 280 µM, about 285 µM, about 290 µM, about 295 µM, about 300 µM, about 305 µM, about 310 µM, about 315 µM, about 320 µM, about 325 µM, about 330 µM, about 335 µM, about 340 µM, about 345 µM, about 350 µM, about 355 µM, about 360 µM, about 365 µM, about 370 µM, about 375 µM, about 380 µM, about 385 µM, about 390 µM, about 395 µM, about 400 µM, about 405 µM, about 410 µM, about 415 µM, about 420 µM, about 425 µM, about 430 µM, about 435 µM, about 440 µM, about 445 µM, about 450 µM, about 455 µM, about 460 µM, about 465 µM, about 470 µM, about 475 µM, about 480 µM, about 485 µM, about 490 µM, about 495 µM, or about 500 µM). In some embodiments, the hydrogel is characterized by a level of covalent crosslinking of about 5% to about 100% (e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%). In some embodiments, the hydrogel is a soft-fast relaxing hydrogel characterized by an initial OVK]^SM WYN_V_] YP KLY_^ + / * DK ^Y KLY_^ ,** DK5 K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP KLY_^ / ]OMYXN ^Y about 10 seconds; a time value for relaxation to 60% of initially applied stress (60% time) of about 5 ]OMYXN ^Y KLY_^ +* ]OMYXN]5 K VY]] KXQVO #n& NOV^K$ YP KLY_^ / e ^Y KLY_^ + / e5 K ]^Y\KQO WYN_V_] #<k$ YP about 2 kPa to about 3 kPa; a loss modulus (G”) of about 0.5 kPa to about 2 kPa; and / or a collagen, a modified collagen, or a combination thereof present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 3 mg / mL or about 1 mg / mL to about 2.5 mg / mL. In some embodiments, the hydrogel is a soft-slow relaxing hydrogel characterized by an SXS^SKV OVK]^SM WYN_V_] YP KLY_^ + / * DK ^Y KLY_^ ,** DK5 K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP KLY_^ / &*** second to about 15,000 seconds; a time value for relaxation to 60% of initially applied stress (60% ^SWO$ YP KLY_^ / &*** ]OMYXN ^Y KLY_^ + / &*** ]OMYXN]5 K VY]] KXQVO #n& NOV^K$ YP KLY_^ +e ^Y KLY_^ +*e5 K storage modulus (G’) of about 2 kPa to about 4 kPa; a loss modulus (G”) of about 0.5 kPa to about 1 kPa; and / or a collagen, a modified collagen, or a combination thereof present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 3 mg / mL or about 1 mg / mL to about 2.5 mg / mL. a bioorthogonal crosslinker present in an amount of about 250 µM to about 350 µM; and / or a level of covalent crosslinking of about 25% to about 75%. In some embodiments, the hydrogel is a stiff-fast relaxing hydrogel characterized by an initial OVK]^SM WYN_V_] YP KLY_^ / ** DK ^Y KLY_^ 3** DK5 K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP KLY_^ , ]OMYXN ^Y 42 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) about 8 seconds; a time value for relaxation to 60% of initially applied stress (60% time) of about 2 ]OMYXN ^Y KLY_^ 2 ]OMYXN]5 K VY]] KXQVO #n& NOV^K$ YP KLY_^ / e ^Y KLY_^ + / e5 K ]^Y\KQO WYN_V_] #<k$ YP about 3.5 kPa to about 4.5 kPa; a loss modulus (G”) of about 0.7 kPa to about 1.1 kPa; and / or a collagen, a modified collagen, or a combination thereof present in an amount of about 3 mg / mL to about 5 mg / mL. In some embodiments, the hydrogel is a stiff-slow relaxing hydrogel characterized by an SXS^SKV OVK]^SM WYN_V_] YP KLY_^ / ** DK ^Y KLY_^ 3** DK5 K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP KLY_^ / ** second to about 1,500 seconds; a time value for relaxation to 60% of initially applied stress (60% ^SWO$ YP KLY_^ / ** ]OMYXN ^Y KLY_^ +& / **5 K VY]] KXQVO #n& NOV^K$ YP KLY_^ / e ^Y KLY_^ +*e5 K ]^Y\KQO modulus (G’) of about 3.5 kPa to about 4.5 kPa; a loss modulus (G”) of about 0.5 kPa to about 0.9 kPa; a collagen, a modified collagen, or a combination thereof present in an amount of about 3 mg / mL to about 5 mg / mL. a bioorthogonal crosslinker present in an amount of about 250 µM to about 350 µM; and / or a level of covalent crosslinking of about 25% to about 75%. In some embodiments, the hydrogel is a fast relaxing interpenetrating polymer network (IPN) RcN\YQOV MRK\KM^O\SdON Lc K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP KLY_^ +** ]OMYXN ^Y KLY_^ ,** ]OMYXN]5 K VY]] KXQVO #n& NOV^K$ YP KLY_^ .e ^Y KLY_^ 0e5 K MYVVKQOX& K WYNSPSON MYVVKQOX& Y\ K MYWLSXK^SYX ^RO\OYP present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 3 mg / mL or about 1 mg / mL to about 2.5 mg / mL; an additional polymer, an additional modified polymer, or a combination thereof in an amount of about 3 mg / mL to about 5 mg / mL. In some embodiments, the hydrogel is a slow relaxing interpenetrating polymer network #>DB$ RcN\YQOV MRK\KM^O\SdON Lc K ]^\O]] \OVKbK^SYX \K^O #p+),$ YP KLY_^ / ** ]OMYXN ^Y KLY_^ +& / ** ]OMYXN]5 K VY]] KXQVO #n& NOV^K$ YP KLY_^ -e ^Y KLY_^ / e5 K MYVVKQOX& K WYNSPSON MYVVKQOX& Y\ K combination thereof present in an amount of about 1 mg / mL to about 3 mg / mL; an additional polymer, an additional modified polymer, or a combination thereof in an amount of about 3 mg / mL to about 5 mg / mL; a bioorthogonal crosslinker present in an amount of about 250 µM to about 350 µM; and / or a level of covalent crosslinking of about 25% to about 75%. In some embodiments, the hydrogel is characterized by a consistent collagen network architecture and pore size distribution. In some embodiments, the covalent crosslinking does not alter collagen network architecture, pore-size distribution, collagen fiber length, collagen fiber waviness, or angle between the fibers of the hydrogel. The stiffness and viscoelasticity of materials, such as the hydrogels described herein, are determined by applying a stress (e.g., oscillatory force) to the material and measuring the resulting displacement (i.e., strain). For an applied oscillatory stress or strain, the stress and strain occur in phase in purely elastic materials, such that the response of one (stress or strain) occurs simultaneously with the other. In purely viscous materials, a phase difference is detected between stress and strain. The strain lags behind the stress by a 90 degree (radian) phase lag. Viscoelastic materials have behavior in between that of purely elastic and purely viscous—they exhibit some phase lag in strain. 43 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) The storage modulus in viscoelastic solid materials is a measure of the stored energy, representing the elastic portion, while the loss modulus in viscoelastic solids is a measure the energy dissipated as heat, representing the viscous portion. The hydrogels described herein are characterized as viscoelastic. The elastic modulus (also called Young’s modulus) is a measure of stiffness of a material, such as a hydrogel. The elastic modulus is the slope of the initial straight portion, e.g., the first 5-10% of strain, of a stress-strain curve. The modulus is the ratio of the change in stress to the change in strain expressed as a fraction of the original length. The elastic modulus has units of Pa (or N / m2or ml+•kg•sl,). For viscoelastic materials, the measured elastic modulus can depend on the timescale of the stress-strain measurement, since viscoelastic materials can exhibit stress relaxation leading to a decrease in the measured modulus for measurements taken over longer timescales. For materials that exhibit significant stress relaxation, the initial elastic modulus is defined as the elastic modulus for a stress-strain measurement that is performed over a timescale at which there is minimal stress relaxation. The initial elastic modulus can be determined using standard methods available in the art, e.g., by a compression test or rheology. For example, a hydrogel is compressed, e.g., to 15% strain, e.g., with a deformation rate of about 1 mm / min. With 15% compression, the stress versus strain relations of the hydrogels are almost linear, and the slope of the initial portion (first 5-10% strain) of the stress strain curves gives the initial elastic modulus. Exemplary polymers suitable or use in the hydrogels of the disclosure include natural polymers and synthetic polymers. In some embodiments, the natural polymer comprises a fibrous protein. Exemplary fibrous proteins include, without limitation, a collagen, an elastin, a keratin, a fibrin, a laminin, a fibronectin, and combinations thereof. Exemplary polymers suitable or use in the hydrogels of the disclosure include alginate, polylactic acid, polyglycolic acid, PLGA, gelatin, collagen, agarose, poly(lysine), polyhydroxybutyrate, poly-epsilon-caprolactone, polyphosphazines, poly(vinyl alcohol), poly(alkylene oxide), poly(ethylene oxide), poly(allylamine), poly(acrylate), poly(4- aminomethylstyrene), pluronic polyol, polyoxamer, poly(uronic acid), poly(anhydride) or poly(vinylpyrrolidone). The hydrogels are fabricated from a variety of synthetic polymers and naturally-occurring polymers such as, but not limited to, collagen, fibrin, hyaluronic acid, agarose, and laminin-rich gels. One preferred material for the hydrogel is collagen or modified collagen material. In a some embodiments, the collagen is present in an amount of about 1 mg / mL to about 10 mg / mL (e.g., about 1 mg / mL, about 1.5 mg / mL, about 2 mg / mL, about 2.5 mg / mL, about 3 mg / mL, about 3.5 mg / mL, about 4 mg / mL, about 4.5 mg / mL, about 5 mg / mL, about 5.5 mg / mL, about 6 mg / mL, about 6.5 mg / mL, about 7 mg / mL, about 7.5 mg / mL, about 8 mg / mL, about 8.5 mg / mL, about 9 mg / mL, about 9.5 mg / mL, or about 10 mg / mL). In a some embodiments, the collagen is present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 3 mg / mL or about 1 mg / mL to about 2.5 mg / mL. In a 44 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) some embodiments, the collagen is present in an amount of about 3 mg / mL to about 5 mg / mL. In a some embodiments, the collagen is a modified collagen comprising a click reagent (e.g., a first click reagent). In a some embodiments, the collagen (e.g., modified collagen) is selected from the group consisting of a type I collagen, a type II collagen, a type III collagen, a type IV collagen, a type V collagen, a type VI collagen, a type VII collagen, a type VIII collagen, a type IX collagen, a type X collagen, a type XI collagen, a type XII collagen, a type XIII collagen, a type XIV collagen, a type XV collagen, a type XVI collagen, a type XVII collagen, a type XVIII collagen, a type XIX collagen, a type XX collagen, a type XXI collagen, a type XXII collagen, a type XXIII collagen, a type XXIV collagen, a type XXV collagen, a type XXVI collagen, a type XXVII collagen, a type XXVIII collagen, a type XXIX collagen, and combinations thereof. In a some embodiments, the collagen (e.g., modified collagen) is selected from the group consisting of COL1A1, COL1A2, COL2A1, COL3A1, COL4A1, COL4A2, COL4A3, COL4A4, COL4A5, COL4A6, COL5A1, COL5A2, COL5A3, COL6A1, COL6A2, COL6A3, COL6A5, COL7A1, COL8A1, COL8A2, COL9A1, COL9A2, COL9A3, COL10A1, COL11A1, COL11A2, COL12A1, COL13A1, COL14A1, COL15A1, COL16A1, COL17A1, COL18A1, COL19A1, COL20A1, COL21A1, COL22A1, COL23A1, COL24A1, COL25A1, EMID2, COL27A1, COL28A1, COL29A1, and combinations thereof. In a some embodiments, the collagen (e.g., modified collagen) comprises a type I collagen, optionally wherein the type I collagen is COL1A1. In a some embodiments, the hydrogel comprises interpenetrating networks (IPNs) of collagen and at least one additional polymer, optionally wherein the additional polymer is selected from the group consisting of a natural polymer, a synthetic polymer, and combinations thereof, optionally wherein the additional polymer comprises Matrigel®. In a some embodiments, the additional polymer is present in an amount of about 1 mg / mL to about 10 mg / mL (e.g., about 1 mg / mL, about 1.5 mg / mL, about 2 mg / mL, about 2.5 mg / mL, about 3 mg / mL, about 3.5 mg / mL, about 4 mg / mL, about 4.5 mg / mL, about 5 mg / mL, about 5.5 mg / mL, about 6 mg / mL, about 6.5 mg / mL, about 7 mg / mL, about 7.5 mg / mL, about 8 mg / mL, about 8.5 mg / mL, about 9 mg / mL, about 9.5 mg / mL, or about 10 mg / mL). In a some embodiments, the additional polymer is present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 3 mg / mL or about 1 mg / mL to about 2.5 mg / mL. In a some embodiments, the additional polymer is present in an amount of about 3 mg / mL to about 5 mg / mL. In a some embodiments, the hydrogel further comprises a crosslinker. In a some embodiments, the hydrogel comprises a plurality of polymer chains and a plurality of crosslinker molecules. As used herein, the term “crosslinker,” or a “crosslinker molecule,” or “bioorthogonal crosslinker” refers to a molecule, e.g., that acts to physically separate and / or covalently crosslink the chains of a polymer, such as a collagen polymer. The crosslinker molecule can comprise a first end and a second end. One of the ends of the crosslinker molecule may comprise a functional group (e.g., 45 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) a click reagent) that allows attachment, e.g., attachment via a covalent bond, of one end of the crosslinker molecule to the polymer chain. In some embodiments, the crosslinker molecule crosslinks polymer chains, i.e., it attaches to two different polymer chains via its two ends. In a some embodiments, the crosslinker molecule comprises a functional group at one of its ends. In a some embodiments, the crosslinker molecule comprises a functional group at both of its ends. In a some embodiments, the hydrogel comprises a crosslinker comprising a click reagent. Exemplary functional groups are known in the art and include, but are not limited to amine, carboxylic acid, carbodiimide, N-Hydroxysuccinimide, hydroxyl group, thiol group, maleimide group, azide, alkyne, alkene groups, etc. In other examples, a crosslinker molecule may be attached to a collagen polymer chain using tetrazine-norbornene chemistry. See Desai et al., Biomaterials 60(2015):30-37. In a some embodiments, the crosslinker comprises a first end and a second end, optionally wherein each end comprises a click reagent (e.g., a second click reagent). In a some embodiments, the click reagent is selected from the group consisting of an azide moiety, an alkyne moiety, a dibenzocyclooctyne moiety, a tetrazine (Tz) moiety, a trans-cyclooctene moiety, a vinyl moiety, a methylcyclopropene moiety, a norbornene (Nb) moiety, and combinations thereof. In a some embodiments, the click reagent forms a covalent crosslink via a click chemistry reaction selected from the group consisting of (i) a Cu(I)-catalyzed azide – alkyne click chemistry reaction (CuAAC); (ii) a strain-promoted azide – alkyne click chemistry reaction (SPAAC); and / or (iii) a tetrazine – trans-cyclooctene (TCO) ligation. In a some embodiments, the click reagent forms a covalent crosslink via an inverse electron demand Diels-Alder (iEDDA) click reaction between tetrazine (Tz) and norbornene (NB) moieties. In a some embodiments, the click reagent comprises a norbornene (Nb) moiety. In a some embodiments, the click reagent comprises a tetrazine (Tz) moiety. In a some embodiments, the crosslinker comprises a methyltetrazine-(PEG)5-methyltetrazine crosslinker. In some embodiments, the first click reagent comprises a norbornene (Nb) moiety and the second click reagent comprises a tetrazine (Tz) moiety. In a some embodiments, the first click reagent is covalently crosslinked to the second click reagent. In a some embodiments, the level of covalent crosslinking comprises a level of covalent crosslinking between the first click reagent and the second click reagent. In a some embodiments, the hydrogel comprises a level of covalent crosslinking of about 5% to about 100% of the modified collagen, e.g., a level of covalent crosslinking of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% of the modified collagen. In some embodiments, the hydrogel is substantially free of covalent crosslinking of the modified collagen. In a some embodiments, the crosslinker is present in the hydrogel in an amount of about 0 µM to about 500 µM (e.g., about 0 µM, about 1 µM, about 5 µM, about 10 µM, about 15 µM, about 20 µM, about 25 µM, about 30 µM, about 35 µM, about 40 µM, about 45 µM, about 50 µM, about 55 µM, about 60 µM, about 65 µM, about 70 µM, about 75 µM, about 80 µM, about 85 µM, about 90 46 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) µM, about 95 µM, about 100 µM, about 105 µM, about 110 µM, about 115 µM, about 120 µM, about 125 µM, about 130 µM, about 135 µM, about 140 µM, about 145 µM, about 150 µM, about 155 µM, about 160 µM, about 165 µM, about 170 µM, about 175 µM, about 180 µM, about 185 µM, about 190 µM, about 195 µM, about 200 µM, about 205 µM, about 210 µM, about 215 µM, about 220 µM, about 225 µM, about 230 µM, about 235 µM, about 240 µM, about 245 µM, about 250 µM, about 255 µM, about 260 µM, about 265 µM, about 270 µM, about 275 µM, about 280 µM, about 285 µM, about 290 µM, about 295 µM, about 300 µM, about 305 µM, about 310 µM, about 315 µM, about 320 µM, about 325 µM, about 330 µM, about 335 µM, about 340 µM, about 345 µM, about 350 µM, about 355 µM, about 360 µM, about 365 µM, about 370 µM, about 375 µM, about 380 µM, about 385 µM, about 390 µM, about 395 µM, about 400 µM, about 405 µM, about 410 µM, about 415 µM, about 420 µM, about 425 µM, about 430 µM, about 435 µM, about 440 µM, about 445 µM, about 450 µM, about 455 µM, about 460 µM, about 465 µM, about 470 µM, about 475 µM, about 480 µM, about 485 µM, about 490 µM, about 495 µM, or about 500 µM). In a some embodiments, the crosslinker is present in the hydrogel at a ratio of about 1:1 and about 1:100 crosslinker : collagen. In the hydrogels of the disclosure, the plurality of polymer chains, e.g., collagen polymer chains, are non-covalently (e.g., ionically) crosslinked to each other. Without wishing to be bound by a specific theory, it is believed that hydrogels comprising ionic cross-links are viscoelastic and are capable of stress relaxation behavior because ionic cross-links, being reversible, can un-bind and re- bind when stresses are applied to the hydrogel. U.S. Patent Number 6,642,363, the entire contents of which are incorporated herein by reference, discloses methods for making and using polymers containing polysaccharides such as alginates or modified alginates. Specifically, in one aspect, the present disclosure provides an in vitro collagen based system in which viscoelasticity can be varied independently of the initial elastic modulus by utilizing a combination of non-covalent and permanent covalent bonds. Adding covalent bonds only to regions of the network that are already in close spatial contact (e.g., already crosslinked physically) leads to minimal changes in the moduli, but dramatic alterations in the viscoelastic properties (e.g., rate of stress relaxation). Accordingly, in one aspect, a sequential crosslinking approach is provided herein, in which physical gelation occurs first, followed by local covalent crosslinking using small biorthogonal crosslinking molecules. This approach preserves a consistent collagen architecture and pore size distribution. While other studies have reported an impact of substrate stiffness on TCR interactions utilizing 2D surfaces or coated particles, or on T cell activation using hydrogels with large pores that effectively create a flat / curved culture surface, or only varying collagen density, the compositions and methods provided herein are the first strategy aimed at generating functionally distinct T cell populations by tuning tissue-level viscoelasticity. This collagen system is the first to report a crosslinking mechanism that successfully decouples ECM stiffness from viscoelasticity, and the crosslinkers themselves had minimal impact on the phenotype of T cells. 47 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) The hydrogels of the disclosure may be porous or non-porous. For example, the hydrogels may contain nanopores, micropores, macropores, or a combination thereof. The size of the pores permits cell migration or movement (e.g., immune cell, e.g., T cell) through the pores. For example, the hydrogel comprises pores that are characterized by a diameter of about 20 µm to about 500 µm (e.g., about 50 µm to about 500 µm, or about 20 µm to about 300 µm). In other examples, the hydrogel comprises nanopores, such as pores of about 1 nm to about 500 nm in diameter. In some cases, hydrogels comprising alginate polymer chains comprise pores of about 1 nm to about 10 nm in diameter, and in other cases, hydrogels comprising collagen comprise pores of about 100 nm to about 500 nm in diameter. For example, the hydrogels are nanoporous having a diameter of less than about 10 nm; microporous wherein the diameter of the pores is preferably in the range of about 100 nm to about 20 µm; or macroporous wherein the diameter of the pores is greater than about 20 µm, more preferably greater than about 100 µm and even more preferably greater than about 400 µm. In one example, the hydrogels are macroporous with aligned pores of about 400 µm to about 500 µm in diameter. In some embodiments, the pore diameter can be about 0.5 µm to about 10 µm (e.g., about 0.5 µm, about 1 µm, about 1.5 µm, about 2 µm, about 2.5 µm, about 3 µm, about 3.5 µm, about 4 µm, about 4.5 µm, about 5 µm, about 5.5 µm, about 6 µm, about 6.5 µm, about 7 µm, about 7.5 µm, about 8 µm, about 8.5 µm, about 9 µm, about 9.5 µm, or about 10 µm). Methods for the preparation of polymer matrices having the desired pore sizes and pore alignments are described, e.g., in U.S. Patent. No.6,511,650 and US Publication No.2013 / 0202707, the entire contents of each of which are incorporated herein by reference. The consistency of a hydrogel varies from a soft / pliable (e.g., a gel) to glassy, rubbery, brittle, tough, elastic, stiff. The structures contain pores, which are nanoporous, microporous, or macroporous, and the pattern of the pores is optionally homogeneous, heterogeneous, aligned, repeating, or random. Accordingly, the hydrogels of the disclosure may include one or more active agents, e.g., compounds that regulate cell function and / or behavior. As used herein, the term “active agent” or “therapeutic agent” refers to an active ingredient that is intended for use in a particular application. In some embodiments, the term “active agent” or “therapeutic agent” refers to an agent that possesses therapeutic, prophylactic, and / or diagnostic properties, e.g., in vivo, e.g., when administered to a subject, such as a human subject or an animal, including mammals and domestic animals. Examples of active agents include, but are not limited to, amino acids, proteins, peptides, antibodies, growth factors, cytokines, nucleic acids, vectors, sugars, lipids, antigens, vaccines, viruses, enzymes, cells, small molecules, drugs, and any combination thereof. In some embodiments, the active agent comprises a T-cell activating molecule and / or a T-cell co-stimulatory molecule. In some embodiments, the T-cell activating molecule and / or the T-cell co-stimulatory molecule can comprise CD3 / CD28 antibodies or CD3 / CD28 / CD137 antibodies. The active agents may be covalently linked to the hydrogel or non-covalently associated with the hydrogel. For example, the bioactive 48 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) composition may be an ECM component that is chemically crosslinked to the polymer chain that is used to make hydrogel. In a some embodiments, the ECM component is selected from the group consisting of a fibrous protein, a glycosaminoglycan (GAG), a proteoglycan (PG), a glycoprotein, a growth factor, a cytokine, a cell adhesion molecule (CAM), and combinations thereof. Regardless of the tissue of origin, ECM components generally include three general classes of macromolecules: fibrous proteins (e.g., collagens), proteoglycans / glycosaminoglycans (PG / GAG), and glycoproteins, e.g., fibronectin (FN), laminin, and thrombospondin. ECM components associate with molecules on the cell surface and mediate adhesion and / or motility. In some embodiments, the hydrogel comprises a fibrous protein (e.g., a modified fibrous protein). In some embodiments, the fibrous protein comprises a fibrous glycoprotein (e.g., a modified fibrous glycoprotein). In some embodiments, the fibrous protein comprises an extracellular matrix (ECM) protein (e.g., a modified ECM protein). As used herein, the term “fibrous protein” refers to a protein comprising one or more polypeptide chains organized approximately in parallel along an axis, forming filamentous and / or sheet-like structures. Fibrous proteins can contain highly repetitive amino acid sequences that result in the formation of relatively uniform secondary structures (e.g., m'ROVSMO]& r']^\KXN]& r'ZVOK^ON ]ROO^]& coiled coils, and / or triple helices), which in turn can facilitate the polymerization and assembly of fibrous proteins into a fibrous protein network. Exemplary fibrous proteins include, without limitation, collagens (COL), elastins (ELAS), fibronectins (FN), laminins (LAM), and combinations thereof. In some embodiments, the fibrous protein comprises a collagen (COL) (e.g., a modified collagen). In some embodiments, the fibrous protein comprises an elastin (ELAS) (e.g., a modified elastin). In some embodiments, the fibrous protein comprises a fibronectin (FN) (e.g., a modified fibronectin). In some embodiments, the fibrous protein comprises a laminin (LAM) (e.g., a modified laminin). In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 1 mg / mL to about 10 mg / mL (e.g., about 1 mg / mL, about 1.5 mg / mL, about 2 mg / mL, about 2.5 mg / mL, about 3 mg / mL, about 3.5 mg / mL, about 4 mg / mL, about 4.5 mg / mL, about 5 mg / mL, about 5.5 mg / mL, about 6 mg / mL, about 6.5 mg / mL, about 7 mg / mL, about 7.5 mg / mL, about 8 mg / mL, about 8.5 mg / mL, about 9 mg / mL, about 9.5 mg / mL, or about 10 mg / mL). In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 1 mg / mL to about 2 mg / mL. In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 1 mg / mL to about 3 mg / mL. In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 2 mg / mL to about 3 mg / mL. In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 2 mg / mL to about 4 mg / mL. In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 3 mg / mL to about 4 mg / mL. In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 3 49 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) mg / mL to about 5 mg / mL. In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 4 mg / mL to about 5 mg / mL. In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 4 mg / mL to about 6 mg / mL. In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 5 mg / mL to about 6 mg / mL. In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 5 mg / mL to about 7 mg / mL. In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 6 mg / mL to about 7 mg / mL. In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 6 mg / mL to about 8 mg / mL. In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 7 mg / mL to about 8 mg / mL. In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 7 mg / mL to about 9 mg / mL. In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 8 mg / mL to about 9 mg / mL. In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 8 mg / mL to about 10 mg / mL. In some embodiments, the fibrous protein (e.g., modified fibrous protein) is present in an amount of about 9 mg / mL to about 10 mg / mL. In some embodiments, the composition comprises a glycosaminoglycan (GAG). As used herein, the term “glycosaminoglycan” or “GAG” generally refers to linear polysaccharides comprising repeating disaccharide units of hexosamine (e.g., glucosamine or galactosamine) and of another sugar (e.g., galactose, glucuronic acid, or iduronic acid). GAGs can differ in accordance to the presence of hexose, hexosamine, or hexuronic acid in their structure. Naturally occurring GAGs can be sulfated or nonsulfated. Sulfated GAGs include, without limitation, chondroitin sulfate (CS), heparin (Hep), heparan sulfate (HS), keratan sulfate (KS), and dermatan sulfate (DS). Hyaluronic acid (HA) is a nonsulfated GAG. GAGs comprising galactosamine are known as galactosaminogylcans. GAGs comprising glucosamine are known as glucosaminoglycans. In some embodiments, the composition comprises a proteoglycan (PG). As used herein, the term “proteoglycan” or “PG” generally refers to proteins that are heavily glycosylated. Proteoglycans typically comprise a core protein to which one or more glycosaminoglycan (GAG) chain(s) are covalently attached. In some embodiments, the composition comprises a glycoprotein. As used herein, the term “glycoprotein” refers to proteins which contain oligosaccharide chains covalently attached to amino acid side-chains. In some embodiments, the glycoprotein comprises a noncollagenous glycoprotein. In some embodiments, the glycoprotein comprises an adhesive glycoprotein. In some embodiments, the glycoprotein is selected from the group consisting of a fibronectin (FN), a laminin (LM), a vitronectin (VN), a thrombospondins (TSPs), a tenascin (TN), and combinations thereof. In some embodiments, the composition comprises a fibronectin (FN). In some embodiments, the composition comprises a laminin (LM). In some embodiments, the composition comprises a vitronectin (VN). In some 50 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) embodiments, the composition comprises a thrombospondins (TSPs). In some embodiments, the composition comprises a tenascin (TN). In some examples, the ECM component may be crosslinked to the polymer chain, e.g., collagen polymer chain. In further embodiments, the concentration of a ECM component in the crosslinking reaction is greater than 5 µM, e.g., at least 5.1, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 1000, 1200, 1300, 1400, 1500, 1750 µM, or greater. Components of the ECM, e.g., FN, laminin, and collagen, interact with the cell surface via the integrin family of receptors, a group of divalent cation-dependent cell surface glycoproteins that mediate cellular recognition and adhesion to components of the ECM and to other cells. Ligands recognized by integrins typically contain an RGD amino acid sequence that is expressed in many ECM proteins. Exemplary molecules that mediate cell adhesion and / or movement include FN, laminin, collagen, thrombospondin 1, vitronectin, elastin, tenascin, aggrecan, agrin, bone sialoprotein, cartilage matrix protein, fibronogen, fibrin, fibulin, mucins, entactin, osteopontin, plasminogen, restrictin, serglycin, SPARC / osteonectin, versican, von Willebrand Factor, polysaccharide heparin sulfate, cell adhesion molecules including connexins, selectins include collagen, RGD (Arg-Gly-Asp) and YIGSR (Tyr-Ile-Gly-Ser-Arg) (SEQ ID NO: 6) peptides, glycosaminoglycans (GAGs), hyaluronic acid (HA), integrins, selectins, cadherins and members of the immunoglobulin superfamily. Carbohydrate ligands of the ECM include the polysaccharides hyaluronic acid, and chondroitin-6-sulfate. Signal transduction events that participate in the process of cell motility are initiated in response to cell growth and / or cell differentiation factors. Thus, the device optionally comprises a growth factor, morphogen, differentiation factor, or chemoattractant. Other factors include hormones, neurotransmitters, neurotransmitter or growth factor receptors, interferons, interleukins, chemokines, MMP-sensitive substrate, cytokines, colony stimulating factors. In a some embodiments, the hydrogel comprises a mammalian cell. In a some embodiments, the hydrogel comprises a highly contractile cell. In a some embodiments, the hydrogel comprises a spheroid. Collagen In one aspect, the present disclosure provides an extracellular matrix (ECM) mimetic, comprising a collagen hydrogel. In some embodiments, the hydrogel comprises a modified collagen. The modified collagen can comprise a first click reagent, wherein the first click reagent can be capable of covalently crosslinking with a bioorthogonal crosslinker comprising a second click reagent. 51 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) In some embodiments, the collagen (e.g., modified collagen) is selected from the group consisting of a type I collagen (e.g., COL1A1 and / or COL1A2), a type II collagen (e.g., COL2A1), a type III collagen (e.g., COL3A1), a type IV collagen (e.g., COL4A1, COL4A2, COL4A3, COL4A4, COL4A5, and / or COL4A6), a type V collagen (e.g., COL5A1, COL5A2, and / or COL5A3), a type VI collagen (e.g., COL6A1, COL6A2, COL6A3, and / or COL6A5), a type VII collagen (e.g., COL7A1), a type VIII collagen (e.g., COL8A1 and / or COL8A2), a type IX collagen (e.g., COL9A1, COL9A2, and / or COL9A3), a type X collagen (e.g., COL10A1), a type XI collagen (e.g., COL11A1 and / or COL11A2), a type XII collagen (e.g., COL12A1), a type XIII collagen (e.g., COL13A1), a type XIV collagen (e.g., COL14A1), a type XV collagen (e.g., COL15A1), a type XVI collagen (e.g., COL16A1), a type XVII collagen (e.g., COL17A1), a type XVIII collagen (e.g., COL18A1), a type XIX collagen (e.g., COL19A1), a type XX collagen (e.g., COL20A1), a type XXI collagen (e.g., COL21A1), a type XXII collagen (e.g., COL22A1), a type XXIII collagen (e.g., COL23A1), a type XXIV collagen (e.g., COL24A1), a type XXV collagen (e.g., COL25A1), a type XXVI collagen (e.g., EMID2), a type XXVII collagen (e.g., COL27A1), a type XXVIII collagen (e.g., COL28A1), a type XXIX collagen (e.g., COL29A1), and combinations thereof. In some embodiments, the collagen (e.g., modified collagen) is selected from the group consisting of a type I collagen, a type II collagen, a type III collagen, a type IV collagen, a type V collagen, a type VI collagen, a type VII collagen, a type VIII collagen, a type IX collagen, a type X collagen, a type XI collagen, a type XII collagen, a type XIII collagen, a type XIV collagen, a type XV collagen, a type XVI collagen, a type XVII collagen, a type XVIII collagen, a type XIX collagen, a type XX collagen, a type XXI collagen, a type XXII collagen, a type XXIII collagen, a type XXIV collagen, a type XXV collagen, a type XXVI collagen, a type XXVII collagen, a type XXVIII collagen, a type XXIX collagen, and combinations thereof. In some embodiments, the collagen is selected from the group consisting of COL1A1, COL1A2, COL2A1, COL3A1, COL4A1, COL4A2, COL4A3, COL4A4, COL4A5, COL4A6, COL5A1, COL5A2, COL5A3, COL6A1, COL6A2, COL6A3, COL6A5, COL7A1, COL8A1, COL8A2, COL9A1, COL9A2, COL9A3, COL10A1, COL11A1, COL11A2, COL12A1, COL13A1, COL14A1, COL15A1, COL16A1, COL17A1, COL18A1, COL19A1, COL20A1, COL21A1, COL22A1, COL23A1, COL24A1, COL25A1, EMID2, COL27A1, COL28A1, COL29A1, and combinations thereof. In some embodiments, the collagen is selected from the group consisting of COL1A1, COL1A2, and combinations thereof. In some embodiments, the collagen comprises COL1A1. In some embodiments, the collagen comprises a type I collagen (e.g., COL1A1 and / or COL1A2). In some embodiments, the collagen comprises a type II collagen (e.g., COL2A1). In some embodiments, the collagen comprises a type III collagen (e.g., COL3A1). In some embodiments, the collagen comprises a type IV collagen (e.g., COL4A1, COL4A2, COL4A3, COL4A4, COL4A5, and / or COL4A6). In some embodiments, the collagen comprises a type V collagen (e.g., COL5A1, 52 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) COL5A2, and / or COL5A3). In some embodiments, the collagen comprises a type VI collagen (e.g., COL6A1, COL6A2, COL6A3, and / or COL6A5). In some embodiments, the collagen comprises a type VII collagen (e.g., COL7A1). In some embodiments, the collagen comprises a type VIII collagen (e.g., COL8A1 and / or COL8A2). In some embodiments, the collagen comprises a type IX collagen (e.g., COL9A1, COL9A2, and / or COL9A3). In some embodiments, the collagen comprises a type X collagen (e.g., COL10A1). In some embodiments, the collagen comprises a type XI collagen (e.g., COL11A1 and / or COL11A2). In some embodiments, the collagen comprises a type XII collagen (e.g., COL12A1). In some embodiments, the collagen comprises a type XIII collagen (e.g., COL13A1). In some embodiments, the collagen comprises a type XIV collagen (e.g., COL14A1). In some embodiments, the collagen comprises a type XV collagen (e.g., COL15A1). In some embodiments, the collagen comprises a type XVI collagen (e.g., COL16A1). In some embodiments, the collagen comprises a type XVII collagen (e.g., COL17A1). In some embodiments, the collagen comprises a type XVIII collagen (e.g., COL18A1). In some embodiments, the collagen comprises a type XIX collagen (e.g., COL19A1). In some embodiments, the collagen comprises a type XX collagen (e.g., COL20A1). In some embodiments, the collagen comprises a type XXI collagen (e.g., COL21A1). In some embodiments, the collagen comprises a type XXII collagen (e.g., COL22A1). In some embodiments, the collagen comprises a type XXIII collagen (e.g., COL23A1). In some embodiments, the collagen comprises a type XXIV collagen (e.g., COL24A1). In some embodiments, the collagen comprises a type XXV collagen (e.g., COL25A1). In some embodiments, the collagen comprises a type XXVI collagen (e.g., EMID2). In some embodiments, the collagen comprises a type XXVII collagen (e.g., COL27A1). In some embodiments, the collagen comprises a type XXVIII collagen (e.g., COL28A1). In some embodiments, the collagen comprises a type XXIX collagen (e.g., COL29A1). In some embodiments, the collagen is a modified collagen comprising a click reagent. In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 1 mg / mL to about 10 mg / mL (e.g., about 1 mg / mL, about 1.5 mg / mL, about 2 mg / mL, about 2.5 mg / mL, about 3 mg / mL, about 3.5 mg / mL, about 4 mg / mL, about 4.5 mg / mL, about 5 mg / mL, about 5.5 mg / mL, about 6 mg / mL, about 6.5 mg / mL, about 7 mg / mL, about 7.5 mg / mL, about 8 mg / mL, about 8.5 mg / mL, about 9 mg / mL, about 9.5 mg / mL, or about 10 mg / mL). In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 1 mg / mL to about 2 mg / mL. In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 1 mg / mL to about 3 mg / mL. In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 2 mg / mL to about 3 mg / mL. In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 2 mg / mL to about 4 mg / mL. In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 3 mg / mL to about 4 mg / mL. In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 3 mg / mL to about 5 mg / mL. In some embodiments, the collagen (e.g., modified collagen) is present in an 53 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) amount of about 4 mg / mL to about 5 mg / mL. In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 4 mg / mL to about 6 mg / mL. In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 5 mg / mL to about 6 mg / mL. In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 5 mg / mL to about 7 mg / mL. In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 6 mg / mL to about 7 mg / mL. In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 6 mg / mL to about 8 mg / mL. In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 7 mg / mL to about 8 mg / mL. In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 7 mg / mL to about 9 mg / mL. In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 8 mg / mL to about 9 mg / mL. In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 8 mg / mL to about 10 mg / mL. In some embodiments, the collagen (e.g., modified collagen) is present in an amount of about 9 mg / mL to about 10 mg / mL. Immune Cells In a some embodiments, the hydrogel (e.g., collagen hydrogel) comprises an immune cell. As used herein, the term “cell” refers to a single cell and / or to a population of (i.e., more than one) cells. In some embodiments, the cell is a prokaryotic cell or a eukaryotic cell (e.g., a mammalian cell, such as a human cell). As used herein, the term “immune cell” refers to any cell that plays a role in an immune system, including, for example, a cell associated with an innate immune system and / or an adaptive immune system. In some embodiments, the immune cell is a leukocyte, such as a myeloid cell or a lymphoid cell. Exemplary myeloid cells (also referred to as “myelocytes”) include, without limitation, neutrophils, eosinophils, mast cells, basophils, and monocytes (e.g., dendritic cells and macrophages). Exemplary lymphoid cells (also referred to as “lymphocytes”) include, without limitation, T cells (e.g., helper CD4+ T cells, cytotoxic CD8+ T cells, memory T cell, regulatory CD4+ T cells, innate- like T cells, natural killer T (NKT) cells, mucosal associated invariant T (MAIT) cells, and gamma NOV^K #sn$ G MOVV]$& 7 MOVV] #e.g., plasmablasts, plasma cells, lymphoplasmacytoid cells, memory B cells, follicular (FO) B cells (also known as “B-2 cells”), marginal-zone (MZ) B cells, B-1 cells, and regulatory B (Breg) cells), and natural killer (NK) cells. In some embodiments, the cell is a T cell (e.g., a helper CD4+ T cell, a cytotoxic CD8+ T cell, a memory T cell, a regulatory CD4+ T cell, an innate-like T cell, a natural killer T (NKT) cell, a W_MY]KV K]]YMSK^ON SX`K\SKX^ G #A6>G$ MOVV& KXN)Y\ K QKWWK NOV^K #sn$ G MOVV$( In a some embodiments, the immune cell comprises an autologous immune cell or an allogeneic immune cell. In a some embodiments, the immune cell comprises a phagocyte, a macrophage, a dendritic cell, a monocyte, a B cell, a T cell, a natural killer cell (NK) cell, and combinations thereof. In a some embodiments, the immune cell is a T cell. In a some embodiments, 54 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) the T cell is an autologous T cell or an allogeneic T cell. In a some embodiments, the T cell is a pan T cell or a T cell with a shared TCR clonotype. In a some embodiments, the T cell is selected from the group consisting of a naïve T cell, a helper T cell, a cytotoxic T cell, a memory T cell, a regulatory T cell, an innate-like T cell, a natural killer T cell, a mucosal associated invariant T cell, a gamma delta T cell, and combinations thereof. In a some embodiments, the T cell is a genetically modified T cell, optionally wherein the genetically modified T cell is a T cell receptor (TCR) T cell or a chimeric antigen receptor (CAR) T cell. Immune Cell Phenotypes In one aspect the hydrogels provided herein can be used to produce an immune cell characterized by an immune cell signature. In some embodiments, the compositions and methods provided herein can be used to produce a T cell characterized by a T cell signature. Exemplary T cell signatures include, without limitation, (i) a normal tissue and / or blood T cell gene signature; (ii) a tumor T cell gene signature, optionally wherein the tumor T cell gene signature is for non-small cell lung cancer (NSCLC), liver cancer, colorectal cancer, and / or breast cancer; (ii) a T cell gene signature for liver fibrosis; (iii) an activation / inhibitory T cell signature, optionally wherein the activation / inhibitory T cell signature is based on a marker selected from the group consisting of PD1, TIGIT, TIM3, LAG3, OX40, CD39, CD25, CTLA4, and combinations thereof; (iv) a memory T cell signature, optionally wherein the memory T cell signature is based on a marker selected from the group consisting of CD62L, CCR7, CD127, CD45RA, CD27, and combinations thereof; and / or (v) a T cell AP-1 gene signature. In some embodiments, the immune cell signature, e.g., T cell signature, comprises one or more of the genes listed in any one of Tables 2-8. In some embodiments, the T cell signature comprises one or more of the genes listed in Table 2. In some embodiments, the T cell signature comprises one or more of the genes listed in Table 3. In some embodiments, the T cell signature comprises one or more of the genes listed in Table 4. In some embodiments, the T cell signature comprises one or more of the genes listed in Table 5. In some embodiments, the T cell signature comprises one or more of the genes listed in Table 6. In some embodiments, the T cell signature comprises one or more of the genes listed in Table 7. In some embodiments, the T cell signature comprises one or more of the genes listed in Table 8. In some embodiments, the compositions and methods provided herein increases and / or decreases the expression level of one or more of the genes listed in any one of Tables 2-8. In some embodiments, the compositions and methods provided herein increases and / or decreases the expression level of one or more of the genes listed in Table 2. In some embodiments, the compositions and methods provided herein increases and / or decreases the expression level of one or more of the genes listed in Table 3. In some embodiments, the compositions and methods provided herein increases and / or decreases the expression level of one or more of the genes listed in Table 4. In 55 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) some embodiments, the compositions and methods provided herein increases and / or decreases the expression level of one or more of the genes listed in Table 5. In some embodiments, the compositions and methods provided herein increases and / or decreases the expression level of one or more of the genes listed in Table 6. In some embodiments, the compositions and methods provided herein increases and / or decreases the expression level of one or more of the genes listed in Table 7. In some embodiments, the compositions and methods provided herein increases and / or decreases the expression level of one or more of the genes listed in Table 8. In some embodiments, the compositions and methods provided herein increases the expression level of an activation / inhibitory T cell marker in T cells contacted with the slow relaxing hydrogel compared to the fast relaxing hydrogel, optionally wherein the activation / inhibitory T cell marker is selected from the group consisting of IL2RA (CD25), ENTPD1 (CD39), FAS, TNFRSF4 (OX40), LAG3, and combinations thereof. In some embodiments, the compositions and methods provided herein increases the expression level of a transcription factor associated with a T cell effector phenotype in T cells contacted with the slow relaxing hydrogel compared to the fast relaxing hydrogel, optionally wherein the transcription factor associated with a T cell effector phenotype is selected from the group consisting of PRDM1 (BLIMP-1), ZEB2, and combinations thereof. In some embodiments, the compositions and methods provided herein increases the expression level of an AP- 1 pathway-associated gene in T cells contacted with the slow relaxing hydrogel compared to the fast relaxing hydrogel, optionally wherein the AP-1 pathway-associated gene is selected from the group consisting of JUN, ATF3, BATF, FOS, FOSB, JUNB, and combinations thereof. In some embodiments, the compositions and methods provided herein increases the expression level of a mitogen-activated protein kinase in T cells contacted with the slow relaxing hydrogel compared to the fast relaxing hydrogel, optionally wherein the mitogen-activated protein kinase is selected from the group consisting of MAPK8, MAPK6, MAPK1, and combinations thereof. In some embodiments, the compositions and methods provided herein increases the expression level of a T cell memory marker and / or a T cell memory associated transcription factor in T cells contacted with the fast relaxing hydrogel compared to the slow relaxing hydrogel, optionally wherein the T cell memory marker and / or the T cell memory associated transcription factor is selected from the group consisting of CD62L, KLF2, CXCR3, S1PR4, and combinations thereof. Chemoattractants The compositions of the present disclosure can comprise a chemoattractant for cells. The term “chemoattractant,” as used herein, refers to any agent that attracts a motile cell, such as an immune cell. In certain embodiments, the chemoattractant for immune cells is a growth factor, a cytokine, and / or a chemokine. 56 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) In some embodiments, the chemoattractant is a growth factor. The compositions of the present disclosure can comprise a growth factor. The term “growth factor,” as used herein, refers to an agent that is capable of stimulating cellular growth, proliferation, healing, and / or cellular differentiation. In certain embodiments, growth factors are polypeptides. Growth factor polypeptides typically act as signaling molecules. In certain embodiments, the growth factor polypeptides are cytokines. Exemplary cytokines include, but are not limited to, interleukins, lymphokines, monokines, interferons, and colony stimulating factors. Exemplary growth factors include, but are not limited to, transforming growth factor beta #G<;'r$& Q\KX_VYMc^O'MYVYXc ]^SW_VK^SXQ PKM^Y\ #<'8F;$& Q\KX_VYMc^O'WKM\YZRKQO MYVYXc ]^SW_VK^SXQ factor (GM-CSF), nerve growth factor (NGF), neurotrophins, Platelet-derived growth factor (PDGF), erythropoietin (EPO), thrombopoietin (TPO), myostatin (GDF-8), growth differentiation factor-9 (GDF9), acidic fibroblast growth factor (aFGF or FGF-1), basic fibroblast growth factor (bFGF or FGF-2), epidermal growth factor (EGF), hepatocyte growth factor (HGF). In some embodiments, the chemoattractant is a chemokine. Exemplary chemokines include, but are not limited to, CC chemokines, CXC chemokines, C chemokines, CX3C chemokines. In some embodiments, the chemoattractant is a cytokine. Exemplary cytokines include, but K\O XY^ VSWS^ON ^Y& >@'+& >@',& >@'-& >@'.& >@' / & >@'0& >@'2& >@'+*& >@'+, +@'+ / & +@'+1& +@'+2& GB;'m& >;B's& KXN >;B'm( In some embodiments, the compositions of the present disclosure include a chemoattractant for immune cells. In some embodiments, the compositions of the present disclosure comprise a compound that attracts an immune cell to or into the device, wherein the immune cell comprises a macrophage, T-cell, B-cell, natural killer (NK) cell, or dendritic cell. Non-limiting examples of compounds useful for attracting an immune cell to or into the device comprises granulocyte- macrophage colony stimulating factor (GM-CSF), an FMS-like tyrosine kinase 3 ligand (Flt3L), chemokine (C-C motif) ligand 19 (CCL-19), chemokine (C-C motif) ligand 20 (CCL20), chemokine (C-C motif) ligand 21 (CCL-21), a N-formyl peptide, fractalkine, monocyte chemotactic protein-1, and macrophage inflammatory protein-3 (MIP-3a). In certain embodiments, the chemoattractant for immune cells is Granulocyte-macrophage colony-stimulating factor (GM-CSF). Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a protein secreted by macrophages, T cells, mast cells, endothelial cells and fibroblasts. Specifically, GM-CSF is a cytokine that functions as a white blood cell growth factor. GM-CSF stimulates stem cells to produce granulocytes and monocytes. Monocytes exit the blood stream, migrate into tissue, and subsequently mature into macrophages. In some embodiments, the compositions of the present disclosure can comprise and release GM-CSF polypeptides to attract host DCs to the device. Contemplated GM-CSF polypeptides are isolated from endogenous sources or synthesized in vivo or in vitro. Endogenous GM-CSF polypeptides may be isolated from healthy human tissue. Synthetic GM-CSF polypeptides are 57 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) synthesized in vivo following transfection or transformation of template DNA into a host organism or cell, e.g., a mammalian or human cell line. Alternatively, synthetic GM-CSF polypeptides are synthesized in vitro by polymerase chain reaction (PCR) or other art-recognized methods Sambrook, J., Fritsch, E.F., and Maniatis, T., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, NY, Vol.1, 2, 3 (1989), herein incorporated by reference). In certain embodiments, GM-CSF polypeptides may be recombinant. In some embodiments, GM-CSF polypeptides are humanized derivatives of mammalian GM-CSF polypeptides. Exemplary mammalian species from which GM-CSF polypeptides are derived include, but are not limited to, mouse, rat, hamster, guinea pig, ferret, cat, dog, monkey, or primate. In some embodiments, GM-CSF is a recombinant human protein (PeproTech, Catalog # 300-03). In some embodiments, GM-CSF is a recombinant murine (mouse) protein (PeproTech, Catalog #315-03). In some embodiments, GM-CSF is a humanized derivative of a recombinant mouse protein. In certain embodiments, GM-CSF polypeptides may be modified to increase protein stability in vivo. In certain embodiments, GM-CSF polypeptides may be engineered to be more or less immunogenic. Endogenous mature human GM-CSF polypeptides are glycosylated, reportedly, at amino acid residues 23 (leucine), 27 (asparagine), and 39 (glutamic acid) (see US Patent No. 5,073,627). In certain embodiments, GM-CSF polypeptides of the present invention may be modified at one or more of these amino acid residues with respect to glycosylation state. The chemoattractant for immune cells may recruit immune cells to the scaffolds of the present invention. Immune cells include cells of the immune system that are involved in immune response. Exemplary immune cells includes, but not limited to, T cells, B cells, leucocytes, lymphocytes, antigen presenting cells, dendritic cells, neutrophils, eosinophils, basophils, monocytes, macrophages, histiocytes, mast cells, and microglia. In certain embodiments, the chemoattractant can recruit a cell to the scaffold following the administration of the composition to a subject. The recruited cell may be autologous. For example, the recruited cell may be an immune cell, such as a T cell, from the subject. The recruited cell may also be syngeneic, allogeneic, or xenogeneic. As used herein, the term “syngeneic” refers to genetically identical, or sufficiently identical and immunologically compatible as to allow for transplantation. For example, syngeneic cells may include transplanted cells obtained from an identical twin. As used herein, the term “allogeneic” refers to cells that are genetically dissimilar, although from individuals of the same species. As used herein, the term “xenogeneic” refers to cells derived from a different species and therefore genetically different. For example, the recruited cell may be a donor cell in a transplantation. In certain embodiments, the transplantation is a hematopoietic stem cell transplantation (HSCT). As used herein, HSCT refers to the transplantation of multipotent hematopoietic stem cells or hematopoietic progenitor cells, usually derived from bone marrow, peripheral blood, or umbilical cord blood. HSCT may be autologous (the patient's own stem cells or progenitor cells are used), allogeneic (the stem 58 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) cells or progenitor cells come from a donor), syngeneic (from an identical twin) or xenogenic (from different species). Methods of incorporating polypeptides (e.g., growth factor polypeptides) are known in the art. See, US Patent Nos.: 8,728,456; 8,067,237; and 10,045,947; US Patent Publication No.: US20140079752; International Patent Publication No.: WO2017 / 136837; incorporated herein by reference in their entirety. The release of the growth factor polypeptides may be controlled. The methods of controlled release of polypeptides (e.g., growth factor polypeptides) are known in the art. See, US Patent Nos.: 8,728,456; 8,067,237; 10,045,946, incorporated by reference in their entirety. In certain embodiments, the growth factors may be released over an extended period of time, such as 7- 30 days or longer. In certain embodiments, the growth factors retain their bioactivity over an extended period of time. The term “bioactivity,” as used herein, refers to the beneficial or adverse effects of an agent, such as a growth factor. The bioactivity of the growth factor may be measured by any appropriate means. In certain example, the growth factors retain their bioactivity for at least 10 days, 12 days, 14 days, 20 days, or 30 days after the incorporation of the growth factors into the scaffold. In certain embodiments, growth factor polypeptides may be recombinant. In some embodiments, growth factor polypeptides are humanized derivatives of mammalian growth factor polypeptides. Exemplary mammalian species from which growth factor polypeptides are derived include, but are not limited to, mouse, rat, hamster, guinea pig, ferret, cat, dog, monkey, or primate. In some embodiments, the growth factor is a recombinant human protein . In some embodiments, the growth factor is a recombinant murine (mouse) protein. In some embodiments, the growth factor is a humanized derivative of a recombinant mouse protein. In certain embodiments, the growth factor polypeptides may be modified to increase protein stability in vivo. In certain embodiments, the growth factor polypeptides may be engineered to be more or less immunogenic. The terms “immunogenic” and “immunogenicity” refer to the ability of a particular substance, such as a protein, an antigen, or an epitope, to provoke an immune response in the body of a human and other animal. In certain embodiments, the growth factors may be present at between about 0.001 nmol and about 1000 nmol per scaffold, or about 0.001 and about 100 nmol per scaffold, or about 0.001 nmol and about 1 nmol per scaffold. In some embodiments, the growth factors may be present at between about 1 ng to 1000 micrograms per scaffold. For example, the growth factors may be present at an amount between about 1 µg and about 1000 µg, between about 1 µg and 500 µg, between about 1 µg and about 200 µg, between about 1 µg and about 100 µg, between about 1 µg and about 50 µg, or between about 1 µg and 10 µg. In certain embodiments, the composition of the present invention comprises nanogram quantities of growth factors (e.g., about 1 ng to about 1000 ng of growth factors). For example, the 59 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) growth factors may be present at an amount between about 5 ng and about 500 ng, between about 5 ng and about 250 ng, between about 5 ng and about 200 ng, between about 10 ng and about 200 ng, between about 25 ng and about 200 ng, between about 50 ng and 200 ng, between about 100 ng and 200 ng, and about 200 ng. Nanogram quantities of the growth factor are also released in a controlled manner. The nanogram quantities of the growth factors and / or the controlled release can contribute to reduced toxicity of the compositions and methods of the present invention as compared to other delivery system, which uses high dose of growth factors and has suboptimal release kinetics. In various embodiments, the amount of growth factors present in a scaffold may vary according to the size of the scaffold. For example, the growth factor may be present at about 0.03 ng / mm3(the ratio of the amount of growth factors in weight to the volume of the scaffold) to about 350 ng / mm3, such as between about 0.1 ng / mm3and about 300 ng / mm3, between about 0.5 ng / mm3and about 250 ng / mm3, between about 1 ng / mm3and about 200 ng / mm3, between about 2 ng / mm3and about 150 ng / mm3, between about 3 ng / mm3and about 100 ng / mm3, between about 4 ng / mm3and about 50 ng / mm3, between about 5 ng / mm3and 25 ng / mm3, between about 6 ng / mm3and about 10 ng / mm3, or between about 6.5 ng / mm3and about 7.0 ng / mm3. In some embodiments, the amount of growth factors may be present at between about 300 ng / mm3and about 350 µg / mm3, such as between about 400 ng / mm3and between about 300 µg / mm3, between about 500 ng / mm3and about 200 µg / mm3, between about 1 µg / mm3and about 100 µg / mm3, between about 5 µg / mm3and about 50 µg / mm3, between about 10 µg / mm3and about 25 µg / mm3. Adjuvants The compositions of the present disclosure can comprise an adjuvant. The term “adjuvant,” as used herein, refers to compounds that can be added to vaccines to stimulate immune responses against antigens. Adjuvants may enhance the immunogenicity of highly purified or recombinant antigens. Adjuvants may reduce the amount of antigen or the number of immunizations needed to achieve protective immunity. For example, adjuvants may activate antibody-secreting B cells to produce a higher amount of antibodies. Alternatively, adjuvants can act as a depot for an antigen, present the antigen over a longer period of time, which could help maximize the immune response and provide a longer-lasting protection. Adjuvants may also be used to enhance the efficacy of a vaccine by helping to modify the immune response to particular types of immune system cells, for example, by activating T cells instead of antibody-secreting B cells depending on the purpose of the vaccine. Adjuvants are also used in the production of antibodies from immunized animals (Petrovskyl et al, 2002, Immunology and Cell Biology 82: 488–496). Adjuvants can be classified according to their source, mechanism of action or physicochemical properties. For example, adjuvants can be classified into three groups: (i) active immunostimulants, being substances that increase the immune response to the antigen; (ii) carriers, being immunogenic proteins that provide T-cell help; and (iii) vehicle adjuvants, being oil emulsions 60 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) or liposomes that serve as a matrix for antigens as well as stimulating the immune response (Edelman R.1992, AIDS Res. Hum. Retroviruses 8: 1409–11). An alternative adjuvant classification divides adjuvants according to administration route, namely mucosal or parenteral. A third classification divides adjuvants into alum salts and other mineral adjuvants; tensoactive agents; bacterial derivatives; vehicles and slow release materials or cytokines (Byars et al.,1990, Laboratory Methods in Immunology: 39–51). A fourth classification divides adjuvants into the following groups: gel-based adjuvants, tensoactive agents, bacterial products, oil emulsions, particulated adjuvants, fusion proteins or lipopeptides (Jennings R et al., 1998, Dev. Biol. Stand, 92: 19–28). The compositions of the present disclosure can comprise one or more adjuvants. Adjuvants suitable for use in the present invention include, but are not limited to, mineral salt-based adjuvants such as alum-based adjuvants, calcium-based adjuvants, iron-based adjuvants, zirconium-based adjuvants; particulate adjuvants; mucosal adjuvants; tensoactive adjuvants; bacteria-derived adjuvants; oil-based adjuvants; cytokines, liposome adjuvants, polymeric microsphere adjuvants, carbohydrate adjuvants. Exemplary adjuvants include, but are not limited to, aluminium hydroxide, aluminum phosphate, calcium phosphate, Quil A, Quil A derived saponin QS-21, or other types of saponins, Detox, ISCOMs, cell wall peptidoglycan or lipopolysaccharide of Gram-negative bacteria, trehalose dimycolate, bacterial nucleic acids such as DNA containing CpG motifs, FIA, Montanide, Adjuvant 65, Freund's complete adjuvant, Freund's incomplete adjuvant, Lipovant, interferon, granulocyte- macrophage colony stimulating factor (GM-CSF), AS03, AS04, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL- 7, IL-8, IL-10, IL-12, IL-15, IL-17, IL-18, STING, Toll-like receptor ligand, CD40L, ovalbumin (OVA), monophosphoryl lipid A (MPL), polyinosinic:polycytidylic acid (poly(I:C)), a combination of LPS (or MPLA) and OxPAPC, MF59, N-acetyl muramyl-L-alanyl-D-isoglutamine (MDP), poly (DL- lactide-coglycolide) microspheres, paraffin oil, squalene, virosome, gamma inulin, glucans, dextrans, lentinans, glucomannans and galactomannans, pathogen-associated molecular patterns (PAMPs), damage-associated molecular pattern molecules (DAMPs), antibodies against immune suppressive molecules (e.g., antibody or antagonist against transforming growth factor (TGF)-beta, A2aR antagonists), Freund’s complete adjuvant, Freund’s incomplete adjuvant, lipopolysaccharides (LPS), Fas ligand, Trail, lymphotactin, Mannan (M-FP), APG-2, Hsp70 and Hsp90. In certain embodiments, the compositions of the present disclosure can comprise an agent that activates and matures recruited immune cells. In some embodiments, the agent is a toll-like receptor (TLR) ligand. TLRs are a class of single transmembrane domain, non-catalytic, receptors that recognize structurally conserved molecules referred to as pathogen-associated molecular patterns (PAMPs). PAMPs are present on microbes and are distinguishable from host molecules. TLRs are present in all vertebrates. Thirteen TLRs (referred to as TLRs 1-13, consecutively) have been identified in humans and mice. Human TLRs comprise TLRs 1-10. 61 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) TLRs and interleukin-1 (IL-1) receptors comprise a receptor superfamily the members of which all share a TIR domain (Toll-IL-1 receptor). TIR domains exist in three varieties with three distinct functions. TIR domains of subgroup 1 are present in receptors for interleukins produced by macrophages, monocytes, and dendritic cells. TIR domains of subgroup 2 are present in classical TLRs which bind directly or indirectly to molecules of microbial origin. TIR domains of subgroup 3 are present in cytosolic adaptor proteins that mediate signaling between proteins comprising TIR domains of subgroups 1 and 2. TLR ligands comprise molecules that are constantly associated with and highly specific for a threat to the host’s survival such as a pathogen or cellular stress. TLR ligands are highly specific for pathogens and not the host. Exemplary pathogenic molecules include, but are not limited to, lipopolysaccharides (LPS), lipoproteins, lipoarabinomannan, flagellin, double-stranded RNA, and unmethylated CpG islands of DNA. All known TLR ligands found either on a cell surface or an internal cellular compartment are encompassed by the compositions, methods, and devices of the present invention. Exemplary TLR ligands include, but are not limited to, triacyl lipoproteins (TLR1); lipoproteins, gram positive peptidoglycan, lipteichoic acids, fungi, and viral glycoproteins (TLR2); double-stranded RNA, poly I:C (TLR 3); lipopolysaccaride, viral glycoproteins (TLR 4); flagellin (TLR5); diacyl lipoproteins (TLR6); small synthetic compounds, single-stranded RNA (TLR7 and TLR 8); unmethylated CpG DNA (TLR9); Profilin (TLR11). Also included as TRL ligands are host molecules like fibronectin and heat shock proteins (HSPs). Host TLR ligands are also encompassed by the present invention. The role of TLRs in innate immunity and the signaling molecules used to activate and inhibit them are known in the art ( for a review, see Holger K. Frank B., Hessel E., and Coffman RL. Therapeutic targeting of innate immunity with Toll-like receptor agonists and antagonists. Nature Medicine 13, 552-559 (2007), the content of which is herein incorporated by reference). CpG sites are regions of deoxyribonucleic acid (DNA) where a cysteine nucleotide occurs next to a guanine nucleotide in the linear sequence of bases along its length (the “p” represents the phosphate linkage between them and distinguishes them from a cytosine-guanine complementary base pairing). CpG sites play a pivotal role in DNA methylation, which is one of several endogenous mechanisms cells use to silence gene expression. Methylation of CpG sites within promoter elements can lead to gene silencing. In the case of cancer, it is known that tumor suppressor genes are often silences while oncogenes, or cancer-inducing genes, are expressed. Importantly, CpG sites in the promoter regions of tumor suppressor genes (which prevent cancer formation) have been shown to be methylated while CpG sites in the promoter regions of oncogenes are hypomethylated or unmethylated in certain cancers. The TLR-9 receptor binds unmethylated CpG sites in DNA. In certain embodiments, the compositions of the present disclosure can comprise a cytosine- guanosine dinucleotides and oligonucleotides (CpG-ODN). Contemplated CpG oligonucleotides may be isolated from endogenous sources or synthesized in vivo or in vitro. Exemplary sources of 62 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) endogenous CpG oligonucleotides include, but are not limited to, microorganisms, bacteria, fungi, protozoa, viruses, molds, or parasites. In some embodiments, endogenous CpG oligonucleotides are isolated from mammalian benign or malignant neoplastic tumors. In some embodiments, synthetic CpG oligonucleotides are synthesized in vivo following transfection or transformation of template DNA into a host organism. In certain embodiments, Synthetic CpG oligonucleotides are synthesized in vitro by polymerase chain reaction (PCR) or other art-recognized methods (Sambrook, J., Fritsch, E.F., and Maniatis, T., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, NY, Vol.1, 2, 3 (1989), herein incorporated by reference). CpG oligonucleotides are presented for cellular uptake by dendritic cells. In some embodiments, naked CpG oligonucleotides are used. The term “naked” is used to describe an isolated endogenous or synthetic polynucleotide (or oligonucleotide) that is free of additional substituents. In some embodiments, CpG oligonucleotides are bound to one or more compounds to increase the efficiency of cellular uptake. In some embodiments, , CpG oligonucleotides are bound to one or more compounds to increase the stability of the oligonucleotide within the scaffold and / or dendritic cell. In certain embodiments, CpG oligonucleotides are condensed prior to cellular uptake. In some embodiments, CpG oligonucleotides are condensed using polyethylenimine (PEI), a cationic polymer that increases the efficiency of cellular uptake into dendritic cells. CpG oligonucleotides can be divided into multiple classes. For example, exemplary CpG- ODNs encompassed by compositions, methods and devices of the present invention are stimulatory, neutral, or suppressive. The term “stimulatory” used herein is meant to describe a class of CpG-ODN sequences that activate TLR9. The term “neutral” used herein is meant to describe a class of CpG- ODN sequences that do not activate TLR9. The term “suppressive” used herein is meant to describe a class of CpG-ODN sequences that inhibit TLR9. The term “activate TLR9” describes a process by which TLR9 initiates intracellular signaling. Stimulatory CpG-ODNs can further be divided into three types A, B and C, which differ in their immune-stimulatory activities. Type A stimulatory CpG ODNs are characterized by a phosphodiester central CpG-containing palindromic motif and a phosphorothioate 3’ poly-G string. ;YVVYaSXQ KM^S`K^SYX YP G@E3& ^RO]O 8Z< C9B] SXN_MO RSQR >;B'm Z\YN_M^SYX P\YW ZVK]WKMc^YSN NOXN\S^SM MOVV] #Z98$( GcZO 68Z< C9B] aOKUVc ]^SW_VK^O G@E3'NOZOXNOX^ B;'v7 ]SQXKVSXQ( Type B stimulatory CpG ODNs contain a full phosphorothioate backbone with one or more CpG dinucleotides. Following TLR9 activation, these CpG-ODNs strongly activate B cells. In MYX^\K]^ ^Y GcZO 68ZQ'C9B]& GcZO 78Z<'C9B] aOKUVc ]^SW_VK^O >;B'm ]OM\O^SYX( Type C stimulatory CpG ODNs comprise features of Types A and B. Type C CpG-ODNs contain a complete phosphorothioate backbone and a CpG containing palindromic motif. Similar to GcZO 68Z< C9B]& GcZO 88Z< C9B] SXN_MO ]^\YXQ >;B'm Z\YN_M^SYX P\YW Z98( FSWSVK\ ^Y GcZO B CpG ODNs, Type C CpG ODNs induce strong B cell stimulation. 63 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) Exemplary stimulatory CpG ODNs comprise, but are not limited to, ODN 1585, ODN 1668, ODN 1826, ODN 2006, ODN 2006-G5, ODN 2216, ODN 2336, ODN 2395, ODN M362 (all InvivoGen). The present invention also encompasses any humanized version of the preceding CpG ODNs. In one preferred embodiment, compositions, methods, and devices of the present invention comprise ODN 1826 (the sequence of which from 5’ to 3’ is tccatgacgttcctgacgtt, wherein CpG elements are bolded, SEQ ID NO: 10). Neutral, or control, CpG ODNs that do not stimulate TLR9 are encompassed by the present invention. These ODNs comprise the same sequence as their stimulatory counterparts but contain GpC dinucleotides in place of CpG dinucleotides. Exemplary neutral, or control, CpG ODNs encompassed by the present invention comprise, but are not limited to, ODN 1585 control, ODN 1668 control, ODN 1826 control, ODN 2006 control, ODN 2216 control, ODN 2336 control, ODN 2395 control, ODN M362 control (all InvivoGen). The present invention also encompasses any humanized version of the preceding CpG ODNs. Suppressive CpG ODNs that inhibit TLR9 are encompassed by the present invention. Exemplary potent inhibitory sequences are (TTAGGG)4(ODN TTAGGG, InvivoGen, SEQ ID NO:11), found in mammalian telomeres and ODN 2088 (InvivoGen), derived from a murine stimulatory CpG ODN by replacement of 3 bases. Suppressive ODNs disrupt the colocalization of CpG ODNs with TLR9 in endosomal vesicles without affecting cellular binding and uptake. Suppressive CpG ODNs encompassed by the present invention are used to fine-tune, attenuate, reverse, or oppose the action of a stimulatory CpG-ODN. Alternatively, or in addition, compositions, methods, or devices of the present invention comprising suppressive CpG ODNs are used to treat autoimmune conditions or prevent immune responses following transplant procedures. Antigens The compositions of the present disclosure can comprise an antigen. The antigen can be a cancer antigen or a non-cancer antigen (e.g., a microbial antigen or a viral antigen). In one embodiment, the antigen is a polypeptide. In one embodiment, the polypeptide antigen comprises a stretch of at least 10 consecutive amino acids identical to a stretch of at least 10 consecutive amino acids of a cancer antigen, a microbial antigen, or a viral antigen. In some embodiments, the antigen is a cancer antigen. The device comprising a cancer antigen can be used to vaccinate and / or provide protective immunity to a subject to whom such a device was administered. In some embodiments, a cancer / tumor antigen is from a subject who is administered a device provided herein. In certain embodiments, a cancer / tumor antigen is from a different subject. In various embodiments, a cancer antigen is present in a cancer cell lysate. For example, the tumor cell lysate may comprise one or more lysed cells from a biopsy. In some embodiments, the cancer antigen is present on an attenuated live cancer cell. For example, the attenuated live cancer cell may be an irradiated cancer cell. Antigens may be used alone or in combination with GM-CSF, CpG-ODN sequences, or immunomodulators. 64 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) Moreover, antigens can be provided simultaneously or sequentially with GM-CSF, CpG-ODN sequences, or immunomodulators. One or more antigens may be selected based on an antigenic profile of a subject's cancer or of a pathogen. In certain embodiments, the device lacks a cancer antigen prior to administration to a subject. In some embodiments, the compositions of the present disclosure can comprise an immunoconjugate, wherein the immunoconjugate comprises an immunostimulatory compound covalently linked to an antigen. In various embodiments, the antigen comprises a cancer antigen, such as a central nervous system (CNS) cancer antigen, CNS germ cell tumor antigen, lung cancer antigen, leukemia antigen, acute myeloid leukemia antigen, multiple myeloma antigen, renal cancer antigen, malignant glioma antigen, medulloblastoma antigen, breast cancer antigen, prostate cancer antigen, Kaposi's sarcoma antigen, ovarian cancer antigen, adenocarcinoma antigen, or melanoma antigen. In some embodiments, treating the subject comprises reducing metastasis in the subject. Exemplary cancer antigens encompassed by the compositions, methods, and devices of the present invention include, but are not limited to, tumor lysates extracted from biopsies, and irradiated tumor cells. Exemplary polypeptide cancer antigens include one or more of the following proteins, or fragments thereof: MAGE series of antigens (MAGE-1 is an example), MART-1 / melana, tyrosinase, ganglioside, gp100, GD-2, O-acetylated GD-3, GM-2, MUC-1, Sos1, Protein kinase C-binding protein, Reverse transcriptase protein, AKAP protein, VRK1, KIAA1735, T7-1, T11-3, T11-9, Homo Sapiens telomerase ferment (hTRT), Cytokeratin-19 (CYFRA21-1), SQUAMOUS CELL CARCINOMA ANTIGEN 1 (SCCA-1), (PROTEIN T4-A), SQUAMOUS CELL CARCINOMA ANTIGEN 2 (SCCA-2), Ovarian carcinoma antigen CA125 (1A1-3B) (KIAA0049), MUCIN 1 (TUMOR-ASSOCIATED MUCIN), (CARCINOMA-ASSOCIATED MUCIN), (POLYMORPHIC EPITHELIAL MUCIN),(PEM),(PEMT),(EPISIALIN), (TUMOR-ASSOCIATED EPITHELIAL MEMBRANE ANTIGEN),(EMA),(H23AG), (PEANUT-REACTIVE URINARY MUCIN), (PUM), (BREAST CARCINOMA- ASSOCIATED ANTIGEN DF3), CTCL tumor antigen se1-1, CTCL tumor antigen se14-3, CTCL tumor antigen se20-4, CTCL tumor antigen se20-9, CTCL tumor antigen se33-1, CTCL tumor antigen se37-2, CTCL tumor antigen se57-1, CTCL tumor antigen se89-1, Prostate-specific membrane antigen, 5T4 oncofetal trophoblast glycoprotein, Orf73 Kaposi's sarcoma- associated herpesvirus, MAGE-C1 (cancer / testis antigen CT7), MAGE-B1 ANTIGEN (MAGE-XP ANTIGEN) (DAM10), MAGE-B2 ANTIGEN (DAM6), MAGE-2 ANTIGEN, MAGE-4a antigen, MAGE-4b antigen, Colon cancer antigen NY-CO-45, Lung cancer antigen NY-LU-12 variant A, Cancer associated surface antigen, Adenocarcinoma antigen ART1, Paraneoplastic associated brain- testis-cancer antigen (onconeuronal antigen MA2; paraneoplastic neuronal antigen), Neuro- oncological ventral antigen 2 (NOVA2), Hepatocellular carcinoma antigen gene 520, TUMOR- ASSOCIATED ANTIGEN CO-029, Tumor-associated antigen MAGE-X2, Synovial sarcoma, X breakpoint 2, Squamous cell carcinoma antigen recognized by T cell, Serologically defined colon cancer antigen 1, Serologically defined breast cancer antigen NY-BR-15, Serologically defined breast 65 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) cancer antigen NY-BR-16, Chromogranin A; parathyroid secretory protein 1, DUPAN-2, CA 19-9, CA 72-4, CA 195, Carcinoembryonic antigen (CEA), Trp2, ovalbumin, M27, and M30. In embodiments, the antigen comprises a fragment of one or more of the following proteins. In exemplary embodiments, the fragment can comprise 10 or more consecutive amino acids identical in sequence to one or more of the foregoing proteins. In some embodiments, the fragment can comprise 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000 or more amino acids. In one embodiment, the fragment can comprise 10-500 amino acids. In one embodiment, the antigen is a melanoma antigen. Exemplary melanoma antigens include, but are not limited to, tyrosinase, gp75 (tyrosinase related protein-1 (TRP-1 )), gp100 (Pmel17), Melan A / MART-1, TRP-2, MAGE family, BAGE family, GAGE family, NY-ESO-1, 89?.