Nanobody, polypeptide containing said nanobody and use thereof

Abstract

Provided are a nanobody, a polypeptide containing said nanobody, and a use thereof. The variable region in the amino acid sequence of the nanobody comprises three complementarity-determining regions (CDRs) and a framework region (FR), the complementarity-determining regions (CDRs) comprising a complementarity-determining region CDR1, a complementarity-determining region CDR2 and a complementarity-determining region CDR3. The complementarity-determining region CDR1 comprises the following formula (I): Ser-Gly-Xaa11-Xaa12-Phe-Xaa13-Xaa14-Asn-Xaa15, (I); the complementarity-determining region CDR2 comprises the following formula (II): Xaa21-Thr-Xaa22-Xaa23-Gly-Xaa24-Thr, (II); the complementarity-determining region CDR3 comprises the following formula (III): His-Xaa31-Asp-Glu-Xaa32-Arg-Xaa33-Ser-Xaa34-Trp-Thr-Thr-Ser-Asn-Xaa35, (III). The nanobody and the polypeptide thereof have high affinity and activity, and can specifically recognize and bind to AAV. An adsorbent prepared by means of said nanobody and the polypeptide thereof has a strong adsorption capacity for AAV, and can be used in AAV affinity chromatography, which is conducive to the industrial application of AAV affinity chromatography columns. In addition, it can also be used in the field of AAV detection, and can detect both empty capsids and virus particles.

Description

A nanobody, a polypeptide containing the nanobody and its application Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a nanobody, a polypeptide comprising the nanobody, and applications thereof. Background Art

[0002] Adeno-associated virus (AAV), a member of the genus Dependivirus in the family Parvoviridae, has an icosahedral structure and is the simplest single-stranded DNA defective virus discovered to date. It requires a helper virus (usually an adenovirus) for replication. The virus particle has a diameter ranging from 20 to 26 nm and contains a linear, single-stranded DNA genome ranging in size from 4.7 to 6 kb. AAV is nonpathogenic to humans, and studies have shown that approximately 80% of the population tests positive for AAV serology.

[0003] Recombinant adeno-associated virus (rAAV), derived from a non-pathogenic wild-type adeno-associated virus, is considered one of the most promising gene transfer vectors due to its safety, broad host cell range (dividing and non-dividing cells), low immunogenicity, and prolonged expression of foreign genes in vivo. It is widely used in gene therapy and vaccine research worldwide, encompassing in vitro and in vivo studies of gene function, disease model development, gene knockout, gene therapy, and vaccine research.

[0004] Because rAAV upstream production is completed in cells, its lysis products contain impurities such as nucleic acids, residual culture medium impurities, and host cell proteins. Residual DNA can be treated with nucleases, but the removal of HCPs is a complex process, typically involving multiple steps, which can reduce yields, delay process development, and pose significant challenges to downstream purification processes. In particular, AAV has multiple different serotypes (AAV1-AAV10), which have different capsid protein spatial structures, sequences, and tissue specificities. They have different infection efficiencies for different tissues and cells, and recognize and bind to different cell surface receptors. Therefore, a universal affinity chromatography solution is difficult to implement.

[0005] Traditional downstream processes require multiple processing steps, including cesium chloride or iodixanol gradient centrifugation and multiple chromatography steps. These processes are not ideal because even high yields in individual steps can significantly reduce the overall yield when multiple steps are required. Furthermore, a major drawback of this method is that it is not suitable for direct purification of viruses from large lysate volumes, making it suitable only for research-scale applications.

[0006] To address this challenge, the latest affinity chromatography methods have reduced the number of steps required to purify AAV, improving yield and shortening process time. For example, heparin-affinity chromatography columns can be used to purify rAAV3 and rAAV6; mucin-affinity chromatography columns can be used to purify rAAV1, rAAV4, rAAV5 and rVVA6; and antibody-affinity columns are used to detect and purify rAAV, such as monoclonal antibodies that recognize and bind to AAVXL32.1 (Patent Document 1) and polyclonal antibodies that specifically recognize the AAV9 capsid protein (Patent Document 2).

[0007] However, traditional antibody preparation is expensive, and the large size of the antibody leads to low coupling capacity on the carrier, which limits its industrial application. Camel-derived nanobodies have high specificity and stability. AVB Sepharose based on nanobodies TM (GE Healthcare TM ) Filler and POROS TM CaptureSelect AAVX (Thermo Scientific TM ) fillers (Non-Patent Document 1) perform well in column chromatography, making industrial application of AAV affinity chromatography columns possible. However, nanobodies with different sequences screened by different screening methods have significant differences in affinity, stability, and binding spectrum.

[0008] Patent Document 1: CN113583112B

[0009] Patent Document 2: CN114685651A

[0010] Non-patent document 1: Orjana Terova, et.al, Overcoming Downstream Purification Challenges for Viral Vector Manufacturing: Enabling Advancement of Gene Therapies in the Clinic, Cell Gene Therapy Insights 2018; 4(2), 101-111.

[0011] Summary of the Invention

[0012] The purpose of the present invention is to provide nanobodies with amino acid sequences of specific structures, polypeptides containing the nanobodies and their applications, in order to solve the problems faced by existing AAV enrichment, purification, detection and other aspects, such as the complex antibody preparation process, high cost, and poor antibody affinity, stability and binding spectrum.

[0013] In order to achieve the above technical objectives, the technical solutions adopted in this application are as follows:

[0014] In a first aspect, the present invention provides a nanobody, wherein the variable region in the amino acid sequence of the nanobody includes a complementarity determining region CDR and a framework region FR, wherein the complementarity determining region CDR includes a complementarity determining region CDR1, a complementarity determining region CDR2 and a complementarity determining region CDR3, wherein:

[0015] The complementary determining region CDR1 comprises the following formula (I):

[0016] Ser-Gly-Xaa 11 -Xaa 12 -Phe-Xaa 13 -Xaa 14 -Asn-Xaa 15 , (I);

[0017] The complementary determining region CDR2 comprises the following formula (II):

[0018] Xaa 21 -Thr-Xaa 22 -Xaa 23 -Gly-Xaa 24 -Thr, (II);

[0019] The complementary determining region CDR3 comprises the following formula (III):

[0020] His-Xaa 31 -Asp-Glu-Xaa 32 -Arg-Xaa 33 -Ser-Xaa 34 -Trp-Thr-Thr-Ser-Asn-Xaa 35 , (III);

[0021] in,

[0022] Xaa 11 independently selected from Arg, Ser, Thr; and / or,

[0023] Xaa 12 independently selected from Ala, Gly, His, Ile, Met, Asn, Arg, Ser, Thr; and / or,

[0024] Xaa 13 independently selected from Ile, Arg, Ser, Thr, Val; and / or,

[0025] Xaa 14 Independently selected from Ala, Ile, Leu; and / or,

[0026] Xaa 15 independently selected from Ala, Ile, Leu, Ser, Thr, Val; and / or,

[0027] Xaa 21 independently selected from Phe, Ile, Leu, Val; and / or,

[0028] Xaa 22 independently selected from Pro, Arg, Ser; and / or,

[0029] Xaa 23 Independently selected from Ala, Asp, Gly; and / or,

[0030] Xaa 24 independently selected from Asp, Gly, Asn, Ser, Thr, Val; and / or,

[0031] Xaa 31 Independently selected from Ile, Leu, Val; and / or,

[0032] Xaa 32 Independently selected from Ile, Leu, Val; and / or,

[0033] Xaa 33 Independently selected from Asp, Glu, Gln,; and / or,

[0034] Xaa 34 independently selected from Gly, Ile, Ser, Thr; and / or,

[0035] Xaa 35 Independently selected from Ile, Leu.

[0036] Preferably, in the complementarity determining region CDR1,

[0037] Xaa 11 Arg, Xaa 12 Ser, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or

[0038] Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or

[0039] Xaa11 Arg, Xaa 12 His, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or

[0040] Xaa 11 Arg, Xaa 12 Ala, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or

[0041] Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Ser; or

[0042] Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Ser; or

[0043] Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Leu; or,

[0044] Xaa 11 Ser, Xaa 12 Thr, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or

[0045] Xaa 11 Ser, Xaa 12 Gly, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or

[0046] Xaa 11 Ser, Xaa 12 Ala, Xaa 13Ser, Xaa 14 Ile, Xaa 15 is Thr; or

[0047] Xaa 11 Ser, Xaa 12 Asn, Xaa 13 Arg, Xaa 14 Ile, Xaa 15 is Thr; or

[0048] Xaa 11 Ser, Xaa 12 Asn, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or

[0049] Xaa 11 Ser, Xaa 12 Ser, Xaa 13 Thr, Xaa 14 Ile, Xaa 15 is Thr; or

[0050] Xaa 11 Ser, Xaa 12 Ser, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or

[0051] Xaa 11 Arg, Xaa 12 Gly, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or

[0052] Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or

[0053] Xaa 11 Ser, Xaa 12 His, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or

[0054] Xaa 11 Arg, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or

[0055] Xaa 11 Ser, Xaa 12 Met, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or

[0056] Xaa 11 Ser, Xaa 12 Ser, Xaa 13 Val, Xaa 14 Ile, Xaa 15 is Thr; or

[0057] Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ile, Xaa 14 Ile, Xaa 15 is Thr; or

[0058] Xaa 11 Ser, Xaa 12 His, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or

[0059] Xaa 11 Ser, Xaa 12 Thr, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or

[0060] Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or

[0061] Xaa 11 Ser, Xaa12 Ser, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Ala; or

[0062] Xaa 11 Arg, Xaa 12 Arg, Xaa 13 Thr, Xaa 14 Ile, Xaa 15 is Thr; or

[0063] Xaa 11 Arg, Xaa 12 Asn, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or

[0064] Xaa 11 Arg, Xaa 12 Ala, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or

[0065] Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Thr, Xaa 14 Ile, Xaa 15 is Ser; or

[0066] Xaa 11 Ser, Xaa 12 Met, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or

[0067] Xaa 11 Thr, Xaa 12 Met, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or

[0068] Xaa 11 Thr, Xaa 12 Arg, Xaa 13 Ser, Xaa 14Ile, Xaa 15 is Thr; or

[0069] Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ile, Xaa 14 Ile, Xaa 15 is Thr; or

[0070] Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Val, Xaa 14 Ile, Xaa 15 is Thr; or

[0071] Xaa 11 Ser, Xaa 12 Ser, Xaa 13 Ser, Xaa 14 Ala, Xaa 15 is Thr; or

[0072] Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ala, Xaa 15 is Thr; or

[0073] Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 for Ile; or,

[0074] Xaa 11 Ser, Xaa 12 His, Xaa 13 Thr, Xaa 14 Ile, Xaa 15 is Ser; or

[0075] Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Ala; or

[0076] Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Ser; or

[0077] Xaa 11 Thr, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Val; or,

[0078] Xaa 11 Thr, Xaa 12 Asn, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 For Val.

[0079] Preferably, in the complementarity determining region CDR2,

[0080] Xaa 21 Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Ser; or

[0081] Xaa 21 Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Gly; or

[0082] Xaa 21 Ile, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Asn; or

[0083] Xaa 21 Ile, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Ser; or

[0084] Xaa 21 Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Asn; or

[0085] Xaa 21 Ile, Xaa 22 For Pro, Xaa 23 Gly, Xaa 24 is Asn; or

[0086] Xaa 21 Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Val; or,

[0087] Xaa 21 Val, Xaa 22 Arg, Xaa 23 Asp, Xaa 24 is Ser; or

[0088] Xaa 21 Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Thr; or

[0089] Xaa 21 Phe, Xaa 22 Arg, Xaa 23 Ala, Xaa 24 is Asn; or

[0090] Xaa 21 Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Asp; or,

[0091] Xaa 21 Leu, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Ser; or

[0092] Xaa 21 Val, Xaa 22 For Pro, Xaa 23 Ala, Xaa 24 is Ser; or

[0093] Xaa 21 Val, Xaa 22 Ser, Xaa 23 Ala, Xaa24 is Ser; or

[0094] Xaa 21 Val, Xaa 22 Ser, Xaa 23 Gly, Xaa 24 is Gly; or

[0095] Xaa 21 Val, Xaa 22 Arg, Xaa 23 Asp, Xaa 24 is Gly; or

[0096] Xaa 21 Ile, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Gly; or

[0097] Xaa 21 Val, Xaa 22 Arg, Xaa 23 Ala, Xaa 24 is Ser; or

[0098] Xaa 21 Val, Xaa 22 For Pro, Xaa 23 Gly, Xaa 24 is Ser; or

[0099] Xaa 21 Phe, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Asn; or

[0100] Xaa 21 Ile, Xaa 22 Ser, Xaa 23 Gly, Xaa 24 For Ser.

[0101] Preferably, in the complementarity determining region CDR3,

[0102] Xaa 31 Ile, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 for Ile; or,

[0103] Xaa 31 Val, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 for Ile; or,

[0104] Xaa 31 Val, Xaa 32 Val, Xaa 33 Glu, Xaa 34 Ser, Xaa 35 is Leu; or,

[0105] Xaa 31 Val, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 is Leu; or,

[0106] Xaa 31 Val, Xaa 32 Val, Xaa 33 Asp, Xaa 34 Ser, Xaa 35 for Ile; or,

[0107] Xaa 31 Leu, Xaa 32 Val, Xaa 33 Glu, Xaa 34 Ser, Xaa 35 is Leu; or,

[0108] Xaa 31 Val, Xaa 32 Ile, Xaa 33 Glu, Xaa 34 Ser, Xaa 35 is Leu; or,

[0109] Xaa 31 Ile, Xaa 32 Ile, Xaa 33 Glu, Xaa 34 Ser, Xaa 35 is Leu; or,

[0110] Xaa 31 Val, Xaa32 Ile, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 is Leu; or,

[0111] Xaa 31 Leu, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 for Ile; or,

[0112] Xaa 31 Leu, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 is Leu; or,

[0113] Xaa 31 Ile, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 is Leu; or,

[0114] Xaa 31 Val, Xaa 32 Leu, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 is Leu; or,

[0115] Xaa 31 Leu, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Thr, Xaa 35 is Leu; or,

[0116] Xaa 31 Val, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Thr, Xaa 35 is Leu; or,

[0117] Xaa 31 Val, Xaa 32 Val, Xaa 33 Glu, Xaa 34Thr, Xaa 35 is Leu; or,

[0118] Xaa 31 Leu, Xaa 32 Val, Xaa 33 Asp, Xaa 34 Ser, Xaa 35 is Leu; or,

[0119] Xaa 31 Val, Xaa 32 Ile, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 for Ile; or,

[0120] Xaa 31 Val, Xaa 32 Leu, Xaa 33 Asp, Xaa 34 Ser, Xaa 35 is Leu; or,

[0121] Xaa 31 Val, Xaa 32 Val, Xaa 33 Asp, Xaa 34 Ser, Xaa 35 is Leu; or,

[0122] Xaa 31 Val, Xaa 32 Leu, Xaa 33 Glu, Xaa 34 Gly, Xaa 35 is Leu; or,

[0123] Xaa 31 Val, Xaa 32 Leu, Xaa 33 Glu, Xaa 34 Ser, Xaa 35 is Leu; or,

[0124] Xaa 31 Val, Xaa 32 Leu, Xaa 33 Gln, Xaa 34 Thr, Xaa 35 is Leu; or,

[0125] Xaa 31 Ile, Xaa 32 Ile, Xaa 33 Glu, Xaa 34 Thr, Xaa 35 is Leu; or,

[0126] Xaa 31 Val, Xaa 32 Val, Xaa 33 Glu, Xaa 34 Thr, Xaa 35 for Ile; or,

[0127] Xaa 31 Val, Xaa 32 Ile, Xaa 33 Glu, Xaa 34 Thr, Xaa 35 is Leu; or,

[0128] Xaa 31 Val, Xaa 32 Val, Xaa 33 Glu, Xaa 34 Ile, Xaa 35 is Leu; or,

[0129] Xaa 31 Leu, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Thr, Xaa 35 for Ile; or,

[0130] Xaa 31 Val, Xaa 32 Leu, Xaa 33 Asp, Xaa 34 Thr, Xaa 35 is Leu; or,

[0131] Xaa 31 Leu, Xaa 32 Val, Xaa 33 Glu, Xaa 34 Thr, Xaa 35 is Leu; or,

[0132] Xaa 31 Val, Xaa 32 Val, Xaa33 Gln, Xaa 34 Thr, Xaa 35 for Ile; or,

[0133] Xaa 31 Val, Xaa 32 Ile, Xaa 33 Gln, Xaa 34 Thr, Xaa 35 For Leu.

