Method for producing genome-edited soybean plant having early flowering or early maturation induced by gmft4 or gmft6 gene editing, and early flowering- or early maturation-induced soybean plant produced thereby

Abstract

The present invention relates to a method for producing a genome-edited soybean plant in which early flowering or early maturation is induced by soybean-derived GmFT4 (Glycine max FLOWERING LOCUS T 4) or GmFT6 (Glycine max FLOWERING LOCUS T 6) gene editing, and to an early flowering- or early maturation-derived, genome-edited soybean plant produced by the method.

Description

Method for producing a genome-edited soybean plant induced to flower early or ripen early by GmFT4 or GmFT6 gene correction, and a genome-edited soybean plant induced to flower early or ripen early by the method

[0001] The present invention relates to a method for producing a genome-edited soybean plant induced to flower early or ripen early by GmFT4 (Glycine maxFLOWERING LOCUS T 4) or GmFT6 (Glycine maxFLOWERING LOCUS T 6) gene correction, and to a genome-edited soybean plant induced to flower early or ripen early produced by the method.

[0002]

[0003] This research was supported by the Ministry of Education's National Research Foundation of Korea's Science and Engineering Research Infrastructure Development Project (Project Number: 2018R1D1A3B07049940).

[0004] Soybeans (Glycine max) are rich in protein, fat, and dietary fiber, and contain various health-promoting functional substances such as isoflavones, anthocyanins, lecithin, lutein, and saponins. They not only possess high nutritional value as a food, but also have significant industrial value as feed and processing crops. The maturation period for most soybeans grown domestically is early to mid-October. However, recent climate change has led to frequent autumn monsoon rains and frequent typhoons during the soybean harvest season, frequently reducing soybean yields and quality.

[0005] Therefore, research on accelerating soybean maturation is crucial for improving cropping systems and increasing farm income, as it can help avoid the deteriorating weather conditions during the fall harvest season, which have recently been hampering soybean productivity and quality. In particular, for the stable, mass production of high-quality soybeans with enhanced functionality and industrial usability, it is crucial to develop soybean varieties that guarantee high productivity even under changing climate conditions.

[0006] Among the methods for editing the genome, the CRISPR / Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR associated protein 9) system has recently attracted attention. Using CRISPR / Cas9, a third-generation gene-editing technology, it can specifically edit only the desired genes in a cell in a short period of time. It has proven to be more accurate and efficient than the existing first-generation gene-editing technologies, zinc finger nucleases (ZFNs) and second-generation TALENs (Transcriptor Activator-Like Effector Nucleases), and it also boasts the advantages of simple design and low cost. Recently, it has been reported that this technology has successfully induced transformation in various plant species, including tomatoes, grapes, and rice. Furthermore, it has been confirmed that these mutants are stably transmitted to the next generation.

[0007] Meanwhile, Korean Patent Registration No. 0742219 discloses a 'method for controlling fruit ripening using an expansin gene derived from melon', and Korean Publication Patent No. 2023-0029430 discloses a 'method for producing a transgenic soybean plant having increased productivity characteristics using MtAHL23 and MtAHL5 genes isolated from Medicago truncatula', but there is no description of a method for producing a genome-edited soybean plant induced to flower early or ripen early by the GmFT4 or GmFT6 gene correction of the present invention, and a genome-edited soybean plant induced to flower early or ripen early produced by the method.

[0008] The present invention was derived from the above-mentioned needs, and the inventors of the present invention confirmed that the maturation period of a genetically corrected soybean plant produced using a CRISPR / Cas9 system targeting the soybean-derived GmFT4 (Glycine maxFLOWERING LOCUS T 4) gene was shortened by about 6 to 8 days compared to the wild type, and that the flowering period of a genetically corrected soybean plant produced using a CRISPR / Cas9 system targeting the soybean-derived GmFT6 (Glycine maxFLOWERING LOCUS T 6) gene was shortened by about 1 to 3 days compared to the wild type, and the maturation period was shortened by about 5 to 8 days compared to the wild type, thereby completing the present invention.

[0009] To solve the above problem, the present invention provides a method for producing a genome-corrected soybean plant induced to flower early or ripen early, comprising the steps of: (a) introducing a guide RNA and an endonuclease protein specific to a target base sequence of a soybean-derived GmFT4 (Glycine maxFLOWERING LOCUS T 4) or GmFT6 (Glycine maxFLOWERING LOCUS T 6) gene into a soybean plant cell to correct the genome; and (b) redifferentiating a soybean plant from the genome-corrected soybean plant cell.

[0010] In addition, the present invention provides a genome-edited soybean plant and seeds thereof that are induced to flower early or ripen early, and are produced by the above method.

