Anti-tick vaccines and methods of use thereof
Patent Information
- Application Number
- PCT/US2024/033772
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-06-14
- Filing Date
- 2024-06-13
- Publication Date
- 2025-05-30
AI Technical Summary
Current methods lack effective solutions for controlling tick infestations and reducing the transmission of tick-borne diseases, as ticks pose a significant threat to humans and animals by transmitting pathogens through their bites.
A recombinant virus vaccine composition encoding subolesin, a tick protein, is developed, which is administered to subjects to generate an immune response and reduce tick infestations and the risk of tick-borne infections by interfering with tick immune response modulation and vector competency.
The vaccine effectively elicits an immune response against subolesin, reducing tick infestations and the risk of tick-borne diseases such as Lyme disease and others, by targeting the tick's immune response and reproduction processes.
Smart Images

Figure US2024033772_30052025_PF_FP_ABST
Abstract
Description
[0001] TITLE OF THE INVENTION
[0002] Anti-Tick Vaccines and Methods of Use Thereof
[0003] CROSS-REFERENCE TO RELATED APPLICATIONS
[0004] This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 63 / 472,973, filed June 14, 2023, which is incorporated herein by reference in its entirety.
[0005] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0006] The XML file named “205961_7098W01_SequenceListing.xml” created on June 10, 2024, comprising 48.8 KB, is hereby incorporated herein by reference in its entirety.
[0007] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0008] This invention was made with government support under Project Number 5R01 AH 54542-03 awarded by the National Institutes of Health. The government has certain rights in the invention.
[0009] BACKGROUND
[0010] Hematophagous arthropods, such as ticks, are arthropods that feed on the blood of a vertebrate host. Such hematophagous arthropods salivate into the vertebrate host to facilitate efficient blood acquisition, while minimally impacting the vertebrate host so that the feeding arthropod remains undetected and not affected by host immune responses.
[0011] Hematophagous arthropods are important vectors of several human and animal diseases, as they can transmit pathogens from one host to another during blood feeding. For example, ticks can transmit Lyme disease, Rocky Mountain spotted fever, inter alia, and mosquitos can transmit diseases such as malaria, dengue fever, and Zika virus, inter alia.
[0012] There is thus a need in the art for vaccine compositions against infections, diseases, and / or disorders caused or facilitated by hematophagous arthropods (e.g., ticks). The present disclosure addresses this need. BRIEF SUMMARY
[0013] In one aspect, the disclosure provides an isolated nucleic acid encoding a recombinant virus comprising subolesin (SUB), or a portion thereof.
[0014] In certain embodiments, the isolated nucleic acid further comprises a nucleic acid sequence encoding at least a portion of the genome of a RABV. In certain embodiments, the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a nucleoprotein (N) and a nucleic acid sequence encoding a phosphoprotein (P). In certain embodiments, the nucleic acid sequence encoding the subolesin, or a portion thereof, is inserted into a position between the nucleic acid sequence encoding the nucleoprotein (N) and the nucleic acid sequence encoding the phosphoprotein (P). In certain embodiments, a nucleic acid sequence encoding one or more of a 51 -residue ectodomain of rabies virus glycoprotein (RABV-G) (ED51), a RABV-G transmembrane domain (TM), and a RABV-G cytoplasmic domain (CD) is inserted into a position between the nucleic acid sequence encoding the nucleoprotein (N) and the nucleic acid sequence encoding the phosphoprotein (P). In certain embodiments, the isolated nucleic acid of the disclosure, wherein the nucleic acid comprises a nucleotide sequence having at least 85% sequence homology with SEQ ID NO:7.
[0015] In another aspect, the disclosure provides a recombinant virus comprising a nucleic acid sequence encoding subolesin (SUB), or a portion thereof.
[0016] In another aspect, the disclosure provides a vector comprising the isolated nucleic acid of the disclosure.
[0017] In another aspect, the disclosure provides a vaccine comprising the isolated nucleic acid of the disclosure or the recombinant virus of the disclosure and a pharmaceutically acceptable carrier.
[0018] In another aspect, the disclosure provides a method for controlling, reducing, or eliminating a tick infestation in a subject, the method comprising administering to the subject an effective amount of the isolated nucleic acid of the disclosure, the recombinant virus of the disclosure, the vector of the disclosure, or the vaccine of the disclosure.
[0019] In another aspect, the disclosure provides a method for controlling, reducing, or eliminating a tick infestation in a group of subjects, the method comprising administering to at least one subject in the group an effective amount of the isolated nucleic acid of the disclosure, the recombinant virus of the disclosure, the vector of the disclosure, or the vaccine of the disclosure.
[0020] In certain embodiments, the tick is at least one selected from the group consisting of Ixodes scapularis (blacklegged tick), Amblyomma americanum (lone star tick), Dermacentor variabilis (American dog tick), Hyalomma marginatum, Rhipicephalus sanguineus (brown dog tick), and Haemaphysalis longicornis (Asian longhorned tick).
[0021] In another aspect, the disclosure provides a method for decreasing risk of a tick-borne infection, disease, or disorder in a subject, the method comprising administering to the subject an effective amount of the isolated nucleic acid of the disclosure, the recombinant virus of the disclosure, the vector of the disclosure, or the vaccine of the disclosure.
[0022] A method for decreasing risk of a tick-borne infection, disease, or disorder in each subject in a group of subjects, the method comprising administering to at least one subject in the group an effective amount of the isolated nucleic acid of the disclosure, the recombinant virus of the disclosure, the vector of the disclosure, or the vaccine of the disclosure.
[0023] In certain embodiments, the infection, disease, or disorder is at least one selected from the group consisting of Lyme disease, rocky mountain spotted fever, ehrlichiosis, anaplasmosis, babesiosis, Powassan virus disease, Crimean-Congo Hemorrhagic Fever Virus (CCHFV), tularemia, Colorado tick fever, malaria, and dengue fever.
[0024] In another aspect, the disclosure provides an antiserum reactive with subolesin (SUB).
[0025] In another aspect, the disclosure provides a method for preparing the antiserum of the disclosure, the method comprising administering to a subject an effective amount of the isolated nucleic acid of the disclosure, the recombinant virus of the disclosure, the vector of the disclosure, or the vaccine of the disclosure.
[0026] BRIEF DESCRIPTION OF THE FIGURES
[0027] The drawings illustrate generally, by way of example, but not by way of limitation, various embodiments of the present application.
[0028] FIG. 1 depicts: (top) an exemplary vaccine construct of the present disclosure (i.e., BNSP333-Subolesin-ED51” or “BNSP333-SUB”) comprising a nucleic acid sequence encoding a number of rabies virus (RABV) components including nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and RNA-dependent RNA polymerase (L), wherein a nucleic acid sequence encoding subolesin (SUB), a 51 -residue ectodomain of rabies virus glycoprotein (ED51), transmembrane protein (TM), and cytoplasmic domain (CD) is positioned between the nucleoprotein (N) and phosphoprotein (P) domains; and (bottom) a control vaccine construct (z.e., “BNSP333-GP85-ED51” or “BNSP333-GP85”) comprising a nucleic acid sequence encoding a number of rabies virus (RABV) components including nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and RNA-dependent RNA polymerase (L), wherein a nucleic acid encoding mucin-like domain (MLD), a GP38 domain, a 51-residue ectodomain of rabies virus glycoprotein (ED51), transmembrane protein (TM), and cytoplasmic domain (CD) is positioned between the nucleoprotein (N) and phosphoprotein (P) domains.