[0134] Preferably, the framework region FR includes: framework region FR1, framework region FR2, framework region FR3 and framework region FR4, and the framework region FR1, framework region FR2, framework region FR3 and framework region FR4 are amino acid sequences with more than 50% homology, preferably with more than 70% homology, and more preferably with more than 95% homology;

[0135] More preferably, the framework region FR1 is represented by the following formula (IV):

[0136] ValGlnLeuGlnGluSerGlyGlyGlyXaa 41 Xaa 42 Xaa 43 Xaa 44 GlyGlySerLeuXaa 45 LeuSerCysXaa 46 Ala formula (Ⅳ);

[0137] The framework region FR2 is represented by the following formula (V):

[0138] Xaa 51 GlyTrpTyrArgXaa 52 Xaa 53 Xaa 54 Xaa 55 LysXaa 56 ArgGluXaa 57 ValaXaa 58 Formula (V);

[0139] The framework region FR3 is represented by the following formula (VI):

[0140] Xaa 61 TyrXaa 62 Xaa 63 Xaa 64 ValLysGlyArgPheThrIleSerArgAspAsnXaa 65 LysXaa 66ThrXaa 67 TyrLeuGlnMAsnXaa 68 LeXaa 69 ProGluAspThrAlaValTyrTyrCys formula (VI);

[0141] The framework region FR4 is represented by the following formula (VII):

[0142] TrpGlyGlnGlyThrGlnValThrValSerSer formula (VII) (SEQ ID No: 102); wherein,

[0143] Xaa 41 independently selected from Leu, Ala; and / or,

[0144] Xaa 42 independently selected from Val, Ala; and / or,

[0145] Xaa 43 Independently selected from Gln, His; and / or,

[0146] Xaa 44 independently selected from Pro, Ala, Ser, Thr; and / or,

[0147] Xaa 45 independently selected from Arg, Lys; and / or,

[0148] Xaa 46 independently selected from Ala, Val, Leu, Ile, Phe; and / or,

[0149] Xaa 51 independently selected from Met, Val; and / or,

[0150] Xaa 52 independently selected from Gln, Arg; and / or,

[0151] Xaa 53 independently selected from Ala, Arg; and / or,

[0152] Xaa 54 independently selected from Pro, Ala; and / or,

[0153] Xaa 55 Independently selected from Gly, Pro, Ala, Arg; and / or,

[0154] Xaa 56 Independently selected from Gln, Trp; and / or,

[0155] Xaa 57independently selected from Leu, Phe, Lys, Ile, Met; and / or,

[0156] Xaa 58 independently selected from Thr, Ala, Ser, Pro, Asn; and / or,

[0157] Xaa 61 independently selected from Asn, Ser, Lys, Thr, Trp; and / or,

[0158] Xaa 62 independently selected from Ala, Gly; and / or,

[0159] Xaa 63 Independently selected from Gly, Asp, Glu, Asn; and / or,

[0160] Xaa 64 independently selected from Ser, Phe; and / or,

[0161] Xaa 65 independently selected from Ala, Pro, Thr, Gly, Asp; and / or,

[0162] Xaa 66 independently selected from Asn, Asp, Ser, Thr; and / or,

[0163] Xaa 67 are independently selected from Val, Ile, Ala; and / or,

[0164] Xaa 68 independently selected from Ser, Thr, Asn; and / or,

[0165] Xaa 69 Independently selected from Arg, Gln;

[0166] Preferably, the framework regions FR and the complementarity determining regions CDR are arranged alternately in a chronological order.

[0167] Preferably, the amino acid sequence of the nanobody comprises: SEQ ID No:1, SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQ ID No:6, SEQ ID No:7, SEQ ID No:8, SEQ ID No:9, SEQ ID No:10, SEQ ID No:11, SEQ ID No:12, SEQ ID No:13, SEQ ID No:14, SEQ ID No:15, SEQ ID No:16, SEQ ID No:17, SEQ ID No:18, SEQ ID No:19, SEQ ID No:20, SEQ ID No:21, SEQ ID No:22, SEQ ID No:23, SEQ ID No:24, SEQ ID No:25, SEQ ID No:26, SEQ ID No:27, SEQ ID No:28, SEQ ID No:29, SEQ ID No:30, SEQ ID No:31, SEQ ID No:32, SEQ ID No:33, SEQ ID No:34, SEQ ID No:35, SEQ ID No:36, SEQ ID No:37, SEQ ID No:38, SEQ ID No:39, SEQ ID No:40, SEQ ID No:41, SEQ ID No:42, SEQ ID No:43, SEQ ID No:44, SEQ ID No:45, SEQ ID No:46, SEQ ID No:47, SEQ ID No:48, SEQ ID No:49, SEQ ID No:50, SEQ ID No:51, SEQ ID No:52, SEQ ID No:53, SEQ ID No:54, SEQ ID No:55, SEQ ID No:56, SEQ ID No:57, SEQ ID No:58, SEQ ID No:59, SEQ ID No:60, SEQ ID No:61, SEQ ID No:62, SEQ ID No:63, SEQ ID No:64, SEQ ID No:65, SEQ ID No:66, SEQ ID No:67, SEQ ID No:68, SEQ ID No:69, SEQ ID No:70, SEQ ID No:71, SEQ ID No:72, SEQ ID No:73, SEQ ID No:74, SEQ ID No:75, SEQ ID No:76, SEQID No:77, SEQ ID No:78, SEQ ID No:79, SEQ ID No:80, SEQ ID No:81, SEQ ID No:82, SEQ ID No:83, SEQ ID No:84, SEQ ID No:85, SEQ ID No:86, SEQ ID No:87, SEQ ID No:88, SEQ ID No:89, SEQ ID No:90, SEQ ID No:91, SEQ ID No:92, SEQ ID No:93, SEQ ID No:94, SEQ ID No:95, SEQ ID No:96, SEQ ID No:97, SEQ ID No:98, SEQ ID No:99, SEQ ID No:100, SEQ ID No:101, SEQ ID No:102, SEQ ID No:103, SEQ ID No:104, SEQ ID No:105、SEQ ID No:106、SEQ ID No:107、SEQ ID No:108、SEQ ID No:109、SEQ ID No:110, SEQ ID No:111, SEQ ID No:112, SEQ ID No:113, SEQ ID No:114.

[0168] Preferably, the Nanobody is a humanized Nanobody, preferably, the humanized Nanobody comprises SEQ ID No: 115, SEQ ID No: 116, SEQ ID No: 117, SEQ ID No: 118, SEQ ID No: 119, SEQ ID No: 120.

[0169] In a second aspect, the present invention provides a polypeptide obtained by modifying the N-terminus and / or C-terminus of the above-mentioned Nanobody.

[0170] Preferably, the method of modifying the N-terminal and / or C-terminal amino acids of the Nanobody comprises:

[0171] Method 1: adding a tag to the N-terminal and / or C-terminal amino acid of the Nanobody;

[0172] Method 2: adding a hinge to the N-terminal and / or C-terminal amino acid of the Nanobody;

[0173] Method three, after the N-terminal and / or C-terminal amino acids of the Nanobody are tagged, the tags are further linked to protective amino acids;

[0174] Preferably, the tag includes at least one of His-tag, GST-tag, Myc-tag, SUMO-tag, Strep-tag, and Flag-tag; the hinge includes at least one of GS hinge, IgG hinge, IgA hinge, and PEG; and the protected amino acid includes Ala, Gln, Glu, Met, or a combination of any two or more of the foregoing amino acids.

[0175] Preferably, the amino acid sequence of the polypeptide includes: SEQ ID No: 147, SEQ ID No: 148, SEQ ID No: 149, SEQ ID No: 150, SEQ ID No: 151.

[0176] In a third aspect, the present invention provides a polypeptide obtained by multivalent synthesis of the above-mentioned nanoantibodies.

[0177] Preferably, the multivalent synthesis comprises a divalent, trivalent or tetravalent synthesis;

[0178] Preferably, the bivalent synthetic amino acid sequence comprises: SEQ ID No: 121, SEQ ID No: 122;

[0179] Preferably, the bivalent synthetic amino acid is a humanized bivalent polypeptide, and further preferably, the amino acid sequence of the humanized bivalent polypeptide comprises: SEQ ID No: 123, SEQ ID No: 124;

[0180] Preferably, the amino acid sequence of the trivalent polypeptide comprises: SEQ ID No: 125, SEQ ID No: 126, SEQ ID No: 127, SEQ ID No: 128, SEQ ID No: 129, SEQ ID No: 130, SEQ ID No: 131, SEQ ID No: 132, SEQ ID No: 133;

[0181] Preferably, the amino acid sequence of the tetravalent polypeptide comprises: SEQ ID No: 134, SEQ ID No: 135, SEQ ID No: 136, SEQ ID No: 137, SEQ ID No: 138, SEQ ID No: 139, SEQ ID No: 140, SEQ ID No: 141, SEQ ID No: 142, SEQ ID No: 143, SEQ ID No: 144, SEQ ID No: 145, SEQ ID No: 146.

[0182] In a fourth aspect, the present invention provides a nucleic acid encoding the aforementioned Nanobody or the aforementioned polypeptide.

[0183] In a fifth aspect, the present invention provides an expression vector comprising an expression cassette of the nucleic acid according to claim 1.

[0184] In a sixth aspect, the present invention provides a host cell comprising the expression vector as claimed in claim 1 .

[0185] In a seventh aspect, the present invention provides the use of the nanobody and / or the polypeptide in immunodetection, enrichment and or purification.

[0186] Preferably, the nanobody and / or the polypeptide is used in the preparation of a virus adsorbent, a virus purification kit, or a virus detection kit; further preferably, the virus is AAV.

[0187] In an eighth aspect, the present invention provides a virus adsorbent comprising a carrier matrix and the aforementioned nanobody and / or the aforementioned polypeptide.

[0188] In a ninth aspect, the present invention provides a virus purification kit comprising a carrier matrix and the aforementioned nanoantibody and / or the aforementioned polypeptide.

[0189] In a tenth aspect, the present invention provides a virus detection kit, characterized in that it comprises a carrier matrix and the above-mentioned nanoantibody and / or the above-mentioned polypeptide.

[0190] In the eleventh aspect, the present invention provides an AAV detection method for non-diagnostic purposes, wherein the above-mentioned nanoantibodies and / or the above-mentioned polypeptides are coupled with HRP and then detected by direct enzyme immunosorbent assay or sandwich enzyme immunosorbent assay.

[0191] The nanobody of the present invention is an anti-AAV nanobody with a novel amino acid sequence discovered through screening. This nanobody and its polypeptide have high affinity and activity, and can specifically recognize and bind to AAV. The adsorbent prepared using this nanobody and its polypeptide has a strong adsorption capacity for AAV and can be used in AAV affinity chromatography, facilitating the industrial application of AAV affinity chromatography columns. It can also be used in the field of AAV detection, and can detect both empty capsids and viral particles. BRIEF DESCRIPTION OF THE DRAWINGS

[0192] Figure 1 is the purified Nanobody in Example 1 of the present invention;

[0193] Figure 2 is a kinetic sensorgram of the nanobody in Example 5 of the present invention;

[0194] Figure 3 is a schematic diagram of the bivalent Nanobody in Example 7 of the present invention;

[0195] FIG4 is a standard curve of direct ELISA detection in Example 11 of the present invention;

[0196] FIG5 is a standard curve of sandwich ELISA detection in Example 11 of the present invention. DETAILED DESCRIPTION

[0197] The above and other aspects of the present invention will be further described below, in which:

[0198] (1) Unless otherwise indicated, the term "sequence" as used herein (e.g., in similar terms such as "antibody sequence," "variable region sequence," "V HH The term "sequence" or "protein sequence" should generally be understood to include the relevant amino acid sequence and the nucleic acid sequence or nucleotide sequence encoding the amino acid sequence, unless the context requires a narrower interpretation.

[0199] (2) Unless otherwise indicated, all methods, steps, techniques and operations not specifically described are known and familiar to those skilled in the art. For example, reference is made to the general background art cited above and other references cited therein.

[0200] (3) The term "specificity" refers to the ability of a particular antigen-binding molecule (such as a Nanobody or polypeptide of the invention) to bind to different types of antigens or antigenic determinants. The specificity of an antigen-binding molecule can be determined based on its affinity and / or activity. Affinity is expressed as the dissociation equilibrium constant (K) between the antigen and the antigen-binding molecule. D ), is a measure of the binding strength between the antigen and the antigen-binding molecule, K D The smaller the value, the stronger the binding strength between the antigen and the antigen-binding molecule. D The larger the value, the weaker the binding strength between the antigen and the antigen-binding molecule. a represents the binding constant, K a The larger the value, the faster the binding. a The smaller the K, the slower the binding; d represents the dissociation constant, K d The larger the K, the faster the dissociation. d The smaller the K, the slower the dissociation; and D =K d / K a .

[0201] (4) The amino acid residues of single-domain antibodies (i.e., nanobodies) are in accordance with the V given by Kabat et al. in "Serequence of proteins of immunological interest", US Public Health Services, Publication No. 91. HHThe domains are numbered according to the general numbering scheme used by Riechmann and Muyldermans for V from Camelidae. HH Domains. According to this numbering method, the FR1 of a single-domain antibody includes amino acid residues at positions 1 to 30, the CDR1 of a single-domain antibody includes amino acid residues at positions 31 to 36, the FR2 of a single-domain antibody includes amino acid residues at positions 37 to 49, the CDR2 of a single-domain antibody includes amino acid residues at positions 50 to 65, the FR3 of a single-domain antibody includes amino acid residues at positions 66 to 94, the CDR3 of a single-domain antibody includes amino acid residues at positions 95 to 102, and the FR4 of a single-domain antibody includes amino acid residues at positions 103 to 113. In this regard, it should be noted that as discussed in the art regarding V HH Domain and about V HH It is well known that the total number of amino acid residues in each CDR can be different and may not correspond to the total number of amino acid residues indicated by the Kabat numbering (i.e., one or more positions according to the Kabat numbering may not be occupied in the actual sequence, or the actual sequence may contain more amino acid residues than allowed by the Kabat numbering). This means that, in general, the amino acid residues in the actual sequence may be the same or different than the actual numbering according to the Kabat numbering. It can also be said that the amino acid residue numbering of the CDRs is not taken into account according to the Kabat numbering, but position 1 according to the Kabat numbering corresponds to the start of FR1, and vice versa; position 36 according to the Kabat numbering corresponds to the start of FR2, and vice versa, position 66 according to the Kabat numbering corresponds to the start of FR3; and vice versa, position 103 according to the Kabat numbering corresponds to the start of FR4, and vice versa.

[0202] (5) The term “immobilized capacity” refers to the total amount of ligand coupled to a unit volume of affinity medium (adsorbent).

[0203] (6) The term “homologous” refers to a family of Nanobody sequences that bind to the same antigen, have the same number of amino acids, and have an amino acid sequence identity greater than 70%.

[0204] The amino acid sequence of the Nanobodies of the invention essentially comprises complementarity determining regions CDR and framework regions FR.

[0205] The complementarity determining regions CDR include complementarity determining regions CDR1, complementarity determining regions CDR2 and complementarity determining regions CDR3, and the framework regions FR include framework regions FR1, framework regions FR2, framework regions FR3 and framework regions FR4.

[0206] The complementary determining region CDR1 comprises the following formula (I):

[0207] Ser-Gly-Xaa 11 -Xaa 12 -Phe-Xaa 13 -Xaa 14 -Asn-Xaa 15 (I),

[0208] The complementary determining region CDR2 comprises the following formula (II):

[0209] Xaa 21 -Thr-Xaa 22 -Xaa 23 -Gly-Xaa 24 -Thr(II),

[0210] The complementary determining region CDR3 comprises the following formula (III):

[0211] His-Xaa 31 -Asp-Glu-Xaa 32 -Arg-Xaa 33 -Ser-Xaa 34 -Trp-Thr-Thr-Ser-Asn-Xaa 35 (III),

[0212] Among them, Xaa 11 independently selected from Arg, Ser, Thr; and / or, Xaa 12 independently selected from Ala, Gly, His, Ile, Met, Asn, Arg, Ser, Thr; and / or, Xaa 13 independently selected from Ile, Arg, Ser, Thr, Val; and / or, Xaa 14 Independently selected from Ala, Ile, Leu; and / or, Xaa 15 Independently selected from Ala, He, Leu, Ser, Thr, Val;

[0213] and / or Xaa 21 Independently selected from Phe, Ile, Leu, Val; and / or, Xaa 22 independently selected from Pro, Arg, Ser; and / or, Xaa 23 Independently selected from Ala, Asp, Gly; and / or, Xaa 24 Independently selected from Asp, Gly, Asn, Ser, Thr, Val;

[0214] and / or Xaa 31Independently selected from Ile, Leu, Val; and / or, Xaa 32 Independently selected from Ile, Leu, Val; and / or, Xaa 33 are independently selected from Asp, Glu, Gln, and / or Xaa 34 Independently selected from Gly, Ile, Ser, Thr; and / or, Xaa 35 Independently selected from Ile, Leu.

[0215] Amino acid substitution can generally be described as replacing an amino acid residue with an amino acid having a similar chemical structure or with an amino acid having a dissimilar chemical structure, as long as there is little or no effect on the function, activity or other biological properties of the polypeptide. Preferably, the amino acid residue can be replaced with an amino acid having a similar chemical structure.

[0216] For the above-mentioned substitution mode, for example, the situations disclosed in documents WO04 / 037999, WO 98 / 49185, WO 00 / 46383 and WO 01 / 09300 can be cited, but it is not limited thereto. In addition, the (preferred) type and / or combination of the substitution can be selected based on the relevant information of other references cited in WO 04 / 037999 and WO 06 / 122786.

[0217] The amino acid substitutions of the present invention include, but are not limited to, substitutions in which one amino acid in the following groups (a) to (e) is replaced by another amino acid in the same group: (a) Ala, Ser, Thr, Pro, and Gly; (b) Asp, Asn, Glu, and Gln; (c) His, Lys, and Arg; (d) Met, Leu, Ile, Val, and Cys; and (e) Phe, Tyr, and Trp.

[0218] Preferred amino acid substitutions can be listed but are not limited to the following: Ala is substituted with Gly or Ser; Arg is substituted with Lys; Asn is substituted with Gln or His; Asp is substituted with Glu; Cys is substituted with Ser or Thr; Gln is substituted with Asn; Glu is substituted with Asp; Gly is substituted with Ala or Pro; His is substituted with Asn or Gln; Ile is substituted with Leu or Val; Leu is substituted with Ile or Val; Lys is substituted with Arg, Glu or Gln; Met is substituted with Leu, Tyr or Ile; Phe is substituted with Met, Tyr or Leu; Ser is substituted with Thr; Thr is substituted with Ser; Tyr is substituted with Trp; Trp is substituted with Tyr.