[0011] In addition, the present invention provides a composition for genome correction for inducing early flowering or early ripening of a soybean plant, comprising as an active ingredient a recombinant vector comprising a DNA encoding a guide RNA specific to a target base sequence of a soybean-derived GmFT4 or GmFT6 gene and a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA specific to a target base sequence of a soybean-derived GmFT4 or GmFT6 gene and an endonuclease protein.

[0012] The method for producing genome-edited plants of the present invention is expected to save costs and time, unlike GMO crops, which require enormous costs and time to assess for safety and environmental hazards, as they do not contain inserted foreign genes and contain only minor mutations indistinguishable from natural ones. Furthermore, because CRISPR gene-editing technology introduces mutations in specific genes, it is expected to be a permanent method for quantitatively improving traits.

[0013] In addition, since the manufacturing method of the present invention can advance the harvest time by inducing early flowering or early ripening of soybean plants, it can be usefully used to improve soybean yield by avoiding worsening weather conditions during the soybean harvesting period.

[0014] Figure 1A is a schematic diagram showing the positions of the target sequence of gRNA1 of the present invention (Target 1: within the first exon of the GmFT4 gene) and the target sequence of gRNA2 (Target 2: within the second exon of the GmFT4 gene), and Figure 1B is a result confirming that gRNA1 and gRNA2 of the present invention specifically bind only to the GmFT4 gene.

[0015] Figure 2 is a schematic diagram (A) of the pMDC123_pcoCas9_CRISPR_FT4 vector used for GmFT4 gene correction in the present invention, and a photograph (B) showing the process of correcting the GmFT4 gene in a soybean plant using an Agrobacterium tumefaciens strain containing the vector.

[0016] Figure 3 shows the PCR results confirming whether the GmFT4 gene was corrected in the T1 transformant in which the GmFT4 gene was corrected. Bar is a marker gene, and WT is a wild-type soybean plant.

[0017] Figure 4 shows the results of comparative analysis of the base sequence (A) and amino acid sequence (B) of the GmFT4 gene of a T1 transformant in which the GmFT4 gene has been corrected with that of a wild-type soybean plant.

[0018] Figure 5 shows the results of confirming the flowering period (A), first ripening period (B), final ripening period (C), and total ripening period (D) of T2 transformants with corrected GmFT4 gene. R1: first flowering period, R7: time when one pod first turns yellow, R8: time when 95% of pods turn yellow, R7~R8: period from when pods first start to ripen until more than 95% of pods are ripe, W82: wild-type soybean plant, DAS: day after sowing.

[0019] Figure 6 is a photograph showing the pod phenotype 108 days after sowing of T2 transgenic seeds with the GmFT4 gene corrected. W82: wild-type soybean plant, DAS: day after sowing.

[0020] Figure 7 shows the results of checking the plant height (A), the number of effective nodes with pods (B), and the number of seeds (C) 108 days after sowing the T2 transformant seeds with the GmFT4 gene corrected, and a photograph (D) of the T3 seeds obtained from the GmFT4 gene corrected T2 transformant.

[0021] Figure 8 is a schematic diagram showing the maturity of the GmFT4 gene-corrected transformant (GmFT4GE #7) and the wild type (W82). DAS: day after sowing.

[0022] FIG. 9A is a schematic diagram showing the positions of the target sequence of gRNA1 of the present invention (Target 1: within the first exon of the GmFT6 gene) and the target sequence of gRNA2 (Target 2: within the second intron of the GmFT6 gene), and FIG. 9B is a result confirming that gRNA1 and gRNA2 of the present invention specifically bind only to the GmFT6 gene.

[0023] Figure 10 is a schematic diagram (A) of the pMDC123_pcoCas9_CRISPR_FT6 vector used for GmFT6 gene correction in the present invention, and a photograph (B) showing the process of correcting the GmFT6 gene in a soybean plant using an Agrobacterium tumefaciens strain containing the vector.

[0024] Figure 11 shows the PCR results confirming whether the GmFT6 gene was corrected in the T1 transformant in which the GmFT6 gene was corrected. Bar is a marker gene, and WT is a wild-type soybean plant.

[0025] Figure 12 shows the results of comparative analysis of the base sequence (A) and amino acid sequence (B) of the GmFT6 gene of a T1 transformant in which the GmFT6 gene has been corrected with that of a wild-type soybean plant.

[0026] Figure 13 shows the results of confirming the flowering period (A), first ripening period (B), final ripening period (C), and total ripening period (D) of T2 transformants with the corrected GmFT6 gene. R1: first flowering period, R7: the period when one pod first turns yellow, R8: the period when 95% of the pods turn yellow, R7~R8: the period from when the pods first begin to ripen until more than 95% of them are ripe, W82: wild-type soybean plant, DAS: day after sowing.