[0029] FIG. 2 depicts BNSP333-SUB virus characterization. Sucrose purified virions were separated on an SDS PAGE protein gel and subjected to Western blot probing for subolesin. The viruses on the blot are the parental BNSP333 vector, BNSP333-SUB, and a recombinant RABV with an irrelevant protein CCHFV-GP85. Blot was probed withpolyclonal rabbit sera that is specific for the recombinant subolesin protein.
[0030] FIG. 3 depicts immunofluorescence surface staining of infected cells. BSR cells infected with BNSP333 (parental vector), BNSP333-SUB, BNSP333-GP85, pCAGGS-SUB, and negative control (Mock) were fixed and stained with antibodies against subolesin, CCHFV- GP38, and rabies virus glycoprotein (RVG). Slides were mounted with mounting media containing DAPI stain and images were taken on a confocal microscope.
[0031] FIGs. 4A-4B depict an analysis of sucrose purified virions (i.e., BNSP333, BNSP333- SUB, and BNSP333-GP85). Viral particles resolved by SDS-PAGE, then total protein stained against anti-GP38 (FIG. 4A) and anti-RVG+P (FIG. 4B). Viral proteins are indicated. The arrow in FIG. 4A highlights that there is a high concentration of GP38 protein in the BNSP333-GP85 virus. The arrow in FIG. 4B highlights that there is a higher concentration of RVG protein in the BNSP333-SUB virus compared to BNSP333 and BNSP333-GP85.
[0032] FIGs. 5A-5D depict quantification of antigen surface expression using flow cytometry. BSR cells were infected with each virus, fixed, and stained with antibodies against subolesin, CCHFV-GP38, and rabies virus glycoprotein (RVG). Stained cells were then run through flow cytometry for analysis. FIGs. 5A-5C represent the histograms for subolesin (FIG. 5A), CCHFV- GP38 (FIG. 5B), and RVG (FIG. 5C). FIG. 5D provides a bar graph depicting quantification of the geometric mean fluorescence from each of histogram depicted in FIGs. 5A-5C. The arrow in FIG. 5 A highlights that BNSP333-SUB has the greatest number of antigen surface in RABV-G. Arrow (1) in FIG. 5B highlights that BNSP333-SUB has the greatest number of antigen surface in GP38 and arrow (2) in FIG. 5B highlights that BNSP333-GP85 has the lowest number of antigen surface in GP38. The arrow in FIG. 5C highlights that BNSP333-SUB has the greatest number of antigen surface in Subolesin.
[0033] FIGs. 6A-6B depict multi-step (FIG. 6A) and one-step (FIG. 6B) growth curves on BSR cells after infection with BNSP33 (circle), BNSP333-SUB (square), and BNSP333-GP85 (triangle). Cells were infected with a low multiplicity of infection (MOI) of 0.1 for multi-step and a high MOI of 10 for one-step. Supernatant from cells was sampled every 24 h and tittered. The arrow in FIG. 6A highlights that, as the number of hours increases, the amount of BNSP333, BNSP333-SUB, and BNSP333-GP85 increases. The arrow in FIG. 6B highlights that, as the number of hours increases, the amount of virus titer for BNSP333, BNSP333-SUB, and BNSP333-GP85 increases.
[0034] FIG. 7 depicts subolesin ECso antibody titers of mice on day 28 post immunization with BNSP333-SUB. EC so antibody titers from total IgG anti-subolesin ELISAs. All vaccines containing subolesin or the positive control mouse sera had 4-star significance over any vaccine without subolesin or the negative control PBS group.
[0035] DETAILED DESCRIPTION OF THE INVENTION
[0036] Reference will now be made in detail to certain embodiments of the disclosed subject matter, examples of which are illustrated in part in the accompanying drawings. While the disclosed subject matter will be described in conjunction with the enumerated claims, it will be understood that the exemplified subject matter is not intended to limit the claims to the disclosed subject matter.
[0037] Throughout this document, values expressed in a range format should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. For example, a range of "about 0.1% to about 5%" or "about 0.1% to 5%" should be interpreted to include not just about 0.1% to about 5%, but also the individual values (e.g., 1%, 2%, 3%, and 4%) and the sub-ranges (e.g., 0.1% to 0.5%, 1.1% to 2.2%, 3.3% to 4.4%) within the indicated range. The statement "about X to Y" has the same meaning as "about X to about Y," unless indicated otherwise. Likewise, the statement "about X, Y, or about Z" has the same meaning as "about X, about Y, or about Z," unless indicated otherwise.
[0038] In this document, the terms "a," "an," or "the" are used to include one or more than one unless the context clearly dictates otherwise. The term "or" is used to refer to a nonexclusive "or" unless otherwise indicated. The statement "at least one of A and B" or "at least one of A or B" has the same meaning as "A, B, or A and B." In addition, it is to be understood that the phraseology or terminology employed herein, and not otherwise defined, is for the purpose of description only and not of limitation. Any use of section headings is intended to aid reading of the document and is not to be interpreted as limiting; information that is relevant to a section heading may occur within or outside of that particular section. All publications, patents, and patent documents referred to in this document are incorporated by reference herein in their entirety, as though individually incorporated by reference.
[0039] In the methods described herein, the acts can be carried out in any order, except when a temporal or operational sequence is explicitly recited. Furthermore, specified acts can be carried out concurrently unless explicit claim language recites that they be carried out separately. For example, a claimed act of doing X and a claimed act of doing Y can be conducted simultaneously within a single operation, and the resulting process will fall within the literal scope of the claimed process.
[0040] Definitions
[0041] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although any methods and materials similar or equivalent to those described herein may be used in the practice for testing of the present invention, the preferred materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used.
[0042] The term "about" as used herein can allow for a degree of variability in a value or range, for example, within 10%, within 5%, or within 1% of a stated value or of a stated limit of a range, and includes the exact stated value or range. The term “antibody” or “Ab” as used herein, refers to a protein, or polypeptide sequence derived from an immunoglobulin molecule, which specifically binds to a specific epitope on an antigen. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. The antibodies useful in the present invention may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, intracellular antibodies (“intrabodies”), Fv, Fab and F(ab)2, as well as single chain antibodies (scFv) and humanized antibodies (Harlow et al., 1998, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426). An antibody may be derived from natural sources or from recombinant sources. Antibodies are typically tetramers of immunoglobulin molecules.
[0043] The term “antiserum” as used herein refers to a serum obtained after immunization of an animal with an immunogen. The antiserum comprises antibodies specific to said immunogen generated after the immune response produced in the animal.
[0044] The term “ameliorating” or “treating” means that the clinical signs and / or the symptoms associated with a disease are lessened as a result of the actions performed. The signs or symptoms to be monitored will be well known to the skilled clinician.
[0045] As used herein when referring to a measurable value such as an amount, a temporal duration, and the like, the term “about” is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
[0046] The term “biological” or “biological sample” refers to a sample obtained from an organism or from components (e.g., cells) of an organism. The sample may be of any biological tissue or fluid. Frequently the sample will be a “clinical sample” which is a sample derived from a patient. Such samples include, but are not limited to, bone marrow, cardiac tissue, sputum, blood, lymphatic fluid, blood cells (e.g., white cells), tissue or fine needle biopsy samples, urine, peritoneal fluid, and pleural fluid, or cells therefrom. Biological samples may also include sections of tissues such as frozen sections taken for histological purposes.