[0219] In some preferred embodiments, in the above formula (I), the above Xaa 11 Arg, Xaa 12 Ser, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-1")

[0220] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-2")

[0221] In some preferred embodiments, in the above formula (I), the above Xaa 11 Arg, Xaa 12 His, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-3")

[0222] In some preferred embodiments, in the above formula (I), the above Xaa 11 Arg, Xaa 12 Ala, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-4")

[0223] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Ser. (denoted as "CDR1-5")

[0224] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Ser. (denoted as "CDR1-6")

[0225] In some preferred embodiments, in the above formula (I), the above Xaa11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Leu. (denoted as "CDR1-7")

[0226] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Thr, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-8")

[0227] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Gly, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-9")

[0228] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Ala, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-10")

[0229] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Asn, Xaa 13 Arg, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-11")

[0230] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Asn, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-12")

[0231] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa12 Ser, Xaa 13 Thr, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-13")

[0232] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Ser, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-14")

[0233] In some preferred embodiments, in the above formula (I), the above Xaa 11 Arg, Xaa 12 Gly, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-15")

[0234] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-16")

[0235] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 His, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-17")

[0236] In some preferred embodiments, in the above formula (I), the above Xaa 11 Arg, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-18")

[0237] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12Met, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-19")

[0238] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Ser, Xaa 13 Val, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-20")

[0239] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ile, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-21")

[0240] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 His, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 Thr. (denoted as "CDR1-22")

[0241] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Thr, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 Thr. (denoted as "CDR1-23")

[0242] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 Thr. (denoted as "CDR1-24")

[0243] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Ser, Xaa13 Ser, Xaa 14 Ile, Xaa 15 is Ala. (denoted as "CDR1-25")

[0244] In some preferred embodiments, in the above formula (I), the above Xaa 11 Arg, Xaa 12 Arg, Xaa 13 Thr, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-26")

[0245] In some preferred embodiments, in the above formula (I), the above Xaa 11 Arg, Xaa 12 Asn, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 Thr. (denoted as "CDR1-27")

[0246] In some preferred embodiments, in the above formula (I), the above Xaa 11 Arg, Xaa 12 Ala, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 Thr. (denoted as "CDR1-28")

[0247] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Thr, Xaa 14 Ile, Xaa 15 Ser. (denoted as "CDR1-29")

[0248] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Met, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 Thr. (denoted as "CDR1-30")

[0249] In some preferred embodiments, in the above formula (I), the above Xaa 11 Thr, Xaa 12 Met, Xaa 13Ser, Xaa 14 Leu, Xaa 15 Thr. (denoted as "CDR1-31")

[0250] In some preferred embodiments, in the above formula (I), the above Xaa 11 Thr, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-32")

[0251] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ile, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-33")

[0252] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Val, Xaa 14 Ile, Xaa 15 Thr. (denoted as "CDR1-34")

[0253] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Ser, Xaa 13 Ser, Xaa 14 Ala, Xaa 15 Thr. (denoted as "CDR1-35")

[0254] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ala, Xaa 15 Thr. (denoted as "CDR1-36")

[0255] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ser, Xaa14 Ile, Xaa 15 Ile. (denoted as "CDR1-37")

[0256] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 His, Xaa 13 Thr, Xaa 14 Ile, Xaa 15 Ser. (denoted as "CDR1-38")

[0257] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Ala. (denoted as "CDR1-39")

[0258] In some preferred embodiments, in the above formula (I), the above Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 Ser. (denoted as "CDR1-40")

[0259] In some preferred embodiments, in the above formula (I), the above Xaa 11 Thr, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Val. (denoted as "CDR1-41")

[0260] In some preferred embodiments, in the above formula (I), the above Xaa 11 Thr, Xaa 12 Asn, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Val. (denoted as "CDR1-42")

[0261] In some preferred embodiments, in the above formula (II), the above Xaa 21 Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24Ser. (denoted as "CDR2-1")

[0262] In some preferred embodiments, in the above formula (II), the above Xaa 21 Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 Gly. (denoted as "CDR2-2")

[0263] In some preferred embodiments, in the above formula (II), the above Xaa 21 Ile, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 Asn. (denoted as "CDR2-3")

[0264] In some preferred embodiments, in the above formula (II), the above Xaa 21 Ile, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 Ser. (denoted as "CDR2-4")

[0265] In some preferred embodiments, in the above formula (II), the above Xaa 21 Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 Asn. (denoted as "CDR2-5")

[0266] In some preferred embodiments, in the above formula (II), the above Xaa 21 Ile, Xaa 22 For Pro, Xaa 23 Gly, Xaa 24 Asn. (denoted as "CDR2-6")

[0267] In some preferred embodiments, in the above formula (II), the above Xaa 21 Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Val. (denoted as "CDR2-7")

[0268] In some preferred embodiments, in the above formula (II), the above Xaa 21 Val, Xaa 22 Arg, Xaa 23 Asp, Xaa 24Ser. (denoted as "CDR2-8")

[0269] In some preferred embodiments, in the above formula (II), the above Xaa 21 Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 Thr. (denoted as "CDR2-9")

[0270] In some preferred embodiments, in the above formula (II), the above Xaa 21 Phe, Xaa 22 Arg, Xaa 23 Ala, Xaa 24 Asn. (denoted as "CDR2-10")

[0271] In some preferred embodiments, in the above formula (II), the above Xaa 21 Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 Asp. (denoted as "CDR2-11")

[0272] In some preferred embodiments, in the above formula (II), the above Xaa 21 Leu, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 Ser. (denoted as "CDR2-12")

[0273] In some preferred embodiments, in the above formula (II), the above Xaa 21 Val, Xaa 22 For Pro, Xaa 23 Ala, Xaa 24 Ser. (denoted as "CDR2-13")

[0274] In some preferred embodiments, in the above formula (II), the above Xaa 21 Val, Xaa 22 Ser, Xaa 23 Ala, Xaa 24 Ser. (denoted as "CDR2-14")

[0275] In some preferred embodiments, in the above formula (II), the above Xaa 21 Val, Xaa 22 Ser, Xaa 23 Gly, Xaa24 Gly. (denoted as "CDR2-15")

[0276] In some preferred embodiments, in the above formula (II), the above Xaa 21 Val, Xaa 22 Arg, Xaa 23 Asp, Xaa 24 Gly. (denoted as "CDR2-16")

[0277] In some preferred embodiments, in the above formula (II), the above Xaa 21 Ile, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 Gly. (denoted as "CDR2-17")

[0278] In some preferred embodiments, in the above formula (II), the above Xaa 21 Val, Xaa 22 Arg, Xaa 23 Ala, Xaa 24 Ser. (denoted as "CDR2-18")

[0279] In some preferred embodiments, in the above formula (II), the above Xaa 21 Val, Xaa 22 For Pro, Xaa 23 Gly, Xaa 24 Ser. (denoted as "CDR2-19")

[0280] In some preferred embodiments, in the above formula (II), the above Xaa 21 Phe, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 Asn. (denoted as "CDR2-20")

[0281] In some preferred embodiments, in the above formula (II), the above Xaa 21 Ile, Xaa 22 Ser, Xaa 23 Gly, Xaa 24 Ser. (denoted as "CDR2-21")

[0282] In some preferred embodiments, in the above formula (III), the above Xaa 31 Ile, Xaa 32 Val, Xaa 33Gln, Xaa 34 Ser, Xaa 35 is Ile. (denoted as "CDR3-1")

[0283] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 is Ile. (denoted as "CDR3-2")

[0284] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Val, Xaa 33 Glu, Xaa 34 Ser, Xaa 35 Leu. (denoted as "CDR3-3")

[0285] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 Leu. (denoted as "CDR3-4")

[0286] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Val, Xaa 33 Asp, Xaa 34 Ser, Xaa 35 is Ile. (denoted as "CDR3-5")

[0287] In some preferred embodiments, in the above formula (III), the above Xaa 31 Leu, Xaa 32 Val, Xaa 33 Glu, Xaa 34 Ser, Xaa 35 Leu. (denoted as "CDR3-6")

[0288] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Ile, Xaa 33 Glu, Xaa34 Ser, Xaa 35 Leu. (denoted as "CDR3-7")

[0289] In some preferred embodiments, in the above formula (III), the above Xaa 31 Ile, Xaa 32 Ile, Xaa 33 Glu, Xaa 34 Ser, Xaa 35 Leu. (denoted as "CDR3-8")

[0290] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Ile, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 Leu. (denoted as "CDR3-9")

[0291] In some preferred embodiments, in the above formula (III), the above Xaa 31 Leu, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 is Ile. (denoted as "CDR3-10")

[0292] In some preferred embodiments, in the above formula (III), the above Xaa 31 Leu, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 Leu. (denoted as "CDR3-11")

[0293] In some preferred embodiments, in the above formula (III), the above Xaa 31 Ile, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 Leu. (denoted as "CDR3-12")

[0294] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Leu, Xaa 33 Gln, Xaa34 Ser, Xaa 35 Leu. (denoted as "CDR3-13")

[0295] In some preferred embodiments, in the above formula (III), the above Xaa 31 Leu, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Thr, Xaa 35 Leu. (denoted as "CDR3-14")

[0296] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Thr, Xaa 35 Leu. (denoted as "CDR3-15")

[0297] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Val, Xaa 33 Glu, Xaa 34 Thr, Xaa 35 Leu. (denoted as "CDR3-16")

[0298] In some preferred embodiments, in the above formula (III), the above Xaa 31 Leu, Xaa 32 Val, Xaa 33 Asp, Xaa 34 Ser, Xaa 35 Leu. (denoted as "CDR3-17")

[0299] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Ile, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 Ile. (denoted as "CDR3-18")

[0300] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Leu, Xaa 33 Asp, Xaa34 Ser, Xaa 35 Leu. (denoted as "CDR3-19")

[0301] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Val, Xaa 33 Asp, Xaa 34 Ser, Xaa 35 Leu. (denoted as "CDR3-20")

[0302] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Leu, Xaa 33 Glu, Xaa 34 Gly, Xaa 35 Leu. (denoted as "CDR3-21")

[0303] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Leu, Xaa 33 Glu, Xaa 34 Ser, Xaa 35 Leu. (denoted as "CDR3-22")

[0304] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Leu, Xaa 33 Gln, Xaa 34 Thr, Xaa 35 Leu. (denoted as "CDR3-23")

[0305] In some preferred embodiments, in the above formula (III), the above Xaa 31 Ile, Xaa 32 Ile, Xaa 33 Glu, Xaa 34 Thr, Xaa 35 Leu. (denoted as "CDR3-24")

[0306] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Val, Xaa 33 Glu, Xaa34 Thr, Xaa 35 Ile. (denoted as "CDR3-25")

[0307] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Ile, Xaa 33 Glu, Xaa 34 Thr, Xaa 35 Leu. (denoted as "CDR3-26")

[0308] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Val, Xaa 33 Glu, Xaa 34 Ile, Xaa 35 Leu. (denoted as "CDR3-27")

[0309] In some preferred embodiments, in the above formula (III), the above Xaa 31 Leu, Xaa 32 Val, Xaa 33 Gln, Xaa 34 Thr, Xaa 35 Ile. (denoted as "CDR3-28")

[0310] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Leu, Xaa 33 Asp, Xaa 34 Thr, Xaa 35 Leu. (denoted as "CDR3-29")

[0311] In some preferred embodiments, in the above formula (III), the above Xaa 31 Leu, Xaa 32 Val, Xaa 33 Glu, Xaa 34 Thr, Xaa 35 Leu. (denoted as "CDR3-30")

[0312] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Val, Xaa 33 Gln, Xaa34 Thr, Xaa 35 is Ile. (denoted as "CDR3-31")

[0313] In some preferred embodiments, in the above formula (III), the above Xaa 31 Val, Xaa 32 Ile, Xaa 33 Gln, Xaa 34 Thr, Xaa 35 Leu. (denoted as "CDR3-32")

[0314] The amino acid sequence and structure of the above-mentioned Nanobodies include framework regions in addition to the three complementarity determining regions (CDR1 to CDR3).

[0315] The framework regions are more conserved than the complementarity determining regions. Those skilled in the art will perform reasonable screening of the sequence structure of the framework regions based on the actual use and function of the Nanobody. As amino acid sequences in the framework regions, amino acid sequences with a homology of 50% or more are preferred, further preferably amino acid sequences with a homology of 70% or more, and further preferably amino acid sequences with a homology of 95% or more are preferred.

[0316] The contribution of framework regions to affinity is relatively small, so amino acid substitutions in the framework regions generally do not affect the affinity of the Nanobody. As long as the Nanobody can be present in a soluble form, the amino acid substitutions in the framework regions are also suitable for the above-mentioned amino acid substitutions. Among them, humanization is a typical example of framework region amino acid substitutions. In the present invention, the framework region amino acid homology between A4-H1 and A4-003 is 82%, and the framework region amino acid homology between A4-H3 and A4-015 is 85%, neither of which affects the affinity of the original sequence.

[0317] Examples of the frame region include the frame region FR1, the frame region FR2, the frame region FR3, and the frame region FR4, but the present invention is not limited thereto.

[0318] Specific examples of the framework region include the following:

[0319] The framework region FR1 is represented by the following formula (IV):

[0320] ValGlnLeuGlnGluSerGlyGlyGlyXaa 41 Xaa 42 Xaa 43 Xaa 44 GlyGlySerLeuXaa 45 LeuSerCysXaa 46 Ala formula (Ⅳ)

[0321] The framework region FR2 is represented by the following formula (V):

[0322] Xaa 51 GlyTrpTyrArgXaa 52 Xaa 53 Xaa 54 Xaa 55 LysXaa 56 ArgGluXaa 57 ValaXaa 58 , (V);

[0323] The framework region FR3 is represented by the following formula (VI):

[0324] Xaa 61 TyrXaa 62 Xaa 63 Xaa 64 ValLysGlyArgPheThrIleSerArgAspAsnXaa 65 LysXaa 66 ThrXaa 67 TyrLeuGlnMAsnXaa 68 LeXaa 69 ProGluAspThrAlaValTyrTyrCys, (VI);

[0325] The framework region FR4 is represented by the following formula (VII):

[0326] TrpGlyGlnGlyThrGlnValThrValSerSer, (VII); wherein,

[0327] Xaa 41 Independently selected from Leu, Ala; and / or, Xaa 42 Independently selected from Val, Ala; and / or, Xaa 43 Independently selected from Gln, His; and / or, Xaa 44 independently selected from Pro, Ala, Ser, Thr; and / or, Xaa 45 independently selected from Arg, Lys; and / or, Xaa 46 Independently selected from Ala, Val, Leu, Ile, Phe; and / or, Xaa 51 independently selected from Met, Val; and / or, Xaa 52 independently selected from Gln, Arg; and / or, Xaa 53 independently selected from Ala, Arg; and / or, Xaa 54 independently selected from Pro, Ala; and / or, Xaa 55Independently selected from Gly, Pro, Ala, Arg; and / or, Xaa 56 Independently selected from Gln, Trp; and / or, Xaa 57 independently selected from Leu, Phe, Lys, Ile, Met; and / or, Xaa 58 independently selected from Thr, Ala, Ser, Pro, Asn; and / or, Xaa 61 independently selected from Asn, Ser, Lys, Thr, Trp; and / or, Xaa 62 Independently selected from Ala, Gly; and / or, Xaa 63 Independently selected from Gly, Asp, Glu, Asn; and / or, Xaa 64 independently selected from Ser, Phe; and / or, Xaa 65 Independently selected from Ala, Pro, Thr, Gly, Asp; and / or, Xaa 66 independently selected from Asn, Asp, Ser, Thr; and / or, Xaa 67 Independently selected from Val, Ile, Ala; and / or, Xaa 68 independently selected from Ser, Thr, Asn; and / or, Xaa 69 Independently selected from Arg, Gln.

[0328] The amino acid sequences of the above-mentioned Nanobodies include the following:

[0329] CDR1 is CDR1-1, CDR2 is CDR2-1, CDR3 is CDR3-1, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-001, SEQ ID No: 1); or,

[0330] CDR1 is CDR1-1, CDR2 is CDR2-1, CDR3 is CDR3-1, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-002, SEQ ID No: 2); or,

[0331] CDR1 is CDR1-1, CDR2 is CDR2-1, CDR3 is CDR3-1, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Val, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-003, SEQ ID No: 3); or,

[0332] CDR1 is CDR1-2, CDR2 is CDR2-1, CDR3 is CDR3-1, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-004, SEQ ID No: 4); or,

[0333] CDR1 is CDR1-3, CDR2 is CDR2-2, CDR3 is CDR3-1, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ala, Xaa 45 Arg, Xaa46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-005, SEQ ID No: 5); or,

[0334] CDR1 is CDR1-3, CDR2 is CDR2-1, CDR3 is CDR3-1, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-006, SEQ ID No: 6); or,

[0335] CDR1 is CDR1-3, CDR2 is CDR2-1, CDR3 is CDR3-1, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ala, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-007, SEQ ID No: 7); or,

[0336] CDR1 is CDR1-4, CDR2 is CDR2-1, CDR3 is CDR3-2, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ala, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 For Pro, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65Ala, Xaa 66 Asn, Xaa 67 Ile, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-008, SEQ ID No: 8); or

[0337] CDR1 is CDR1-2, CDR2 is CDR2-1, CDR3 is CDR3-2, Xaa 41 Leu, Xaa 42 Ala, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Phe, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Thr, Xaa 69 is Arg, (denoted as A4-009, SEQ ID No: 9); or

[0338] CDR1 is CDR1-5, CDR2 is CDR2-5, CDR3 is CDR3-3, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ala, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-010, SEQ ID No: 10); or,

[0339] CDR1 is CDR1-5, CDR2 is CDR2-5, CDR3 is CDR3-3, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ala, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-011, SEQ ID No: 11); or,

[0340] CDR1 is CDR1-5, CDR2 is CDR2-5, CDR3 is CDR3-3, Xaa 41 Ala, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ala, Xaa 45Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-012, SEQ ID No: 12); or,

[0341] CDR1 is CDR1-6, CDR2 is CDR2-5, CDR3 is CDR3-3, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-013, SEQ ID No: 13); or,

[0342] CDR1 is CDR1-6, CDR2 is CDR2-5, CDR3 is CDR3-3, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-014, SEQ ID No: 14); or,

[0343] CDR1 is CDR1-7, CDR2 is CDR2-6, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 Ala, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-015, SEQ ID No: 15); or,

[0344] CDR1 is CDR1-7, CDR2 is CDR2-6, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-016, SEQ ID No: 16); or,