[0027] Figure 14 shows the flower phenotype (A) at 32 days after sowing and the pod phenotype (B) at 108 days after sowing of T2 transgenic seeds in which the GmFT6 gene was corrected. W82: wild-type soybean plant, DAS: day after sowing.

[0028] Figure 15 shows the results of checking the plant height (A), the number of effective nodes with pods (B), and the number of seeds (C) 108 days after sowing the T2 transformant seeds with the GmFT6 gene corrected, and a photograph (D) of the T3 seeds obtained from the GmFT6 gene corrected T2 transformant.

[0029] Figure 16 is a schematic diagram showing the maturity of the GmFT6 gene-corrected transformant (GmFT6GE #9) and the wild type (W82). DAS: day after sowing.

[0030] In order to achieve the object of the present invention, the present invention comprises the steps of (a) introducing guide RNA and endonuclease protein specific to the target base sequence of soybean-derived GmFT4 (Glycine maxFLOWERING LOCUS T 4) or GmFT6 (Glycine maxFLOWERING LOCUS T 6) gene into soybean plant cells to correct the genome; and

[0031] (b) a step of re-differentiating a soybean plant from a soybean plant cell in which the genome has been corrected; a method for producing a genome-corrected soybean plant induced to flower early or ripen early is provided.

[0032] In the method for producing a genome-edited soybean plant induced to flower early or ripen early according to the present invention, the genome-edited soybean plant produced using a guide RNA specific to the target base sequence of the GmFT4 gene is characterized by inducing early ripening, and the genome-edited soybean plant produced using a guide RNA specific to the target base sequence of the GmFT6 gene is characterized by inducing early flowering and early ripening.

[0033] In a method for producing a genome-edited soybean plant induced to flower early or ripen early according to one embodiment of the present invention, the maturation period refers to the time when the pods of the soybean plant turn yellow, and preferably refers to the period of time required from the time when one pod first begins to ripen yellow until 95% or more of the pods ripen yellow.

[0034] In a method for producing a genome-edited soybean plant induced to flower early or ripen early according to one embodiment of the present invention, the soybean-derived GmFT4 gene may preferably be composed of a base sequence of SEQ ID NO: 1, and the soybean-derived GmFT6 gene may preferably be composed of a base sequence of SEQ ID NO: 8, but is not limited thereto.

[0035] In addition, in the method for producing a genome-edited soybean plant induced to flower early or ripen early according to one embodiment of the present invention, the target base sequence of the GmFT4 gene may be composed of the base sequences of SEQ ID NO: 2 and SEQ ID NO: 3, and the target base sequence of the GmFT6 gene may be composed of the base sequences of SEQ ID NO: 9 and SEQ ID NO: 10, but is not limited thereto.

[0036] That is, the positions in the GmFT4 gene targeted by the guide RNA specific to the target base sequence according to the present invention are two in total, namely the base sequences of SEQ ID NO: 2 and SEQ ID NO: 3, and the positions in the GmFT6 gene are two in total, namely the base sequences of SEQ ID NO: 9 and SEQ ID NO: 10, but are not limited thereto.

[0037] The term "genome / gene editing" refers to a technology that can introduce targeted mutations into the genome sequence of plant and animal cells, including human cells, by knocking out or knocking in a specific gene through deletion, insertion, substitution, etc. of one or more nucleic acid molecules by DNA cleavage, or by introducing mutations into non-coding DNA sequences that do not produce proteins. For the purposes of the present invention, the genome editing may be, in particular, introducing mutations into plants using an endonuclease, such as a Cas9 protein, and a guide RNA.

[0038] The term "target gene" refers to a portion of DNA within the genome of a plant to be corrected through the present invention. In principle, the type of gene is not limited and may include both coding and non-coding regions. Those skilled in the art can select the target gene based on the desired mutation for the genome-edited plant to be produced, depending on the purpose.

[0039] The term "guide RNA" refers to an RNA specific for DNA encoding a base sequence of a target gene, and refers to a ribonucleic acid that serves to guide an endonuclease protein to the target DNA base sequence by complementarily binding to all or part of the target DNA base sequence. The guide RNA may be a dual RNA comprising two RNAs, namely, crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; or a single-stranded guide RNA (sgRNA) comprising a first region comprising a sequence that is all or partly complementary to a base sequence in the target DNA and a second region comprising a sequence that interacts with an RNA-guided nuclease. However, if the RNA-guided nuclease is in a form that can be active at the target base sequence, it may be included in the scope of the present invention without limitation. The guide RNA according to the present invention may preferably be in the form of a single-stranded guide RNA, but is not limited thereto, and may be appropriately selected according to techniques known in the art, such as the type of endonuclease used or the microorganism from which the endonuclease is derived.