& r' MK^OXSX& W_^K^ON SX^\YX]& B'KMO^cVQV_MY]KWSXcV^\KX]PO\K]O I QOXO Z\YN_M^& AHA'+& Z+ / & gangliosides (e.g., GM2, GD2, GM3, GD3), high molecular weight chondroitin sulfate proteoglycan, p97 melanotransferrin, and SEREX antigens (e.g., D-1, SSX-2) (Hodi FS, Clin Cancer Res, February 1, 2006, 12: 673-678), or fragments thereof. In certain embodiments, the antigen comprises a non-tumor antigen such as a microbial antigen. For example, the microbial antigen may comprise a bacterial antigen, a fungal antigen, an archaean antigen, or a protozoan antigen. In some embodiments, the microbial antigen is a viral antigen, e.g., an HIV antigen or influenza antigen. In some embodiments, the antigen is from a microbe such as a bacterium, virus, protozoan, archaean, or fungus. Various embodiments relate to vaccinating against or treating a bacterial, viral, or fungal infection. In various embodiments, a delivery vehicle comprising an antigen from a pathogen. For example, a pathogen includes but is not limited to a fungus, a bacterium (e.g., Staphylococcus species, Staphylococcus aureus, Streptococcus species, Streptococcus pyogenes, Pseudomonas aeruginosa, Burkholderia cenocepacia, Mycobacterium species, Mycobacterium tuberculosis, Mycobacterium avium, Salmonella species, Salmonella typhi, Salmonella typhimurium, Neisseria species, Brucella species, Bordetella species, Borrelia species, Campylobacter species, Chlamydia species, Chlamydophila species, Clostrium species, Clostrium botulinum, Clostridium difficile, Clostridium tetani, Helicobacter species, Helicobacter pylori, Mycoplasma pneumonia, Corynebacterium species, Neisseria gonorrhoeae, Neisseria meningitidis, Enterococcus species, Escherichia species, Escherichia coli, Listeria species, Francisella species, Vibrio species, Vibrio cholera, Legionella species, or Yersinia pestis), a virus (e.g., adenovirus, Epstein-Barr virus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Herpes simplex virus type 1, 2, or 8, human immunodeficiency virus, influenza virus, measles, Mumps, human papillomavirus, poliovirus, rabies, respiratory syncytial virus, rubella virus, or varicella-zoster virus), a parasite or a protozoa (e.g., Entamoeba histolytica, Plasmodium, Giardia lamblia, Trypanosoma brucei, or a parasitic protozoa such as malaria-causing Plasmodium). In one embodiment, a pathogen antigen can be derived from a pathogen cell or particle described herein. 66 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) Genetically-modified T-cell immunotherapies In some embodiments, the hydrogel (e.g., collagen hydrogel) comprises a genetically- modified immune cell, e.g., a genetically modified T-cell. In some embodiments, the hydrogel (e.g., collagen hydrogel) comprises a T cell receptor (TCR) T cell or a chimeric antigen receptor (CAR) T cell. In some embodiments, the hydrogel (e.g., collagen hydrogel) can be used to generate a genetically-modified T-cell immunotherapy. In some embodiments, the genetically-modified T-cell immunotherapy may comprise a chimeric antigen receptor T cell (CAR T cell). In some embodiments, the engineered T-cell or population of engineered T-cells may comprise a chimeric antigen receptor T cell (CAR T cell). In some embodiments, a subject’s T cells are genetically modified with an engineered T-cell receptor, such as a chimeric antigen receptor (Sadelain et al., Cancer Discov.3:388-398, 2013). For example, a T cell is provided and recombinant nucleic acid encoding an engineered T-cell receptor, such as a chimeric antigen receptor, is introduced into the patient-derived T cell to generate a CAR T cell. In some embodiments, T cells not derived from the subject are genetically modified with an engineered T-cell receptor, such as a chimeric antigen receptor. For example, in some embodiments, the T cells are allogeneic cells. A variety of different methods known in the art can be used to introduce nucleic acids or expression vectors into a T cell. Non-limiting examples of methods for introducing nucleic acid into a T cell include: lipofection, transfection (e.g., calcium phosphate transfection, transfection using highly branched organic compounds, transfection using cationic polymers, dendrimer-based transfection, optical transfection, particle-based transfection (e.g., nanoparticle transfection), or transfection using liposomes (e.g., cationic liposomes)), microinjection, electroporation, cell squeezing, sonoporation, protoplast fusion, impalefection, hydrodynamic delivery, gene gun, magnetofection, viral transfection, and nucleofection. Furthermore, the CRISPR / Cas9 genome editing technology known in the art can be used to introduce CAR nucleic acids into T cells and / or to introduce other genetic modifications into T cells to enhance CAR T cell activity (for use of CRISPR / Cas9 technology in connection with CAR T cells, see e.g., US 9,890,393; US 9,855,297; US 2017 / 0175128; US 2016 / 0184362; US 2016 / 0272999; WO 2015 / 161276; WO 2014 / 191128; CN 106755088; CN 106591363; CN 106480097; CN 106399375; CN 104894068). As used herein, the term “engineered T-cell” may refer, in some embodiments, to a T-cell comprising an engineered T-cell receptor. An “engineered T-cell receptor” may comprise (a) an extracellular antigen binding domain, (b) a transmembrane domain, and (c) an intracellular signaling domain. In some embodiments, an engineered T-cell receptor is a genetically modified TCR, a modified TCR, a recombinant TCR, a transgenic TCR, a partial TCR, a chimeric fusion protein, a CAR, a first generation CAR, a second generation CAR, a third generation CAR, or a fourth generation TRUCK. In some aspects, the engineered T-cell receptor comprises an antibody or a fragment of an antibody. In preferred aspects, the engineered T-cell receptor is a genetically modified TCR or a CAR. 67 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) As used herein, the term “T-cell receptor” or “TCR” refers to a cell surface molecule found on T-cells that functions to recognize and bind antigens presented by antigen presenting molecules. Generally, a TCR is a heterodimer of an alpha chain (TRA) and a beta chain (TRB). Some TCRs are comprised of alternative gamma (TRG) and delta (TRD) chains. T-cells expressing this version of a G8E K\O UXYaX K] sn G'MOVV]( G8E] K\O ZK\^ YP ^RO SWW_XYQVYL_VSX ]_ZO\PKWSVc( 6MMY\NSXQVc& VSUO KX antibody, the TCR comprises three hypervariable CDR regions per chain. There is also an additional area of hypervariability on the beta-chain (HV4). The TCR heterodimer is generally present in an YM^YWO\SM MYWZVOb ^RK^ P_\^RO\ MYWZ\S]O] ^R\OO NSWO\SM ]SQXKVSXQ WYN_VO] qy-s)o& 89- / )2& KXN As used herein, a “chimeric antigen receptor” (CAR) is an artificially constructed hybrid protein or polypeptide comprising a specificity or recognition (i.e. binding) domain linked to an immune receptor responsible for signal transduction in lymphocytes. Generally, the term “CAR” may be understood to refer to an artificial transmembrane protein receptor comprising an extracellular domain capable of binding to a predetermined CAR ligand or antigen, an intracellular segment comprising one or more cytoplasmic domains derived from signal transducing proteins different from the polypeptide from which the extracellular domain is derived, and a transmembrane domain. The binding domain is typically derived from a Fab antibody fragment that has been fashioned into a single chain scFv via the introduction of a flexible linker between the antibody chains within the specificity domain. Other possible specificity domains can include the signaling portions of hormone or cytokine molecules, the extracellular domains of receptors, and peptide ligands or peptides isolated by library (e.g. phage) screening (see Ramos and Dotti, (2011) Expert Opin Bio Ther 11(7): 855). In some embodiments, antigen-binding domains may include antibody fragments and multi-specific (e.g., bi-specific) antibodies or antibody fragments. Examples of antibodies and antigen-binding fragments thereof include, but are not limited to: single-chain Fvs (scFvs), Fab fragments, Fab’ fragments, F(ab’)2, disulfide-linked Fvs (sdFvs), Fvs, and fragments containing either a VL or a VH domain. Flexibility between the signaling and the binding portions of the CAR may be a desirable characteristic to allow for more optimum interaction between the target and the binding domain, so often a hinge region is included. One example of a structure that can be used is the CH2-CH3 region from an immunoglobulin such as an IgG molecule. The signaling domain of the typical CAR MYWZ\S]O] SX^\KMOVV_VK\ NYWKSX] YP ^RO G8E'89- MYWZVOb ]_MR K] ^RO dO^K MRKSX( 6V^O\XK^S`OVc& ^RO s chain of an Fe receptor may be used. The transmembrane portion of the typical CAR can comprise transmembrane portions of proteins such as CD4, CD8 or CD28 (Ramos and Dotti, ibid). Characteristics of some CARs include their ability to redirect T-cell specificity and reactivity toward a selected target in a non-MHC-restricted manner. The non-MHC-restricted target recognition gives T- cells expressing CARs the ability to recognize a target independent of antigen processing, thus bypassing a major mechanism of tumor escape. The “chimeric antigen receptor (CAR)” is sometimes 68 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) called a “chimeric receptor,” a “T-body,” or a “chimeric immune receptor (CIR).” Typically these receptors are used to impart the antigen specificity of a monoclonal antibody onto a T cell. In some embodiments, CARs contain three domains: 1) an ectodomain typically comprising a signal peptide, a ligand or antigen recognition region (e.g. scFv), and a flexible spacer; 2) a transmembrane (TM) domain; 3) an endodomain (alternatively known as an “activation domain”) typically comprising one or more intracellular signaling domains. The “intracellular signaling domain” means any oligopeptide or polypeptide domain known to function to transmit a signal causing activation or inhibition of a biological process in a cell, for example, activation of an immune MOVV ]_MR K] K G MOVV Y\ K B? MOVV( :bKWZVO] SXMV_NO >@E MRKSX& 89,2 KXN)Y\ 89-t( GRO OM^YNYWKSX of the CAR resides outside of the cell and exposed to the extracellular space, whereby it is accessible for interaction with its cognate ligand. The TM domain allows the CAR to be anchored into the cell membrane of the effector cell. The third endodomain (also known as the “activation domain”) aids in effector cell activation upon binding of the CAR to its specific ligand. In some embodiments, effector cell activation comprises induction of cytokine and chemokine production, as well as activation of the cytolytic activity of the cells. In some embodiments, the CARs redirect cytotoxicity toward tumor cells. In some embodiments, chimeric antigen receptors (CARs) comprise a ligand- or antigen- specific recognition domain that binds to a specific target ligand or antigen (also referred to as a binding domain). In some embodiments, the binding domain is a single-chain antibody variable fragment (scFv), a tethered ligand or the extracellular domain of a co-receptor, fused to a transmembrane domain, which is linked, in turn, to a signaling domain. In some embodiments, the ]SQXKVSXQ NYWKSX S] NO\S`ON P\YW 89-t Y\ ;MEs( >X ]YWO OWLYNSWOX^]& ^RO 86E MYWZ\S]O] YXO Y\ more co-stimulatory domains derived from a protein such as CD28, 4.1BB (CD137), OX40 (CD134), 89,1 #GB;EF;1$& <>GE #89- / 1$& 89-* #GB;EF;2$& =I:A #89,1*$& @GrE #GB;EF;-$& 9E- (TNFRSF25), ICOS (CD278), CD226 (DNAM1), CRTAM (CD355),TIM1 (HAVCR1, KIM1), CD2 (LFA2, OX34), SLAM (CD150, SLAMF1), 2B4 (CD244, SLAMF4), Ly108 (NTBA, CD352, SLAMF6), CD84 (SLAMF5), Ly9 (CD229, SLAMF3), ICAM-1, and CRACC (CD319, BLAME). In some embodiments, engagement of the antigen binding domain of the CAR with its target antigen on the surface of a target cell results in clustering of the CAR and delivers an activation stimulus to the CAR-containing cell. In some embodiments, the main characteristic of CARs are their ability to redirect immune effector cell specificity, thereby triggering proliferation, cytokine production, phagocytosis or production of molecules that can mediate cell death of the target antigen expressing cell in a major histocompatibility (MHC) independent manner, exploiting the cell specific targeting abilities of monoclonal antibodies, soluble ligands or cell specific co-receptors. Although ]M;`'LK]ON 86E] OXQSXOO\ON ^Y MYX^KSX K ]SQXKVSXQ NYWKSX P\YW 89-t Y\ ;MEc RK`O LOOX ]RYaX ^Y deliver a potent signal for T cell activation and effector function, they are not sufficient to elicit signals that promote T cell survival and expansion in the absence of a concomitant co-stimulatory 69 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) signal. A new generation of CARs containing a binding domain, a hinge, a transmembrane and the ]SQXKVSXQ NYWKSX NO\S`ON P\YW 89-t Y\ ;MEc ^YQO^RO\ aS^R YXO Y\ WY\O MY']^SW_VK^Y\c ]SQXKVSXQ domains (e.g., intracellular co-stimulatory domains derived from CD28, CD137, CD134 and CD278) has been shown to more effectively direct antitumor activity as well as increased cytokine secretion, lytic activity, survival and proliferation of CAR expressing T cells in vitro, in animal models and cancer patients (Milone et al., Molecular Therapy, 2009; 17: 1453-1464; Zhong et al., Molecular Therapy, 2010; 18: 413-420; Carpenito et al., PNAS, 2009; 106:3360-3365). In some embodiments, chimeric antigen receptor-expressing T cells (e.g. CAR T-cells) are cells that are derived from a patient with a disease or condition and genetically modified in vitro to express at least one CAR with specificity for a ligand. In some embodiments, the cells perform at least one effector function (e.g. induction of cytokines) that is stimulated or induced by the specific binding of the ligand to the CAR and that is useful for treatment of the same patient’s disease or condition. In some embodiments, the effector cell is a T cell (e.g. a cytotoxic T cell) that exerts its effector function (e.g. a cytotoxic T cell response) on a target cell when brought in contact or in proximity to the target or target cell (e.g. a cancer cell) (see e.g., Chang and Chen (2017) Trends Mol Med 23(5):430-450). Prolonged exposure of T cells to their cognate antigen can result in exhaustion of effector functions, enabling the persistence of infected or transformed cells. Recently developed strategies to stimulate or rejuvenate host effector function using agents that induce an immune checkpoint blockade have resulted in success towards the treatment of several cancers. Emerging evidence suggests that T cell exhaustion may also represent a significant impediment in sustaining long-lived antitumor activity by chimeric antigen receptor-expressing T cells (CAR T cells). In some embodiments, the differentiation status of the patient-harvested T cells prior to CAR transduction and the conditioning regimen a patient undergoes before reintroducing the CAR T cells (e.g., addition or exclusion of alkylating agents, fludarabine, total-body irradiation) can profoundly affect the persistence and cytotoxic potential of CAR T cells. In vitro culture conditions that stimulate (via anti- CD3 / CD28 or stimulator cells) and expand (via cytokines, such as IL-2) T cell populations can also alter the differentiation status and effector function of CAR T cells (Ghoneim et al., (2016) Trends in Molecular Medicine 22(12):1000-1011). The phrase “CAR ligand” used interchangeably with “CAR antigen” and “T-cell ligand” means any natural or synthetic molecule (e.g., small molecule, protein, peptide, lipid, carbohydrate, nucleic acid) or part or fragment thereof that can specifically bind to the CAR. Such ligands may be T-cell activating ligands or T-cell inhibiting ligands. In some embodiments, the one or more T-cell ligands is loaded into and / or presented on the hydrogel. In some embodiments, the one or more T-cell ligands is an antibody molecule or antigen- binding fragment thereof. In some embodiments, the one or more T-cell ligands is an anti-idiotype antibody or derivative thereof that binds to the antigen-binding domain of a CAR molecule of the administered population of engineered T-cells in the subject. In some embodiments, the one or more 70 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) G'MOVV VSQKXN] S] ]OVOM^ON P\YW ^RO Q\Y_Z MYX]S]^SXQ YP KX KX^S'SNSY^cZO 89- KX^SLYNc #m89-$ Y\ KX KX^SQOX'LSXNSXQ P\KQWOX^ ^RO\OYP5 KX KX^S'SNSY^cZO 89 / KX^SLYNc #m89 / $ Y\ KX KX^SQOX'LSXNSXQ P\KQWOX^ ^RO\OYP5 KX KX^S'SNSY^cZO 891 KX^SLYNc #m891$ Y\ KX KX^SQOX'LSXNSXQ P\KQWOX^ ^RO\OYP5 KX KX^S'SNSY^cZO 89,2 KX^SLYNc #m89,2$ Y\ KX KX^SQOX'LSXNSXQ P\KQWOX^ ^RO\OYP5 KX KX^S'SNSY^cZO 89+3 KX^SLYNc #m89+3$ Y\ KX KX^SQOX'LSXNSXQ P\KQWOX^ ^RO\OYP5 KX KX^S'SNSY^cZO 89,* KX^SLYNc #m89,*$ Y\ KX KX^SQOX'LSXNSXQ P\KQWOX^ ^RO\OYP5 KX KX^S'SNSY^cZO 89,, KX^SLYNc #m89,,$ Y\ KX KX^SQOX' LSXNSXQ P\KQWOX^ ^RO\OYP5 KX KX^S'SNSY^cZO 891* KX^SLYNc #m891*$ Y\ KX KX^SQOX'LSXNSXQ P\KQWOX^ ^RO\OYP5 KX KX^S'SNSY^cZO 89+,- KX^SLYNc #m89+,-$ Y\ KX KX^SQOX'LSXNSXQ P\KQWOX^ ^RO\OYP5 KX KX^S' SNSY^cZO 8F+ KX^SLYNc #m8F+$ Y\ KX KX^SQOX'LSXNSXQ P\KQWOX^ ^RO\OYP5 KX KX^S'SNSY^cZO 78A6 KX^SLYNc #m78A6$ Y\ KX KX^SQOX'LSXNSXQ P\KQWOX^ ^RO\OYP5 KX KX^S'SNSY^cZO F@6A;1 KX^SLYNc #mF@6A;1$ Y\ KX KX^SQOX'LSXNSXQ P\KQWOX^ ^RO\OYP5 KX KX^S'SNSY^cZO 8VK_NSX'0 KX^SLYNc #m8VK_NSX' 0$ Y\ KX KX^SQOX'LSXNSXQ P\KQWOX^ ^RO\OYP5 KX KX^S'SNSY^cZO B?<,9 KX^SLYNc #mB?<,9$ Y\ KX KX^SQOX'LSXNSXQ P\KQWOX^ ^RO\OYP5 KX KX^S'SNSY^cZO B?<,9@ KX^SLYNc #mB?<,9@$ Y\ KX KX^SQOX' LSXNSXQ P\KQWOX^ ^RO\OYP5 KX KX^S'SNSY^cZO <9, KX^SLYNc #m<9,$ Y\ KX KX^SQOX'LSXNSXQ P\KQWOX^ ^RO\OYP5 KX KX^S'SNSY^cZO =O\, KX^SLYNc #m=O\,$ Y\ KX KX^SQOX'LSXNSXQ P\KQWOX^ ^RO\OYP5 KXN KX KX^S' SNSY^cZO WO]Y^ROVSX KX^SLYNc #mAF@B$ Y\ KX KX^SQOX'LSXNSXQ P\KQWOX^ ^RO\OYP5 Y\ K MYWLSXK^SYX thereof. In some embodiments, the one or more T-cell ligands comprises a T-cell antigen or derivative thereof that binds to a CAR molecule of the administered population of engineered T-cells in the subject. In some embodiments, the one or more T-cell ligands is selected from the group consisting of a CD3 molecule or a fragment thereof; a CD5 molecule or a fragment thereof; a CD7 molecule or a fragment thereof; a CD28 molecule or a fragment thereof; a CD19 molecule or a fragment thereof; a CD20 molecule or a fragment thereof; a CD22 molecule or a fragment thereof; a CD70 molecule or a fragment thereof; a CD123 molecule or a fragment thereof; a CS1 molecule or a fragment thereof; a BCMA molecule or a fragment thereof; a SLAMF7 molecule or a fragment thereof; a Claudin-6 molecule or a fragment thereof; a NKG2D molecule or a fragment thereof; a NKG2DL molecule or a fragment thereof; a GD2 molecule or a fragment thereof; a Her2 molecule or a fragment thereof; and a mesothelin (MSLN) molecule or a fragment thereof; or a combination thereof. In some embodiments, the one or more T-cell ligands is selected from the group consisting of an anti-CD3 antibody or an antigen-binding fragment thereof, anti-macrophage scavenger receptor (MSR1) antibody or an antigen-binding fragment thereof, an anti-T-cell receptor (TCR) antibody or an antigen-binding fragment thereof, an anti-CD2 antibody or an antigen-binding fragment thereof, an anti-CD47 antibody or an antigen-binding fragment thereof, a major histocompatibility complex (MHC) molecule loaded with an MHC peptide or a multimer thereof, and an MHC-immunoglobulin (Ig) conjugate or a multimer thereof, ICAM-1, or a combination thereof. In some embodiments, the one or more T-cell ligands comprises a cancer antigen or derivative thereof that binds to a CAR molecule of the administered population of engineered T-cells 71 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) in the subject. As used herein, “cancer antigen,” in some embodiments, refers to (i) tumor-specific antigens, (ii) tumor-associated antigens, (iii) cells that express tumor-specific antigens, (iv) cells that express tumor-associated antigens, (v) embryonic antigens on tumors, (vi) autologous tumor cells, (vii) tumor-specific membrane antigens, (viii) tumor-associated membrane antigens, (ix) growth factor receptors, (x) growth factor ligands, and (xi) any other type of antigen or antigen-presenting cell or material that is associated with a cancer. Accordingly, in one embodiment, an exogenous T cell may be modified to express a receptor (e.g., TCR or CAR), such as a receptor that recognizes a cancer antigen (also referred to as a tumor antigen). A cancer antigen typically is an antigen that is expressed preferentially by cancer cells (i.e., it is expressed at higher levels in cancer cells than on non-cancer cells) and in some instances is expressed solely by cancer cells. The cancer antigen may be expressed within a cancer cell or on the surface of the cancer cell. Non-limiting examples of cancer antigens include, without limitation, an epithelial cancer antigen, (e.g., breast, gastrointestinal, lung), a prostate specific cancer antigen (PSA) or prostate specific membrane antigen (PSMA), a bladder cancer antigen, a lung (e.g., small cell lung) cancer antigen, a colon cancer antigen, an ovarian cancer antigen, a brain cancer antigen, a gastric cancer antigen, a renal cell carcinoma antigen, a pancreatic cancer antigen, a liver cancer antigen, an esophageal cancer antigen, a head and neck cancer antigen, or a colorectal cancer antigen. In certain embodiments, the tumor antigen is a lymphoma antigen (e.g., non-Hodgkin's lymphoma or Hodgkin's lymphoma), a B-cell lymphoma cancer antigen, a leukemia antigen, a myeloma (e.g., multiple myeloma or plasma cell myeloma) antigen, an acute lymphoblastic leukemia antigen, a chronic myeloid leukemia antigen, or an acute myelogenous leukemia antigen. Exemplary CAR include, without limitation, a CD3 CAR, a CD5 CAR, a CD7 CAR, a CD28 CAR, a CD19 CAR, a CD20 CAR, a CD22 CAR, a CD70 CAR, a CD123 CAR, a CS1 CAR, a BCMA CAR, a SLAMF7 CAR, a Claudin-6 CAR, a NKG2D CAR, a NKG2DL CAR, a GD2 CAR, a Her2 CAR, and a mesothelin (MSLN) CAR, or a combination thereof. In another embodiment, the therapeutic efficacy of CAR T cells is enhanced by contact with the extracellular matrix (ECM) mimetics, described herein. Pharmaceutical Compositions For administration to a subject, the scaffolds, e.g., hydrogels, and / or immune cells, e.g., T cells, described herein can be provided as pharmaceutically acceptable (e.g., sterile) compositions. These pharmaceutically acceptable compositions can be formulated together with one or more pharmaceutically acceptable carriers (additives) and / or diluents. As described in detail below, the pharmaceutical compositions of the present disclosure can be specifically formulated for administration in solid or liquid form, including those adapted for the following: (1) parenteral administration, for example, by subcutaneous, intramuscular, intravenous (e.g., bolus or infusion) or epidural injection as, for example, a sterile solution or suspension, or 72 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) sustained-release formulation; (2) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), lozenges, dragees, capsules, pills, tablets (e.g., those targeted for buccal, sublingual, and / or systemic absorption), boluses, powders, granules, pastes for application to the tongue; (3) topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; (5) sublingually; (6) ocularly; (7) transdermally; (8) transmucosally; or (9) nasally. Additionally, compounds can be implanted into a patient or injected using a drug delivery system. See, for example, Urquhart, et al., Ann. Rev. Pharmacol. Toxicol.24: 199-236 (1984); Lewis, ed. “Controlled Release of Pesticides and Pharmaceuticals” (Plenum Press, New York, 1981); U.S. Pat. No.3,773,919; and U.S. Pat. No.353,270,960, content of all of which is herein incorporated by reference. As used herein, the term “pharmaceutically acceptable” or “pharmacologically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. Moreover, for animal (e.g., human) administration, it will be understood that compositions should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards. As used herein, the term “pharmaceutically acceptable carrier” means a pharmaceutically- acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; (22) C2-C12 alcohols, such as ethanol; and (23) other non- toxic compatible substances employed in pharmaceutical formulations. Wetting agents, coloring 73 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) agents, release agents, coating agents, disintegrating agents, binders, sweetening agents, flavoring agents, perfuming agents, protease inhibitors, plasticizers, emulsifiers, stabilizing agents, viscosity increasing agents, film forming agents, solubilizing agents, surfactants, preservative and antioxidants can also be present in the formulation. The terms such as “excipient”, “carrier”, “pharmaceutically acceptable carrier” or the like are used interchangeably herein. The pharmaceutical compositions of the disclosure comprising a hydrogel and / or cells can be delivered to an in vivo locus in a subject. Exemplary in vivo loci include, but are not limited to site of a disease, e.g., a tumor. The composition can be delivered to the in vivo locus by, for example, implanting the compositions into a subject. The composition can optionally include one or more additives. Additives can include, but are not limited to, resolving (biodegradable) polymers, mannitol, starch sugar, inosite, sorbitol, glucose, lactose, saccharose, sodium chloride, calcium chloride, amino acids, magnesium chloride, citric acid, acetic acid, hydroxyl-butanedioic acid, phosphoric acid, glucuronic acid, gluconic acid, poly-sorbitol, sodium acetate, sodium citrate, sodium phosphate, zinc stearate, aluminium stearate, magnesium stearate, sodium carbonate, sodium bicarbonate, sodium hydroxide, polyvinylpyrolidones, polyethylene glycols, carboxymethyl celluloses, methyl celluloses, starch or their mixtures. In one aspect, the present invention provides an immune cell, such as a T cell, with enhanced function, which may be generated using an ECM mimetic described herein. In some embodiments, the enhanced function of the T cell comprises an improved effector function of the T cell. In some embodiments, the enhanced function of the T cell comprises an improvement in the proliferation rate of the T cell, an increase in the production amount of cytokine, and / or an improvement in cytotoxicity. In some embodiments, the enhanced function of the T cell comprises cancellation and suppression of tolerance of the T cell in the suppressed state such as the anergy (unresponsive) state, or the rest state, that is, transfer of the T cell from the suppressed state into the state where the T cell responds to stimulation from the outside. The function enhancement of the immune cells, such as T cells, of the present disclosure can be assessed at a plurality of time points before and after each step of any of the methods described herein using a cytokine assay, an antigen-specific cell assay (tetramer assay), a proliferation assay, a cytolytic cell assay, or an in vivo delayed hypersensitivity test using a recombinant tumor-associated antigen or an immunogenic fragment or an antigen-derived peptide. Examples of an additional method for measuring an increase in an immune response include a delayed hypersensitivity test, flow cytometry using a peptide major histocompatibility gene complex tetramer, a lymphocyte proliferation assay, an enzyme-linked immunosorbent assay, an enzyme-linked immunospot assay, cytokine flow cytometry, a direct cytotoxicity assay, measurement of cytokine mRNA by a quantitative reverse transcriptase polymerase chain reaction, or an assay which is currently used for measuring a T cell response such as a limiting dilution method. 