[0345] CDR1 is CDR1-7, CDR2 is CDR2-3, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-017, SEQ ID No: 17); or,

[0346] CDR1 is CDR1-2, CDR2 is CDR2-5, CDR3 is CDR3-5, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ala, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Phe, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Glu, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-018, SEQ ID No: 18); or,

[0347] CDR1 is CDR1-8, CDR2 is CDR2-4, CDR3 is CDR3-2, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ala, Xaa45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-019, SEQ ID No: 19); or,

[0348] CDR1 is CDR1-8, CDR2 is CDR2-3, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ala, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-020, SEQ ID No: 20); or,

[0349] CDR1 is CDR1-8, CDR2 is CDR2-3, CDR3 is CDR3-2, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ala, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-021, SEQ ID No: 21); or,

[0350] CDR1 is CDR1-9, CDR2 is CDR2-8, CDR3 is CDR3-6, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa64 Phe, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-022, SEQ ID No: 22); or,

[0351] CDR1 is CDR1-10, CDR2 is CDR2-19, CDR3 is CDR3-6, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ser, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Ile, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-023, SEQ ID No: 23); or,

[0352] CDR1 is CDR1-11, CDR2 is CDR2-1, CDR3 is CDR3-3, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 For Pro, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-024, SEQ ID No: 24); or,

[0353] CDR1 is CDR1-11, CDR2 is CDR2-1, CDR3 is CDR3-3, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 For Pro, Xaa 66 Asp, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-025, SEQ ID No: 25); or,

[0354] CDR1 is CDR1-11, CDR2 is CDR2-1, CDR3 is CDR3-3, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 For Pro, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-026, SEQ ID No: 26); or,

[0355] CDR1 is CDR1-12, CDR2 is CDR2-12, CDR3 is CDR3-3, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69is Arg, (denoted as A4-027, SEQ ID No: 27); or,

[0356] CDR1 is CDR1-12, CDR2 is CDR2-11, CDR3 is CDR3-7, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-028, SEQ ID No: 28); or,

[0357] CDR1 is CDR1-12, CDR2 is CDR2-1, CDR3 is CDR3-8, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Arg, Xaa 54 Ala, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-029, SEQ ID No: 29); or,

[0358] CDR1 is CDR1-13, CDR2 is CDR2-1, CDR3 is CDR3-9, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Ile, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-030, SEQ ID No: 30); or,

[0359] CDR1 is CDR1-9, CDR2 is CDR2-14, CDR3 is CDR3-9, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-031, SEQ ID No: 31); or,

[0360] CDR1 is CDR1-14, CDR2 is CDR2-8, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Val, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asn, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-032, SEQ ID No: 32); or,

[0361] CDR1 is CDR1-14, CDR2 is CDR2-8, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Val, Xaa 51 Met, Xaa 52 Arg, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asn, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-033, SEQ ID No: 33); or,

[0362] CDR1 is CDR1-15, CDR2 is CDR2-9, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa69 is Arg, (denoted as A4-034, SEQ ID No: 34); or,

[0363] CDR1 is CDR1-15, CDR2 is CDR2-9, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ala, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-035, SEQ ID No: 35); or,

[0364] CDR1 is CDR1-15, CDR2 is CDR2-9, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Ala, Xaa 43 Gln, Xaa 44 Ala, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-036, SEQ ID No: 36); or,

[0365] CDR1 is CDR1-16, CDR2 is CDR2-1, CDR3 is CDR3-10, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-037, SEQ ID No: 37); or,

[0366] CDR1 is CDR1-17, CDR2 is CDR2-1, CDR3 is CDR3-11, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asn, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-038, SEQ ID No: 38); or,

[0367] CDR1 is CDR1-9, CDR2 is CDR2-1, CDR3 is CDR3-12, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Trp, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-039, SEQ ID No: 39); or

[0368] CDR1 is CDR1-18, CDR2 is CDR2-1, CDR3 is CDR3-9, Xaa 41 Leu, Xaa42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-040, SEQ ID No: 40); or,

[0369] CDR1 is CDR1-15, CDR2 is CDR2-1, CDR3 is CDR3-13, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asn, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa68 Ser, Xaa 69 is Arg, (denoted as A4-041, SEQ ID No: 41); or,

[0370] CDR1 is CDR1-4, CDR2 is CDR2-8, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-042, SEQ ID No: 42); or,

[0371] CDR1 is CDR1-4, CDR2 is CDR2-8, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-043, SEQ ID No: 43); or,

[0372] CDR1 is CDR1-14, CDR2 is CDR2-7, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-044, SEQ ID No: 44); or

[0373] CDR1 is CDR1-14, CDR2 is CDR2-7, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-045, SEQ ID No: 45); or,

[0374] CDR1 is CDR1-2, CDR2 is CDR2-1, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-046, SEQ ID No: 46); or,

[0375] CDR1 is CDR1-2, CDR2 is CDR2-1, CDR3 is CDR3-4, Xaa41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-047, SEQ ID No: 47); or,

[0376] CDR1 is CDR1-19, CDR2 is CDR2-5, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-048, SEQ ID No: 48); or,

[0377] CDR1 is CDR1-19, CDR2 is CDR2-5, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-049, SEQ ID No: 49); or

[0378] CDR1 is CDR1-20, CDR2 is CDR2-1, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-050, SEQ ID No: 50); or,

[0379] CDR1 is CDR1-20, CDR2 is CDR2-1, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Arg, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-051, SEQ ID No: 51); or,

[0380] CDR1 is CDR1-21, CDR2 is CDR2-1, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-052, SEQ ID No: 52); or,

[0381] CDR1 is CDR1-21, CDR2 is CDR2-1, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Arg, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-053, SEQ ID No: 53); or,

[0382] CDR1 is CDR1-10, CDR2 is CDR2-1, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-054, SEQ ID No: 54); or,

[0383] CDR1 is CDR1-16, CDR2 is CDR2-1, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-055, SEQ ID No: 55); or,

[0384] CDR1 is CDR1-10, CDR2 is CDR2-1, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Lys, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-056, SEQ ID No: 56); or,

[0385] CDR1 is CDR1-16, CDR2 is CDR2-1, CDR3 is CDR3-4, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa56 Gln, Xaa 57 Lys, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-057, SEQ ID No: 57); or,

[0386] CDR1 is CDR1-16, CDR2 is CDR2-8, CDR3 is CDR3-14, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Ala, Xaa 56 Gln, Xaa 57 Ile, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Glu, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-058, SEQ ID No: 58); or,

[0387] CDR1 is CDR1-22, CDR2 is CDR2-1, CDR3 is CDR3-15, Xaa 41 Ala, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Arg, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Ile, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-059, SEQ ID No: 59); or,

[0388] CDR1 is CDR1-23, CDR2 is CDR2-1, CDR3 is CDR3-15, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Ile, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Glu, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-060, SEQ ID No: 60); or,

[0389] CDR1 is CDR1-24, CDR2 is CDR2-1, CDR3 is CDR3-15, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asn, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-061, SEQ ID No: 61); or,

[0390] CDR1 is CDR1-25, CDR2 is CDR2-9, CDR3 is CDR3-6, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ala, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa64 Ser, Xaa 65 For Pro, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-062, SEQ ID No: 62); or,

[0391] CDR1 is CDR1-26, CDR2 is CDR2-4, CDR3 is CDR3-12, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Arg, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 For Pro, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-063, SEQ ID No: 63); or,

[0392] CDR1 is CDR1-27, CDR2 is CDR2-15, CDR3 is CDR3-16, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ser, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Val, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-064, SEQ ID No: 64); or,

[0393] CDR1 is CDR1-27, CDR2 is CDR2-1, CDR3 is CDR3-3, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ser, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Val, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-065, SEQ ID No: 65); or,

[0394] CDR1 is CDR1-28, CDR2 is CDR2-1, CDR3 is CDR3-3, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa44 Thr, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-066, SEQ ID No: 66); or,

[0395] CDR1 is CDR1-28, CDR2 is CDR2-1, CDR3 is CDR3-3, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Thr, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Trp, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Thr, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Asn, Xaa 69is Arg, (denoted as A4-067, SEQ ID No: 67); or,

[0396] CDR1 is CDR1-28, CDR2 is CDR2-1, CDR3 is CDR3-3, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Thr, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Trp, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Asn, Xaa 69 is Arg, (denoted as A4-068, SEQ ID No: 68); or,

[0397] CDR1 is CDR1-29, CDR2 is CDR2-5, CDR3 is CDR3-17, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Trp, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62Ala, Xaa 63 Asn, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Thr, Xaa 69 is Arg, (denoted as A4-069, SEQ ID No: 69); or

[0398] CDR1 is CDR1-5, CDR2 is CDR2-1, CDR3 is CDR3-17, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Trp, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asn, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Thr, Xaa 69 is Arg, (denoted as A4-070, SEQ ID No: 70); or,

[0399] CDR1 is CDR1-8, CDR2 is CDR2-1, CDR3 is CDR3-11, Xaa 41 Ala, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ala, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Gly, Xaa 63 Asp, Xaa 64 Phe, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Thr, Xaa 69 is Arg, (denoted as A4-071, SEQ ID No: 71); or,

[0400] CDR1 is CDR1-20, CDR2 is CDR2-1, CDR3 is CDR3-13, Xaa 41 Leu, Xaa 42 Ala, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Phe, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Gly, Xaa 63 Glu, Xaa 64 Phe, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-072, SEQ ID No: 72); or,

[0401] CDR1 is CDR1-12, CDR2 is CDR2-1, CDR3 is CDR3-18, Xaa 41 Leu, Xaa 42Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Met, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Gly, Xaa 63 Asp, Xaa 64 Phe, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-073, SEQ ID No: 73); or,

[0402] CDR1 is CDR1-30, CDR2 is CDR2-17, CDR3 is CDR3-13, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ser, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Ser, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68Ser, Xaa 69 is Arg, (denoted as A4-074, SEQ ID No: 74); or,

[0403] CDR1 is CDR1-30, CDR2 is CDR2-17, CDR3 is CDR3-13, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ser, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-075, SEQ ID No: 75); or,

[0404] CDR1 is CDR1-30, CDR2 is CDR2-17, CDR3 is CDR3-13, Xaa 41 Leu, Xaa 42 Val, Xaa 43 His, Xaa 44 Ser, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61Ser, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-076, SEQ ID No: 76); or,

[0405] CDR1 is CDR1-19, CDR2 is CDR2-4, CDR3 is CDR3-19, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Phe, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Phe, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-077, SEQ ID No: 77); or,

[0406] CDR1 is CDR1-31, CDR2 is CDR2-1, CDR3 is CDR3-20, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Leu, Xaa 51 Met, Xaa 52Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Phe, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-078, SEQ ID No: 78); or

[0407] CDR1 is CDR1-32, CDR2 is CDR2-13, CDR3 is CDR3-19, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Asn, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-079, SEQ ID No: 79); or,

[0408] CDR1 is CDR1-24, CDR2 is CDR2-1, CDR3 is CDR3-21, Xaa 41Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Phe, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-080, SEQ ID No: 80); or,

[0409] CDR1 is CDR1-24, CDR2 is CDR2-1, CDR3 is CDR3-21, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-081, SEQ ID No: 81); or,

[0410] CDR1 is CDR1-24, CDR2 is CDR2-1, CDR3 is CDR3-21, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Lys, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Phe, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-082, SEQ ID No: 82); or,

[0411] CDR1 is CDR1-24, CDR2 is CDR2-5, CDR3 is CDR3-22, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Thr, Xaa 45 Lys, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Arg, Xaa 56 Gln, Xaa 57 Phe, Xaa 58Ala, Xaa 61 Asn, Xaa 62 Gly, Xaa 63 Asp, Xaa 64 Phe, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-083, SEQ ID No: 83); or,

[0412] CDR1 is CDR1-24, CDR2 is CDR2-5, CDR3 is CDR3-22, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Lys, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Arg, Xaa 56 Gln, Xaa 57 Phe, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Gly, Xaa 63 Asp, Xaa 64 Phe, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-084, SEQ ID No: 84); or

[0413] CDR1 is CDR1-24, CDR2 is CDR2-5, CDR3 is CDR3-22, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Phe, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Gly, Xaa 63 Asp, Xaa 64 Phe, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-085, SEQ ID No: 85); or

[0414] CDR1 is CDR1-24, CDR2 is CDR2-5, CDR3 is CDR3-22, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Phe, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-086, SEQ ID No: 86); or,

[0415] CDR1 is CDR1-24, CDR2 is CDR2-5, CDR3 is CDR3-22, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Gly, Xaa 63 Asp, Xaa 64 Phe, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-087, SEQ ID No: 87); or,

[0416] CDR1 is CDR1-24, CDR2 is CDR2-5, CDR3 is CDR3-22, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Thr, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Gly, Xaa 63 Asp, Xaa 64 Phe, Xaa65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-088, SEQ ID No: 88); or,

[0417] CDR1 is CDR1-12, CDR2 is CDR2-10, CDR3 is CDR3-20, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Gly, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-089, SEQ ID No: 89); or,

[0418] CDR1 is CDR1-33, CDR2 is CDR2-20, CDR3 is CDR3-16, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Val, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Glu, Xaa 64 Ser, Xaa 65 Gly, Xaa 66 Ser, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-090, SEQ ID No: 90); or,

[0419] CDR1 is CDR1-2, CDR2 is CDR2-8, CDR3 is CDR3-23, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Arg, Xaa 54 Ala, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Thr, Xaa 62 Ala, Xaa 63 Asn, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-091, SEQ ID No: 91); or,

[0420] CDR1 is CDR1-16, CDR2 is CDR2-18, CDR3 is CDR3-7, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Thr, Xaa45 Arg, Xaa 46 Leu, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Arg, Xaa 54 Ala, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-092, SEQ ID No: 92); or,

[0421] CDR1 is CDR1-21, CDR2 is CDR2-1, CDR3 is CDR3-13, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Thr, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Arg, Xaa 54 Ala, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Thr, Xaa 69 is Arg, (denoted as A4-093, SEQ ID No: 93); or,

[0422] CDR1 is CDR1-34, CDR2 is CDR2-16, CDR3 is CDR3-8, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Val, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-094, SEQ ID No: 94); or

[0423] CDR1 is CDR1-35, CDR2 is CDR2-3, CDR3 is CDR3-24, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Gly, Xaa 63 Asp, Xaa64 Ser, Xaa 65 Ala, Xaa 66 Asp, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-095, SEQ ID No: 95); or,

[0424] CDR1 is CDR1-35, CDR2 is CDR2-3, CDR3 is CDR3-24, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ile, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Gly, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-096, SEQ ID No: 96); or,

[0425] CDR1 is CDR1-36, CDR2 is CDR2-3, CDR3 is CDR3-7, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ile, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Gly, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Thr, Xaa 69 is Arg, (denoted as A4-097, SEQ ID No: 97); or,

[0426] CDR1 is CDR1-16, CDR2 is CDR2-3, CDR3 is CDR3-7, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ile, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Gly, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Thr, Xaa 69 is Arg, (denoted as A4-098, SEQ ID No: 98); or,

[0427] CDR1 is CDR1-14, CDR2 is CDR2-11, CDR3 is CDR3-8, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa44 Thr, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Trp, Xaa 57 Leu, Xaa 58 Ala, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Glu, Xaa 64 Ser, Xaa 65 Gly, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-099, SEQ ID No: 99); or,

[0428] CDR1 is CDR1-34, CDR2 is CDR2-12, CDR3 is CDR3-25, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ser, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Asp, Xaa 66 Asn, Xaa 67 Ile, Xaa 68 Ser, Xaa 69is Arg, (denoted as A4-100, SEQ ID No: 100); or,

[0429] CDR1 is CDR1-37, CDR2 is CDR2-9, CDR3 is CDR3-26, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ser, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 For Pro, Xaa 66 Asn, Xaa 67 Ile, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-101, SEQ ID No: 101); or,

[0430] CDR1 is CDR1-38, CDR2 is CDR2-9, CDR3 is CDR3-19, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Val, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 For Pro, Xaa 61 Asn, Xaa 62Ala, Xaa 63 Asp, Xaa 64 Phe, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-102, SEQ ID No: 102); or,

[0431] CDR1 is CDR1-39, CDR2 is CDR2-4, CDR3 is CDR3-27, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-103, SEQ ID No: 103); or,

[0432] CDR1 is CDR1-40, CDR2 is CDR2-21, CDR3 is CDR3-3, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Asn, Xaa 69 is Gln, (denoted as A4-104, SEQ ID No: 104); or,

[0433] CDR1 is CDR1-39, CDR2 is CDR2-21, CDR3 is CDR3-27, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Ala, Xaa 68 Asn, Xaa 69 is Gln, (denoted as A4-105, SEQ ID No: 105); or,

[0434] CDR1 is CDR1-39, CDR2 is CDR2-21, CDR3 is CDR3-27, Xaa 41 Leu, Xaa42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ile, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Ala, Xaa 68 Asn, Xaa 69 is Gln, (denoted as A4-106, SEQ ID No: 106); or,

[0435] CDR1 is CDR1-9, CDR2 is CDR2-12, CDR3 is CDR3-2, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ile, Xaa 51 Val, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Ala, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 For Pro, Xaa 66 Asn, Xaa 67 Val, Xaa68 Ser, Xaa 69 is Arg, (denoted as A4-107, SEQ ID No: 107); or,

[0436] CDR1 is CDR1-9, CDR2 is CDR2-1, CDR3 is CDR3-28, Xaa 41 Leu, Xaa 42 Ala, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Leu, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 For Pro, Xaa 56 Trp, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 For Pro, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-108, SEQ ID No: 108); or,

[0437] CDR1 is CDR1-41, CDR2 is CDR2-5, CDR3 is CDR3-29, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Ala, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Ser, Xaa61 Asn, Xaa 62 Ala, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Thr, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-109, SEQ ID No: 109); or,

[0438] CDR1 is CDR1-42, CDR2 is CDR2-4, CDR3 is CDR3-17, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Phe, Xaa 51 Val, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Ala, Xaa 63 Glu, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Val, Xaa 68 Asn, Xaa 69 is Arg, (denoted as A4-110, SEQ ID No: 110); or,

[0439] CDR1 is CDR1-12, CDR2 is CDR2-4, CDR3 is CDR3-30, Xaa 41 Leu, Xaa 42 Ala, Xaa 43 Gln, Xaa 44 For Pro, Xaa 45 Arg, Xaa 46 Ala, Xaa 51 Met, Xaa52 Gln, Xaa 53 Arg, Xaa 54 Ala, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Phe, Xaa 58 Thr, Xaa 61 Asn, Xaa 62 Gly, Xaa 63 Asp, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Thr, Xaa 67 Val, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-111, SEQ ID No: 111); or,

[0440] CDR1 is CDR1-16, CDR2 is CDR2-18, CDR3 is CDR3-31, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Thr, Xaa 45 Arg, Xaa 46 Ile, Xaa 51 Val, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 For Pro, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Trp, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Ala, Xaa 66 Asn, Xaa 67 Ile, Xaa 68 Thr, Xaa 69 is Arg, (denoted as A4-112, SEQ ID No: 112); or,

[0441] CDR1 is CDR1-2, CDR2 is CDR2-1, CDR3 is CDR3-32, Xaa41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Thr, Xaa 45 Arg, Xaa 46 Val, Xaa 51 Val, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Trp, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Thr, Xaa 66 Asn, Xaa 67 Ile, Xaa 68 Ser, Xaa 69 is Arg, (denoted as A4-113, SEQ ID No: 113); or,

[0442] CDR1 is CDR1-16, CDR2 is CDR2-18, CDR3 is CDR3-23, Xaa 41 Leu, Xaa 42 Val, Xaa 43 Gln, Xaa 44 Thr, Xaa 45 Arg, Xaa 46 Val, Xaa 51 Val, Xaa 52 Gln, Xaa 53 Ala, Xaa 54 For Pro, Xaa 55 Gly, Xaa 56 Gln, Xaa 57 Leu, Xaa 58 Thr, Xaa 61 Trp, Xaa 62 Ala, Xaa 63 Gly, Xaa 64 Ser, Xaa 65 Thr, Xaa 66 Asn, Xaa67 Ile, Xaa 68 Ser, Xaa 69 is Arg (denoted as A4-114, SEQ ID No: 114).