[0040] Additionally, the guide RNA may be, but is not limited to, one transcribed from a plasmid template or one transcribed in vitro (e.g., an oligonucleotide duplex).

[0041] In addition, in the manufacturing method according to one embodiment of the present invention, the introduction of the guide RNA and endonuclease protein of step (a) into the soybean plant cell may be performed using, but is not limited to, a recombinant vector including a DNA encoding a guide RNA specific to the target base sequence of the soybean-derived GmFT4 or GmFT6 gene and a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA specific to the target base sequence of the soybean-derived GmFT4 or GmFT6 gene and an endonuclease protein.

[0042] In a manufacturing method according to one embodiment of the present invention, the endonuclease protein may be at least one selected from the group consisting of Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Francisella 1), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) or a functional analog thereof, and may preferably be a Cas9 protein, but is not limited thereto.

[0043] Cas9 protein or genetic information can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI). For example, the Cas9 protein may be one or more selected from the group consisting of, but is not limited to, a Cas9 protein derived from Streptococcus pyogenes, a Cas9 protein derived from Campylobacter jejuni, a Cas9 protein derived from Streptococcus thermophilus or Streptococcus aureus, a Cas9 protein derived from Neisseria meningitidis, a Cas9 protein derived from Pasteurella multocida, a Cas9 protein derived from Francisella novicida, etc.

[0044] The Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double-stranded DNA breaks. For the Cas9 protein to precisely bind to a target DNA sequence and cleave the DNA strand, a short three-base sequence known as a Protospacer Adjacent Motif (PAM) must be present next to the target DNA sequence. The Cas9 protein cleaves between the third and fourth base pairs from the PAM sequence (NGG).

[0045] In a manufacturing method according to one embodiment of the present invention, the guide RNA and the endonuclease protein form a ribonucleoprotein complex and operate as an RNA-Guided Engineered Nuclease (RGEN).

[0046] The CRISPR / Cas9 system used in the present invention is a gene correction method using the NHEJ (non-homologous end joining) mechanism that introduces a double-strand break at a specific location of a specific gene to be corrected, thereby inducing an insertion-deletion (InDel) mutation due to incomplete repair induced during the DNA repair process.

[0047] In the manufacturing method according to the present invention, the method for transducing the complex of the guide RNA and the endonuclease protein into plant cells can be suitably selected from the calcium / polyethylene glycol method for protoplasts, electroporation of protoplasts, microinjection into plant elements, particle bombardment of various plant elements (DNA or RNA-coated), infection by virus (incomplete) in gene transfer mediated by Agrobacterium tumefaciens, etc.

[0048] Furthermore, introducing the recombinant vector into a plant cell refers to a transformation method. Transformation of plant species is now commonplace, including both dicotyledonous and monocotyledonous plants. In principle, any transformation method can be used to introduce the recombinant vector according to the present invention into a suitable progenitor cell.

[0049] The "plant cell" used in the above trait correction may be any plant cell. The plant cell may be a cultured cell, cultured tissue, cultured organ, or a whole plant. "Plant tissue" includes differentiated or undifferentiated plant tissues, such as, but not limited to, roots, stems, leaves, pollen, seeds, and cancer tissues, as well as various types of cells used in culture, such as single cells, protoplasts, shoots, and callus tissues. The plant tissue may be in planta, organ culture, tissue culture, or cell culture.

[0050] In the manufacturing method of the present invention, any method known in the art can be used to regenerate a genome-edited plant from a genome-edited plant cell. The genome-edited plant cell must be regenerated into a whole plant. Techniques for regenerating mature plants from callus or protoplast cultures are well known in the art for numerous different species.

[0051] The present invention also provides a genome-edited soybean plant induced to flower early or ripen early, produced by the above production method, and seeds of the plant.

[0052] The genome-edited soybean plant, which is induced to flower early or ripen early according to the present invention, is a soybean plant in which the GmFT4 or GmFT6 gene is edited using the CRISPR / Cas9 system, and the soybean-derived GmFT4 or GmFT6 gene is knocked out, thereby inducing early flowering or early ripening compared to a soybean plant in which the genome is not edited.

[0053] In the genome-edited soybean plant of the present invention, the soybean plant in which the GmFT4 gene is corrected is characterized by early ripening, and the soybean plant in which the GmFT6 gene is corrected is characterized by early flowering and early ripening.