74 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) Kits Any of the compositions, e.g., hydrogels, described herein may be comprised in a kit. In some embodiments, the kit includes the device and / or scaffold described elsewhere herein. In a non-limiting example, the kit includes a device including a polymer scaffold and a click reagent. In certain embodiments, the kit comprises a click functionalized collagen polymer. In certain embodiments, the kits includes a cell culture dish and / or a cell culture plate. The kit may further include reagents or instructions for using the hydrogel according to any of the methods described elsewhere herein. It may also include one or more buffers. Other kits of the disclosure may include components for assays to detect the phenotype of the cell. The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, cell culture plate, cell culture dish, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there are more than one component in the kit (multiple components may be packaged together), the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. The kits may also comprise a second container means for containing a sterile, pharmaceutically acceptable buffer and / or other diluent. However, various combinations of components may be comprised in a vial. The kits of the present disclosure also will typically include a means for containing the compositions of the disclosure, e.g., the click functionalized polymer (e.g., collagen), and any other reagent containers in close confinement for commercial sale. When the components of the kit are provided in one and / or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred. However, the components of the kit may be provided as dried powder(s). When reagents and / or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means. The present disclosure is further illustrated by the following examples, which should not be construed as limiting. The entire contents of all of the references cited throughout this application are hereby expressly incorporated herein by reference. Methods of Making The present disclosures provides extracellular matrix (ECM) mimetics (e.g., collagen hydrogels), compositions thereof, and methods of making and using the same. In one aspect, the present disclosure provides a method of making an extracellular matrix (ECM) mimetic. In some embodiments, the method comprises providing a polymer, such as a collagen functionalized with 5-Norbornene-2-acetic acid succinimidyl ester (Nb-NHS), e.g., at a ratio of 0.1g Nb-NHS: 1g collagen. For example, collagen can be first neutralized with NaOH to pH 7.2-7.5 and 75 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) buffered with 10x DPBS to a concentration of 2 mg / mL. Next, Nb-NHS can be dissolved in DMSO to an initial concentration of 2 mg / mL and diluted 10-fold in 1x PBS, after which the Nb-NHS solution can be added to the neutralized collagen, resulting in 1 mg / mL final collagen concentration. The reaction can be allowed to proceeded for about 5 hours at 4 ºC under rigorous stirring to delay collagen gelation, after which 0.1N acetic acid can be added to quench the reaction and re-acidify the collagen solution. The product, Norbornene-modified collagen (Col-Nb) can be dialyzed in 0.025 N acetic acid for 4 days, filtered with a 0.45 µm filter and then lyophilized for use. In some embodiments, the method comprises Col-Nb crosslinking and T cell encapsulation in Col-Nb. For example, lyophilized Col-Nb can be first dissolved to 6 mg / mL in 0.025 N acetic acid at . i8 PY\ KLY_^ .2 RY_\]( GY PKL\SMK^O ,** wV PK]^ \OVKbSXQ #XYX'MVSMU M\Y]]VSXUON$ KXN ]VYa \OVKbSXQ (click crosslinked) Col-Nb gels, dissolved Col-Nb can be mixed on ice with 10x PBS, Milli Q water, and neutralized with NaOH to a final pH of 7.2-7.5 and a final collagen concentration to 2 mg / ml or 4 mg / ml. Dynabead activated T cells can be resuspended in PBS on ice, and 100,000 cells can be added to the collagen solution for a desired final cell density of 500,000 cells / ml. The collagen-T cell solution can then be gently transferred into 10 mm diameter microwells of a 6-well MatTek plate (#P06G-0-10-F) and incubated at 37 ºC for 30 minutes for collagen type I gelation to occur. After collagen gelation, secondary collagen crosslinking can be performed in two steps: linker diffusion step, which can occur at room temperature and results in minimum crosslinking, and the click reaction step, which can occurr at 37 ºC. For the diffusion step, the plate can be cooled to room temperature for 7 min, and 4 ml of either PBS control (with DMSO vehicle solution) or Methyltetrazine-(PEG)5- Methyltetrazine crosslinker solution can be added to each well to allow for crosslinker diffusion. After 20 min, the PBS or crosslinker solution can be removed, and the plate can be moved to 37 ºC for 1 hr to allow click crosslinking to proceed. After crosslinking, collagen gels can undergo two 30 mins washes with T cell media to remove excess crosslinker. T cell media can then be added to maintain culture. T cells in both fast relaxing and slow relaxing matrices can be exposed to the same temperatures and same amount of vehicle solution for the same time period. In some embodiments, the method comprises Col-Nb-Matrigel IPN crosslinking and ]_L]O[_OX^ G MOVV OXMKZ]_VK^SYX( ;Y\ ObKWZVO& ^Y PKL\SMK^O ,** wV PK]^ \OVKbSXQ KXN ]VYa \OVKbSXQ 8YV' Nb-Matrigel IPN gels, Col-Nb solution can first be neutralized as described elsewhere herein, and Matrigel can be mixed into Col-Nb solution to make a final collagen concentration of 2 mg / ml and Matrigel concentration of 4 mg / ml. Dynabead activated T cells can be resuspended in PBS on ice, and 100,000 cells can be added to the Col-Nb-Matrigel solution. The gel was casted and crosslinked as described elsewhere herein. Exemplary hydrogels and methods of making them are described in US 2012 / 0100182, PCT / US2010 / 057630, and PCT / US2012 / 35505, the entire contents of each of which is hereby incorporated by reference. U.S. Patent Number 6,642,363, incorporated herein by reference, discloses 76 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) methods for making and using polymers containing polysaccharides such as alginates or modified alginates that are particularly useful for cell transplantation and tissue engineering applications. Methods of making a hydrogel described herein include using gas foaming, e.g., as described in detail in Harris et al. J. Biomed. Materials Res. Part A.42.3(1998)396-402 and Sheridan et al. J. Control. Rel.64(2000)91-102, both incorporated herein by reference. In other embodiments, wires (e.g., a template containing multiple wires) are used as porogens, i.e., to create pores in the scaffold, e.g., to create aligned pores. In other examples, methods for making hydrogels, e.g., encapsulating cells, are also described in PCT / US2012 / 033208, the entire contents of which are incorporated herein by reference. Methods of Use The present disclosure further provides methods for generating a population of immune cells using the ECM mimetics (e.g., hydrogels) described herein. In one aspect, the present disclosure provides in vitro methods for generating a population of immune cells, comprising: contacting a population of immune cells with the ECM mimetics (e.g., hydrogels) described herein, thereby generating the population of immune cells, optionally wherein the generated population of immune cells is suitable for use in an adoptive cell therapy and / or is characterized by enhanced efficacy as compared to a population of immune cells generated using conventional plate-culture protocols. In some embodiments, the methods for generating a population of immune cells described herein generate an immune cell, e.g., a T cell, with enhanced function. As used herein, the term “enhanced function” of an immune cells, such as a T cell, refers to an effector function of the immune cell, e.g., T cell, that is improved. The enhanced function of the immune cell, e.g., T cell, without limitation, can include an improvement in the proliferation rate of the T cell, an increase in the production amount of cytokine, and / or an improvement in cytotoxicity. Further, the enhanced function of the T cell can include cancellation and suppression of tolerance of the T cell in the suppressed state such as the anergy (unresponsive) state, or the rest state, that is, transfer of the T cell from the suppressed state into the state where the T cell responds to stimulation from the outside. The function enhancement of the T cell in the methods of the present disclosure can be assessed at a plurality of time points before and after each step using a cytokine assay, an antigen- specific cell assay (tetramer assay), a proliferation assay, a cytolytic cell assay, or an in vivo delayed hypersensitivity test using a recombinant tumor-associated antigen or an immunogenic fragment or an antigen-derived peptide. Examples of additional methods for measuring an increase in an immune response include a delayed hypersensitivity test, flow cytometry using a peptide major histocompatibility gene complex tetramer. a lymphocyte proliferation assay, an enzyme-linked immunosorbent assay, an enzyme-linked immunospot assay, cytokine flow cytometry, a direct 77 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) cytotoxicity assay, measurement of cytokine mRNA by a quantitative reverse transcriptase polymerase chain reaction, or an assay which is currently used for measuring a T cell response such as a limiting dilution method. In one aspect, the present disclosure provides methods for activating and / or expanding a population of immune cells, comprising: contacting a population of immune cells with the ECM mimetics (e.g., hydrogels) described herein, thereby activating and / or expanding the population of immune cells. In one aspect, the present disclosure provides methods for modulating immune cell phenotype and / or immune cell function, comprising: contacting a population of immune cells with the ECM mimetics (e.g., hydrogels) described herein, thereby modulating immune cell phenotype and / or immune cell function. In one aspect, the present disclosure provides methods for modulating immune cell differentiation, comprising: contacting a population of immune cells with the ECM mimetics (e.g., hydrogels) described herein, thereby modulating immune cell differentiation. In one aspect, the present disclosure provides methods of preventing and / or treating cancer in a subject in need thereof, comprising: contacting a population of immune cells with the ECM mimetics (e.g., hydrogels) described herein; and administering a therapeutically effective amount of the population of immune cells to the subject, thereby preventing and / or treating cancer in the subject. In some embodiments, the method can comprise contacting the population of immune cells with a T-cell activating molecule and / or a T-cell co-stimulatory molecule. In some embodiments, the T-cell activating molecule and / or the T-cell co-stimulatory molecule can comprise CD3 / CD28 or CD3 / CD28 / CD137 dynabeads. In some embodiments, the method can comprise activating the immune cells with a predefined strength of antigenic stimulation and / or a predefined duration of antigenic stimulation. In some embodiments, the activating is prior to, concurrently with, and / or subsequent to contacting the population of immune cells with the ECM mimetic. In some embodiments, predefined strength of antigenic stimulation comprises a bead-to-cell ratio of 0.5:1, 1:1, or 5:1. In some embodiments, the beads comprise CD3 / CD28 dynabeads or CD3 / CD28 / CD137 dynabeads. In some embodiments, the predefined duration of antigenic stimulation comprises a time period of about 1 day to about 10 days. In some embodiments, the time period comprises about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, or about 10 days. In some embodiments, the method can comprise culturing the population of immune cells under conditions and time sufficient for immune cell expansion and / or enrichment to occur. In some embodiments, expanding the immune cells comprises contacting the immune cells with a growth factor, optionally wherein the growth factor is IL-2. In some embodiments, the method can comprise isolating the immune cells from the ECM mimetic. In some embodiments, the method can comprise subsequently culturing the isolated immune 78 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) cells in suspension with or without restimulation. In some embodiments, the restimulation can comprise contacting the immune cells with CD3 / CD28 dynabeads or CD3 / CD28 / CD137 dynabeads. In some embodiments, the method can comprise phenotypically profiling and / or functionally testing the immune cells for their cytotoxic potential and / or effector cytokine production. In some embodiments, the population of immune cells is characterized by greater cytotoxicity towards cancer cells enhanced efficacy and / or effector cytokine production as compared to a population of immune cells generated using conventional plate-culture protocols. In some embodiments, the adoptive cell therapy is selected from the group consisting of a tumor-infiltrating lymphocyte (TIL) therapy, a engineered T cell receptor (TCR) therapy, a chimeric antigen receptor (CAR) T cell therapy, a natural killer (NK) cell therapy, and combinations thereof. In some embodiments, the immune cell comprises an autologous immune cell or an allogeneic immune cell, optionally wherein the immune cell comprises a phagocyte, a macrophage, a dendritic cell, a monocyte, a B cell, a T cell, a natural killer cell (NK) cell, and combinations thereof. In some embodiments, the immune cell comprises a T cell. In some embodiments, the T cell is an autologous T cell or an allogeneic T cell. In some embodiments, the T cell is a pan T cell or a T cell with a shared TCR clonotype. In some embodiments, the T cell is selected from the group consisting of a naïve T cell, a helper T cell, a cytotoxic T cell, a memory T cell, a regulatory T cell, an innate-like T cell, a natural killer T cell, a mucosal associated invariant T cell, a gamma delta T cell, and combinations thereof. In some embodiments, the method produces a T cell characterized by a T cell signature. In some embodiments, the T cell signature is a normal tissue and / or blood T cell gene signature. In some embodiments, the T cell signature is a tumor T cell gene signature, optionally wherein the tumor T cell gene signature is for non-small cell lung cancer (NSCLC), liver cancer, colorectal cancer, and / or breast cancer. In some embodiments, the T cell signature is a T cell gene signature for liver fibrosis. In some embodiments, the T cell signature is an activation / inhibitory T cell signature, optionally wherein the activation / inhibitory T cell signature is based on a marker selected from the group consisting of PD1, TIGIT, TIM3, LAG3, OX40, CD39, CD25, CTLA4, and combinations thereof. In some embodiments, the T cell signature is a memory T cell signature, optionally wherein the memory T cell signature is based on a marker selected from the group consisting of CD62L, CCR7, CD127, CD45RA, CD27, and combinations thereof. In some embodiments, the T cell signature is a T cell AP- 1 gene signature. In some embodiments, the method increases the expression level of an activation / inhibitory T cell marker in T cells contacted with the slow relaxing hydrogel compared to the fast relaxing hydrogel, optionally wherein the activation / inhibitory T cell marker is selected from the group consisting of IL2RA (CD25), ENTPD1 (CD39), FAS, TNFRSF4 (OX40), LAG3, and combinations thereof. 79 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) In some embodiments, the method increases the expression level of a transcription factor associated with a T cell effector phenotype in T cells contacted with the slow relaxing hydrogel compared to the fast relaxing hydrogel, optionally wherein the transcription factor associated with a T cell effector phenotype is selected from the group consisting of PRDM1 (BLIMP-1), ZEB2, and combinations thereof. In some embodiments, the method increases the expression level of an AP-1 pathway- associated gene in T cells contacted with the slow relaxing hydrogel compared to the fast relaxing hydrogel, optionally wherein the AP-1 pathway-associated gene is selected from the group consisting of JUN, ATF3, BATF, FOS, FOSB, JUNB, and combinations thereof. In some embodiments, the method increases the expression level of a mitogen-activated protein kinase in T cells contacted with the slow relaxing hydrogel compared to the fast relaxing hydrogel, optionally wherein the mitogen-activated protein kinase is selected from the group consisting of MAPK8, MAPK6, MAPK1, and combinations thereof. In some embodiments, the method increases the expression level of a T cell memory marker and / or a T cell memory associated transcription factor in T cells contacted with the fast relaxing hydrogel compared to the slow relaxing hydrogel, optionally wherein the T cell memory marker and / or the T cell memory associated transcription factor is selected from the group consisting of CD62L, KLF2, CXCR3, S1PR4, and combinations thereof. In some embodiments, the method comprises isolating the population of immune cells from a subject. In some embodiments, the method comprises administering a therapeutically effective amount of the population of immune cells to a subject in need thereof. In some embodiments, the subject is suffering from a cancer. Exemplary cancers include, without limitation, carcinomas, sarcomas, lymphomas, leukemias, germ cell tumors, and blastomas. In some embodiments, the cancer is a breast cancer, a gastrointestinal (GI) cancer, an endocrine cancer, a neuroendocrine cancer, an eye cancer, a genitourinary cancer, a germ cell cancer, a gynecologic cancer, a head and neck cancer, a hematologic cancer, a musculoskeletal cancer, a neurologic cancer, a respiratory / thoracic cancer, a skin cancer, and / or an unknown primary cancer. In some embodiments, the cancer is a breast cancer. In some embodiments, the cancer is a gastrointestinal (GI) cancer, e.g., an anal cancer, an appendix cancer, a bile duct cancer, a colon cancer, a colorectal cancer, an esophageal cancer, a gallbladder cancer, a gastric cancer, a gastrointestinal stromal tumor (GIST), an islet cell tumor, a pancreatic neuroendocrine tumor, a liver cancer, a gastrointestinal neuroendocrine tumor, a pancreatic cancer, a rectal cancer, a small intestine cancer, and / or a stomach cancer. In some embodiments, the cancer is an endocrine cancer and / or a neuroendocrine cancer, e.g., an adrenocortical carcinoma, an islet cell tumor, a pancreatic neuroendocrine tumor, a neuroendocrine 80 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) carcinoma of the skin (Merkel cell carcinoma), a gastrointestinal neuroendocrine tumor, a parathyroid cancer, a paraganglioma, a pheochromocytoma, a pituitary tumor, and / or a thyroid cancer. In some embodiments, the cancer is an eye cancer, e.g., an intraocular melanoma and / or a retinoblastoma. In some embodiments, the cancer is a genitourinary cancer, e.g., a bladder cancer, a kidney (renal cell) cancer, a penile cancer, a prostate cancer, a transitional cell renal pelvis and ureter cancer, a testicular cancer, a urethral cancer, and / or a Wilms tumor. In some embodiments, the cancer is a germ cell cancer, e.g., an extracranial germ cell tumor, an extragonadal germ cell tumor, an ovarian germ cell tumor, and / or a testicular cancer. In some embodiments, the cancer is a gynecologic cancer, e.g., a cervical cancer, an endometrial cancer, a fallopian tube cancer, a gestational trophoblastic tumor, an ovarian epithelial cancer, an ovarian germ cell tumor, an ovarian low malignant potential tumor, a primary peritoneal cancer, a uterine sarcoma, a vaginal cancer, and / or a vulvar cancer. In some embodiments, the cancer is a head and neck cancer, e.g., a hypopharyngeal cancer, a laryngeal cancer, a lip and oral cavity cancer, a metastatic squamous neck cancer with occult primary, a mouth cancer, a nasopharyngeal cancer, an oropharyngeal cancer, a paranasal sinus and nasal cavity cancer, a parathyroid cancer, a pharyngeal cancer, a salivary gland cancer, a throat cancer, and / or a thyroid cancer. In some embodiments, the cancer is a hematologic cancer, e.g., a leukemia, a lymphoma, a chronic myeloproliferative neoplasm, a Langerhans cell histiocytosis, a multiple myeloma / plasma cell neoplasm, a myelodysplastic syndrome, and / or a myelodysplastic / myeloproliferative neoplasm. In some embodiments, the leukemia is an acute lymphoblastic leukemia (ALL), an acute myeloid leukemia (AML), a chronic lymphocytic leukemia (CLL), a chronic myelogenous leukemia (CML), and / or a hairy cell leukemia (HCL). In some embodiments, the lymphoma is an AIDS-related lymphoma, a cutaneous T-cell lymphoma, a Hodgkin lymphoma, a non-Hodgkin lymphoma, a primary central nervous system lymphoma, and / or a Waldenström macroglobulinemia. In some embodiments, the cancer is a musculoskeletal cancer, e.g., a bone cancer, a rhabdomyosarcoma, and / or a soft tissue sarcoma. In some embodiments, the bone cancer is an Ewing sarcoma, an osteosarcoma and undifferentiated pleomorphic sarcoma (UPS), and / or a chordoma. In some embodiments, the cancer is a neurologic cancer, e.g., a brain tumor, a neuroblastoma, a pituitary tumor, and / or a primary central nervous system (CNS) lymphoma. In some embodiments, the brain tumor is an astrocytoma, a brain and spinal cord tumor, a brain stem glioma, a central nervous system atypical teratoid / rhabdoid tumor, a medulloblastoma, a central nervous system embryonal tumor, a central nervous system germ cell tumor, a craniopharyngioma, and / or an ependymoma. 81 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) In some embodiments, the cancer is a respiratory / thoracic cancer, e.g., a non-small cell lung cancer (NSCLC), a small cell lung cancer (SCLC), a pleuropulmonary blastoma, a tracheobronchial tumor, a malignant mesothelioma, and / or a thymoma and thymic carcinoma. In some embodiments, the cancer is a skin cancer, e.g., a cutaneous t-cell lymphoma, a Kaposi Sarcoma, a melanoma, and / or a Merkel cell carcinoma. In some embodiments, the cancer is an unknown primary cancer, e.g., a carcinoma of unknown primary. The disclosure is further illustrated in the following non-limiting examples. EXAMPLES Example 1. Matrix Viscoelasticity Regulates T Cell Phenotype The efficacy of adoptive T cell therapy is highly dependent on the generation of T cell populations that are able to both provide immediate effector function and long-term protective immunity. To evaluate whether T cell phenotype and function may be linked to their tissue localization, this disclosure presents an approach to generate functionally distinct T cell populations via the physical properties of their surrounding matrix. A collagen type I based extracellular matrix (ECM) was engineered to allow for independent tuning of matrix stiffness and viscoelasticity, two features that characterize the mechanical properties of tissues. As described herein, the mechanical properties of the ECM, particularly ECM viscoelasticity, regulated T cell phenotype and function, and the AP-1 pathway, which is a critical regulator of T cell fate. These observations were found to be consistent with the profiles of T cells isolated from mechanically distinct tissues in cancer and fibrosis patients. The engineered ECM was then utilized to generate functionally distinct T cell populations from cells that received the same initial stimulation. Altogether these findings demonstrate the direct role of tissue viscoelasticity in directing T cell function and provide a strategy for generating functionally distinct T cell populations. Introduction T cells play a critical role in the immune response to tumors and are characterized by their antigen specificity, and their long-term memory potential that establishes protective immunity (Reddy, S. T. Nature.547:36–38, 2017; Chaplin, D. D. J Allergy Clin Immunol.125:S3-23, 2010; Adu-Berchie, K. et al. Acc. Chem. Res.53:1749–1760, 2020). Adoptive T cell therapy is an emerging area of immunotherapy where T cells are harvested from a patient, manipulated ex vivo and reinfused into the patient (Met, Ö. et al. Semin Immunopathol.41:49–58, 2019). These T cells can either be tumor infiltrating lymphocytes (TILs), which are isolated from tumors, or more commonly autologous polyclonal T cells isolated from apheresed PBMCs (June, C. H. et al. Science Translational Medicine. 