[0443] However, it is not limited to the above examples, as long as there is little or substantially no effect on the function, activity or other biological properties of the polypeptide.

[0444] Furthermore, the total number of residues in a Nanobody may be in the range of 110 to 120. However, parts, fragments or analogs of Nanobodies are not particularly limited in their length and / or size, as long as such parts, fragments or analogs meet the further requirements listed below and are also suitable for the purposes described herein.

[0445] The Nanobodies of the present invention belong to the same family of Nanobodies, whose amino acid sequences have the same overall length, and whose framework regions (FRs) and antigen-binding regions (CDRs) have the same length and high sequence identity, similar structures, and substantially equivalent antigen-binding abilities. The framework regions (FRs) and complementarity-determining regions (CDRs) are arranged in a staggered order, such as FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0446] The method for preparing a "Nanobody" in its broadest sense is not limited to a specific biological source or a specific method of preparation. For example, the Nanobodies of the present invention can be obtained by: (1) isolating the V chain of a naturally occurring heavy chain antibody; HH domain; (2) by expressing a naturally occurring V HH The nucleotide sequence of the domain; (3) by HH domains are "humanized" (as described below) or by expressing a protein encoding the humanized V HH (4) preparing a protein, polypeptide or other amino acid sequence using synthetic or semi-synthetic techniques; (5) preparing a nucleic acid encoding a Nanobody by applying nucleic acid synthesis techniques and then expressing the nucleic acid thus obtained; and / or (6) by any combination of the foregoing.

[0447] In addition, based on a variant of the nanobody of the invention, it also includes a V HH Nanobodies with amino acid sequences that correspond to the humanized domains. Humanization is the use of V domains from conventional human 4-chain antibodies. H One or more amino acid residues present at corresponding positions in the structural domain replace the naturally occurring V HH One or more amino acid residues of a domain sequence.

[0448] Specific examples of Nanobodies with humanized amino acid sequences include SEQ ID No: 115 (denoted as "A4-H1"), SEQ ID No: 116 (denoted as "A4-H2"), SEQ ID No: 117 (denoted as "A4-H3"), SEQ ID No: 118 (denoted as "A4-H4"), SEQ ID No: 119 (denoted as "A4-H5"), and SEQ ID No: 120 (denoted as "A4-H6"), but are not limited thereto.

[0449] Furthermore, the present invention also relates to a HH The domain or at least one protein or polypeptide based thereon can be exemplified by SEQ ID No: 147.

[0450] According to one non-limiting embodiment of the invention, the above-mentioned polypeptide essentially consists of a Nanobody. "Essentially consists of" means that the amino acid sequence of the polypeptide of the invention is identical or corresponds to the amino acid sequence of a Nanobody, wherein a limited number of amino acid residues, such as 1 to 10 amino acid residues, and preferably 1 to 6 amino acid residues, such as 1, 2, 3, 4, 5 or 6 amino acid residues, is added to the amino terminus (N-terminus) and / or carboxyl terminus (C-terminus) of said Nanobody or polypeptide.

[0451] The above amino acid residues may not change the biological properties of the Nanobody and may add other functionalities to the Nanobody. For example, the amino acid residues may:

[0452] a is a purification tag, i.e. an amino acid sequence or residue that facilitates the purification of the Nanobody, for example, using affinity techniques directed against said sequence or residue. Some preferred, but non-limiting examples of such residues are groups of His-tags (His6 or His8), GST-tag, MBP-tag, Myc-tag, Strep-tag, Flag-tag, HA-tag, V5-tag, S-tag, E-tag;

[0453] b is a soluble tag, i.e., a tag that helps increase the solubility of the nanobody, such as SUMO;

[0454] c is an N-terminal amino acid residue, for example, Met, Ala, Gln or MetAlaGln, AlaGln, thereby enabling expression in a heterologous host cell or host organism;

[0455] d is a C-terminal Cys residue, which can react with -SH on the ligand or with the Au surface, for example;

[0456] e is a hinge to provide a link or spacer between the nanobody and other groups, for example, a combination of GlySer, an IgG hinge, an IgA hinge, or other artificially synthesized hinges;

[0457] f is one or more amino acid residues which may be provided with functional groups and / or have been functionalized in a known manner, for example amino acid residues such as lysine or cysteine ​​allowing attachment of a PEG group as is known in the art.

[0458] The polypeptides of the present invention may also comprise two or more of said Nanobodies, also known as multivalent polypeptides.

[0459] A bivalent polypeptide of the invention comprises two Nanobodies, optionally linked by one hinge sequence, a trivalent polypeptide of the invention comprises three Nanobodies, optionally linked by two hinge sequences, and a tetravalent polypeptide of the invention comprises four Nanobodies, optionally linked by three hinge sequences.

[0460] In the multivalent polypeptides of the invention, the two or more Nanobodies may be the same or different. For example, the two or more Nanobodies in the multivalent polypeptides of the invention may be directed against the same antigen, i.e. against the same epitope of said antigen or against two or more different epitopes of said antigen; may be directed against different antigens; or a combination thereof.

[0461] For example, the bivalent polypeptide AA or AB of the present invention may include two identical Nanobodies A, or two different Nanobodies A and Nanobodies B, wherein at least one of Nanobodies A and B is selected from the Nanobodies of the present invention; may include a first Nanobody directed against a certain epitope of a first antigen and a second Nanobody directed against the same epitope or a different epitope of the antigen; may include a first Nanobody directed against a first antigen and a second Nanobody directed against a second antigen different from the first antigen. Specific examples of amino acid sequences of bivalent polypeptides include, but are not limited to, SEQ ID No: 121 (denoted as "A4-B1") and SEQ ID No: 122 (denoted as "A4-B2"). In addition, specific examples of humanized bivalent polypeptides include, but are not limited to, SEQ ID No: 123 (denoted as "A4-B3") and SEQ ID No: 124 (denoted as "A4-B4").

[0462] For example, the trivalent polypeptides AAA, AAB, and ABC of the present invention may include three identical Nanobodies A, may include two identical Nanobodies A and another Nanobody B, may include three different Nanobodies A, Nanobody B, and Nanobody C, wherein at least one of Nanobodies A, B, and C is selected from the Nanobodies of the present invention, and the order of the three is not limited; may include identical or different Nanobodies directed against the same antigen; may include two identical or different Nanobodies directed against the same or different epitopes of a first antigen and a third Nanobody directed against a second antigen different from the first antigen; may include a first Nanobody directed against a first antigen, a second Nanobody directed against a second antigen different from the first antigen, and a third Nanobody directed against a third antigen different from the first and second antigens.

[0463] For example, the tetravalent polypeptides AAAA, AAAB, AABC, ABCD of the invention (in any order) may comprise four identical Nanobodies A, three identical Nanobodies A and another Nanobody B, two identical Nanobodies A and two other different Nanobodies B and Nanobody C, or four different Nanobodies A, Nanobodies B, Nanobodies C and Nanobody D, wherein at least one of Nanobodies A, B, C and D is selected from the Nanobodies of the invention, and the order of the four is not limited; may comprise identical or different Nanobodies directed against the same antigen; may comprise two identical or different Nanobodies directed against the same or different epitopes of a first antigen and a third Nanobodies directed against a second antigen different from the first antigen; may comprise a first Nanobody directed against a first antigen, a second Nanobody directed against a second antigen different from the first antigen, and a third Nanobody directed against a third antigen different from the first and second antigens; may comprise a first Nanobody directed against a first antigen, a second Nanobody directed against a second antigen different from the first antigen, a third Nanobody directed against a third antigen different from the first and second antigens, and a fourth Nanobody directed against a fourth antigen different from the first and second antigens and different from the third antigen.

[0464] Polypeptides of the invention comprising at least two Nanobodies, wherein at least one Nanobody is directed against a first antigen and at least one Nanobody is directed against a second Nanobody different from said first antigen (or a second Nanobody directed against a different epitope of the first antigen), are also called "multispecific" antibodies. Thus, a bispecific antibody is one comprising at least one Nanobody directed against a first antigen and at least one further Nanobody directed against a second antigen, while a trispecific antibody is one comprising at least one Nanobody directed against a first antigen, at least one further Nanobody directed against a second antigen, and at least one further Nanobody directed against a third antigen; and so on.

[0465] Specific examples of the amino acid sequence of a multivalent polypeptide include trivalent polypeptides having amino acid sequences of SEQ ID No: 125 (denoted as "A4-C1"), SEQ ID No: 126 (denoted as "A4-C2"), SEQ ID No: 127 (denoted as "A4-C3"), SEQ ID No: 128 (denoted as "A4-C4"), SEQ ID No: 129 (denoted as "A4-C5"), SEQ ID No: 130 (denoted as "A4-C6"), SEQ ID No: 131 (denoted as "A4-C7"), SEQ ID No: 132 (denoted as "A4-C8"), and SEQ ID No: 133 (denoted as "A4-C9"). Examples of tetravalent polypeptides include amino acid sequences of SEQ ID No: 134 (denoted as "A4-D1"), SEQ ID No: 135 (denoted as "A4-D2"), and SEQ ID No: 136 (denoted as "A4-D3"). No.: 136 (recorded as "A4-D3"), SEQ ID No.: 137 (recorded as "A4-D4"), SEQ ID No.: 138 (recorded as "A4-D5"), SEQ ID No.: 139 (recorded as "A4-D6"), SEQ ID No.: 140 (recorded as "A4-D7"), SEQ ID No.: 141 (recorded as "A4-D8"), SEQ ID No.: 142 (recorded as "A4-D9"), SEQ ID No.: 143 (recorded as "A4-D10"), SEQ ID No.: 144 (recorded as "A4-D11"), SEQ ID No.: 145 (recorded as "A4-D12"), and SEQ ID No.: 146 (recorded as "A4-D13"), but are not limited thereto.

[0466] About containing one or more V HH For multivalent and multispecific polypeptides of the structural domain and their preparation, reference may be made to the description in EP 0822985.

[0467] Hinges for multivalent and multispecific polypeptides are well known to those skilled in the art and may include, for example, Gly-Ser, such as (Gly4Ser)3 or (Gly3Ser2)3 described in WO 99 / 42077, or naturally occurring heavy chain antibody hinge regions or portions thereof. For other suitable hinges, reference is also made to the general background art cited above.

[0468] Furthermore, in addition to the one or more Nanobodies, the polypeptides of the invention may also comprise functional groups, parts or residues, such as therapeutically active substances, and / or labels, such as fluorescent labels, isotope labels, biotin labels and enzyme catalytic labels, etc.

[0469] In addition, the dissociation equilibrium constant (K D ) is 10 -6 ~10 -11 Mole / liter (M), preferably 10 -7 ~10 -11 Mole / liter (M), more preferably 10 -8 ~10 -10 Mole / liter (M).

[0470] The specific binding between the above-mentioned antigen and the antigen-binding molecule can be determined by any suitable known method, including Sercatchard analysis and / or competitive binding assays such as radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA), as well as other novel methods known in the art, such as plasma resonance technology (SPR) and / or biomembrane interferometry (BLI) technology.

[0471] The Nanobodies, polypeptides, and nucleic acids encoding the same of the invention can be prepared in a known manner, as will be apparent to those skilled in the art from the further description herein. A particularly useful method for preparing such Nanobodies, polypeptides, and nucleic acids generally comprises the following steps:

[0472] (1) expressing a nucleic acid encoding said Nanobody or polypeptide of the invention in a suitable host cell or host organism or in another suitable expression system, optionally followed by;

[0473] (2) Isolating and / or purifying the Nanobodies or polypeptides of the invention thus obtained.

[0474] Alternatively, another method may include the following steps:

[0475] (3) culturing and / or maintaining the host of the present invention under conditions such that the host of the present invention expresses and / or produces a Nanobody and / or polypeptide of the present invention; optionally followed by;

[0476] (4) Isolating and / or purifying the Nanobody or polypeptide of the invention thus obtained.

[0477] Nucleic acid of the present invention can be the form of single-stranded or double-stranded DNA or RNA, and preferably double-stranded DNA form.For example, nucleotide sequence of the present invention can be genomic DNA, cDNA or synthetic DNA (as DNA with codon utilization that is particularly suitable for expressing in the host cell that will use or host organism, that is, codon optimized).

[0478] The nucleic acids of the invention can be prepared or obtained in a manner known per se, based on the information given herein on the amino acid sequences of the Nanobodies or polypeptides of the invention, and / or can be isolated from suitable natural sources. For example, for naturally occurring V HH The nucleic acid sequence of the structural domain is subjected to site-directed mutagenesis to provide the nucleic acid of the present invention encoding the analog.

[0479] Nucleic acid of the present invention can also be such form, is present in and / or is the part of genetic construct, and this is well known to those skilled in the art.Such genetic construct usually comprises at least a nucleic acid of the present invention, can be vector form, as plasmid, YAC, viral vector or transposon.Especially, said carrier can be an expression vector, that is, can provide the carrier (as in suitable host cell, host organism and / or expression system) of external and internal expression.

[0480] The nucleic acids of the invention and / or the genetic constructs of the invention can be used to transform host cells or host organisms, i.e. for the expression and / or production of the Nanobodies or polypeptides of the invention. Suitable hosts or host cells are well known to those skilled in the art and may, for example, be any suitable fungal, prokaryotic or eukaryotic cell or organelle or organism, such as: bacterial strains including but not limited to Escherichia coli and Bacillus subtilis; fungal cells including but not limited to Trichoderma, Aspergillus or other filamentous fungi; yeast cells including but not limited to Seraccharomyces and Pichia; amphibian cells or cell lines, such as Xenopus oocytes; oocytes); cells or cell lines derived from insects, such as Serpodoptera Serf9 and Serf21 cells or Drosophila cell lines Serchneider and Kc cells; plants or plant cells, such as tobacco plants; mammalian cells or cell lines, such as cells or cell lines derived from humans and / or other mammals, including but not limited to CHO cells, BHK cells, Hela cells and CHS cells, etc.; and all other hosts or host cells known per se for the expression and production of antibodies and antibody fragments (including but not limited to single domain antibodies and ScFv fragments), which are well known to those skilled in the art.

[0481] For production, the Nanobodies and polypeptides of the invention can be produced in the milk of transgenic mammals, for example in the milk of rabbits, cows, goats or sheep, but also in plants or parts of plants, including but not limited to their leaves, flowers, fruits, roots or seeds.

[0482] As mentioned above, one advantage of using Nanobodies is that polypeptides based thereon can be expressed and produced in prokaryotic systems, and suitable prokaryotic expression systems, vectors, host cells, etc. are well known to those skilled in the art, for example, as cited in the references above. However, it should be noted that the present invention in its broadest sense is not limited to expression in bacterial systems.

[0483] Preferably, in the present invention, the Nanobodies or polypeptides are produced in bacterial cells, in particular in bacterial cells suitable for large-scale pharmaceutical production, as described above.

[0484] When the Nanobodies or polypeptides of the invention are expressed for production in cells, the Nanobodies or polypeptides of the invention can be produced intracellularly (e.g. in the cytoplasm or periplasmic space), then isolated from the host cell and optionally further purified; or can be produced extracellularly (i.e. secretory expression), then isolated from the culture medium and optionally further purified.

[0485] Some preferred but non-limiting vectors for use with these host cells include vectors for expression in mammalian cells - pMANneo (Clonetech), pUCTtag (ATCC37460) and pMClneo (Stratagene); vectors for expression in bacterial cells - pET vectors (Novagen) and pQE vectors (Qiagen); vectors for expression in yeast or other fungal cells - pYES2 (Invitrogen) and Picha expression vector (Invitrogen); vectors for expression in insect cells - pBlueBacⅡ (Invitrogen) and other baculovirus vectors; and the like.