[0047] As used herein, the terms "control," or " reference " are used interchangeably and refer to a value that is used as a standard of comparison. The term “ immunogenicity” as used herein, refers to the innate ability of an antigen or organism to elicit an immune response in an animal when the antigen or organism is administered to the animal. Thus, "enhancing the immunogenicity" refers to increasing the ability of an antigen or organism to elicit an immune response in an animal when the antigen or organism is administered to an animal. The increased ability of an antigen or organism to elicit an immune response can be measured by, among other things, a greater number of antibodies that bind to an antigen or organism, a greater diversity of antibodies to an antigen or organism, a greater number of T-cells specific for an antigen or organism, a greater cytotoxic or helper T-cell response to an antigen or organism, a greater expression of cytokines in response to an antigen, and the like.
[0048] As used herein, the terms “eliciting an immune response” or “immunizing” refer to the process of generating a B cell and / or a T cell response against a heterologous protein.
[0049] The term “antigen” or “Ag” as used herein is defined as a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both. The skilled artisan will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an “antigen” as that term is used herein. Furthermore, one skilled in the art will understand that an antigen need not be encoded solely by a full-length nucleotide sequence of a gene. It is readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a “gene” at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid.
[0050] The term “hematophagous arthropod” as used herein refers to an arthropod (J.e., any of a phylum of invertebrate animals (as insects, arachnids, and crustaceans) having a segmented body, jointed limbs, and a shell of chitin that is shed periodically) which at least partially feeds on the blood of a host organism. Non-limiting examples of hematophagous arthropods include ticks, mosquitos, and fleas.
[0051] “Heterologous antigens” used herein to refer to an antigen that is not endogenous to the organism comprising or expressing an antigen. As an example, a virus vaccine vector comprising or expressing a viral or tumor antigen comprises a heterologous antigen. The term “Heterologous protein” as used herein refers to a protein that elicits a beneficial immune response in a subject (i.e. mammal), irrespective of its source.
[0052] The term “specifically binds”, “selectively binds” or “binding specificity” refers to the ability of the humanized antibodies or binding compounds of the invention to bind to a target epitope with a greater affinity than that which results when bound to a non-target epitope. In certain embodiments, specific binding refers to binding to a target with an affinity that is at least 10, 50, 100, 250, 500, or 1000 times greater than the affinity for a non-target epitope.
[0053] As used herein, by “combination therapy” is meant that a first agent is administered in conjunction with another agent, “in combination with” or “in conjunction with” refers to administration of one treatment modality in addition to another treatment modality. As such, “in combination with” refers to administration of one treatment modality before, during, or after delivery of the other treatment modality to the individual. Such combinations are considered to be part of a single treatment regimen or regime.
[0054] “Humoral immunity” or “humoral immune response” both refer to B-cell mediated immunity and are mediated by highly specific antibodies, produced and secreted by B- lymphocytes (B-cells).
[0055] “Prevention” refers to the use of a pharmaceutical compositions for the vaccination against a disorder.
[0056] “Adjuvant” refers to a substance that is capable of potentiating the immunogenicity of an antigen. Adjuvants can be one substance or a mixture of substances and function by acting directly on the immune system or by providing a slow release of an antigen. Examples of adjuvants are aluminum salts, poly anions, bacterial glycopeptides and slow release agents as Freund's incomplete.
[0057] “Delivery vehicle” refers to a composition that helps to target the antigen to specific cells and to facilitate the effective recognition of an antigen by the immune system. The best-known delivery vehicles are liposomes, virosomes, microparticles including microspheres and nanospheres, polymers, bacterial ghosts, bacterial polysaccharides, attenuated bacteria, virus like particles, attenuated viruses and ISCOMS.
[0058] The term “expression” as used herein is defined as the transcription and / or translation of a particular nucleotide sequence driven by its promoter.
[0059] As used herein, the term “expression cassette” means a nucleic acid sequence capable of directing the transcription and / or translation of a heterologous coding sequence. In some embodiments, the expression cassette comprises a promoter sequence operably linked to a sequence encoding a heterologous protein. In some embodiments, the expression cassette further comprises at least one regulatory sequence operably linked to the sequence encoding the heterologous protein.
[0060] The terms “incorporated into” or “encapsulated in” as used herein refer to an antigenic peptide that is within a delivery vehicle, such as microparticles, bacterial ghosts, attenuated bacteria, virus like particles, attenuated viruses, ISCOMs, liposomes and preferably virosomes.
[0061] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that may comprise a protein or peptide’s sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
[0062] In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. “A” refers to adenosine, “C” refers to cytosine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.
[0063] The term “RNA” as used herein is defined as ribonucleic acid. "Transform", "transforming", and "transformation "is used herein to refer to a process of introducing an isolated nucleic acid into the interior of an organism.
[0064] The term “treatment” as used within the context of the present invention is meant to include therapeutic treatment as well as prophylactic, or suppressive measures for the disease or disorder. As used herein, the term “treatment” and associated terms such as “treat” and “treating” means the reduction of the progression, severity and / or duration of a disease condition or at least one symptom thereof. The term ‘treatment’ therefore refers to any regimen that can benefit a subject. The treatment may be in respect of an existing condition or may be prophylactic (preventative treatment). Treatment may include curative, alleviative or prophylactic effects. References herein to “therapeutic” and “prophylactic” treatments are to be considered in their broadest context. The term “therapeutic” does not necessarily imply that a subject is treated until total recovery. Similarly, “prophylactic” does not necessarily mean that the subject will not eventually contract a disease condition. Thus, for example, the term treatment includes the administration of an agent prior to or following the onset of a disease or disorder thereby preventing or removing all signs of the disease or disorder. As another example, administration of the agent after clinical manifestation of the disease to combat the symptoms of the disease comprises “treatment” of the disease.
[0065] The term “equivalent,” when used in reference to nucleotide sequences, is understood to refer to nucleotide sequences encoding functionally equivalent polypeptides. Equivalent nucleotide sequences will include sequences that differ by one or more nucleotide substitutions, additions- or deletions, such as allelic variants; and will, therefore, include sequences that differ from the nucleotide sequence of the nucleic acids described herein due to the degeneracy of the genetic code.
[0066] The term “isolated” as used herein with respect to nucleic acids, such as DNA or RNA, refers to molecules separated from other DNAs or RNAs, respectively that are present in the natural source of the macromolecule. The term isolated as used herein also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Moreover, an “isolated nucleic acid” is meant to include nucleic acid fragments, which are not naturally occurring as fragments and would not be found in the natural state. The term “isolated” is also used herein to refer to polypeptides, which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides. An “isolated cell” or “isolated population of cells” is a cell or population of cells that is not present in its natural environment.
[0067] “Identity” as used herein refers to the subunit sequence identity between two polymeric molecules particularly between two amino acid molecules, such as, between two polypeptide molecules. When two amino acid sequences have the same residues at the same positions; e.g., if a position in each of two polypeptide molecules is occupied by an Arginine, then they are identical at that position. The identity or extent to which two amino acid sequences have the same residues at the same positions in an alignment is often expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matching or identical positions; e.g., if half (e.g, five positions in a polymer ten amino acids in length) of the positions in two sequences are identical, the two sequences are 50% identical; if 90% of the positions (e.g., 9 of 10), are matched or identical, the two amino acids sequences are 90% identical.
[0068] The term "injury" as used herein refers to any damage or harm caused to the structure or function of a subject's body (e.g., skin puncture).
[0069] The term "infestation" as used herein in the context of an affected individual, host, or subject, refers to the presence of two or more ticks on a particular individual, host, or subject. In the context of a population or herd (i.e., group of subjects), the term “infestation” refers to the presence of at least one tick on two or more members of the herd or population (i.e., at least two affected individuals, hosts, or subjects).