7:280ps7-280ps7, 2015). Autologous T cells can be genetically modified into TCR T cells or 82 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) Chimeric Antigen Receptor (CAR) T cells based on whether the antigen being recognized is in the presence or absence of MHC respectively (June, C. H. et al. Science Translational Medicine. 7:280ps7-280ps7, 2015). While T cell therapy has shown remarkable promise, especially in hematological cancers, the efficacy of T cell therapies can be enhanced by generating T cell populations that provide both immediate and durable long-term protection against cancer (June, C. H. et al. Science Translational Medicine.7:280ps7-280ps7, 2015; Pampusch, M. S. et al. Mol Ther Methods Clin Dev.16:1–10, 2020; Kalos, M. et al. Sci Transl Med.3:95ra73, 2011; Redeker, A. et al. Front. Immunol.7:345, 2016). The generation of CAR T cells and genetically modified TCR T cells involve ex vivo stimulation of isolated T cells prior to genetic manipulation (Redeker, A. et al. Front. Immunol.7:345, 2016; Levine, B. L. et al. Mol Ther Methods Clin Dev.4:92-101, 2017). Approaches to T cell stimulation have evolved from the labor-intensive use of purified autologous antigen presenting cells (APCs) (Adu-Berchie, K. et al. Acc. Chem. Res.53:1749–1760, 2020; Hunder, N. N. et al. N Engl J Med.358(25):2698-2703, 2008) to more efficient artificial APCs presenting aCD3 / aCD28 monoclonal antibodies, supplemented with growth factors such as IL-2 for T cell expansion (Levine, B. L. et al. Mol Ther Methods Clin Dev.4:92-101, 2017; Cheung, A. S. et al. Nat Biotechnol.36:160– 169, 2018). Activated T cells are incubated with either viral vectors or non-viral transposon systems for stable CAR or TCR expression (McGarrity, G. J. et al. J Gene Med.15:78-82, 2013; Huls, M. H. et al. J Vis Exp.72:e50070, 2013), or mRNA for more transient expression (Beatty, G. L. et al. Cancer Immunol Res.2:112–120, 2014). Most approaches aiming to generate various T cell populations in vitro are limited to altering the strength and duration of T cell stimulation (Redeker, A. et al. Front. Immunol.7:345, 2016; Gett, A. V., Sallusto, F. et al. Nat Immunol.4:355–360, 2003). Approaches that can further tune T cell phenotype for a given stimulation regimen could broaden the repertoire of T cells available for therapy. Prior studies suggest that T cell phenotype is inherently linked to their location, and this is likely linked to the distinct properties of various anatomic locations (Masopust, D. et al. J Immunol. 176:2079–2083, 2006; Schenkel, J. M. et al. Immunity 41:886–897, 2014; Szabo, P. A. et al. Nature Comm.10:1–16, 2019). In tissues, T cells encounter mechanical resistances in the form of stiffness and viscoelasticity as they engage extracellular matrices (ECM) like collagens, which are altered in pathologies like cancer and fibrosis. Stiffness describes a material’s resistance to instantaneous deformation, whereas viscoelasticity is a distinct feature from stiffness that refers to a material’s time- dependent mechanical response to applied stresses and strains (Wells, R. G. Biochim Biophys Acta. 1832: 884–890, 2013; Chaudhuri, O. Nature.584:535–546, 2020). The stress needed to maintain a particular deformation decreases more rapidly with time for minimally crosslinked, fast relaxing ECM (more viscous) than for more highly crosslinked, slow relaxing ECM (more elastic). Both tissue stiffness and viscoelasticity have been shown to independently influence the behavior of cells, including their proliferation, mobility and differentiation (Chaudhuri, O. Nature.584:535–546, 2020). 83 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) Here, it is hypothesized that functionally distinct T cell populations can be generated by selectively tuning the mechanical properties of matrices in which cells are embedded, mimicking distinct mechanical properties of the tissue microenvironment. To address this hypothesis, a collagen type 1 based ECM model was first engineered to allow for independent tuning of matrix stiffness and viscoelasticity. Collagen type 1 was utilized because it is a major ECM constituent in multiple tissues, forming the fibrillar structures that provide mechanical tissue integrity, as well as adhesion ligands for cell adhesion and migration (Boraschi-Diaz, I. et al. Frontiers in Physics.5:12, 2017). To control for initial T cell activation, T cells received the same initial stimulation regimen before they were cultured in matrices with different viscoelasticity. In vivo, T cells are primed when antigen presenting cells sample, process, and present antigen to T cells on their major histocompatibility complex (MHC) proteins. However, the phenotype of these antigen presenting cells themselves could be influenced by their mechanical environment, complicating one’s ability to determine how matrix mechanical properties regulate T cell activation. Consequently, we used synthetic CD3 / CD28 dynabeads, which is the industry standard for CAR-T cell activation and expansion for clinical use, and which can be easily separated from T cells via the use of magnets before the cells are seeded in collagen matrices. T cell phenotype, in vitro cytotoxic function and cytokine secretion profiles, as well as in vivo function were analyzed, as was the AP-1 pathway, which has been shown to be a critical regulator of T cell activation, differentiation and exhaustion. The profiles of T cells cultured in the distinct mechanical environments was further compared to T cells derived from mechanically distinct tissues in cancer and fibrosis patients. Together, these studies further our understanding of the role of tissue mechanical properties in directing T cell function and provide a tool for generating functionally distinct populations of T cells. Results T cell phenotype varies in mechanically distinct tissues in vivo First, to confirm that aspects of the tissue microenvironment may regulate T cell phenotype in vivo, published scRNA-seq datasets were analyzed to compare CD8+ T cells located in tumors, adjacent normal tissues, and blood for patients with non-small cell lung cancer (NSCLC) (Guo, X. et al. Nat Med.24:978–985, 2018), liver cancer (Zheng, C. et al. Cell.169:1342-1356.e16, 2017), and colorectal cancer (Zhang, L. et al. Nature.564:268–272, 2018), representing diverse mechanical environments. These analyses were performed for both pan T cells and T cells with shared T cell receptor (TCR) clonotypes between the tissue types. The three tissue types were selected because they span the spectrum between very soft, fast-relaxing (blood: a viscous fluid) (Secomb, T. W. et al. C R Phys.14:470–478, 2013) and stiff, slow-relaxing (tumor) (Liu, C., et al. Onco Targets Ther.13:2747– 2755, 2020; Huang, J. et al. Sig Transduct Target Ther.6:1–24, 2021) tissues. Umap plots of pan T cells showed distinct localization of T cells from the different tissue compartments, with increased overlap between T cells from tumors and those from their corresponding normal tissues compared to 84 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) blood (FIG.1A). Tumor T cell gene signatures were generated for each tumor type by performing differential gene expression analysis between tumor derived T cells and T cells in normal tissue and blood (Table 2). These signatures were then applied to T cells from the different tissue compartments to compare their aggregate expression levels. T cells from the blood had the lowest expression of tumor T cell gene signatures, with T cells in adjacent normal tissue being intermediate (FIG.1B). This trend was maintained when the same analysis was performed for T cells with shared TCR clonotypes (FIG.1C). These results suggest that the tissue microenvironment may be playing a role in modulating T cell phenotype. To better correlate the observed transcriptomic differences between T cells isolated from the different tissues with their microenvironment, and to further inform the choice of extracellular matrix (ECM) protein for subsequent studies, bulk sequencing from The Cancer Genome Atlas (TCGA) dataset was analyzed to compare the relative expressions of canonical matrix proteins that are known to influence tissue mechanical properties. In particular, collagen type I (COL1A1) and lysyl oxidase (LOX), which is known to crosslink collagen fibers in vivo, were found to be differentially expressed in tumors relative to normal tissues for each tumor type (FIG.1D). Synthesizing collagen-based ECM mimetic with tunable mechanical properties Next a collagen type I based ECM model was engineered to allow for independent tuning of matrix stiffness and viscoelasticity for T cell culture. Collagen type I was first modified with norbornene (Nb), which undergoes a highly selective bioorthogonal click reaction with tetrazine (Tz) moieties via inverse electron demand Diels-Alder (L. Oliveira, B. et al. Chemical Society Reviews. 46:4895–4950, 2017). Matrix stiffness was tuned by varying the collagen concentration, while the addition of local covalent crosslinking to the Nb-modified collagen post gelation with low molecular weight Tz crosslinkers regulated matrix viscoelastic properties without changing the stiffness (FIG. 2A, FIG.3A). Two collagen concentrations were utilized, as these yielded matrices which spanned the stiffness range of multiple soft tissues (Vining, K. H. et al. Nat Rev Mol Cell Biol.18:728–742g, 2017) (FIG. 2B), as well as pre-malignant and malignant tumors (Butcher, D. T. et al. Nat Rev Cancer.9:108–122, 2009; Levental, K. R. et al. Cell.139:891–906, 2009; Kass, L.et al. Int Journal Biochem Cell Bio.39:1987–1994, 2007; Cox, T. R. et al. Dis Model Mech.4:165–178, 2011; Staunton, J. R. et al. Cell Mol Bioeng.9:398–417, 2016). Mechanical characterization of the matrices showed that while click crosslinking influenced matrix viscoelastic properties, as reflected in stress relaxation and loss angle of the matrices, it did not affect bulk stiffness values (FIGs. 3B-3C, FIG. 2C). Further characterization by cryo-scanning electron microscopy (Cryo-SEM) and second harmonic generation imaging (SHG) showed that click crosslinking did not alter the fibrillar architecture or pore-size distribution of collagen matrices (FIGs.3D-3E, FIG.2D), and did not affect collagen fiber length, waviness or angle between the fibers (FIGs.2E-2G). Importantly, analysis of local mechanical properties with nanoindentation confirmed similar storage moduli (G’) for each 85 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) collagen concentration but significantly different loss moduli (G”) between fast and slow relaxing matrices (FIGs.2H-2I). CD8+ T cells were subsequently isolated from healthy donors, activated, and subsequently cultured in fast relaxing (non-click crosslinked) or slow relaxing (click crosslinked), soft (2 mg / ml) or stiff (4 mg / ml) collagen matrices. After 3 days in the various matrices, the T cells showed notable phenotypic differences, driven more by changes in collagen viscoelasticity than by stiffness (FIGs. 3F-3H). In particular, flow cytometry analysis of CD8+ T cells showed higher expression of activation and inhibitory markers in slow relaxing matrices, while T cells in fast relaxing matrices exhibited higher memory marker expression, such as CD62L and CD45RA (FIG.3F). These observations were consistent with multiple donors and across multiple independent experiments (FIG. 4) Collagen modification and crosslinker have minimal effects on T cell adhesion and phenotype Potential effects of collagen modification and the presence of methyltetrazine crosslinkers on T cell adhesion and phenotype were next investigated. T cells that were seeded on top of unmodified and Nb-modified collagen with and without methyltetrazine crosslinkers adhered similarly to their respective collagen matrices (FIG.5A). In addition, T cells remained highly viable in all matrix conditions (FIG. 5B) and had similar phenotypic profiles when they were embedded in unmodified collagen (Col) or in Nb-modified collagen (Col-Nb) (FIGs.5C-5E). The presence of methyltetrazine crosslinkers had minimal effect on T cells cultured in unmodified collagen matrices (Col (+Linkers)), but had significant effects on T cells cultured in modified collagen (Col-Nb (+Linkers)), as expected due to changes in matrix viscoelasticity from the resultant crosslinking in the latter (FIGs.5C-5E). Importantly, PCA analyses confirmed our observations, with Col-Nb (+Linkers) being most different along PC1 (FIG.5F). ECM viscoelasticity modulates T cell phenotype in complex ECM Even though collagen type I forms a significant fraction of many tissue ECMs, the effects of viscoelasticity within the context of a more complex ECM formulation was next studied. These studies were performed with an interpenetrating network (IPN) of Matrigel and collagen type I to mimic the complexity of tissue ECM. The viscoelasticity of the collagen-Matrigel IPN was again tuned by selectively and locally crosslinking collagen-Nb within the network with low molecular weight methyltetrazine crosslinkers. Bulk rheological characterization of the IPNs showed significant effects of click crosslinking on stress relaxation halftime and loss angle (FIG.6A). Importantly, similar to the observations made for the collagen-only matrices, alterations in viscoelastic properties led to significant changes in T cell phenotype (FIGs.6B-6E). 86 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) Extracellular matrix viscoelasticity modulates T cell transcriptomic profile To investigate how ECM viscoelasticity drives changes in the transcriptional landscape of T cells, scRNA-seq of CD8+ T cells cultured in fast relaxing and slow relaxing collagen matrices was next performed. Umap analysis showed distinct localization of the two T cell populations (FIG.7A). Global differential expression identified upregulation of several conventional activation and inhibitory T cell markers, including IL2RA (CD25), ENTPD1 (CD39) (FIG. 7B), as well as FAS, TNFRSF4 (OX40) and LAG3 (TABLE 3) in slow-relaxing matrices compared to fast-relaxing matrices. In addition, transcription factors that have been implicated in T cell effector phenotype such as PRDM1 (BLIMP-1) and ZEB2 were also more highly expressed for T cells cultured in slow relaxing matrices. Of note, several genes related to the AP-1 pathway, including JUN, ATF3, BATF (FIG. 7B) and FOS and FOSB, in addition to some mitogen-activated protein kinases such as MAPK8, MAPK6 and MAPK1 (TABLE 3) were enriched in T cells cultured in slow relaxing matrices. In contrast, T cells in fast relaxing matrices expressed higher levels of T cell memory markers and memory related transcription factors such as CD62L, KLF2, CXCR3 and S1PR4 (FIG. 7B, TABLE 4). We next performed consensus non-negative matrix factorization (cNMF) (Kotliar, D. et al. eLife.8:e43803, 2019) to group genes into expression programs in an unsupervised manner, and investigate programs enriched for T cells in the different microenvironments. cNMF identified 15 gene expression programs, 4 of which were significantly enriched in T cells cultured in slow relaxing matrices and 2 in fast relaxing matrices (FIGs.7C-7D). Module 5 was the most notably enriched module in slow relaxing matrices and included AP-1 pathway-related genes such as JUN, ATF3, FOS, FOSB and JUNB (FIG.7D, TABLE 5). Unique genes from the 4 programs enriched in slow relaxing matrices were combined into the Slow-Relaxing Module (SModule), and the 2 programs associated with fast relaxing matrices were grouped into the Fast-Relaxing Module (FModule). Umap overlay of aggregate expression levels of the SModule and FModule showed distinct localizations that mapped to regions of high T cell density in slow relaxing and fast relaxing matrices respectively (FIG.7E). When the expression profiles of FModule and SModule were compared between plate-cultured T cells (i.e., 2D suspension culture with no collagen matrix), and T cells embedded in fast relaxing or slow relaxing collagen matrices, T cells in the slow relaxing collagen matrices were the most different, having the lowest expression of FModule and highest expression of SModule (FIG. 7F). Pathway enrichment analysis showed that the SModule was enriched for pathways related to TCR signaling, CD8+ T cell activation, and T cell cytotoxicity, indicating a more activated T cell state, while the FModule was enriched for genes related to leukocyte adhesion to endothelial cells (FIG.7G). Next, we applied the gene modules to a series of independently published RNA-seq datasets from both in vitro and in vivo studies to correlate our observed T cell states to independent studies involving T cell activation and tissue localization respectively. In a bulk RNA-seq dataset from activated and non-activated T cells in vitro (Bediaga, N. G. et al. Sci Rep.11:528, 2021), the SModule was significantly enriched in activated T cells while the FModule was enriched in the non- 87 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) activated condition (FIG. 7H). The SModule was then applied to CD8+ T cells in tumors, adjacent normal tissue, and blood from the scRNA-seq datasets for NSCLC, liver cancer, colorectal cancer analyzed in FIGs.1A-1C, for both pan CD8+ T cells (FIG. 8) or T cells with shared TCR clonotypes (FIG.7I), in addition to a breast cancer dataset for pan CD8+ T cells (FIG.8) (Azizi, E. et al. Cell. 174:1293-1308.e36, 2018). The trends for SModule expression were consistent with those in FIGs. 1A-1C, with T cells in tumors having the highest expression levels among the three tissue types, T cells in blood having the lowest, and T cells in normal tissue having intermediate expression levels. AP-1 Pathway is enhanced in T cells cultured in slow relaxing ECM in vitro, and in tumors and fibrotic tissues in vivo Due to the observation that multiple AP-1 related genes were enriched in T cells from slow relaxing matrices, we performed AP-1 gene enrichment analysis on the cNMF modules. We saw significant enrichment of the AP-1 pathway in cNMF Module 5 (FIG. 9A), which was the most notable module in slow relaxing matrices. Consequently, we hypothesized that ECM viscoelasticity modulates the AP-1 pathway, which in turn drives the observed T cell phenotypic profiles. To test the relevance of this hypothesis in vivo, we investigated the expression levels of cNMF Module 5 (AP-1 Module) in T cells derived from tumors, adjacent normal tissue, and blood from scRNA-seq datasets for NSCLC, liver cancer, colorectal cancer for T cells with shared TCR clonotypes (FIG. 9B). We observed the highest expression levels in tumors, while T cells in blood had the lowest expression levels of the AP-1 Module. T cells in adjacent normal tissues had AP-1 expression levels that were again intermediate. To examine whether the observations of AP-1 enrichment in T cells are specific to cancer, or more broadly to conditions with altered matrix mechanics, a similar analysis was performed in the context of fibrosis. Fibrosis is generally accompanied by increased ECM deposition and crosslinking (Weiskirchen, R. et al. Mol Asp Med.65:2–15, 2019), resulting in changes in matrix stiffness and viscoelasticity. We investigated the AP-1 pathway in T cells located in fibrotic tissues by first generating cNMF modules from CD8+ T cell data derived from a published liver cirrhosis scRNA-seq dataset (Dobie, R. et al. Cell Reports 29, 1832-1847.e8, 2019) and two IPF datasets (Arun C. Habermann et al. Sci. Adv.6:eaba1972, 2020; DePianto, D. J. et al. JCI Insight.6(8):e143626, 2021), which compared fibrotic tissues to adjacent normal tissues. These cNMF modules were generated from the published datasets themselves and were independent of the modules generated in this study in vitro. We then performed AP-1 gene enrichment analyses and saw AP-1 enriched modules in all the fibrosis datasets investigated (FIG.9C-D). Importantly, the expression levels of the AP-1 modules were significantly higher in fibrotic tissues than in normal tissues. This trend was maintained when we investigated the expression levels of the in vitro generated AP-1 module in the fibrotic tissues (FIG.9E). 88 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) The phosphorylation states of a number of transcription factors and kinases related to the AP- 1 pathway were next examined to further probe AP-1 transcriptional regulation after T cells are cultured in collagen matrices of varying stiffness and viscoelasticity (FIG.10A). For all transcription factors investigated, there was increased phosphorylation in T cells cultured in slow relaxing matrices for both CD4+ and CD8+ T cells. Principal component analysis (PCA) revealed that ECM viscoelasticity was the main driver of the differential phosphorylation states (FIG.10B). In addition to c-Jun and p-c-Jun, PCA loadings identified features such as pPyk2, pPlcg1, pPlcg2, pMAPK8, pMAPK14 and pCD3z as important factors underlying the observed PCA trend (FIG.10C). Matrix viscoelasticity impacts pattern of AP-1 protein expression We next examined the patterns of AP-1 protein expression and their interactions, specifically with c-Jun, due to their importance in the regulation of T cell phenotype and function (Lynn, R. C. et al. Nature 576:293–300, 2019). In particular, c-Jun and c-Fos are canonical AP-1 partners that have been shown to enhance IL2 production (Lynn, R. C. et al. Nature 576:293–300, 2019). BATF promotes effector T cell differentiation but also drives exhaustion (Kurachi, M. et al. Nat Immunol. 15:373–383, 2014; Quigley, M. et al. Nat Med.16:1147–1151, 2010; Seo, H. et al. Nat Immunol. 22:983–995, 2021). JunB has been shown to enhance Th17 differentiation and IL2 production, but also promotes T cell exhaustion and effector Treg differentiation (Koizumi, S. et al. Nat Commun. 9:5344, 2018; Schütte, J. et al. Cell.59(6): 987-997, 1989; Chiu, R. et al. Cell 59:979–986, 989; Atsaves, V. et al. Cancers (Basel) 11:1037, 2019). Flow cytometry analyses after culturing T cells in fast and slow relaxing matrices showed that T cells cultured in slow relaxing matrices had enhanced expression of c-Jun, c-Fos, and BATF (FIGs.11A-11B). Additionally, T cells from slow relaxing matrices exhibited higher interaction of c-Fos, JunB and BATF with c-Jun, as analyzed by c-Jun co- immunoprecipitation of cell lysates to assess AP-1 binding partners (FIG.11C). The ability of c-Jun to mediate effects of viscoelasticity on T cell phenotype was directly tested by blocking c-Jun function with the SP600125 Jun N-terminal kinase inhibitor (Bennett, B. L. et al. Proc Nat Acad Sci.98:13681–13686, 2001). Umap and K-means analyses of T cell phenotypes showed that SP600125 abrogated the effects of matrix viscoelasticity (FIG.11D) and led to increased expression of memory markers in all conditions (FIG.11E). PCA analysis confirmed these results. The slow relaxing matrix without SP600125, and all conditions with SP600125 were located at the two extremes of PC1, while plate culture and fast relaxing matrix conditions without SP600125 were intermediate (FIG.11F). Together, these findings demonstrate that the patterns of AP-1 protein expression and their interactions with c-Jun can be modulated by ECM viscoelasticity. ECM viscoelasticity does not select for specific T cell clones To assess whether the observed phenotypic differences imparted by matrix viscoelasticity are due to the selection and persistence of specific T cell clones, we performed single cell RNA- 89 ME148011808v.1 Attorney Docket No.: 117823-35320 (HU 9279) sequencing with TCR sequencing using T cells from a different donor. Umap analysis on pan T cells from the different conditions showed distinct localization of T cells from plate-culture, fast relaxing and slow relaxing matrix conditions (FIG.12A). The Slow-Relaxing Module (SModule), generated from the previous scRNA-seq in FIG.7, was applied to pan T cells from this dataset to investigate consistency across different donors. The trends for SModule expression were consistent with those in FIG.7, with T cells cultured in slow relaxing matrices having the highest expression of SModule (FIG.12B). To explore the potential of ECM viscoelasticity in skewing the TCR, the profile of T cell \OMOZ^Y\ r #GEr$& K MYWZYXOX^ YP ^RO G8E RO^O\YNSWO\& aK] SX`O]^SQK^ON( FSWSVK\ P\O[_OXMc NS]^\SL_^SYX] aO\O YL]O\`ON PY\ ^RO NSPPO\OX^ GErI QOXO] K] K P_XM^SYX YP :8A MYXNS^SYX #FIG. 13A). >X KNNS^SYX& K IOXX NSKQ\KW YP ^RO GErI QOXO] ]RYaON ^RK^ 30" YP ^RO QOXO] aO\O...