[0486] The corresponding techniques for transforming the host or host cell of the present invention are well known to those skilled in the art.

[0487] After the conversion, it is possible to detect and select those hosts that have successfully converted nucleotide sequence of the present invention / genetic construct. The transformed host cell (which can be the form of a stable cell line) or the host organism (which can be the form of a stable mutant line or strain) form another aspect of the present invention.

[0488] The amino acid sequence of the invention can then be isolated from the host cells / host organisms and / or from the culture medium in which said host cells or host organisms are cultivated, by means of protein separation and / or purification techniques known per se, such as (preparative) chromatography and / or electrophoresis techniques, differential precipitation techniques, affinity techniques (e.g. using specific / cleavable amino acid sequences fused to the amino acid sequence of the invention) and / or preparative immunological techniques (i.e. using antibodies directed against the amino acid sequence to be isolated).

[0489] The nanobody or polypeptide of the present invention can specifically bind to the antigen AAV, so a preferred but non-limiting application of the present invention is an AAV adsorbent, which comprises a carrier matrix and the nanobody or polypeptide.

[0490] The aforementioned AAV includes AAV1 to AAV10 classified by serotype, and the nanoantibody of the present invention has a broad-spectrum adsorption capacity for different serotypes of AAV.

[0491] The aforementioned carrier matrix can be a porous material, for example, agarose gel microspheres, cellulose spheres, magnetic beads, silica microspheres, activated carbon or resin microspheres.

[0492] The carrier used for the aforementioned adsorbent can be obtained through commercial purchase. Specific examples include, but are not limited to, Sepharose CL-6B (GE Healthcare, US) and Nanomicro resin microspheres (Suzhou Nanomicro Technology Co., Ltd.).

[0493] When using the above-mentioned support, it is preferred that the support be activated. The activation method may be, for example, but not limited to, the following method: first, epoxy activation, then diaminopropylimide (DADPA) activation, and finally, iodoacetic acid activation, etc.

[0494] The aforementioned adsorbent is obtained by coupling a nanobody or polypeptide to an activated carrier. The specific method is not particularly limited. For example, the purified nanobody or polypeptide solution can be mixed with the carrier and separated by centrifugation, and finally the final adsorbent can be obtained by washing / filtering the gel.

[0495] The adsorbent of the present invention can be used to specifically identify AAV.

[0496] The nanobody, polypeptide or adsorbent of the present invention can be used to purify AAV and can also be used to prepare a kit for detecting AAV.

[0497] Example

[0498] The following examples are given to illustrate the specific implementation of the present invention, but the implementation of the present invention is not limited to the following examples. Any selection and change can be made within the scope that does not affect the technical effects to be achieved by the present invention.

[0499] A. Screening for Nanobodies that Specifically Bind to AAV

[0500] Example 1

[0501] Construction of anti-AAV nanobody library.

[0502] The phage display library used in the present invention is an immune library with T7 phage as the carrier, and the establishment steps are as follows:

[0503] (1) Alpacas (numbers 1139 and 462) were immunized with AAV. After four immunizations, jugular vein blood was collected from two alpacas, peripheral blood lymphocytes were isolated, and total RNA was extracted (PuerLink TM RNA Mini Kit, Life Technologies: 12183018A);

[0504] (3) Total RNA was reverse transcribed into cDNA and amplified using two rounds of nested PCR. HH Gene;

[0505] In the first round of PCR, cDNA was used as a template, with UP primer 1 and DOWN primer 1 as upstream and downstream primers, respectively. After amplification, a band of 650 to 750 bp was recovered. This band was used as a template for the second round of PCR, with UP primer 2 and DOWN primer 2 as upstream and downstream primers, respectively. A PCR product of 450 to 500 bp was recovered.

[0506] UP primer1:CTTGGTGGTCCTGGCTGCTCT(SEQ ID No:152),

[0507] DOWN primer1:GGTACGTGCTGTTGAACTGTTCC (SEQ ID No:153),

[0508] UP primer2: TATCTAGTCGAATTCCGCCCAGGTGCAGCTC (SEQ ID No: 154),

[0509] DOWN primer2: AGCGACTAAGCTT TTGTGGTTTTGGTGTC (SEQ ID No: 155);

[0510] (3) The PCR product was double-digested with EcoRI and HindIII, and subjected to agarose electrophoresis to recover the 350-500 bp gene band, which was V HH gene fragments;

[0511] (4) Use T4 ligase to connect the T7 vector ( Cloning Kit,Meterck Metillipore 70550-3) and V HH gene fragments;

[0512] (5) Mixing the ligation product with the packaging protein to form a complete T7 phage, and amplifying the mixture to obtain the original phage library;

[0513] (6) After testing, the titer of the original library was 3.14×10 10 pfu / mL, with a diversity of 1.7×10 6 .

[0514] Example 2

[0515] Screening of nanobodies.

[0516] First, dilute the antigen (AAV2) to 10 μg / mL in TBS, add 100 μL to a 96-well plate, and incubate at 4°C for 12 hours. Aspirate the antigen dilution, wash the plate three times with TBS, pat dry, and add 300 μL / well of 1% protein-free blocking buffer (purchased from Sangon Biotech Co., Ltd.) and incubate at room temperature for 2 hours. (Alternate between 1% protein-free blocking buffer and 1% BSA during screening.) Aspirate the blocking buffer, wash the plate six times with TBST, pat dry, and add 100 μL / well of amplified phage. Incubate at room temperature for 30 minutes. Wash the plate ten times with TBST, elute the phage with T7 elution buffer (1% SDS), incubate at room temperature for 30 minutes, and amplify the eluate for the next round of screening.

[0517] The antigen (AAV5) was then diluted and coated in the same manner, and the eluate was incubated, panned, and amplified again for the next round of screening.

[0518] The antigen (AAV8) was diluted and coated in the same manner, and the eluate was incubated, panned, and amplified again for the next round of screening.

[0519] The antigen (AAV9) was diluted and coated in the same manner, and the above eluate was incubated, panned, and amplified again.

[0520] Example 3

[0521] Construction of genetically engineered bacteria

[0522] (1) After four rounds of screening, the screening eluate was subjected to solid amplification, plaques were picked, and PCR amplification was performed using the plaque amplification solution as a template and UP primer 3 and DOWN primer 3 as upstream and downstream primers;

[0523] UP primer3:TTCCTTAACATATGGCCCAGGTGCAGCTCGT (SEQ ID No: 156),

[0524] DOWN primer3: TTAAGGAACTCGAGCACGGTGACCAGGGTC (SEQ ID No: 157);

[0525] (2) A portion of the PCR product was outsourced for sequencing to obtain the sequence information of the nanobody, as shown in Table 1.

[0526] (3) Another portion of the PCR product was double-digested with NdeI and XhoI, and the digestion product was recovered. Simultaneously, the digestion product and the vector were recovered using the same method, and the digestion product and the vector were ligated with T4 ligase. The ligation product was then transformed into Escherichia coli to obtain a genetically engineered bacterium expressing AAV-specific nanobodies.

[0527] Table 1 Nanobody sequence information

[0528] Example 4

[0529] Preparation of AAV nanobodies

[0530] (1) The basal culture medium for the nanobody was TB medium, which was inoculated at a 5% inoculum and cultured at 37°C for 3–5 h. The inducer IPTG (final concentration 0.25 mM, the same below) was added for overnight induction.

[0531] (2) After induction, the mixture was centrifuged at 4000 rpm for 20 min to obtain wet bacteria containing nanobodies.

[0532] (3) Lysis buffer (10 mM imidazole, 500 mM NaCl, pH 7.4, 0.02 M PB) was added to the wet bacteria at a ratio of 1:10, and the cells were disrupted using a 700 bar high-pressure homogenizer;

[0533] (4) Centrifuge at 4°C and 10,000 rpm for 20 min and collect the supernatant;

[0534] (5) The supernatant was filtered through a 0.45 μm filter and then passed through an affinity chromatography column (GE Healthcare, US) for separation and purification of AAV nanobodies, wherein the affinity chromatography column was filled with Ni Sepharose High Performance;

[0535] (6) The nanoantibodies purified by affinity chromatography were subjected to SDS-PAGE electrophoresis to determine the purity, and the protein solution with higher purity was selected to determine the protein concentration using the BCA method. The SDS-PAGE of the purified nanoantibodies is shown in Figure 1. The nanoantibody bands are correct, and the purity is high after one purification. Since the nanoantibodies of the present invention belong to the same family, their molecular weight and charge are similar, so the positions of their electrophoretic bands are also roughly the same. For the sake of simplicity, only the electrophoretic patterns of A4-001 (SEQ ID No: 1) to A4-022 (SEQ ID No: 22) are listed. Figure 1, from left to right, is:

[0536] Left: Protein marker, supernatant after A4-001 (SEQ ID No: 1) whole cell disruption, precipitate, flow-through during purification, and purified A4-001 to A4-003 (SEQ ID No: 1 to 3) (in the order from left to right in the left figure).

[0537] Middle: Purified A4-004-A4-008 (SEQ ID No: 4-8), protein marker, purified A4-009-A4-014 (SEQ ID No: 9-14) (in the order from left to right in the left figure),

[0538] Right panel: Purified A4-015-A4-022 (SEQ ID Nos: 15-22) and protein markers (in the order from left to right in the left panel).

[0539] Example 5

[0540] The binding capacity of nanobodies to AAV was analyzed using SPR technology. AAV was amino-coupled to a CM5 sensor chip at a density of 500 to 800 RU. Nanobodies were injected at seven different concentrations ranging from 1 to 100 nM, with a flow rate of 45 μL / min in all experiments. Chip regeneration conditions were glycine-HCl pH 1.5. Binding curves obtained at different nanobody concentrations were used to calculate the kinetic parameter K. a , K d and K D(Table 2 and Figure 2, due to space limitations, Figure 2 only shows the kinetic sensorgrams of the nanobodies with sequence names A4-001, A4-002, A4-003, and A4-004). The curves in Figure 2 are the response curves of the nanobodies at concentrations of 100 nM, 50 nM, 25 nM, 12.5 nM, 6.25 nM, 3.125 nM, and 1.5625 nM, from top to bottom. The kinetic parameters shown in Table 2 were calculated by equation fitting. The nanobodies have high affinity for AAV2, AAV5, AAV8, and AAV9, with K D Range 10 -6 ~10 -11 (M).

[0541] Table 2 Affinity of nanobodies to different AAVs

[0542] B. Sequence Optimization of Anti-AAV Nanobodies

[0543] Example 6: Humanized Nanobody Transformation and Affinity Determination

[0544] Humanization method 1

[0545] The protein sequences of Nanobodies A4-015 and A4-036 were aligned with those of human germlines, and the differential amino acids in the framework regions were marked. Site-directed mutagenesis was then used to replace some of the differential amino acids with human amino acids, generating humanized Nanobodies A4-H3, A4-H4, A4-H5, and A4-H6. The humanized Nanobodies were then expressed and purified.

[0546] Humanization method 2

[0547] The protein sequence of the Nanobody was aligned with that of the human germline, and the complementarity determining region sequence of A4-003 was transplanted into the human germline antibody framework region. Humanized Nanobody sequences A4-H1 and A4-H2 were generated by gene synthesis. The humanized Nanobodies were then expressed and purified.

[0548] (1) The basal culture medium for humanized nanobodies is TB medium, which is inoculated at a 5% inoculum and cultured at 37°C for 3-5 hours. The inducer IPTG is then added for overnight induction.

[0549] (2) After induction, centrifuge at 4000 rpm for 20 min to obtain wet bacteria containing humanized nanobodies;

[0550] (3) Lysis buffer (10 mM imidazole, 500 mM NaCl, pH 7.4, 0.02 M PB) was added to the wet bacteria at a ratio of 1:10, and the cells were disrupted using a 700 bar high-pressure homogenizer;

[0551] (4) Centrifuge at 4°C and 10,000 rpm for 20 min and collect the supernatant;

[0552] (5) The supernatant was filtered through a 0.45 μm filter and then purified by affinity chromatography column (GE Healthcare, US), where the affinity chromatography column was filled with Ni Sepharose High Performance;

[0553] (6) The nanoantibodies purified by affinity chromatography were subjected to SDS-PAGE electrophoresis to determine the purity, and the protein solution with higher purity was selected to determine the protein concentration using the BCA method.

[0554] Application of SPR technology to analyze the binding ability of humanized nanobodies to AAV

[0555] AAV was amino-coupled to a CM5 sensor chip at a density of 500–800 RU. Nanobodies were injected at six different concentrations ranging from 1 to 100 nM, with a flow rate of 45 μL / min in all experiments. Chip regeneration conditions were glycine-HCl pH 1.5. Binding curves obtained at different nanobody concentrations were used to calculate the kinetic parameter K. a , K d and K D Table 3 is obtained.

[0556] Compared with the original sequence, the affinity of the humanized nanobody to the antigen AAV has not been significantly reduced, and the affinity for the relevant antigens remains at the same order of magnitude. For example, the affinity of A4-003 to AAV8, AAV2, AAV9, and AAV5 is 1.2×10 -9 , 6.07×10 -9 , 1.84×10 -7 , 8.24×10 -9 M, its two humanized sequences A4-H1 and A4-H2 still have an affinity level of 10 for the above four antigens -9 , 10 -9 , 10 -7 , 10 -9 M.

[0557] Table 3 Kinetic parameters of humanized nanobodies

[0558] Example 7: Sequence Optimization Strategy 2

[0559] Multivalent antibody modification and affinity determination

[0560] 1. Preparation of Bivalent Antibodies

[0561] The amino acid sequence of the bivalent polypeptide sequence that specifically binds to AAV is designed, as shown in A4-B1, A4-B2, A4-B3 and A4-B4. It consists of a C-terminal nanobody A, a 15-amino acid Gly / Ser linker and a C-terminal nanobody B (as shown in Figure 3). Among them, nanobody A and nanobody B can be the same or different. The nanobody A of A4-B1 is A4-015, and nanobody B is the same as A; the nanobody A of A4-B2 is A4-014, and nanobody B is A4-012; the nanobody A of A4-B3 is A4-H1, and nanobody B is the same as A; the nanobody A of A4-B4 is A4-H1, and nanobody B is A4-H4.

[0562] The DNA sequences of these bivalent polypeptides were artificially synthesized, and the DNA fragments were connected to the pET23a vector to construct bivalent polypeptide plasmids, which were then transformed into Escherichia coli to obtain bivalent polypeptide engineered bacteria.

[0563] Then the bivalent peptide was expressed and purified:

[0564] (1) The basic culture medium for the bivalent polypeptide is TB medium, which is inoculated at a volume ratio of 5%, cultured at 37°C for 3-5 hours, and then induced overnight by adding the inducer IPTG (final concentration 0.25 mM);

[0565] (2) After induction, centrifuge at 4000 rpm for 20 min to obtain wet bacteria containing divalent polypeptides.

[0566] (3) Lysis buffer (10 mM imidazole, 500 mM NaCl, pH 7.4, 0.02 M PB) was added to the wet bacteria at a ratio of 1:10, and the cells were disrupted using a 700 bar high-pressure homogenizer;

[0567] (4) Centrifuge at 4°C and 10,000 rpm for 20 min and collect the supernatant;

[0568] (5) The supernatant was filtered through a 0.45 μm filter and then passed through an affinity chromatography column (GE Healthcare, US) for separation and purification of the divalent peptide, wherein the affinity chromatography column was filled with Ni Sepharose High Performance;

[0569] (6) The nanoantibodies purified by affinity chromatography were subjected to SDS-PAGE electrophoresis to determine the purity, and the protein solution with higher purity was selected to determine the protein concentration using the BCA method.

[0570] 2. Preparation of trivalent antibodies

[0571] The amino acid sequence of a trivalent polypeptide sequence that specifically binds to AAV is designed, as shown in A4-C1, A4-C2, A4-C3, A4-C4, A4-C5, A4-C6, A4-C7, A4-C8, and A4-C9. It consists of Nanobody A-(GGGGS)3-Nanobody B-(GGGGS)3-Nanobody C. Among them, Nanobody A, Nanobody B, and Nanobody C can be the same or different, and their order can also be swapped. The nanoantibodies A, B, and C of A4-C1 are identical as A4-057; the nanoantibodies A, B, and C of A4-C2 are identical as A4-055; the nanoantibodies A and B of A4-C3 are identical as A4-015, and the nanoantibody C is A4-054; the nanoantibodies A and B of A4-C4 are identical as A4-014, and the nanoantibody C is A4-054; the nanoantibodies A and C of A4-C5 are identical as A4-056, and the nanoantibody B is A4-051; the nanoantibody A of A4-C6 is identical as A4-057; the nanoantibody B of A4-C7 is identical as A4-056; the nanoantibody A of A4-C8 is identical as A4-056; the nanoantibody B of A4-C9 is identical as A4-056; the nanoantibody A of A4-C10 is identical as A4-056; the nanoantibody A of A4-C11 is identical as A4-056; the nanoantibody A of A4-C12 is identical as A4-056; the nanoantibody A of A4-C13 is identical as A4-056; the nanoantibody A of A4-C14 is identical as A4-056; the nanoantibody A of A4-C15 is identical as A4-056; the nanoantibody A of A4-C13 is identical as A4-056; the nanoantibody A of A4-C14 is identical as A4-056; the nanoantibody A of A4-C13 ... The Nanobody A of A4-C7 is A4-051, Nanobody B is A4-053, and Nanobody C is A4-049; the Nanobody A of A4-C8 is A4-053, Nanobody B is A4-051, and Nanobody C is A4-052; the Nanobody A of A4-C9 is A4-051, Nanobody B is A4-052, and Nanobody C is A4-053.

[0572] The DNA sequences of these trivalent polypeptides were artificially synthesized, and the DNA fragments were connected to the pET23a vector to construct trivalent polypeptide plasmids, which were then transformed into Escherichia coli to obtain trivalent polypeptide engineered bacteria.

[0573] Then the trivalent polypeptide was expressed and purified, and the expression and purification process was the same as above.