[0054] The present invention also provides a composition for genome editing for inducing early flowering or early ripening of a soybean plant, comprising as an active ingredient a recombinant vector comprising a DNA encoding a guide RNA specific to a target base sequence of a soybean-derived GmFT4 (Glycine maxFLOWERING LOCUS T 4) or GmFT6 (Glycine maxFLOWERING LOCUS T 6) gene and a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA specific to a target base sequence of a soybean-derived GmFT4 (Glycine maxFLOWERING LOCUS T 4) or GmFT6 (Glycine maxFLOWERING LOCUS T 6) gene and an endonuclease protein.

[0055] In the composition for genome correction of the present invention, the target base sequence of the GmFT4 gene may be composed of the base sequences of SEQ ID NO: 2 and SEQ ID NO: 3, and the target base sequence of the GmFT6 gene may be composed of the base sequences of SEQ ID NO: 9 and SEQ ID NO: 10, but is not limited thereto.

[0056] The composition for genome correction of the present invention comprises a recombinant vector including a DNA encoding a guide RNA specific to a target base sequence of a GmFT4 or GmFT6 gene and a nucleic acid sequence encoding an endonuclease protein, or a complex of a guide RNA specific to a target base sequence of a GmFT4 or GmFT6 gene and an endonuclease protein, so that when the composition is treated on a soybean plant cell, the complex of the guide RNA and the endonuclease protein can act as RNA genetic scissors to correct a target gene.

[0057] The composition for genome correction of the present invention preferably contains a guide RNA specific to the target base sequence of the GmFT4 gene consisting of the base sequences of SEQ ID NO: 2 and SEQ ID NO: 3, so that the GmFT4 gene can be knocked out, and early ripening of soybean plants can be induced through the knock-out of the GmFT4 gene.

[0058] In addition, the genome correction composition of the present invention preferably contains a guide RNA specific to the target base sequence of the GmFT6 gene consisting of the base sequences of SEQ ID NO: 9 and SEQ ID NO: 10, so that the GmFT6 gene can be knocked out, and early flowering and early ripening of soybean plants can be induced through the knock-out of the GmFT6 gene.

[0059]

[0060] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0061]

[0062] Materials and Methods

[0063] 1. Plant materials

[0064] Seeds of the soybean (Glycine max) Williams 82 variety were washed in running water for 30 minutes, and seeds with normal seed coats were selected, sterilized in 70% (v / v) ethanol for 30 seconds, sterilized in 1% (v / v) sodium hypochlorite solution for 30 minutes, washed, and excess moisture was removed to prepare. After that, the seeds were placed on a germination medium (B5 medium 3.2 g, sucrose 20 g, MES 0.5 g, agar 8 g, pH 5.7) with the navel facing down and germinated in an incubator at 26℃ for 20 hours under dark conditions, and then cultivated in a greenhouse under long-term conditions (16 hours of light, 8 hours of darkness).

[0065]

[0066] 2. Construction of vectors for transformation and soybean transformation

[0067] To perform sperm correction targeting the soybean-derived GmFT4 (Glycine maxFLOWERING LOCUS T 4, Glyma08g363100) gene, each gRNA (gRNA1 or gRNA2) that specifically binds to the target sequence within the first exon or the second exon of the GmFT4 gene was designed using the CRISPRdirect web tool (Fig. 1A), and gRNA1 and gRNA2 were inserted into the pMDC123 vector containing the codon-optimized Cas9 gene (plant codon optimized Cas9) via Golden Gate cloning to produce the pMDC123_pcoCas9_CRISPR_FT4 vector (Fig. 2A).

[0068] In addition, in order to perform sperm correction targeting the soybean-derived GmFT6 (Glycine maxFLOWERING LOCUS T 6, Glyma08g363200) gene, each gRNA (gRNA1 or gRNA2) that specifically binds to the target sequence within the first exon or the second intron of the GmFT6 gene was designed using the CRISPRdirect web tool (Fig. 9A), and gRNA1 and gRNA2 were inserted into the pMDC123 vector containing the codon-optimized Cas9 gene (plant codon-optimized Cas9) through Golden Gate cloning to produce the pMDC123_pcoCas9_CRISPR_FT6 vector (Fig. 10A).