Claims

Attorney Docket No.117823-35320 HU 9279 CLAIMS What is claimed is:

1. An extracellular matrix (ECM) mimetic, comprising a collagen hydrogel, wherein the collagen hydrogel comprises non-covalent crosslinking.

2. The ECM mimetic of claim 1, wherein the hydrogel is a fast relaxing hydrogel characterized by being substantially free of covalent crosslinking, optionally wherein the fast relaxing hydrogel comprises a level of covalent crosslinking of no more than about 5% covalent crosslinking, optionally wherein the fast relaxing hydrogel comprises a level of covalent crosslinking of no more than about 1%, no more than about 2%, no more than about 3%, no more than about 4%, or no more than about 5% covalent crosslinking, optionally wherein the fast relaxing hydrogel comprises a level of covalent crosslinking of about 1%, about 2%, about 3%, about 4%, or about 5% covalent crosslinking.

3. The ECM mimetic of claim 1, wherein the hydrogel comprises covalent crosslinking, optionally wherein the covalent crosslinking is between a modified collagen comprising a first click reagent and a bioorthogonal crosslinker comprising a second click reagent.

4. The ECM mimetic of claim 3, wherein the hydrogel is a slow relaxing hydrogel characterized by comprises a level of covalent crosslinking of about 5% to about 100%, optionally wherein the level of covalent crosslinking is about 25% to about 50%, optionally wherein the level of covalent crosslinking is about 25% to about 75%, optionally wherein the level of covalent crosslinking is about 50% to about 75%, optionally wherein the level of covalent crosslinking is about 75% to about 100%, optionally wherein the level of covalent crosslinking is about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%.

5. The ECM mimetic of any one of claims 1-4, wherein: (i) the level of non-covalent crosslinking allows for tuning of matrix stiffness; and / or (ii) the level of covalent crosslinking allows for tuning of matrix viscoelasticity, optionally wherein the hydrogel is configured to allow for independent tuning of matrix stiffness and matrix viscoelasticity. 185 ME148011808v.1Attorney Docket No.117823-35320 HU 9279 6. The ECM mimetic of any one of claims 1-5, wherein the collagen is a modified collagen comprising a first click reagent, optionally wherein the collagen is present in an amount of about 1 mg / mL to about 10 mg / mL, optionally wherein the collagen is present in an amount of about 1 mg / mL to about 2.5 mg / mL, optionally wherein the collagen is present in an amount of about 3 mg / mL to about 5 mg / mL.

7. The ECM mimetic of any one of claims 3-6, wherein the hydrogel further comprises a bioorthogonal crosslinker comprising a second click reagent, optionally wherein the bioorthogonal crosslinker comprises a first end and a second end, wherein each end comprises a second click reagent, optionally wherein the bioorthogonal crosslinker is a methyltetrazine-(PEG)5-methyltetrazine crosslinker, optionally wherein the bioorthogonal crosslinker is present in an amount of about 1 µM to about 500 µM, optionally wherein the bioorthogonal crosslinker is present in an amount of about 1 µM, about 5 µM, about 10 µM, about 15 µM, about 20 µM, about 25 µM, about 30 µM, about 35 µM, about 40 µM, about 45 µM, about 50 µM, about 55 µM, about 60 µM, about 65 µM, about 70 µM, about 75 µM, about 80 µM, about 85 µM, about 90 µM, about 95 µM, about 100 µM, about 105 µM, about 110 µM, about 115 µM, about 120 µM, about 125 µM, about 130 µM, about 135 µM, about 140 µM, about 145 µM, about 150 µM, about 155 µM, about 160 µM, about 165 µM, about 170 µM, about 175 µM, about 180 µM, about 185 µM, about 190 µM, about 195 µM, about 200 µM, about 205 µM, about 210 µM, about 215 µM, about 220 µM, about 225 µM, about 230 µM, about 235 µM, about 240 µM, about 245 µM, about 250 µM, about 255 µM, about 260 µM, about 265 µM, about 270 µM, about 275 µM, about 280 µM, about 285 µM, about 290 µM, about 295 µM, about 300 µM, about 305 µM, about 310 µM, about 315 µM, about 320 µM, about 325 µM, about 330 µM, about 335 µM, about 340 µM, about 345 µM, about 350 µM, about 355 µM, about 360 µM, about 365 µM, about 370 µM, about 375 µM, about 380 µM, about 385 µM, about 390 µM, about 395 µM, about 400 µM, about 405 µM, about 410 µM, about 415 µM, about 420 µM, about 425 µM, about 430 µM, about 435 µM, about 440 µM, about 445 µM, about 450 µM, about 455 µM, about 460 µM, about 465 µM, about 470 µM, about 475 µM, about 480 µM, about 485 µM, about 490 µM, about 495 µM, or about 500 µM, optionally wherein the bioorthogonal crosslinker is present at a ratio of about 1:1 and about 1:100 crosslinker : collagen. 186 ME148011808v.1Attorney Docket No.117823-35320 HU 9279 8. The ECM mimetic of claim 6 or 7, wherein the first click reagent and the second click reagent are covalently crosslinked, optionally wherein: (i) the first click reagent and the second click reagent are independently selected from the group consisting of an azide moiety, an alkyne moiety, a dibenzocyclooctyne moiety, a tetrazine (Tz) moiety, a trans-cyclooctene moiety, a vinyl moiety, a methylcyclopropene moiety, a norbornene (Nb) moiety, and combinations thereof; (ii) the first click reagent and the second click reagent are covalently crosslink via a click chemistry reaction selected from the group consisting of a Cu(I)-catalyzed azide – alkyne click chemistry reaction (CuAAC), a strain-promoted azide – alkyne click chemistry reaction (SPAAC), a tetrazine – trans-cyclooctene (TCO) ligation, and combinations thereof; and / or (iii) the first click reagent and the second click reagent are covalently crosslink via an inverse electron demand Diels-Alder (iEDDA) click reaction between tetrazine (Tz) and norbornene (NB) moieties.

9. The ECM mimetic of claim 8, wherein the first click reagent comprises a norbornene (Nb) moiety and the second click reagent comprises a tetrazine (Tz) moiety.

10. The ECM mimetic of any one of claims 1-9, wherein the hydrogel comprises at least one additional polymer, optionally wherein the additional polymer is selected from the group consisting of a natural polymer, a synthetic polymer, and combinations thereof, optionally wherein the additional polymer comprises an ECM component, optionally wherein the additional polymer comprises Matrigel®, optionally wherein the additional polymer is present in an amount of about 1 mg / mL to about 10 mg / mL, optionally wherein the additional polymer is present in an amount of about 1 mg / mL to about 2.5 mg / mL, optionally wherein the additional polymer is present in an amount of about 3 mg / mL to about 5 mg / mL.

11. The ECM mimetic of claim 10, wherein the hydrogel is an interpenetrating polymer network (IPN) hydrogel, optionally wherein the IPN hydrogel comprises interpenetrating networks of collagen and at least one additional polymer, optionally wherein the collagen is present in an amount of about 1 mg / mL to about 2.5 mg / mL, 187 ME148011808v.1Attorney Docket No.117823-35320 HU 9279 optionally wherein the additional polymer is present in an amount of about 3 mg / mL to about 5 mg / mL.

12. The ECM mimetic of any one of claims 1-11, wherein the hydrogel is a soft hydrogel characterized by collagen being present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 3 mg / mL or about 1 mg / mL to about 2.5 mg / mL, optionally wherein: (i) the hydrogel is a soft-fast relaxing hydrogel characterized by collagen being present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 3 mg / mL or about 1 mg / mL to about 2.5 mg / mL, and by being substantially free of covalent crosslinking; or (ii) the hydrogel is a soft-slow relaxing hydrogel characterized by collagen being present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 3 mg / mL or about 1 mg / mL to about 2.5 mg / mL, and by comprising a level of covalent crosslinking of at least about 10%.

13. The ECM mimetic of any one of claims 1-11, wherein the hydrogel is a stiff hydrogel characterized by collagen being present in an amount of at least about 3 mg / mL, optionally wherein: (i) the hydrogel is a stiff-fast relaxing hydrogel characterized by collagen being present in an amount of at least about 3 mg / mL and by being substantially free of covalent crosslinking; or (ii) the hydrogel is a stiff-slow relaxing hydrogel characterized by collagen being present in an amount of at least about 3 mg / mL and by comprising a level of covalent crosslinking of at least about 10%.

14. The ECM mimetic of any one of the preceding claims, wherein the hydrogel is characterized by (i) an initial elastic modulus of about 10 Pa to about 1,000 Pa; "66# / ;<:3;; :37 / ? / <698 : / <3 "B'%(# 94 / < 73 / ;< / 09=< ' ;31982$ e.g., about 1 second to about 20,000 seconds or more; (iii) a time value for relaxation to 60% of initially applied stress (60% time) of about 1 second to about 20,000 seconds; "6># / 79;; / 8573 "A$ 237< / # 94 / 09=< '@ <9 / 09=< (&@. (v) a storage modulus (G’) of about 1 kPa to about 5 kPa; (vi) a loss modulus (G”) of about 0.1 kPa to about 3 kPa; (vii) a fiber length of about 0.01 µm to about 20 µm; (viii) a fiber thickness of about 0.01 µm to about 0.1 µm (ix) a fiber angle of about 1° to about 100°; (x) a fiber waviness of about 0.05 µm to about 0.5 µm; (xi) a pore diameter of about 0.5 µm to about 10 µm; 188 ME148011808v.1Attorney Docket No.117823-35320 HU 9279 (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 1 mg / mL to about 10 mg / mL; (xiii) optionally an additional polymer, an additional modified polymer, or a combination thereof in an amount of about 1 mg / mL to about 10 mg / mL; (ixx) optionally a bioorthogonal crosslinker present in an amount of about 1 µM to about 500 µM; and / or (xx) optionally a level of covalent crosslinking of about 5% to about 100%.

15. The ECM mimetic of claim 14, wherein the hydrogel is a soft-fast relaxing hydrogel characterized by (i) an initial elastic modulus of about 150 Pa to about 200 Pa; "66# / ;<:3;; :37 / ? / <698 : / <3 "B'%(# 94 / 09=< + ;31982 <9 / 09=< '& ;31982;. (iii) a time value for relaxation to 60% of initially applied stress (60% time) of about 5 second to about 10 seconds; "6># / 79;; / 8573 "A$ 237< / # 94 / 09=< +@ <9 / 09=< '+@. (v) a storage modulus (G’) of about 2 kPa to about 3 kPa; (vi) a loss modulus (G”) of about 0.5 kPa to about 2 kPa; and / or (xii) a collagen, a modified collagen, or a combination thereof present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 3 mg / mL or about 1 mg / mL to about 2.5 mg / mL.