[0070] A “mutation” as used therein is a change in a DNA sequence resulting in an alteration from its natural state. The mutation can comprise a deletion and / or insertion and / or duplication and / or substitution of at least one deoxyribonucleic acid base such as a purine (adenine and / or thymine) and / or a pyrimidine (guanine and / or cytosine).
[0071] Mutations may or may not produce discernible changes in the observable characteristics (phenotype) of an organism.
[0072] As used herein, the term “nucleic acid” refers to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides. ESTs, chromosomes, cDNAs, mRNAs, and rRNAs are representative examples of molecules that may be referred to as nucleic acids. As used herein, nucleic acids include but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a viral genome, using ordinary cloning technology and PCR™, and the like, and by synthetic means.
[0073] In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. “A” refers to adenosine, “C” refers to cytosine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.
[0074] As used herein, "operably linked" sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest. Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. There are numerous expression control sequences, including promoters which are native, constitutive, inducible and / or tissue-specific, are known in the art that may be used in the compositions of the invention. “Operably linked” should be construed to include RNA expression and control sequences in addition to DNA expression and control sequences.
[0075] As used herein, the term “pharmaceutical composition” refers to a mixture of at least one compound useful within the invention with other chemical components, such as carriers, stabilizers, diluents, adjuvants, dispersing agents, suspending agents, thickening agents, and / or excipients. The pharmaceutical composition facilitates administration of the compound to an organism. Multiple techniques of administering a compound exist in the art including, but not limited to: intravenous, oral, aerosol, parenteral, ophthalmic, pulmonary and topical administration.
[0076] The language “pharmaceutically acceptable carrier” includes a pharmaceutically acceptable salt, pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting a compound(s) of the present invention within or to the subject such that it may perform its intended function. Typically, such compounds are carried or transported from one organ, or portion of the body, to another organ, or portion of the body. Each salt or carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation, and not injurious to the subject. Some examples of materials that may serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer’s solution; ethyl alcohol; phosphate buffer solutions; diluent; granulating agent; lubricant; binder; disintegrating agent; wetting agent; emulsifier; coloring agent; release agent; coating agent; sweetening agent; flavoring agent; perfuming agent; preservative; antioxidant; plasticizer; gelling agent; thickener; hardener; setting agent; suspending agent; surfactant; humectant; carrier; stabilizer; and other non-toxic compatible substances employed in pharmaceutical formulations, or any combination thereof. As used herein, “pharmaceutically acceptable carrier” also includes any and all coatings, antibacterial and antifungal agents, and absorption delaying agents, and the like that are compatible with the activity of the compound, and are physiologically acceptable to the subject. Supplementary active compounds may also be incorporated into the compositions.
[0077] As used herein, the term “effective amount” or “therapeutically effective amount” means the amount of the virus like particle generated from vector of the invention which is required to prevent the particular disease condition, or which reduces the severity of and / or ameliorates the disease condition or at least one symptom thereof or condition associated therewith.
[0078] A “subject” or “patient,” as used therein, may be a human or non-human mammal. Nonhuman mammals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals. Preferably, the subject is human.
[0079] "Titers" are numerical measures of the concentration of a virus or viral vector compared to a reference sample, where the concentration is determined either by the activity of the virus, or by measuring the number of viruses in a unit volume of buffer. The titer of viral stocks are determined, e.g., by measuring the infectivity of a solution or solutions (typically serial dilutions) of the viruses, e.g., on HeLa cells using the soft agar method (see, Graham & Van Der eb (1973) Virology 52:456-467) or by monitoring resistance conferred to cells, e.g., G418 resistance encoded by the virus or vector, or by quantitating the viruses by UV spectrophotometry (see, Chardonnet & Dales (1970) Virology 40:462-477).
[0080] “Vaccination” refers to the process of inoculating a subject with an antigen to elicit an immune response in the subject, that helps to prevent or treat the disease or disorder the antigen is connected with. The term “immunization” is used interchangeably herein with vaccination.
[0081] A “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. In the present disclosure, the term “vector” includes an autonomously replicating virus.
[0082] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
[0083] Description
[0084] Ticks, and other hematophagous arthropods, pose a threat to humans and animals, as these insects transmit pathogens (e.g., viruses, bacteria, and parasites) to hosts through their bites. Ticks, and other hematophagous arthropods, deposit saliva into the vertebrate host to facilitate efficient blood acquisition.
[0085] Subolesin (SUB) is a transcription factor that is an ortholog of the Akirin gene found in mosquitoes and vertebrates. One of the primary functions of subolesin is its role in modulating immune response in arthropods (i.e., by initiating the NF-KB pathway). By controlling these immune-related genes, subolesin helps arthropods defend against infections by pathogens, including bacteria and parasites. Subolesin is also involved in various physiological processes in the tick, including digestion, reproduction, and metabolism.
[0086] In one aspect, subolesin represents a target for the development of strategies to control tick populations and reduce the transmission of tick-borne diseases in a population (e.g., livestock population). It is hypothesized that interference with subolesin function may disrupt the life cycle, reproduction, and vector competency of ticks, ultimately reducing their impact on human and animal health.
[0087] In one aspect, the present disclosure relates to a vaccine composition comprising an isolated nucleic acid encoding at least a portion of a viral genome (e. , rabies virus) and subolesin (SUB), or a fragment thereof. In certain embodiments, the subolesin or fragment thereof are immunogenic.
[0088] In certain embodiments, the compositions and / or methods of the present disclosure permit generation of an immune response to a tick transcription factor. In certain embodiments, the compositions and / or methods of the present disclosure are suitable for at least partially controlling, reducing, and / or eliminating a tick infestation. In certain embodiments, the tick infestation comprises infestation of a single host subject. In certain embodiments, the tick infestation comprises infestation of a population of hosts ( .g, livestock population).
[0089] Isolated Nucleic Acids
[0090] In one aspect, the present disclosure provides an isolated nucleic acid encoding a recombinant virus comprising subolesin (SUB), or a portion thereof.
[0091] In certain embodiments, the virus is a rhabdovirus. In certain embodiments, the virus is a paramyxovirus.
[0092] In certain embodiments, the virus is a rabies virus (RABV). In certain embodiments, the virus is a vesicular stomatitis virus (VSV). In certain embodiments, the virus is a measles virus (MV).
[0093] In certain embodiments, the isolated nucleic acid comprises a nucleic acid sequence encoding at least a portion of the genome of the virus.
[0094] In certain embodiments, the isolated nucleic acid comprises: (a) a nucleic acid sequence encoding at least a portion of the genome of a RABV; and
[0095] (b) a nucleic acid sequence encoding subolesin or a portion thereof.
[0096] In certain embodiments, the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a nucleoprotein (N) and a nucleic acid sequence encoding a phosphoprotein (P).
[0097] In certain embodiments, the nucleic acid sequence encoding the subolesin, or a portion thereof, is inserted into a position between the nucleic acid sequence encoding the nucleoprotein (N) and the nucleic acid sequence encoding the phosphoprotein (P).
[0098] In certain embodiments, the nucleic acid sequence encoding one or more of a 51-residue ectodomain of rabies virus glycoprotein (RABV-G) (ED51), a RABV-G transmembrane domain (TM), and a RABV-G cytoplasmic domain (CD) are further inserted into a position between the nucleic acid sequence encoding the nucleoprotein (N) and the nucleic acid sequence encoding the phosphoprotein (P).
[0099] In certain embodiments, the nucleic acid sequence comprises nucleic acid sequences encoding each of ED51, TM, and CD, wherein the nucleic acid sequence encoding the ED51, the nucleic acid sequence encoding the TM, and the nucleic acid sequence encoding the CD are each inserted into a position between the nucleic acid sequence encoding the nucleoprotein (N) and the nucleic acid sequence encoding the phosphoprotein (P).