[0069] Afterwards, the soybean seeds germinated in the germination medium for 20 hours were split in half using a blade and co-cultured with Agrobacterium tumefaciens EHA105 strain containing the pMDC123_pcoCas9_CRISPR_FT4 vector or the pMDC123_pcoCas9_CRISPR_FT6 vector for 4 days, respectively, and in SEMP5 medium (per 1 liter: MS B5 medium 4.4 g, sucrose 30 g, sodium thiosulfate 158 mg, DTT 154 mg, MES 0.6 g, asparagine 50 mg, pyroglutamic acid 100 mg, agar 8 g, zeatin 1 mg, GA3 1 mg, IAA 0.1 mg, cefotaxime 125 mg, thimetin 50 mg, vancomycin 50 mg). After rooting, when the stems grew more than 4 cm through subculture, the stems were cut and roots were induced in a root induction medium without antibiotics (per 1 liter: MS B5 medium 4.4 g, sucrose 30 g, sodium thiosulfate 158 mg, DTT 154 mg, MES 0.6 g, asparagine 50 mg, pyroglutamic acid 100 mg, agar 8 g, IBA 1 mg, cefotaxime 50 mg, thimetine 50 mg, vancomycin 25 mg). After that, the transformants that developed roots from the cut end of the stem were transferred to small pots, acclimatized in a plastic container for 2 weeks, and then transferred to large pots and cultivated in a greenhouse (Fig. 2B).

[0070]

[0071] Part 1. Analysis of flowering and maturation times in GmFT4 gene-edited soybean plants

[0072] Example 1-1. Production of soybean transformants with corrected GmFT4 gene

[0073] We designed gRNA1 targeting the first exon region of the soybean-derived GmFT4 gene and gRNA2 targeting the second exon region (Table 1). By comparing the base sequences with those of other GmFT family genes (GmFT1, GmFT2, GmFT3, GmFT5, or GmFT6), we confirmed that gRNA1 and gRNA2 are sequences that can specifically bind only to the GmFT4 gene (Fig. 1).

[0074] GmFT4 Gene-targeting gRNA information classification gRNA sequence (3'-5') Sequence number gRNA1 AGGGTTTAGCAGTTGTTTGG2 gRNA2 TGTATACTTCCTTATAAACG3

[0075] Afterwards, the Agrobacterium tumefaciens strain containing the pMDC123_pcoCas9_CRISPR_FT4 vector designed to express gRNA1 and gRNA2 was co-cultured with soybean seeds to produce transformants (T0) with the GmFT4 gene corrected (Fig. 2). The generations were advanced to obtain seeds, which were then cultivated in a greenhouse to obtain 14 T1 transformants. Genomic DNA of each T1 transformant was extracted, and PCR was performed on the marker genes, Bar gene and GmFT4 gene, using the primers in Table 2 below to confirm whether the transformed soybean plants were gene-corrected.

[0076] Primer information used in PCR analysis. Primer sequence (5'-3'). Sequence number. Bar. Gene F: AAACCCACGTCATGCCAGTTC4. R: CCATCGTCAACCACTACATCGAGAC5. GmFT4. Gene F: CAAGATAGGCCAAAAGCTAGC6. R: AGCTTATATACTACGTTGTTACGC7.

[0077] As a result, it was confirmed that the 282 bp band, which did not appear in the wild-type plant, appeared only in the T1 transformant, thereby confirming that the expression of the GmFT4 gene was inhibited in the T1 transformant by gene correction through gRNA1 and gRNA2 (Fig. 3).

[0078] In addition, as a result of performing sequencing analysis of the GmFT4 gene, it was confirmed that the base sequence of the GmFT4 gene of the T1 transformant had a deletion of 226 bp compared to the base sequence of the wild-type GmFT4 gene (Fig. 4A), and as a result of virtually translating the base sequence of the T1 transformant, it was confirmed that a premature stop codon occurred, indicating that the transformant did not produce normal GmFT4 protein (Fig. 4B).

[0079]

[0080] Example 1-2. Confirmation of flowering and ripening periods of soybean transformants with the GmFT4 gene corrected.

[0081] Among the GmFT4 gene corrected T1 transformants according to the present invention, 5 lines (#7-2, #7-3, #7-7, #7-9, #7-14) were selected and advanced to obtain T2 seeds. 8 seeds each were sown and cultured in a greenhouse for 108 days to confirm the flowering stage (R1) and ripening stage (R7, R8). R1 ​​is the first flowering stage, R7 is the stage when one pod first turns yellow, and R8 is the stage when 95% of the pods turn yellow. These are expressed as days after sowing (DAS). R7 to R8 are the periods from the time when the pods first begin to ripen until they are more than 95% ripe.

[0082] As a result, it was confirmed that the flowering period (R1) of the GmFT4 gene corrected T2 transformant was not significantly different from that of the wild type, whereas the first ripening period (R7) of the GmFT4 gene corrected T2 transformant was shortened by about 3 to 5 days compared to the wild type, the final ripening period (R8) was shortened by about 10 to 12 days compared to the wild type, and the total ripening period (R7 to R8) was shortened by about 6 to 8 days (Fig. 5).

[0083] In addition, when the pod phenotype was checked on the 108th day after sowing, it was confirmed that the wild type did not mature and some green pods remained, whereas more than 95% of the pods of the GmFT4 gene-corrected T2 transformant matured (Fig. 6).