[0574] 3. Preparation of Tetravalent Antibodies

[0575] The amino acid sequence of the tetravalent polypeptide sequence that specifically binds to AAV is designed, as shown in A4-D1, A4-D2, A4-D3, A4-D4, A4-D5, A4-D6, A4-D7, A4-D8, A4-D9, A4-D10, A4-D11, A4-D12 and A4-D13. It consists of Nanobody A-(GGGGS)3-Nanobody B-(GGGGS)3-Nanobody C-(GGGGS)3-Nanobody D. Among them, Nanobody A, Nanobody B, Nanobody C and Nanobody D can be the same or different, and the order can also be swapped. The nanoantibodies A, B, C, and D of A4-D1 are the same as A4-043; the nanoantibodies A, B, C, and D of A4-D2 are the same as A4-044; the nanoantibodies A, B, and C of A4-D3 are the same as A4-043, and the nanoantibody D is A4-045; the nanoantibodies A, C, and D of A4-D4 are the same as A4-043, and the nanoantibody B is A4-045; the nanoantibodies A, B, and D of A4-D5 are the same as A4 -046, Nanobody C is A4-047; Nanobody A and B of A4-D6 are the same as A4-067, Nanobody C is A4-068, and Nanobody D is A4-069; Nanobody A and D of A4-D7 are the same as A4-067, Nanobody B is A4-068, and Nanobody C is A4-069; Nanobody B and D of A4-D8 are the same as A4-081, Nanobody A is A4-08 2, Nanobody C is A4-076; Nanobody B and C of A4-D9 are the same as A4-081, Nanobody A is A4-076, and Nanobody D is A4-067; Nanobody A of A4-D10 is A4-043, Nanobody B is A4-036, Nanobody C is A4-025, and Nanobody D is A4-033; Nanobody A of A4-D11 is A4-045, Nanobody B is A 4-033, Nanobody C is A4-025, and Nanobody D is A4-028; the Nanobody A of A4-D12 is A4-033, Nanobody B is A4-043, Nanobody C is A4-036, and Nanobody D is A4-025; the Nanobody A of A4-D13 is A4-025, Nanobody B is A4-033, Nanobody C is A4-043, and Nanobody D is A4-036.

[0576] The DNA sequences of these tetravalent polypeptides were artificially synthesized, and the DNA fragments were connected to the pET23a vector to construct a tetravalent polypeptide plasmid, which was then transformed into Escherichia coli to obtain tetravalent polypeptide engineered bacteria.

[0577] Then the tetravalent polypeptide was expressed and purified, and the expression and purification process was the same as above.

[0578] SPR technology was used to analyze the binding ability of multivalent peptides to AAV.

[0579] AAV was amino-coupled to a CM5 sensor chip at a density of 500-800 RU. Nanobodies were injected at five different concentrations ranging from 1-50 nM, with a flow rate of 45 μL / min in all experiments. Chip regeneration conditions were glycine-HCl pH 1.5. Binding curves obtained at different nanobody concentrations were used to calculate the kinetic parameter K. a , K d and K D The specific data results are shown in Table 4.

[0580] It can be seen that compared with monovalent nanobodies, the affinity of multivalent nanobodies to antigen AAV is improved to varying degrees. The main manifestation is the dissociation constant K d The affinity of the binding site increases with the increase ranging from several times to hundreds of times.

[0581] Table 4 Kinetic parameters of multivalent nanobodies

[0582] Example 8: Sequence Optimization Strategy 3

[0583] Amino acid modification and affinity determination of nanobodies at the N-terminus and C-terminus. One or more amino acid tags (such as histidine tags, biotin ligase tags, HA tags, sumo tags, GST tags, sulfhydryl tags, polylysine tags, thrombin tags, enterokinase tags, etc.) can be added to the N-terminus and C-terminus of nanobodies or multivalent nanobodies through genetic engineering, post-translational modification, and protein engineering. If necessary, amino acid linkers can be added to the amino acid tags to achieve efficient expression, modification, purification, functionalization, etc. of nanobodies without affecting the antigen binding ability of nanobodies.

[0584] The amino acid sequences of the modified C-terminal Nanobodies were designed as shown in A4-T1 (SEQ ID No: 147), A4-T2 (SEQ ID No: 148), and A4-L1 (SEQ ID No: 149). A4-T1 consists of A4-017 and a C-terminal 6×His-tag; A4-T2 consists of A4-017 and a C-terminal GGGGS and a 6×His-tag; and A4-L1 consists of A4-017 and a C-terminal IgA hinge (SerThrProProThrProSerProSerThrProPro) and a 6×His-tag.

[0585] The amino acid sequences of the nanobody N-terminal modifications were designed as shown in A4-M1 (SEQ ID No: 150) and A4-M2 (SEQ ID No: 151). A4-M1 consists of A4-017 and the N-terminal amino acid MetAlaGln; A4-M2 consists of A4-017 and the N-terminal amino acid Met.

[0586] The DNA sequence of the nanobody was artificially synthesized, and the DNA fragment was connected to the pET23a vector to construct a plasmid, which was then transformed into Escherichia coli to obtain the modified nanobody engineered bacteria.

[0587] Then the modified nanobody is expressed and purified:

[0588] (1) The basal culture medium was TB medium, inoculated at 5% inoculum, cultured at 37°C for 3–5 h, and induced overnight by adding the inducer IPTG.

[0589] (2) After induction, centrifuge at 4000 rpm for 20 min to obtain wet bacteria containing the target sequence.

[0590] (3) Lysis buffer (10 mM imidazole, 500 mM NaCl, pH 7.4, 0.02 M PB) was added to the wet bacteria at a ratio of 1:10, and the cells were disrupted using a 700 bar high-pressure homogenizer;

[0591] (4) Centrifuge at 4°C and 10,000 rpm for 20 min and collect the supernatant;

[0592] (5) The supernatant was filtered through a 0.45 μm filter and then separated and purified using an affinity chromatography column (GE Healthcare, US), where the affinity chromatography column was filled with Ni Sepharose High Performance;

[0593] (6) The nanoantibodies purified by affinity chromatography were subjected to SDS-PAGE electrophoresis to determine the purity, and the protein solution with higher purity was selected to determine the protein concentration using the BCA method.

[0594] Application of SPR technology to analyze the binding ability of modified nanoantibodies to AAV

[0595] AAV was amino-coupled to a CM5 sensor chip at a density of 500-800 RU. Nanobodies were injected at five different concentrations ranging from 1-50 nM (50 nM, 25 nM, 12.5 nM, 6.25 nM, 1.5625 nM) with a flow rate of 45 μL / min in all experiments. The chip regeneration condition was glycine-HCl pH 1.5. The binding curves obtained at different nanobody concentrations were used to calculate the kinetic parameter K. a , K d and K D As shown in Table 5, compared with the original sequence A4-017, the affinity of the modified nanobody to the antigen AAV remained basically unchanged.

[0596] Table 5 Kinetic parameters of C-terminally modified nanobodies

[0597] C. Preparation of AAV Adsorbent

[0598] Example 9 Preparation of AAV Adsorbent

[0599] Activate agarose gel. Take 2 g of agarose microspheres, add 2 mol / L NaOH and 0.8 mL of 1,4-butanediol diglycidyl ether, mix in the appropriate proportions, and react for at least 60 minutes. After the reaction, wash the gel with plenty of deionized water and filter it to obtain a wet cake.

[0600] Immobilization of AAV nanobodies. Take the activated agarose gel carrier material, add 2 mL of nanobody solution (PBS is used to prepare the nanobody solution in this embodiment, and physiological saline or pure water can also be used), and perform coupling reaction at 37°C and 250 rpm for 24 hours. After the reaction is completed, add 3 times the volume of ethanolamine (6% by volume, pH 9.0) and block overnight to obtain an AAV adsorbent.

[0601] ① The nanobody is A4-002, the concentration is 10.38 mg / mL, the glue-to-water ratio is 1:3, the epoxy density on the glue is 3 μmol / g, and the final nanobody conjugation amount is 11.58 mg / g adsorbent. This is denoted as adsorbent A.

[0602] ② The nanobody was A4-008 at a concentration of 6.75 mg / mL, the adhesive-to-water ratio was 1:5, the epoxy density on the adhesive was 3 μmol / g, and the final nanobody conjugation amount was 9.77 mg / g adsorbent. This was designated as adsorbent B.

[0603] ③ The nanobody was A4-008 at a concentration of 6.75 mg / mL, the adhesive-to-water ratio was 1:7, the epoxy density on the adhesive was 3 μmol / g, and the final nanobody conjugation amount was 10.74 mg / g adsorbent. This was denoted as adsorbent C.

[0604] ④ The nanobody was A4-014 at a concentration of 3.19 mg / mL, the adhesive-to-water ratio was 1:8, the epoxy density on the adhesive was 2 μmol / g, and the final nanobody conjugation amount was 3.12 mg / g adsorbent. This was denoted as adsorbent D.

[0605] ⑤ The nanobody is A4-024, the concentration is 5.14 mg / mL, the glue-to-water ratio is 1:6, the epoxy density on the glue is 2 μmol / g, and the final nanobody conjugation amount is 6.36 mg / g adsorbent. This is denoted as adsorbent E.

[0606] Example 10 AAV Preparation

[0607] HEK293T cells were cultured and replaced with antibiotic-free medium one day before transfection. The cells were cultured for 12-24 h until the cell density reached 80%.

[0608] Prepare the EZ-Trans DNA complex. In Tube A, add pAAV-hrGFP, pAAV-RC, and pHelper at a 1:1:1 molar ratio, resulting in a total of 36 μg of all three plasmids per 15 mL of cells. Use DMEM to make up the total. In Tube B, add 108 μL of EZ Transfection Reagent diluted in DMEM. Mix thoroughly. Incubate at room temperature for 10-15 minutes.

[0609] Transfect cells. Slowly add the prepared transfection system dropwise to each culture dish, 3 mL / dish. Gently shake the dish to mix thoroughly and incubate in an incubator. After 24 hours of incubation, replace the medium with fresh culture medium and observe transfection efficiency using a fluorescence microscope.

[0610] Virus collection: 48-72 hours after transfection, the virus can be harvested by scraping the cells with a cell scraper into a 50 mL centrifuge tube. Centrifuge at 200 × g for 5 minutes to collect the cell pellet. Resuspend the cells in PBS and disrupt with ultrasound.

[0611] Example 11 Evaluation of the adsorption performance of AAV adsorbent

[0612] 1 mL of the prepared AAV adsorbent was loaded into a chromatographic column with a height of 2 cm. After loading, the column was first rinsed with equilibration buffer; then the sample was loaded, and after loading, the equilibration buffer was used to rinse again; then the elution was performed with elution buffer. The total amount of AAV in the sample, flow-through, equilibration solution, and eluate was determined, and the AAV yield was calculated. VP represents the number of viral capsid particles. AAV yield = AAV elution amount (VP) ÷ AAV binding amount (VP) × 100%

[0613] Equilibration buffer: 10 mM Tris-300 mM NaCl, pH 7.6; elution buffer: 0.1 M NaAc, 0.5 M NaCl, pH 1.5.

[0614] The binding capacity of adsorbent A to AAV2 was 9.40×10 13 , the elution volume is 8.46×10 13 The yield was 90.0%; the binding capacity to AAV5 was 1.17×10 14 , the elution volume is 9.76×10 13 The yield was 83.2%; the binding capacity to AAV6 was 9.20×10 13 , the elution volume is 8.31×10 13 The yield was 90.3%; the binding capacity to AAV8 was 1.02×10 14 , the elution volume is 9.27×10 13 The yield was 90.9%; the binding capacity to AAV9 was 1.26×10 14 , the elution volume is 1.08×10 14 , the yield was 85.5%.

[0615] The binding capacity of adsorbent B for AAV2 was 9.10×10 13 , the elution volume is 7.85×10 13 The yield was 86.2%; the binding capacity to AAV5 was 8.56×10 13 , the elution volume is 7.67×10 13 The yield was 89.6%; the binding capacity to AAV6 was 8.78×10 13 , the elution volume is 7.62×10 13 The yield was 86.8%; the binding capacity to AAV8 was 9.47×10 13 , the elution volume is 7.95×10 13 The yield was 83.9%; the binding capacity to AAV9 was 8.83×10 13 , the elution volume is 7.32×10 13 , the yield was 82.9%.

[0616] The binding capacity of adsorbent C for AAV2 was 1.21×10 14 , the elution volume is 9.42×10 13 The yield was 77.9%; the binding capacity to AAV5 was 8.95×10 13 , the elution volume is 7.48×10 13 The yield was 83.6%; the binding capacity to AAV6 was 9.43×10 13 , the elution volume is 7.88×10 13 The yield was 83.6%; the binding capacity to AAV8 was 1.16×10 14 , the elution volume is 9.94×10 13The yield was 85.7%; the binding capacity to AAV9 was 9.17×10 13 , the elution volume is 8.53×10 13 , the yield was 93.0%.

[0617] The binding capacity of adsorbent D for AAV2 was 4.93×10 13 , the elution volume is 4.37×10 13 The yield was 88.6%; the binding capacity to AAV5 was 3.22×10 13 , the elution volume is 2.83×10 13 The yield was 87.9%; the binding capacity to AAV6 was 2.59×10 13 , the elution volume is 2.20×10 13 The yield was 84.9%; the binding capacity to AAV8 was 3.83×10 13 , the elution volume is 3.51×10 13 The yield was 91.6%; the binding capacity to AAV9 was 4.30×10 13 , the elution volume is 3.76×10 13 , the yield was 87.3%.

[0618] The binding capacity of adsorbent E for AAV2 was 7.65×10 13 , the elution volume is 6.63×10 13 The yield was 86.7%; the binding capacity to AAV5 was 4.80×10 13 , the elution volume is 4.12×10 13 The yield was 85.8%; the binding capacity to AAV6 was 6.09×10 13 , the elution volume is 5.48×10 13 The yield was 90.0%; the binding capacity to AAV8 was 5.17×10 13 , the elution volume is 4.41×10 13 The yield was 85.3%; the binding capacity to AAV9 was 6.50×10 13 , the elution volume is 5.97×10 13 , the yield was 91.8%.

[0619] In summary, the AAV adsorbent prepared by the present invention has the ability to bind to AAVs of different serotypes with high yield. It is a new broad-spectrum AAV adsorbent that can be used for the purification of AAVs of different serotypes.

[0620] Example 11 Preparation of AAV Detection Kit

[0621] Nanobody A4-021 was exchanged into PBS (pH 7.4) to a concentration of about 10 mg / mL and conjugated to HRP using an HRP conjugation kit (abcam, ab102890) and dialyzed thoroughly for fluid replacement.

[0622] Direct ELISA detection method:

[0623] AAV standards or test samples were added to a highly hydrophobic 96-well plate, incubated on a horizontal shaker for 2 hours, and washed with PBS; blocked with 1% to 3% skim milk powder and washed with PBS; HRP-coupled nanoantibody A4-021 was added and incubated on a horizontal shaker for 2 hours, and washed with PBS; TMB working solution was added and incubated at room temperature in the dark for 30 minutes, 2M sulfuric acid stop solution was added to terminate the reaction, and the OD was measured. 450 .

[0624] Sandwich ELISA detection method:

[0625] The capture ligand was coated on a highly hydrophobic 96-well plate, incubated overnight at 4°C in the dark, and washed with PBS; 1% to 3% skim milk powder was used for blocking, and the plate was washed with PBS; AAV standard or test sample was added, incubated on a horizontal shaker for 2 hours, and the plate was washed with PBS; HRP-coupled nanobody A4-021 was added, incubated on a horizontal shaker for 2 hours, and the plate was washed with PBS; TMB working solution was added, incubated at room temperature in the dark for 30 minutes, 2M sulfuric acid stop solution was added to terminate the reaction, and the OD was measured. 450 .

[0626] The capture ligand can be nanobody A4-021 or other nanobodies of the present invention, or an anti-AAV antibody, or other ligand molecules that can bind to AAV. The capture antibody used in this example is A4-040.

[0627] The standard curves of AAV8 detected by the kit of the present invention are shown in Figures 4 and 5, wherein Figure 4 is the standard curve of direct ELISA detection, and Figure 5 is the standard curve of sandwich ELISA detection. 2 All of them can reach above 0.99, indicating that the ELISA detection method established based on the nanobody of the present invention has strong reliability and high sensitivity.

[0628] Existing techniques use real-time quantitative PCR to detect viral particles containing DNA, but are unable to detect empty capsids. The present invention, however, can detect both empty capsids and viral particles. Detection of empty capsids is crucial because they are not therapeutically beneficial and may even increase immunogenicity. Therefore, quantitative detection and control of empty capsid content are crucial for AAV production.

[0629] Industrial applicability

[0630] The nanobody of the present invention is an anti-AAV nanobody with a new amino acid sequence discovered by screening a phage library. The nanobody and its polypeptide have high affinity and activity, can specifically recognize and bind to AAV, and the prepared affinity chromatography column has a strong adsorption capacity for AAV and can be used for AAV purification. The prepared detection kit can be used for detection and quantitative analysis of AAV.

[0631] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.