[0100] In certain embodiments, the sequence encoding the ED51, the nucleic acid sequence encoding the TM, and the nucleic acid sequence encoding the CD are inserted into a position between the nucleic acid sequence encoding the subolesin (SUB) and the nucleic acid sequence encoding the phosphoprotein (P).
[0101] In certain embodiments, the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a matrix protein (M).
[0102] In certain embodiments, the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a glycoprotein (G).
[0103] In certain embodiments, the glycoprotein (G) comprises an attenuating mutation. In certain embodiments, the mutation is R333E.
[0104] In certain embodiments, the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a RNA-dependent RNA polymerase (L). In certain embodiments, the nucleic acid sequence encoding the subolesin (SUB), or a portion thereof, is positioned immediately 3’ to the nucleic acid sequence encoding the nucleoprotein (N) (i.e., 5’-N and 3’-SUB). In certain embodiments, the nucleic acid sequence encoding the ED51 is positioned immediately 3’ to the nucleic acid sequence encoding the subolesin (SUB) (i.e., 5’-SUB and 3’-ED51). In certain embodiments, the nucleic acid sequence encoding the TM is positioned immediately 3’ to the nucleic acid sequence encoding the ED51 (i.e., 5’-ED51 and 3’-TM). In certain embodiments, the nucleic acid sequence encoding the CD is positioned immediately 3’ to the nucleic acid sequence encoding the TM (i.e., 5’-TM and 3’- CD). In certain embodiments, the nucleic acid sequence encoding the phosphoprotein (P) is immediately 3’ to the nucleic acid sequence encoding the CD (i.e., 5’-CD and 3’-P). In certain embodiments, the nucleic acid sequence encoding the matrix protein (M) is immediately 3’ to the nucleic acid sequence encoding the phosphoprotein (P) (i.e., 5’-P and 3’-M). In certain embodiments, the nucleic acid sequence encoding the glycoprotein (G) is immediately 3’ to the nucleic acid sequence encoding the matrix protein (M) (i.e., 5’-M and 3’-G). In certain embodiments, the nucleic acid sequence encoding the RNA-dependent RNA polymerase (L) is immediately 3’ to the nucleic acid sequence encoding the glycoprotein (G) (i.e., 5’-G and 3’-L).
[0105] In certain embodiments, the nucleic acid sequence encoding the subolesin (SUB), or a portion thereof, comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or greater sequence homology with SEQ ID NO: 1. In certain embodiments, the nucleic acid sequence encoding the ED51 comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or greater sequence homology with SEQ ID NO:2. In certain embodiments, the nucleic acid sequence encoding the TM comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or greater sequence homology with SEQ ID NO:5. In certain embodiments, the nucleic acid sequence encoding the CD comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or greater sequence homology with SEQ ID NO:6.
[0106] In certain embodiments, the nucleic acid comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or greater sequence homology with SEQ ID NO:7. In certain embodiments, the nucleic acid encoding the recombinant virus is codon optimized for expression in a host cell, optionally wherein the host cell is a mammalian cell.
[0107] Vaccines and Vectors
[0108] In one aspect, the present disclosure provides a recombinant virus comprising a nucleic acid sequence encoding subolesin (SUB), or a portion thereof.
[0109] In certain embodiments, the virus is a rhabdovirus. In certain embodiments, the virus is a paramyxovirus.
[0110] In certain embodiments, virus is a rabies virus (RABV). In certain embodiments, virus is a vesicular stomatitis virus (VSV). In certain embodiments, virus is a measles virus (MV).
[0111] In certain embodiments, the recombinant virus comprises a nucleic acid sequence encoding at least a portion of the genome of the virus.
[0112] In certain embodiments, the recombinant virus comprises:
[0113] (a) a nucleic acid sequence encoding at least a portion of the genome of a rabies virus (RABV); and
[0114] (b) a nucleic acid sequence encoding subolesin (SUB) or a portion thereof.
[0115] In certain embodiments, the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a nucleoprotein (N) and a nucleic acid sequence encoding a phosphoprotein (P).
[0116] In certain embodiments, the nucleic acid sequence encoding the subolesin, or a portion thereof, is inserted into a position between the nucleic acid sequence encoding the nucleoprotein (N) and the nucleic acid sequence encoding the phosphoprotein (P).
[0117] In certain embodiments, the nucleic acid sequence encoding one or more of a 51-residue ectodomain of rabies virus glycoprotein (RABV-G) (ED51), a RABV-G transmembrane domain I, and a RABV-G cytoplasmic domain (CD) are further inserted into a position between the nucleic acid sequence encoding the nucleoprotein (N) and the nucleic acid sequence encoding the phosphoprotein (P).
[0118] In certain embodiments, the nucleic acid sequence comprises sequences encoding each of ED51, TM, and CD, wherein the nucleic acid sequence encoding the ED51, the nucleic acid sequence encoding the TM, and the nucleic acid sequence encoding the CD are each inserted into a position between the nucleic acid sequence encoding the nucleoprotein (N) and the nucleic acid sequence encoding the phosphoprotein (P).
[0119] In certain embodiments, the nucleic acid sequence encoding the ED51, the nucleic acid sequence encoding the TM, and the nucleic acid sequence encoding the CD are inserted into a position between the nucleic acid sequence encoding the subolesin (SUB) and the nucleic acid sequence encoding the phosphoprotein (P).
[0120] In certain embodiments, the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a matrix protein (M).
[0121] In certain embodiments, the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a glycoprotein (G).
[0122] In certain embodiments, the glycoprotein (G) comprises an attenuating mutation. In certain embodiments, the mutation is R333E.
[0123] In certain embodiments, the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a RNA-dependent RNA polymerase (L).
[0124] In certain embodiments, the nucleic acid sequence encoding the subolesin (SUB), or a portion thereof, is positioned immediately 3’ to the nucleic acid sequence encoding the nucleoprotein (N) (z.e., 5’-N and 3’-SUB). In certain embodiments, the nucleic acid sequence encoding the ED51 is positioned immediately 3’ to the nucleic acid sequence encoding the subolesin (SUB) (z.e., 5’-SUB and 3’-ED51). In certain embodiments, the nucleic acid sequence encoding the TM is positioned immediately 3’ to the nucleic acid sequence encoding the ED51 (z.e., 5’-ED51 and 3’-TM). In certain embodiments, the nucleic acid sequence encoding the CD is positioned immediately 3’ to the nucleic acid sequence encoding the TM (z.e., 5’-TM and 3’- CD). In certain embodiments, the nucleic acid sequence encoding the phosphoprotein (P) is immediately 3’ to the nucleic acid sequence encoding the CD (z.e., 5’-CD and 3’-P). In certain embodiments, the nucleic acid sequence encoding the matrix protein (M) is immediately 3’ to the nucleic acid sequence encoding the phosphoprotein (P) (z.e., 5’-P and 3’-M). In certain embodiments, the nucleic acid sequence encoding the glycoprotein (G) is immediately 3’ to the nucleic acid sequence encoding the matrix protein (M) (z.e., 5’-M and 3’-G). In certain embodiments, the nucleic acid sequence encoding the RNA-dependent RNA polymerase (L) is immediately 3’ to the nucleic acid sequence encoding the glycoprotein (G) (z.e., 5’-G and 3’-L). In certain embodiments, the nucleic acid sequence encoding the subolesin (SUB), or a portion thereof, comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or greater sequence homology with SEQ ID NO: 1. In certain embodiments, the nucleic acid sequence encoding the ED51 comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or greater sequence homology with SEQ ID NO:2. In certain embodiments, the nucleic acid sequence encoding the TM comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or greater sequence homology with SEQ ID NO:5. In certain embodiments, the nucleic acid sequence encoding the CD comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or greater sequence homology with SEQ ID NO:6.