[0084]

[0085] Example 1-3. Confirmation of growth and yield of soybean transformants with corrected GmFT4 gene

[0086] Among the GmFT4 gene corrected T1 transformants according to the present invention, 5 lines (#7-2, #7-3, #7-7, #7-9, #7-14) were selected and advanced to a generation to obtain T2 seeds. Then, 8 seeds were sown for each plant and cultured in a greenhouse for 108 days. Then, the plant height, number of effective nodes with pods, and number of seeds of each plant were investigated.

[0087] As a result, the plant height of the GmFT4 gene-corrected T2 transformant was generally reduced compared to the wild type, the number of effective nodes increased by about 1 to 3 nodes compared to the wild type, and the number of seeds increased by about 22% compared to the wild type (Figures 7A, 7B, and 7C).

[0088] In addition, when T3 seeds obtained from the GmFT4 gene-corrected T2 transformant were filled in the same circular plate to confirm that there was no difference in the size and quality of the seeds due to the GmFT4 gene correction (Fig. 7D).

[0089]

[0090] Based on the above results, it was found that the ripening period of soybean plants was effectively shortened through correction of the GmFT4 gene, thereby bringing forward the harvest time by approximately 11 days compared to the wild type (Fig. 8).

[0091]

[0092] Part 2. Analysis of flowering and maturation times in GmFT6 gene-edited soybean plants

[0093] Example 2-1. Production of soybean transformants with corrected GmFT6 gene

[0094] We designed gRNA1 targeting the first exon region of the soybean-derived GmFT6 gene and gRNA2 targeting the second intron region (Table 3). By comparing the base sequences with those of other GmFT family genes (GmFT1, GmFT2, GmFT3, GmFT6, or GmFT5), we confirmed that gRNA1 and gRNA2 are sequences that can specifically bind only to the GmFT6 gene (Fig. 9).

[0095] GmFT6 Gene-targeting gRNA information classification gRNA sequence (3'-5') Sequence number gRNA1 AGGGTTTATTAGTTTGGGAGG9 gRNA2 GCATGCATCTATGTGTTACG10

[0096] Thereafter, the Agrobacterium tumefaciens strain containing the pMDC123_pcoCas9_CRISPR_FT6 vector designed to express gRNA1 and gRNA2 was co-cultured with soybean seeds to produce transformants (T0) with the GmFT6 gene corrected (Fig. 10). The generations were advanced to obtain seeds, which were then cultivated in a greenhouse to obtain 19 T1 transformants. Genomic DNA of each individual T1 transformant was extracted, and PCR was performed on the Bar gene and GmFT6 gene, which are marker genes, using the primers in Table 4 below to confirm whether the transformed soybean plants were gene-corrected.

[0097] Primer information used in PCR analysis. Primer sequence (5'-3'). Sequence number. Bar. Gene F: AAACCCACGTCATGCCAGTTC4. R: CCATCGTCAACCACTACATCGAGAC5. GmFT6. Gene F: CAATGGCTATTACAACGAACCCTCTTG11. R: CATCCTATCGTTATGTTCATGGAGTAG12.

[0098] As a result, it was confirmed that the 216 bp band, which did not appear in the wild-type plant, appeared only in the T1 transformant, thereby confirming that the expression of the GmFT6 gene was inhibited in the T1 transformant by gene correction through gRNA1 and gRNA2 (Fig. 11).

[0099] In addition, as a result of performing sequencing analysis of the GmFT6 gene, it was confirmed that the base sequence of the GmFT6 gene of the T1 transformant had a deletion of 428 bp compared to the base sequence of the wild-type GmFT6 gene (Fig. 12A), and as a result of virtually translating the base sequence of the T1 transformant, it was confirmed that a premature stop codon occurred, indicating that the transformant did not produce normal GmFT6 protein (Fig. 12B).

[0100]

[0101] Example 2-2. Confirmation of flowering and ripening periods of soybean transformants with the GmFT6 gene corrected.

[0102] Among the GmFT6 gene corrected T1 transformants according to the present invention, 5 lines (#9-3, #9-16, #9-17, #9-18, #9-19) were selected and advanced to obtain T2 seeds. 8 seeds each were sown and cultured in a greenhouse for 108 days to confirm the flowering stage (R1) and ripening stage (R7, R8). R1 ​​is the first flowering stage, R7 is the time when one pod first turns yellow, and R8 is the time when 95% of the pods turn yellow, which are expressed as days after sowing (DAS). R7 to R8 are the periods from the time when the pods first begin to ripen until they are more than 95% ripe.