Claims

1. A nanobody, characterized in that The variable region in the amino acid sequence of the nanobody includes a complementarity determining region CDR and a framework region FR, wherein the complementarity determining region CDR includes a complementarity determining region CDR1, a complementarity determining region CDR2 and a complementarity determining region CDR3, wherein: The complementary determining region CDR1 comprises the following formula (I): Ser-Gly-Xa 11 -No 12 -Phe-Xaa 13 -No 14 -An-Xa 15 , (I)? The complementary determining region CDR2 comprises the following formula (II): Yes 21 -Thr-Xaa 22 -Yes 23 -Gly-Xaa 24 -Thr, (II); The complementary determining region CDR3 comprises the following formula (III): His-Xa 31 -Asp-Glu-Xa 32 -King-Stone 33 -Server-Dog 34 -Trp-Thr-Thr-Ser-Asn-Xaa 35 , (III)? in, XA 11 independently selected from Arg, Ser, Thr; and / or, XA 12 independently selected from Ala, Gly, His, Ile, Met, Asn, Arg, Ser, Thr; and / or, XA 13 is independently selected from Ile, Arg, Ser, Thr, Val; and / or, XA 14 are independently selected from Ala, Ile, Leu; and / or, XA 15 independently selected from Ala, Ile, Leu, Ser, Thr, Val; and / or, XA 21 independently selected from Phe, Ile, Leu, Val; and / or, XA 22 independently selected from Pro, Arg, Ser; and / or, XA 23 Independently selected from Ala, Asp, Gly; and / or, XA 24 independently selected from Asp, Gly, Asn, Ser, Thr, Val; and / or, XA 31 are independently selected from Ile, Leu, Val; and / or, XA 32 are independently selected from Ile, Leu, Val; and / or, XA 33 Independently selected from Asp, Glu, Gln, and / or XA 34 Independently selected from Gly, Ile, Ser, Thr; and / or, XA 35 Independently selected from Ile, Leu.

2. The Nanobody according to claim 1, characterized in that In the complementary determining region CDR1, Xaa 11 Arg, Xaa 12 Ser, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Arg, Xaa 12 His, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Arg, Xaa 12 Ala, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Ser; or, Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Ser; or, Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Leu; or, Xaa 11 Ser, Xaa 12 Thr, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Gly, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Ala, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Asn, Xaa 13 Arg, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Asn, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Ser, Xaa 13 Thr, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Ser, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Arg, Xaa 12 Gly, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 His, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Arg, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Met, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Ser, Xaa 13 For Val, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ile, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 His, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Thr, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Ser, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Ala; or Xaa 11 Arg, Xaa 12 Arg, Xaa 13 Thr, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Arg, Xaa 12 Asn, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or Xaa 11 Arg, Xaa 12 Ala, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Thr, Xaa 14 Ile, Xaa 15 is Ser; or, Xaa 11 Ser, Xaa 12 Met, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or Xaa 11 Thr, Xaa 12 Met, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or Xaa 11 Thr, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ile, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Ile, Xaa 13 For Val, Xaa 14 Ile, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Ser, Xaa 13 Ser, Xaa 14 Ala, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ala, Xaa 15 is Thr; or Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 for Ile; or, Xaa 11 Ser, Xaa 12 His, Xaa 13 Thr, Xaa 14 Ile, Xaa 15 is Ser; or, Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Ala; or Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Ser; or, Xaa 11 Thr, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Val; or, Xaa 11 Thr, Xaa 12 Asn, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 For Val.

3. The Nanobody according to claim 1 or 2, characterized in that In the complementary determining region CDR2, Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Ser; or, Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Gly; or Xaa 21 Ile, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Asn; or Xaa 21 Ile, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Ser; or, Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Asn; or Xaa 21 Ile, Xaa 22 For Pro, Xaa 23 Gly, Xaa 24 is Asn; or Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Val; or, Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Asp, Xaa 24 is Ser; or, Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Thr; or Xaa 21 Phe, Xaa 22 Arg, Xaa 23 Ala, Xaa 24 is Asn; or Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Asp; or, Xaa 21 Leu, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Ser; or, Xaa 21 For Val, Xaa 22 For Pro, Xaa 23 Ala, Xaa 24 is Ser; or, Xaa 21 For Val, Xaa 22 Ser, Xaa 23 Ala, Xaa 24 is Ser; or, Xaa 21 For Val, Xaa 22 Ser, Xaa 23 Gly, Xaa 24 is Gly; or Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Asp, Xaa 24 is Gly; or Xaa 21 Ile, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Gly; or Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Ala, Xaa 24 is Ser; or, Xaa 21 For Val, Xaa 22 For Pro, Xaa 23 Gly, Xaa 24 is Ser; or, Xaa 21 Phe, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Asn; or Xaa 21 Ile, Xaa 22 Ser, Xaa 23 Gly, Xaa 24 For Ser.

4. The Nanobody according to any one of claims 1 to 3, characterized in that In the complementary determining region CDR3, Xaa 31 Ile, Xaa 32 For Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 for Ile; or, Xaa 31 For Val, Xaa 32 For Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 for Ile; or, Xaa 31 For Val, Xaa 32 For Val, Xaa 33 Glu, Xaa 34 Ser, Xaa 35 is Leu; or, Xaa 31 For Val, Xaa 32 For Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 is Leu; or, Xaa 31 For Val, Xaa 32 For Val, Xaa 33 Asp, Xaa 34 Ser, Xaa 35 for Ile; or, Xaa 31 Leu, Xaa 32 For Val, Xaa 33 Glu, Xaa 34 Ser, Xaa 35 is Leu; or, Xaa 31 For Val, Xaa 32 Ile, Xaa 33 Glu, Xaa 34 Ser, Xaa 35 is Leu; or, Xaa 31 Ile, Xaa 32 Ile, Xaa 33 Glu, Xaa 34 Ser, Xaa 35 is Leu; or, Xaa 31 For Val, Xaa 32 Ile, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 is Leu; or, Xaa 31 Leu, Xaa 32 For Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 for Ile; or, Xaa 31 Leu, Xaa 32 For Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 is Leu; or, Xaa 31 Ile, Xaa 32 For Val, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 is Leu; or, Xaa 31 For Val, Xaa 32 Leu, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 is Leu; or, Xaa 31 Leu, Xaa 32 For Val, Xaa 33 Gln, Xaa 34 Thr, Xaa 35 is Leu; or, Xaa 31 For Val, Xaa 32 For Val, Xaa 33 Gln, Xaa 34 Thr, Xaa 35 is Leu; or, Xaa 31 For Val, Xaa 32 For Val, Xaa 33 Glu, Xaa 34 Thr, Xaa 35 is Leu; or, Xaa 31 Leu, Xaa 32 For Val, Xaa 33 Asp, Xaa 34 Ser, Xaa 35 is Leu; or, Xaa 31 For Val, Xaa 32 Ile, Xaa 33 Gln, Xaa 34 Ser, Xaa 35 for Ile; or, Xaa 31 For Val, Xaa 32 Leu, Xaa 33 Asp, Xaa 34 Ser, Xaa 35 is Leu; or, Xaa 31 For Val, Xaa 32 For Val, Xaa 33 Asp, Xaa 34 Ser, Xaa 35 is Leu; or, Xaa 31 For Val, Xaa 32 Leu, Xaa 33 Glu, Xaa 34 Gly, Xaa 35 is Leu; or, Xaa 31 For Val, Xaa 32 Leu, Xaa 33 Glu, Xaa 34 Ser, Xaa 35 is Leu; or, Xaa 31 For Val, Xaa 32 Leu, Xaa 33 Gln, Xaa 34 Thr, Xaa 35 is Leu; or, Xaa 31 Ile, Xaa 32 Ile, Xaa 33 Glu, Xaa 34 Thr, Xaa 35 is Leu; or, Xaa 31 For Val, Xaa 32 For Val, Xaa 33 Glu, Xaa 34 Thr, Xaa 35 for Ile; or, Xaa 31 For Val, Xaa 32 Ile, Xaa 33 Glu, Xaa 34 Thr, Xaa 35 is Leu; or, Xaa 31 For Val, Xaa 32 For Val, Xaa 33 Glu, Xaa 34 Ile, Xaa 35 is Leu; or, Xaa 31 Leu, Xaa 32 For Val, Xaa 33 Gln, Xaa 34 Thr, Xaa 35 for Ile; or, Xaa 31 For Val, Xaa 32 Leu, Xaa 33 Asp, Xaa 34 Thr, Xaa 35 is Leu; or, Xaa 31 Leu, Xaa 32 For Val, Xaa 33 Glu, Xaa 34 Thr, Xaa 35 is Leu; or, Xaa 31 For Val, Xaa 32 For Val, Xaa 33 Gln, Xaa 34 Thr, Xaa 35 for Ile; or, Xaa 31 For Val, Xaa 32 Ile, Xaa 33 Gln, Xaa 34 Thr, Xaa 35 For Leu.

5. The Nanobody according to claim 1, characterized in that The framework region FR includes: framework region FR1, framework region FR2, framework region FR3 and framework region FR4, wherein the framework region FR1, framework region FR2, framework region FR3 and framework region FR4 are amino acid sequences with a homology of more than 50%, preferably an amino acid sequence with a homology of more than 70%, and more preferably an amino acid sequence with a homology of more than 95%; More preferably, the framework region FR1 is of the following formula (IV): ValGlnLeuGlnGluSerGlyGlyGlyXaa 41 Yes 42 Yes 43 Yes 44 GlyGlySerLeuXaa 45 LeuSerCysXa a 46 Road, (IV); The framework region FR2 is the following formula (V): Yes 51 GlyTrpTyrArgXaa 52 Yes 53 Yes 54 Yes 55 LysXaa 56 ArgGluXaa 57 ValaXa 58 , (V); The framework region FR3 is the following formula (VI): Yes 61 TyrXaa 62 Yes 63 Yes 64 ValLysGlyArgPheThrIleSerArgAspAsnXaa 65 LysXaa 66 ThrXaa 67 TyrLeuGlnMAsnXaa 68 LeuXaa 69 ProGluAspThrAlaValTyrTyrCys, (VI); The framework region FR4 is the following formula (VII): TrpGlyGlnGlyThrGlnValThrValSerSer, (VII); wherein, XA 41 independently selected from Leu, Ala; and / or, XA 42 independently selected from Val, Ala; and / or, XA 43 Independently selected from Gln, His; and / or, XA 44 independently selected from Pro, Ala, Ser, Thr; and / or, XA 45 independently selected from Arg, Lys; and / or, XA 46 Independently selected from Ala, Val, Leu, Ile, Phe; and / or, XA 51 independently selected from Met, Val; and / or, XA 52 Independently selected from Gln, Arg; and / or, XA 53 Independently selected from Ala, Arg; and / or, XA 54 independently selected from Pro, Ala; and / or, XA 55 Independently selected from Gly, Pro, Ala, Arg; and / or, XA 56 Independently selected from Gln, Trp; and / or, XA 57 independently selected from Leu, Phe, Lys, Ile, Met; and / or, XA 58 independently selected from Thr, Ala, Ser, Pro, Asn; and / or, XA 61 independently selected from Asn, Ser, Lys, Thr, Trp; and / or, XA 62 Independently selected from Ala, Gly; and / or, XA 63 Independently selected from Gly, Asp, Glu, Asn; and / or, XA 64 Independently selected from Ser, Phe; and / or, XA 65 Independently selected from Ala, Pro, Thr, Gly, Asp; and / or, XA 66 independently selected from Asn, Asp, Ser, Thr; and / or, XA 67 are independently selected from Val, Ile, Ala; and / or, XA 68 independently selected from Ser, Thr, Asn; and / or, XA 69 Independently selected from Arg, Gln; Preferably, the framework regions FR and the complementarity determining regions CDR are arranged alternately in a chronological order.

6. The Nanobody according to claims 1 to 5, characterized in that The amino acid sequences of the said nanobodies include: SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7, SEQ ID No: 8, SEQ ID No: 9, SEQ ID No: 10, SEQ ID No: 11, SEQ ID No: 12, SEQ ID No: 13, SEQ ID No: 14, SEQ ID No: 15, SEQ ID No: 16, SEQ ID No: 17, SEQ ID No: 18, SEQ ID No: 19, SEQ ID No: 20, SEQ ID No: 21, SEQ ID No: 22, SEQ ID No: 23, SEQ ID No: 24, SEQ ID No: 25, SEQ ID No: 26, SEQ ID No: 27, SEQ ID No: 28, SEQ ID No: 29, SEQ ID No: 30, SEQ ID No: 31, SEQ ID No: 32, SEQ ID No: 33, SEQ ID No: 34, SEQ ID No: 35, SEQ ID No: 36, SEQ ID No: 37, SEQ ID No: 38, SEQ ID No: 39, SEQ ID No: 40, SEQ ID No: 41, SEQ ID No: 42, SEQ ID No: 43, SEQ ID No: 44, SEQ ID No: 45, SEQ ID No: 46, SEQ ID No: 47, SEQ ID No: 48, SEQ ID No: 49, SEQ ID No: 50, SEQ ID No: 51, SEQ ID No: 52, SEQ ID No: 53, SEQ ID No: 54, SEQ ID No: 55, SEQ ID No: 56, SEQ ID No: 57, SEQ ID No: 58, SEQ ID No: 59, SEQ ID No: 60, SEQ ID No: 61, SEQ ID No: 62, SEQ ID No: 63, SEQ ID No: 64, SEQ ID No: 65, SEQ ID No: 66, SEQ ID No: 67, SEQ ID No: 68, SEQ ID No: 69, SEQ ID No: 70, SEQ ID No: 71, SEQ ID No: 72, SEQ ID No: 73, SEQ ID No: 74, SEQ ID No: 75, SEQ ID No: 76, SEQID No:77、SEQ ID No:78、SEQ ID No:79、SEQ ID No:80、SEQ ID No:81、SEQ ID No:82、SEQ ID No:83、SEQ ID No:84、SEQ ID No:85、SEQ ID No:86、SEQ ID No:87、SEQ ID No:88、SEQ ID No:89、SEQ ID No:90、SEQ ID No:91、SEQ ID No:92、SEQ ID No:93、SEQ ID No:94、SEQ ID No:95、SEQ ID No:96、SEQ ID No:97、SEQ ID No:98、SEQ ID No:99、SEQ ID No:100、SEQ ID No:101、SEQ ID No:102、SEQ ID No:103、SEQ ID No:104、SEQ ID No:105、SEQ ID No:106、SEQ ID No:107、SEQ ID No:108、SEQ ID No:109、SEQ ID No:110、SEQ ID No:111、SEQ ID No:112、SEQ ID No:113、SEQ ID No:114。 7. The Nanobody according to claims 1 to 6, characterized in that The nanobody is a humanized nanobody. Preferably, the humanized nanobody comprises SEQ ID No: 115, SEQ ID No: 116, SEQ ID No: 117, SEQ ID No: 118, SEQ ID No: 119, and SEQ ID No:

120.

8. A polypeptide, characterized in that It is obtained by modifying the N-terminal and / or C-terminal amino acids of the Nanobody according to any one of claims 1 to 7.

9. A polypeptide according to claim 8, characterized in that The methods of modifying the amino acids at the N-terminus and / or C-terminus of the Nanobody include: Method 1: adding a tag to the N-terminal and / or C-terminal amino acid of the Nanobody; Method 2, adding a hinge to the N-terminal and / or C-terminal amino acid of the Nanobody; Mode three, after the N-terminal and / or C-terminal amino acids of the Nanobody are tagged, the tags are further linked to protective amino acids; Preferably, the tag comprises at least one of His-tag, GST-tag, Myc-tag, SUMO-tag, Strep-tag, and Flag-tag, the hinge comprises at least one of GS hinge, IgG hinge, IgA hinge, and PEG, and the protected amino acid comprises Ala, Gln, Glu, Met, or a combination of any two or more of the foregoing amino acids; Preferably, the amino acid sequence of the polypeptide includes: SEQ ID No: 147, SEQ ID No: 148, SEQ ID No: 149, SEQ ID No: 150, SEQ ID No:

151.

10. A polypeptide, characterized in that It is obtained by multivalent synthesis of the nanobody described in any one of claims 1 to 7.

11. A polypeptide according to claim 10, characterized in that The polyvalent synthesis includes divalent, trivalent or tetravalent synthesis; Preferably, the bivalent synthetic amino acid sequence comprises: SEQ ID No: 121, SEQ ID No: 122; Preferably, the bivalent synthetic amino acid is a humanized bivalent polypeptide, and further preferably, the amino acid sequence of the humanized bivalent polypeptide comprises: SEQ ID No: 123, SEQ ID No: 124; Preferably, the amino acid sequence of the trivalent polypeptide comprises: SEQ ID No: 125, SEQ ID No: 126, SEQ ID No: 127, SEQ ID No: 128, SEQ ID No: 129, SEQ ID No: 130, SEQ ID No: 131, SEQ ID No: 132, SEQ ID No: 133; Preferably, the amino acid sequence of the tetravalent polypeptide comprises: SEQ ID No: 134, SEQ ID No: 135, SEQ ID No: 136, SEQ ID No: 137, SEQ ID No: 138, SEQ ID No: 139, SEQ ID No: 140, SEQ ID No: 141, SEQ ID No: 142, SEQ ID No: 143, SEQ ID No: 144, SEQ ID No: 145, SEQ ID No:

146.

12. A nucleic acid, characterized in that The nucleic acid encodes the Nanobody according to any one of claims 1 to 7 or the polypeptide according to any one of claims 8 to 11.

13. An expression vector, characterized in that: An expression cassette comprising the nucleic acid of claim 12.

14. A host cell, characterized in that Containing the expression vector according to claim 13.

15. Use of the Nanobody according to any one of claims 1 to 7 and / or the polypeptide according to any one of claims 8 to 11 in immunodetection, enrichment and or purification.

16. The use according to claim 15, characterized in that The use of the nanobody and / or the polypeptide in the preparation of a virus adsorbent, a virus purification kit, and a virus detection kit; preferably, the virus is AAV.

17. A virus adsorbent, characterized in that: It comprises a carrier matrix and the nanobody according to any one of claims 1 to 7 and / or the polypeptide according to any one of claims 8 to 11.

18. A virus purification kit, characterized in that: It comprises a carrier matrix and the nanobody according to any one of claims 1 to 7 and / or the polypeptide according to any one of claims 8 to 11.

19. A virus detection kit, characterized in that: It comprises a carrier matrix and the nanobody according to any one of claims 1 to 7 and / or the polypeptide according to any one of claims 8 to 11.

20. A method for detecting AAV for non-diagnostic purposes, characterized in that: The nanobody according to any one of claims 1 to 7 and / or the polypeptide according to any one of claims 8 to 11 are coupled with HRP and then detected by direct enzyme immunosorbent assay or sandwich enzyme immunosorbent assay.

Images