16. The ECM mimetic of claim 14, wherein the hydrogel is a soft-slow relaxing hydrogel characterized by (i) an initial elastic modulus of about 150 Pa to about 200 Pa; "66# / ;<:3;; :37 / ? / <698 : / <3 "B'%(# 94 / 09=< +$&&& ;31982 <9 / 09=< '+$&&& ;31982;. (iii) a time value for relaxation to 60% of initially applied stress (60% time) of about 5,000 second to about 15,000 seconds; "6># / 79;; / 8573 "A$ 237< / # 94 / 09=< '@ <9 / 09=< '&@. (v) a storage modulus (G’) of about 2 kPa to about 4 kPa; (vi) a loss modulus (G”) of about 0.5 kPa to about 1 kPa; and / or (xii) a collagen, a modified collagen, or a combination thereof present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 3 mg / mL or about 1 mg / mL to about 2.5 mg / mL. (ixx) a bioorthogonal crosslinker present in an amount of about 250 µM to about 350 µM; and / or (xx) a level of covalent crosslinking of about 25% to about 75%. 189 ME148011808v.1Attorney Docket No.117823-35320 HU 9279 17. The ECM mimetic of claim 14, wherein the hydrogel is a stiff-fast relaxing hydrogel characterized by (i) an initial elastic modulus of about 500 Pa to about 900 Pa; "66# / ;<:3;; :37 / ? / <698 : / <3 "B'%(# 94 / 09=< ( ;31982 <9 / 09=< - ;31982;. (iii) a time value for relaxation to 60% of initially applied stress (60% time) of about 2 second to about 8 seconds; "6># / 79;; / 8573 "A$ 237< / # 94 / 09=< +@ <9 / 09=< '+@. (v) a storage modulus (G’) of about 3.5 kPa to about 4.5 kPa; (vi) a loss modulus (G”) of about 0.7 kPa to about 1.1 kPa; and / or (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 3 mg / mL to about 5 mg / mL.

18. The ECM mimetic of claim 14, wherein the hydrogel is a stiff-slow relaxing hydrogel characterized by (i) an initial elastic modulus of about 500 Pa to about 900 Pa; "66# / ;<:3;; :37 / ? / <698 : / <3 "B'%(# 94 / 09=< +&& ;31982 <9 / 09=< '$+&& ;31982;. (iii) a time value for relaxation to 60% of initially applied stress (60% time) of about 500 second to about 1,500; "6># / 79;; / 8573 "A$ 237< / # 94 / 09=< +@ <9 / 09=< '&@. (v) a storage modulus (G’) of about 3.5 kPa to about 4.5 kPa; (vi) a loss modulus (G”) of about 0.5 kPa to about 0.9 kPa; (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 3 mg / mL to about 5 mg / mL. (ixx) a bioorthogonal crosslinker present in an amount of about 250 µM to about 350 µM; and / or (xx) a level of covalent crosslinking of about 25% to about 75%.

19. The ECM mimetic of claim 14, wherein the hydrogel is a fast relaxing interpenetrating polymer network (IPN) hydrogel characterized by "66# / ;<:3;; :37 / ? / <698 : / <3 "B'%(# 94 / 09=< '&& ;31982 <9 / 09=< (&& ;31982;. "6># / 79;; / 8573 "A$ 237< / # 94 / 09=< *@ <9 / 09=< ,@. (xii) a collagen, a modified collagen, or a combination thereof present in an amount of up to about 3 mg / mL, e.g., about 1 mg / mL to about 3 mg / mL or about 1 mg / mL to about 2.5 mg / mL; (xiii) an additional polymer, an additional modified polymer, or a combination thereof in an amount of about 3 mg / mL to about 5 mg / mL. 190 ME148011808v.1Attorney Docket No.117823-35320 HU 9279 20. The ECM mimetic of claim 14, wherein the hydrogel is a slow relaxing interpenetrating polymer network (IPN) hydrogel characterized by "66# / ;<:3;; :37 / ? / <698 : / <3 "B'%(# 94 / 09=< +&& ;31982 <9 / 09=< '$+&& ;31982;. "6># / 79;; / 8573 "A$ 237< / # 94 / 09=< )@ <9 / 09=< +@. (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 1 mg / mL to about 3 mg / mL; (xiii) an additional polymer, an additional modified polymer, or a combination thereof in an amount of about 3 mg / mL to about 5 mg / mL; (ixx) a bioorthogonal crosslinker present in an amount of about 250 µM to about 350 µM; and / or (xx) a level of covalent crosslinking of about 25% to about 75%.

21. The ECM mimetic of any one of the preceding claims, wherein the hydrogel is characterized by a consistent collagen network architecture and pore size distribution, optionally wherein the covalent crosslinking does not alter collagen network architecture, pore-size distribution, collagen fiber length, collagen fiber waviness, or angle between the fibers of the hydrogel.

22. The ECM mimetic of any one of the preceding claims, further comprising a mammalian cell, optionally wherein the mammalian cell is an immune cell, optionally wherein the immune cell comprises an autologous immune cell or an allogeneic immune cell, optionally wherein the immune cell comprises a phagocyte, a macrophage, a dendritic cell, a monocyte, a B cell, a T cell, a natural killer cell (NK) cell, and combinations thereof.

23. The ECM mimetic of claim 22, wherein the immune cell is a T cell, optionally wherein the T cell is an autologous T cell or an allogeneic T cell, optionally wherein the T cell is a pan T cell or a T cell with a shared TCR clonotype, optionally wherein the T cell is selected from the group consisting of a naïve T cell, a helper T cell, a cytotoxic T cell, a memory T cell, a regulatory T cell, an innate-like T cell, a natural killer T cell, a mucosal associated invariant T cell, a gamma delta T cell, and combinations thereof.

24. The ECM mimetic of claim 23, wherein the T cell is a genetically modified T cell, optionally wherein the genetically modified T cell is a T cell receptor (TCR) T cell or a chimeric antigen receptor (CAR) T cell.

25. The ECM mimetic of any one of the preceding claims, further comprising a highly contractile cell. 191 ME148011808v.1Attorney Docket No.117823-35320 HU 9279 26. The ECM mimetic of any one of the preceding claims, further comprising a spheroid.

27. The ECM mimetic of any one of the preceding claims, further comprising an extracellular matrix (ECM) component, optionally wherein the ECM component is selected from the group consisting of a fibrous protein, a glycosaminoglycan (GAG), a proteoglycan (PG), a glycoprotein, a growth factor, a cytokine, a cell adhesion molecule (CAM), and combinations thereof.

28. The ECM mimetic of any one of the preceding claims, further comprising a fibrous protein, optionally wherein the fibrous protein is selected from the group consisting of a collagen, an elastin, a keratin, a fibrin, a laminin, a fibronectin, and combinations thereof.

29. The ECM mimetic of any one of the preceding claims, wherein the collagen is selected from the group consisting of a type I collagen, a type II collagen, a type III collagen, a type IV collagen, a type V collagen, a type VI collagen, a type VII collagen, a type VIII collagen, a type IX collagen, a type X collagen, a type XI collagen, a type XII collagen, a type XIII collagen, a type XIV collagen, a type XV collagen, a type XVI collagen, a type XVII collagen, a type XVIII collagen, a type XIX collagen, a type XX collagen, a type XXI collagen, a type XXII collagen, a type XXIII collagen, a type XXIV collagen, a type XXV collagen, a type XXVI collagen, a type XXVII collagen, a type XXVIII collagen, a type XXIX collagen, and combinations thereof.

30. The ECM mimetic of any one of the preceding claims, wherein the collagen is selected from the group consisting of COL1A1, COL1A2, COL2A1, COL3A1, COL4A1, COL4A2, COL4A3, COL4A4, COL4A5, COL4A6, COL5A1, COL5A2, COL5A3, COL6A1, COL6A2, COL6A3, COL6A5, COL7A1, COL8A1, COL8A2, COL9A1, COL9A2, COL9A3, COL10A1, COL11A1, COL11A2, COL12A1, COL13A1, COL14A1, COL15A1, COL16A1, COL17A1, COL18A1, COL19A1, COL20A1, COL21A1, COL22A1, COL23A1, COL24A1, COL25A1, EMID2, COL27A1, COL28A1, COL29A1, and combinations thereof.

31. The ECM mimetic of any one of the preceding claims, wherein the collagen comprises a type I collagen, optionally wherein the type I collagen is COL1A1.

32. The ECM mimetic of any one of the preceding claims, further comprising an active agent.

33. A composition comprising the ECM mimetic of any one of claims 1-32. 192 ME148011808v.1Attorney Docket No.117823-35320 HU 9279 34. A pharmaceutical composition comprising the ECM mimetic of any one of claims 1-32 and a pharmaceutically acceptable carrier.

35. An in vitro method for generating a population of immune cells, comprising: contacting a population of immune cells with the ECM mimetic of any one of claims 1-32, thereby generating the population of immune cells, optionally wherein the generated population of immune cells is suitable for use in an adoptive cell therapy and / or is characterized by enhanced efficacy as compared to a population of immune cells generated using conventional plate-culture protocols.

36. A method for activating and / or expanding a population of immune cells, comprising: contacting a population of immune cells with the ECM mimetic of any one of claims 1-32, thereby activating and / or expanding the population of immune cells.

37. A method for modulating immune cell phenotype and / or immune cell function, comprising: contacting a population of immune cells with the ECM mimetic of any one of claims 1-32, thereby modulating immune cell phenotype and / or immune cell function.

38. A method for modulating immune cell differentiation, comprising: contacting a population of immune cells with the ECM mimetic of any one of claims 1-32, thereby modulating immune cell differentiation.

39. A method of preventing and / or treating cancer in a subject in need thereof, comprising: contacting a population of immune cells with the ECM mimetic of any one of claims 1-32; and administering a therapeutically effective amount of the population of immune cells to the subject, thereby preventing and / or treating cancer in the subject.

40. The method of any one of claims 35-39, further comprising contacting the population of immune cells with a T-cell activating molecule and / or a T-cell co-stimulatory molecule, optionally wherein the T-cell activating molecule and / or the T-cell co-stimulatory molecule comprises CD3 / CD28 or CD3 / CD28 / CD137 dynabeads, optionally activating the immune cells with a predefined strength of antigenic stimulation and / or a predefined duration of antigenic stimulation, optionally wherein the activating is prior to, concurrently with, and / or subsequent to contacting the population of immune cells with the ECM mimetic, optionally wherein: 193 ME148011808v.1Attorney Docket No.117823-35320 HU 9279 (i) the predefined strength of antigenic stimulation comprises a bead-to-cell ratio of 0.5:1, 1:1, or 5:1, optionally wherein the beads comprise CD3 / CD28 dynabeads or CD3 / CD28 / CD137 dynabeads. (ii) the predefined duration of antigenic stimulation comprises a time period of about 1 day to about 10 days, optionally wherein the time period comprises about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, or about 10 days.

41. The method of any one of claims 35-40, further comprising culturing the population of immune cells under conditions and time sufficient for immune cell expansion and / or enrichment to occur, optionally wherein expanding the immune cells comprises contacting the immune cells with a growth factor, optionally wherein the growth factor is IL-2.

42. The method of any one of claims 35-41, further comprising isolating the immune cells from the ECM mimetic and, optionally, subsequently culturing the isolated immune cells in suspension with or without restimulation, optionally wherein the restimulation comprises contacting the immune cells with CD3 / CD28 dynabeads or CD3 / CD28 / CD137 dynabeads.

43. The method of any one of claims 35-42, further comprising phenotypically profiling and / or functionally testing the immune cells for their cytotoxic potential and / or effector cytokine production, optionally wherein the population of immune cells is characterized by greater cytotoxicity towards cancer cells enhanced efficacy and / or effector cytokine production as compared to a population of immune cells generated using conventional plate-culture protocols.

44. The method of any one of claims 35-43, wherein the adoptive cell therapy is selected from the group consisting of a tumor-infiltrating lymphocyte (TIL) therapy, a engineered T cell receptor (TCR) therapy, a chimeric antigen receptor (CAR) T cell therapy, a natural killer (NK) cell therapy, and combinations thereof.

45. The method of any one of claims 35-44, wherein the immune cell comprises an autologous immune cell or an allogeneic immune cell, optionally wherein the immune cell comprises a phagocyte, a macrophage, a dendritic cell, a monocyte, a B cell, a T cell, a natural killer cell (NK) cell, and combinations thereof.

46. The method of any one of claims 35-45, wherein the immune cell comprises a T cell, optionally wherein the T cell is an autologous T cell or an allogeneic T cell, optionally wherein the T cell is a pan T cell or a T cell with a shared TCR clonotype, optionally wherein the T cell is selected from the 194 ME148011808v.1Attorney Docket No.117823-35320 HU 9279 group consisting of a naïve T cell, a helper T cell, a cytotoxic T cell, a memory T cell, a regulatory T cell, an innate-like T cell, a natural killer T cell, a mucosal associated invariant T cell, a gamma delta T cell, and combinations thereof.

47. The method of any one of claims 35-46, which produces a T cell characterized by a T cell signature, optionally wherein the T cell signature is: (i) a normal tissue and / or blood T cell gene signature; (ii) a tumor T cell gene signature, optionally wherein the tumor T cell gene signature is for non-small cell lung cancer (NSCLC), liver cancer, colorectal cancer, and / or breast cancer; (ii) a T cell gene signature for liver fibrosis; (iii) an activation / inhibitory T cell signature, optionally wherein the activation / inhibitory T cell signature is based on a marker selected from the group consisting of PD1, TIGIT, TIM3, LAG3, OX40, CD39, CD25, CTLA4, and combinations thereof; (iv) a memory T cell signature, optionally wherein the memory T cell signature is based on a marker selected from the group consisting of CD62L, CCR7, CD127, CD45RA, CD27, and combinations thereof; and / or (v) a T cell AP-1 gene signature.

48. The method of any one of claims 35-47, wherein the method increases the expression level of an activation / inhibitory T cell marker in T cells contacted with the slow relaxing hydrogel compared to the fast relaxing hydrogel, optionally wherein the activation / inhibitory T cell marker is selected from the group consisting of IL2RA (CD25), ENTPD1 (CD39), FAS, TNFRSF4 (OX40), LAG3, and combinations thereof.

49. The method of any one of claims 35-48, wherein the method increases the expression level of a transcription factor associated with a T cell effector phenotype in T cells contacted with the slow relaxing hydrogel compared to the fast relaxing hydrogel, optionally wherein the transcription factor associated with a T cell effector phenotype is selected from the group consisting of PRDM1 (BLIMP- 1), ZEB2, and combinations thereof.

50. The method of any one of claims 35-49, which increases the expression level of an AP-1 pathway- associated gene in T cells contacted with the slow relaxing hydrogel compared to the fast relaxing hydrogel, optionally wherein the AP-1 pathway-associated gene is selected from the group consisting of JUN, ATF3, BATF, FOS, FOSB, JUNB, and combinations thereof. 195 ME148011808v.1Attorney Docket No.117823-35320 HU 9279 51. The method of any one of claims 35-50, which increases the expression level of a mitogen- activated protein kinase in T cells contacted with the slow relaxing hydrogel compared to the fast relaxing hydrogel, optionally wherein the mitogen-activated protein kinase is selected from the group consisting of MAPK8, MAPK6, MAPK1, and combinations thereof.

52. The method of any one of claims 35-51, which increases the expression level of a T cell memory marker and / or a T cell memory associated transcription factor in T cells contacted with the fast relaxing hydrogel compared to the slow relaxing hydrogel, optionally wherein the T cell memory marker and / or the T cell memory associated transcription factor is selected from the group consisting of CD62L, KLF2, CXCR3, S1PR4, and combinations thereof.

53. The method of any one of claims 35-52, further comprising isolating the population of immune cells from a subject.

54. The method of any one of claims 35-53, further comprising administering a therapeutically effective amount of the population of immune cells to a subject in need thereof.

55. The ECM mimetic of any one of claims 35-54, wherein the hydrogel is characterized by (i) an initial elastic modulus of about 10 Pa to about 1,000 Pa; "66# / ;<:3;; :37 / ? / <698 : / <3 "B'%(# 94 / < 73 / ;< / 09=< ' ;31982$ e.g., about 1 second to about 20,000 seconds; (iii) a time value for relaxation to 60% of initially applied stress (60% time) of at least about 1 second, e.g., about 1 second to about 20,000 seconds; "6># / 79;; / 8573 "A$ 237< / # 94 / 09=< '@ <9 / 09=< (&@. (v) a storage modulus (G’) of about 1 kPa to about 5 kPa; (vi) a loss modulus (G”) of about 0.1 kPa to about 3 kPa; (vii) a fiber length of about 0.01 µm to about 20 µm; (viii) a fiber thickness of about 0.01 µm to about 0.1 µm (ix) a fiber angle of about 1° to about 100°; (x) a fiber waviness of about 0.05 µm to about 0.5 µm; (xi) a pore diameter of about 0.5 µm to about 10 µm; (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 1 mg / mL to about 10 mg / mL; (xiii) optionally an additional polymer, an additional modified polymer, or a combination thereof in an amount of about 1 mg / mL to about 10 mg / mL; 196 ME148011808v.1Attorney Docket No.117823-35320 HU 9279 (ixx) optionally a bioorthogonal crosslinker present in an amount of about 1 µM to about 500 µM; and / or (xx) optionally a level of covalent crosslinking of about 5% to about 100%.

56. The ECM mimetic of claim 55, wherein the hydrogel is a soft-fast relaxing hydrogel characterized by (i) an initial elastic modulus of about 150 Pa to about 200 Pa; "66# / ;<:3;; :37 / ? / <698 : / <3 "B'%(# 94 / 09=< + ;31982 <9 / 09=< '& ;31982;. (iii) a time value for relaxation to 60% of initially applied stress (60% time) of about 5 second to about 10 seconds; "6># / 79;; / 8573 "A$ 237< / # 94 / 09=< +@ <9 / 09=< '+@. (v) a storage modulus (G’) of about 2 kPa to about 3 kPa; (vi) a loss modulus (G”) of about 0.5 kPa to about 2 kPa; and / or (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 1 mg / mL to about 3 mg / mL.

57. The ECM mimetic of claim 55, wherein the hydrogel is a soft-slow relaxing hydrogel characterized by (i) an initial elastic modulus of about 150 Pa to about 200 Pa; "66# / ;<:3;; :37 / ? / <698 : / <3 "B'%(# 94 / 09=< +$&&& ;31982 <9 / 09=< '+$&&& ;31982;. (iii) a time value for relaxation to 60% of initially applied stress (60% time) of about 5,000 second to about 15,000 seconds; "6># / 79;; / 8573 "A$ 237< / # 94 / 09=< '@ <9 / 09=< '&@. (v) a storage modulus (G’) of about 2 kPa to about 4 kPa; (vi) a loss modulus (G”) of about 0.5 kPa to about 1 kPa; and / or (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 1 mg / mL to about 3 mg / mL. (ixx) a bioorthogonal crosslinker present in an amount of about 250 µM to about 350 µM; and / or (xx) a level of covalent crosslinking of about 25% to about 75%.

58. The ECM mimetic of claim 55, wherein the hydrogel is a stiff-fast relaxing hydrogel characterized by (i) an initial elastic modulus of about 500 Pa to about 900 Pa; "66# / ;<:3;; :37 / ? / <698 : / <3 "B'%(# 94 / 09=< ( ;31982 <9 / 09=< - ;31982;. 197 ME148011808v.1Attorney Docket No.117823-35320 HU 9279 (iii) a time value for relaxation to 60% of initially applied stress (60% time) of about 2 second to about 8 seconds; "6># / 79;; / 8573 "A$ 237< / # 94 / 09=< +@ <9 / 09=< '+@. (v) a storage modulus (G’) of about 3.5 kPa to about 4.5 kPa; (vi) a loss modulus (G”) of about 0.7 kPa to about 1.1 kPa; and / or (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 3 mg / mL to about 5 mg / mL.

59. The ECM mimetic of claim 55, wherein the hydrogel is a stiff-slow relaxing hydrogel characterized by (i) an initial elastic modulus of about 500 Pa to about 900 Pa; "66# / ;<:3;; :37 / ? / <698 : / <3 "B'%(# 94 / 09=< +&& ;31982 <9 / 09=< '$+&& ;31982;. (iii) a time value for relaxation to 60% of initially applied stress (60% time) of about 500 second to about 1,500; "6># / 79;; / 8573 "A$ 237< / # 94 / 09=< +@ <9 / 09=< '&@. (v) a storage modulus (G’) of about 3.5 kPa to about 4.5 kPa; (vi) a loss modulus (G”) of about 0.5 kPa to about 0.9 kPa; (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 3 mg / mL to about 5 mg / mL. (ixx) a bioorthogonal crosslinker present in an amount of about 250 µM to about 350 µM; and / or (xx) a level of covalent crosslinking of about 25% to about 75%.

60. The ECM mimetic of claim 55, wherein: A. the hydrogel is a fast relaxing interpenetrating polymer network (IPN) hydrogel characterized by "66# / ;<:3;; :37 / ? / <698 : / <3 "B'%(# 94 / 09=< '&& ;31982 <9 / 09=< (&& ;31982;. "6># / 79;; / 8573 "A$ 237< / # 94 / 09=< *@ <9 / 09=< ,@. (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 1 mg / mL to about 3 mg / mL; (xiii) an additional polymer, an additional modified polymer, or a combination thereof in an amount of about 3 mg / mL to about 5 mg / mL; or B. the hydrogel is a slow relaxing interpenetrating polymer network (IPN) hydrogel characterized by "66# / ;<:3;; :37 / ? / <698 : / <3 "B'%(# 94 / 09=< +&& ;31982 <9 / 09=< '$+&& ;31982;. "6># / 79;; / 8573 "A$ 237< / # 94 / 09=< )@ <9 / 09=< +@. (xii) a collagen, a modified collagen, or a combination thereof present in an amount of about 1 mg / mL to about 3 mg / mL; 198 ME148011808v.1Attorney Docket No.117823-35320 HU 9279 (xiii) an additional polymer, an additional modified polymer, or a combination thereof in an amount of about 3 mg / mL to about 5 mg / mL; (ixx) a bioorthogonal crosslinker present in an amount of about 250 µM to about 350 µM; and / or (xx) a level of covalent crosslinking of about 25% to about 75%.

61. An immune cell, e.g., a T cell, with enhanced function, which is generated using an ECM mimetic, optionally an ECM mimetic of any one of claims 1-60. 199 ME148011808v.1

Images