[0125] In certain embodiments, the nucleic acid comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or greater sequence homology with SEQ ID NO:7.
[0126] In certain embodiments, the nucleic acid encoding the recombinant virus is codon optimized for expression in a host cell, optionally wherein the host cell is a mammalian cell.
[0127] In another aspect, the present disclosure provides a vector comprising the isolated nucleic acid of the present disclosure.
[0128] In another aspect, the present disclosure provides a vaccine comprising the isolated nucleic acid of the present disclosure or the recombinant virus of the present disclosure and a pharmaceutically acceptable carrier.
[0129] In certain embodiments, the vaccine further comprises an adjuvant.
[0130] In another aspect, the present disclosure provides an antiserum reactive with subolesin (SUB). In certain embodiments, the antiserum is obtained from a subject administered an effective amount of the isolated nucleic acid of the present disclosure, the recombinant virus of the present disclosure, the vector of the present disclosure, or the vaccine of the present disclosure.
[0131] Methods In one aspect, the present disclosure provides a method for controlling, reducing, or eliminating a tick infestation in a subject. In certain embodiments, the method comprises administering to the subject an effective amount of the isolated nucleic acid of the present disclosure. In certain embodiments, the method comprises administering to the subject an effective amount of the recombinant virus of the present disclosure. In certain embodiments, the method comprises administering to the subject an effective amount of the vector of the present disclosure. In certain embodiments, the method comprises administering to the subject an effective amount of the vaccine of the present disclosure.
[0132] In another aspect, the present disclosure provides a method for controlling, reducing, or eliminating a tick infestation in a group of subjects. In certain embodiments, the method comprises administering to at least one subject in the group an effective amount of the isolated nucleic acid of the present disclosure. In certain embodiments, the method comprises administering to at least one subject in the group an effective amount of the recombinant virus of the present disclosure. In certain embodiments, the method comprises administering to at least one subject in the group an effective amount of the vector of the present disclosure. In certain embodiments, the method comprises administering to at least one subject in the group an effective amount of the vaccine of the present disclosure.
[0133] In another aspect, the present disclosure provides a method for decreasing risk of a tick- borne infection, disease, or disorder in a subject. In certain embodiments, the method comprises administering to the subject an effective amount of the isolated nucleic acid of the present disclosure. In certain embodiments, the method comprises administering to the subject an effective amount of the recombinant virus of the present disclosure. In certain embodiments, the method comprises administering to the subject an effective amount of the vector of the present disclosure. In certain embodiments, the method comprises administering to the subject an effective amount of the vaccine of the present disclosure.
[0134] In another aspect, the present disclosure provides a method for decreasing risk of a tick- borne infection, disease, or disorder in a group of subjects. In certain embodiments, the method comprises administering to at least one subject in the group an effective amount of the isolated nucleic acid of the present disclosure. In certain embodiments, the method comprises administering to at least one subject in the group an effective amount of the recombinant virus of the present disclosure. In certain embodiments, the method comprises administering to at least one subject in the group an effective amount of the vector of the present disclosure. In certain embodiments, the method comprises administering to at least one subject in the group an effective amount of the vaccine of the present disclosure.
[0135] In certain embodiments, the tick is at least one selected from the group consisting of Ixodes scapularis (blacklegged tick), Amblyomma americanum (lone star tick), Dermacentor variabilis (American dog tick), Hyalomma marginatum, Rhipicephalus sanguineus (brown dog tick), and Haemaphysalis longicornis (Asian longhorned tick).
[0136] In certain embodiments, the infection(s), disease(s), or disorder(s) is at least one selected from the group consisting of Lyme disease, rocky mountain spotted fever, ehrlichiosis, anaplasmosis, babesiosis, Powassan virus disease, Crimean-Congo Hemorrhagic Fever Virus (CCHFV), tularemia, Colorado tick fever, malaria, and dengue fever.
[0137] In certain embodiments, the subject is a mammal. In certain embodiments, the mammal is a human. In certain embodiments, the mammal is cattle (e.g., cows, bulls, and oxen). In certain embodiments, the mammal is sheep. In certain embodiments, the mammal is goats. In certain embodiments, the mammal is pigs. In certain embodiments, the mammal is horses. In certain embodiments, the mammal is mice. In certain embodiments, the mammal is rats. In certain embodiments, the mammal is dogs.
[0138] In another aspect, the present disclosure provides a method of preparing the antiserum of the present disclosure. In certain embodiments, the method comprises administering to a subject an effective amount of the isolated nucleic acid of the present disclosure. In certain embodiments, the method comprises administering to a subject an effective amount of the recombinant virus of the present disclosure. In certain embodiments, the method comprises administering to a subject an effective amount of the vector of the present disclosure. In certain embodiments, the method comprises administering to a subject an effective amount of the vaccine of the present disclosure.
[0139] Pharmaceutical Compositions and Formulations
[0140] The vaccine of the invention may be formulated as a pharmaceutical composition. In some embodiments, the vaccine contains a live virus. In some embodiments, the vaccine contains deactivated viral particles. In some embodiments, the virus is a recombinant virus encoded by any one of the nucleic acid constructs as described herein. Such a pharmaceutical composition may be in a form suitable for administration to a subject (i.e., mammal), or the pharmaceutical composition may further comprise one or more pharmaceutically acceptable carriers, one or more additional ingredients, or some combination of these. The various components of the pharmaceutical composition may be present in the form of a physiologically acceptable salt, such as in combination with a physiologically acceptable cation or anion, as is well known in the art.
[0141] In one embodiment, the pharmaceutical compositions useful for practicing the method of the invention may comprise an adjuvant. Non-limiting examples of suitable adjuvants are Freund’s complete adjuvant, Freund’s incomplete adjuvant, Quil A, Detox, ISCOMs, squalene, MPLA, and CpG or other activators of TLR or inflammasome. The pharmaceutical composition or vaccine composition can comprise any one or more of the adjuvants described herein.
[0142] Pharmaceutical compositions that are useful in the methods of the invention may be suitably developed for inhalation, oral, rectal, vaginal, parenteral, topical, transdermal, pulmonary, intranasal, buccal, ophthalmic, intrathecal, intravenous or another route of administration. Other contemplated formulations include projected nanoparticles, liposomal preparations, resealed erythrocytes containing the active ingredient, and immunologically-based formulations. The route(s) of administration is readily apparent to the skilled artisan and depends upon any number of factors including the type and severity of the disease being treated, the type and age of the veterinary or human patient being treated, and the like.
[0143] Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions suitable for ethical administration to humans, it is understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation.
[0144] The composition of the invention may comprise a preservative from about 0.005% to 2.0% by total weight of the composition. The preservative is used to prevent spoilage in the case of exposure to contaminants in the environment.
[0145] Administration / Dosing The regimen of administration may affect what constitutes an effective amount. For example, the nucleic acid of the invention may be administered to the subject (i.e., mammal) in a single dose, in several divided dosages, as well as staggered dosages may be administered daily or sequentially, or the dose may be continuously infused, or may be a bolus injection. Further, the dosages may be proportionally increased or decreased as indicated by the exigencies of the therapeutic or prophylactic situation.