[0103] As a result, it was confirmed that the flowering period (R1) of the GmFT6 gene corrected T2 transformant was shortened by about 1 to 3 days compared to the wild type, the first ripening period (R7) was shortened by about 2 to 7 days compared to the wild type, the final ripening period (R8) was shortened by about 10 to 15 days compared to the wild type, and the total ripening period (R7 to R8) was shortened by about 5 to 8 days (Fig. 13).

[0104] In addition, when the flower phenotype was checked on the 32nd day after sowing, it was confirmed that the wild type did not flower at all, whereas all GmFT6 gene corrected T2 transformants flowered (Fig. 14A). When the pod phenotype was checked on the 108th day after sowing, it was confirmed that the wild type did not mature and some green pods remained, whereas more than 95% of the pods of the GmFT6 gene corrected T2 transformants matured (Fig. 14B).

[0105]

[0106] Example 2-3. Confirmation of growth and yield of soybean transformants with corrected GmFT6 gene

[0107] Among the GmFT6 gene corrected T1 transformants according to the present invention, 5 lines (#9-3, #9-16, #9-17, #9-18, #9-19) were selected and advanced to obtain T2 seeds. 8 seeds were sown for each plant and cultured in a greenhouse for 108 days. The plant height, number of effective nodes with pods, and number of seeds of each plant were investigated.

[0108] As a result, the plant height of the GmFT6 gene-corrected T2 transformant did not differ significantly from that of the wild type, the number of effective nodes increased by about 1 to 4 nodes compared to the wild type, and the number of seeds increased by about 8.4% compared to the wild type (Figs. 15A, 15B, and 15C).

[0109] In addition, when T3 seeds obtained from the GmFT6 gene-corrected T2 transformant were filled in the same circular plate to confirm that there was no difference in the size and quality of the seeds due to the GmFT6 gene correction (Fig. 15D).

[0110]

[0111] Based on the above results, it was found that the flowering and ripening periods of soybean plants could be effectively shortened through GmFT6 gene correction, thereby bringing forward the harvest time by approximately 13 days compared to the wild type (Fig. 16).

Claims

1. (a) A step of correcting the genome by introducing guide RNA and endonuclease protein specific to the target base sequence of the soybean-derived GmFT4 (Glycine maxFLOWERING LOCUS T 4) or GmFT6 (Glycine maxFLOWERING LOCUS T 6) gene into a soybean plant cell; and (b) A method for producing a genome-corrected soybean plant induced to flower early or ripen early, comprising the step of re-differentiating the soybean plant from the genome-corrected soybean plant cell.

2. A method for producing a genome-edited soybean plant induced to flower early or ripen early, characterized in that the target base sequence of the GmFT4 gene in paragraph 1 consists of the base sequences of sequence number 2 and sequence number 3.

3. A method for producing a genome-edited soybean plant induced to flower early or ripen early, characterized in that the target base sequence of the GmFT6 gene in paragraph 1 consists of the base sequences of SEQ ID NO: 9 and SEQ ID NO:

10.

4. A method for producing a genome-edited soybean plant induced to flower early or ripen early, characterized in that in the first paragraph, the introduction of the guide RNA and endonuclease protein of step (a) into the soybean plant cell uses a recombinant vector comprising a DNA encoding a guide RNA specific to the target base sequence of the soybean-derived GmFT4 or GmFT6 gene and a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA specific to the target base sequence of the soybean-derived GmFT4 or GmFT6 gene and an endonuclease protein.

5. A genome-edited soybean plant induced to flower early or ripen early, produced by the method of any one of claims 1 to 4.

6. Seeds in which the genome of a soybean plant has been corrected according to Article 5.

7. A composition for genome editing for inducing early flowering or early ripening of a soybean plant, comprising as an active ingredient a recombinant vector comprising DNA encoding a guide RNA specific to the target base sequence of a soybean-derived GmFT4 (Glycine maxFLOWERING LOCUS T 4) or GmFT6 (Glycine maxFLOWERING LOCUS T 6) gene and a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA specific to the target base sequence of a soybean-derived GmFT4 (Glycine maxFLOWERING LOCUS T 4) or GmFT6 (Glycine maxFLOWERING LOCUS T 6) gene and an endonuclease protein.

8. A composition for genome correction for inducing early flowering or early ripening of a soybean plant, characterized in that the target base sequence of the GmFT4 gene in paragraph 7 consists of the base sequences of sequence number 2 and sequence number 3.

9. A composition for genome correction for inducing early flowering or early ripening of a soybean plant, characterized in that the target base sequence of the GmFT6 gene in paragraph 7 consists of the base sequences of SEQ ID NO: 9 and SEQ ID NO: 10.

Images