[0146] Administration of the compositions of the present invention to a subject, preferably a mammal, more preferably a human, may be carried out using known procedures, at dosages and for periods of time effective to treat the disease in the subject. An effective amount of the composition necessary to achieve the intended result will vary and will depend on factors such as the disease to be treated or prevented, the age, sex, weight, condition, general health and prior medical history of the subject being treated, and like factors well-known in the medical arts. In particular embodiments, it is especially advantageous to formulate the composition in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subjects to be treated; each unit containing a predetermined quantity of therapeutic compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical vehicle. The dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the composition and the heterologous protein to be expressed, and the particular therapeutic effect to be achieved.
[0147] Routes of Administration
[0148] One skilled in the art will recognize that although more than one route can be used for administration, a particular route can provide a more immediate and more effective reaction than another route. Routes of administration of any of the compositions of the invention include inhalation, oral, nasal, rectal, parenteral, sublingual, transdermal, transmucosal (e.g., sublingual, lingual, (trans)buccal, (trans)urethral, vaginal (e.g., trans- and perivaginally), (intra)nasal, and (trans)rectal), intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, electroporation and topical administration. Kits
[0149] In some embodiments a kit is provided for treating, preventing, or ameliorating a given disease, disorder or condition, or a symptom thereof, as described herein wherein the kit comprises: a) compositions as described herein; and optionally b) an additional agent or therapy as described herein. The kit can further include instructions or a label for using the kit to treat, prevent, or ameliorate the disease, disorder or condition. In yet other embodiments, the invention extends to kits assays for a given disease, disorder or condition, or a symptom thereof, as described herein. Such kits may, for example, contain the reagents from PCR or other nucleic acid hybridization technology (microarrays) or reagents for immunologically based detection techniques (e.g., ELISpot, ELISA).
[0150] Virus production
[0151] In yet another aspect, the present disclosure includes a method of increasing expression of a recombinant virus in a host cell. In one embodiment, the recombinant virus is a rabies virus. In some embodiments, the method comprises expressing in the host cell a nucleic acid sequence described herein. In some embodiments, the nucleic acid sequence has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence comprises SEQ ID NO: 1.
[0152] The recombinant virus can be produced in a host cell using methods known in the art, e.g., as described in Fisher et al., Cell Reports 32, 107920, July 21, 2020. In some embodiments, the host cell is a mammalian cell. In one embodiment, the host cell is a human cell. In one embodiment, the host cell is a primate cell. In some embodiments, the host cell is a BSR cell (a derivative of baby hamster kidney cell line BHK-21). In some embodiments, the host cell is a VERO cell (African green monkey cell line). In another embodiment, the host cell is a human lung cell e.g., human lung cell line BEAS-2b).
[0153] EXAMPLES
[0154] Various embodiments of the present application can be better understood by reference to the following Examples which are offered by way of illustration. The scope of the present application is not limited to the Examples given herein. Example 1: Design and evaluation of an exemplary tick vaccine
[0155] In one aspect, the present disclosure relates to an anti-tick vaccine composition comprising a recombinant Rabies virus (RABV) expressing the tick protein subolesin (SUB).
[0156] The subolesin gene sequence used to generate the recombinant rabies virus described herein is based off of the wild-type subolesin gene of Hyalomma marginatum ticks (879 bp; Subolesin_pUC57 vector). A chimeric subolesin gene was codon optimized for use in bovines. Utilizing methods of molecular cloning known to those of ordinary skill in the art, the chimeric subolesin gene was inserted into the RABV vaccine vector (BNSP333) and the resulting plasmid was designated BNSP333-SUB. The terms “BNSP333-SUB”, “BNSP333-subolesin-ED51”, and “BNSP333-SUB-ED51” are used interchangeably herein to refer to an exemplary isolated nucleic acid, virus, and / or vaccine composition.
[0157] The parent vector RABV vector used in the experiments described herein (i.e., BNSP333), is derived from the SAD B19 strain, which is a vaccine strain attenuated by tissue culture passage. This vector was designed to contain an additional RABV stop-start transcription signal sequence with unique BsiWI and Nhel restriction sites between the nucleoprotein (N) and phosphoprotein (P) genes for the introduction of foreign genes. To further increase the safety profde of the vector, an arginine to glutamic acid mutation was introduced at amino acid position 333 of RABV G, which greatly reduces neurovirulence.
[0158] BNSP333-SUB is a modified BNSP333 vector which comprises subolesin, as described herein (FIG. 1). BNSP333-GP85 is a modified BNSP333 vector, which comprises pre-cleavage glycoprotein MED and GP38 from Crimean-Congo Hemorrhagic Fever virus (CCHFV), as described herein (FIG. 1). Further, the RABV vectors described herein were characterized by Western blot (FIG. 2), immunofluorescence (FIG. 3), and flow cytometry staining of infected cells (FIGs. 5A-5D). Characterization demonstrated that all RABV express the RABV proteins, but only BNSP333-SUB expresses the subolesin protein. Additionally, viral growth kinetics were measured by growth curves (FIGs. 6A-6B), demonstrating that all viruses grew similarly to the parental BNSP333 virus, albeit slightly lower in the multi-step curve.
[0159] After characterization, the immunogenicity of this virus as a live vaccine was tested in mice. Mice were immunized with 1 x 107focus forming units (FFU) of each virus and bled to evaluate antibody response against subolesin. By day 28 post immunization, mice immunized with BNSP333-SUB showed antibody responses against subolesin as measured by a total IgG
[0160] ELISA against subolesin (FIG. 7).
[0161] Various sequences in accordance with some embodiments are as follows:
[0162] Subolesin (SEQ ID NO:1) gcatgtgccaccctgaaaagaacacatgactgggaccccctgcacagcccaaatgggcgcagccccaagcggcgccggtgcatgccttt gtccccacctgccccgccaacgcgagcccaccagatgaacccctctccttttggagaagtgccccccaaaatgacatcagaagaaattgct gccaacatccgagaggagatgaggcgactgcagaggagaaagcagctgtgtttccagggcactgatccagaatcccagcagaccagcg gtctcctaagtccggtaaggcgggaccagccgctcttcacattccggcaagtgggcctcatctgtgagcgcatgatgaaggaaagggagt ctcaaatacgtgaagagtacgatcacgtgctgagcaccaagctggcaggccagtatgacacctttgtcaagttcacctatgatcaa
[0163] ED51 (SEQ ID NO:2) gagagctctgttatcccactggtgcatcctttggctgacccatcaactgtatttaaagatggagatgaagcagaggactttgtggaggtacatc tgcctgatgtgcacaaccaggtcagcggcgtggacctgggcctacccaactggggcaag
[0164] MLD (SEQ ID NO: 3) atgcacatcagcctgatgtacgccatcctgtgcctgcagctgtgcggcctgggcgagacccacggcagccacaatgagacccggcacaa caagaccgacaccatgaccacccctggcgacaaccccagcagcgagccccctgtgagcaccgccctgagcatcaccctggatcctagc accgtgacccccaccacccctgccagcggcctggagggcagcggcgaagtgtacaccagcccccccatcaccaccggcagcctgccc ctgagcgagaccacccccgagctgcccgtgaccaccggcaccgataccctgagcgccggagatgtggaccccagcacccagacagcc ggcggaaccagcgcccccacagtgagaaccagcctgcccaatagccctagcaccccaagcacccctcaggacacccaccaccctgtga gaaacctgctgagcgtgaccagccctggccccgacgagaccagcacccccagcggcaccggcaaggagagcagcgccacctccagc ccccacccagtgagcaatagaccccctacccctcccgccaccgcccagggccccaccgagaacgacagccacaacgccaccgagcac cccgagagcctgacccagagcgccaccccaggcctgatgaccagcccaacccagatcgtgcacccccagtccgccacccctatcaccg tgcaggatacccaccccagccccaccaacaggagcaagcgg
[0165] GP38 (SEQ ID NO:4) aacctgaagatggagatcatcctgaccctgagccagggcctgaagaagtactacggcaagatcctgaggctgctgcagctgaccctggag gaggacaccgagggcctgctggagtggtgcaagagaaacctgggcctggactgcgacgataccttcttccagaagcggatcgaggagtt cttcatcaccggcgagggccacttcaatgaagtgctgcagttcagaacccccggcaccctgagcaccaccgagtctacccctgccggcct gcccaccgccgagcccttcaagagctacttcgccaagggcttcctgagcatcgacagcggctactacagcgccaagtgctacagcggca cctccaacagcggactgcagctgatcaacatcacccggcacagcaccagaatcgtggatacccctggccccaagatcaccaacctgaaa accatcaactgcatcaacctgaaggccagcatcttcaaggagcaccgggaagtggagatcaacgtgctgctgccccaggtggccgtgaat ctgagcaactgccacgtggtgatcaagagccatgtgtgcgactacagcctggatatcgacggcgctgtgagactgccccacatctaccacg agggcgtgttcatccctggcacctacaagatcgtgatcgacaagaagaacaagctgaacgaccggtgcaccctgttcaccgactgcgtgat caagggccgggaagtgagaaagggccagagcgtgctgagacagtacaagaccgagatccggatcggcaaggccagcaccgggtcc
[0166] TM (SEQ ID NO: 5) tacgtgcttctcagtgctggggcgttgacagccctgatgctgatcattttcctcatgacctgctgc
[0167] CD (SEQ ID NO: 6) aggcgcgtcaatagatcagagcccacccagcacaatttaagaggtacaggccgggaagtttcagtcacgccccagtctggaaaaattatat cgtcctgggagtcccataaaagtggtggggaaactcgtttatga BNSP333-SUB (SEQ ID N0:7) ctgacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgccc gctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgc tttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttg gagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatt tcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttccattcgccattcaggct gcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttg ggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgccctagttattaatagtaatcaattacggggtcatta gttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtc aataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagta catcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgg gactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggttt gactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaaca actccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgc ttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagattaagcgtctgatgagtccgtgaggacgaaacccgg cgtaccgggtcacgcttaacaaccagatcaaagaaaaaacagacattgtcaattgcaaagcaaaaatgtaacacccctacaatggatgccg acaagattgtattcaaagtcaataatcaggtggtctctttgaagcctgagattatcgtggatcaatatgagtacaagtaccctgccatcaaagat ttgaaaaagccctgtataaccctaggaaaggctcccgatttaaataaagcatacaagtcagttttgtcaggcatgagcgccgccaaacttaat cctgacgatgtatgttcctatttggcagcggcaatgcagttttttgaggggacatgtccggaagactggaccagctatggaattgtgattgcac gaaaaggagataagatcaccccaggttctctggtggagataaaacgtactgatgtagaagggaattgggctctgacaggaggcatggaac tgacaagagaccccactgtccctgagcatgcgtcctagtcggtcttctcttgagtctgtataggttgagcaaaatatccgggcaaaacactg gtaactataagacaaacattgcagacaggatagagcagatttttgagacagccccttttgttaaaatcgtggaacaccatactctaatgacaac tcacaaaatgtgtgctaattggagtactataccaaacttcagatttttggccggaacctatgacatgtttttctcccggattgagcatctatattca gcaatcagagtgggcacagttgtcactgcttatgaagactgttcaggactggtatcatttactgggttcataaaacaaatcaatctcaccgcta gagaggcaatactatatttcttccacaagaactttgaggaagagataagaagaatgtttgagccagggcaggagacagctgttcctcactctt atttcatccacttccgttcactaggcttgagtgggaaatctccttattcatcaaatgctgttggtcacgtgttcaatctcattcactttgtaggatgct atatgggtcaagtcagatccctaaatgcaacggttattgctgcatgtgctcctcatgaaatgtctgttctagggggctatctgggagaggaattc ttcgggaaagggacatttgaaagaagattcttcagagatgagaaagaacttcaagaatacgaggcggctgaactgacaaagactgacgta gcactggcagatgatggaactgtcaactctgacgacgaggactacttttcaggtgaaaccagaagtccggaggctgtttatactcgaatcat gatgaatggaggtcgactaaagagatctcacatacggagatatgtctcagtcagttccaatcatcaagcccgtccaaactcattcgccgagtt tctaaacaagacatattcgagtgactcataacatgaaaaaaactaacacccctcccgtacggccaccatggagacggacacacttcttctttg ggtgctcctgctgtgggtccctgggtccactggagatgcatgtgccaccctgaaaagaacacatgactgggaccccctgcacagcccaaat gggcgcagccccaagcggcgccggtgcatgcctttgtccccacctgccccgccaacgcgagcccaccagatgaacccctctccttttgga gaagtgccccccaaaatgacatcagaagaaattgctgccaacatccgagaggagatgaggcgactgcagaggagaaagcagctgtgttt ccagggcactgatccagaatcccagcagaccagcggtctcctaagtccggtaaggcgggaccagccgctcttcacattccggcaagtgg gcctcatctgtgagcgcatgatgaaggaaagggagtctcaaatacgtgaagagtacgatcacgtgctgagcaccaagctggcaggccagt atgacacctttgtcaagttcacctatgatcaagagagctctgttatcccactggtgcatcctttggctgacccatcaactgtatttaaagatggag atgaagcagaggactttgtggaggtacatctgcctgatgtgcacaaccaggtcagcggcgtggacctgggcctacccaactggggcaagt acgtgcttctcagtgctggggcgttgacagccctgatgctgatcattttcctcatgacctgctgcaggcgcgtcaatagatcagagcccaccc agcacaattaagaggtacaggccgggaagttcagtcacgccccagtctggaaaaatatatcgtcctgggagtcccataaaagtggtggg gaaactcgtttatgagctagccatgaaaaaaactaacacccctcctttcgaaccatcccaaacatgagcaagatctttgtcaatcctagtgctat tagagccggtctggccgatcttgagatggctgaagaaactgttgatctgatcaatagaaatatcgaagacaatcaggctcatctccaagggg aacccatagaggtggacaatctccctgaggatatggggcgacttcacctggatgatggaaaatcgcccaaccatggtgagatagccaagg tgggagaaggcaagtatcgagaggactttcagatggatgaaggagaggatcctagcttcctgttccagtcatacctggaaaatgttggagtc caaatagtcagacaaatgaggtcaggagagagatttctcaagatatggtcacagaccgtagaagagattatatcctatgtcgcggtcaacttt cccaaccctccaggaaagtcttcagaggataaatcaacccagactactggccgagagctcaagaaggagacaacacccactccttctcag agagaaagccaatcatcgaaagccaggatggcggctcaaattgcttctggccctccagcccttgaatggtcggctaccaatgaagaggatg atctatcagtggaggctgagatcgctcaccagattgcagaaagttctccaaaaaatataagttccctctcgatcctcagggatactcttgtata attttgagcaattgaaaatgaaccttgatgatatagttaaagaggcaaaaaatgtaccaggtgtgacccgtttagcccatgacgggtccaaact ccccctaagatgtgtactgggatgggtcgctttggccaactctaagaaattccagttgttagtcgaatccgacaagctgagtaaaatcatgcaa gatgacttgaatcgctatacatcttgctaaccgaacctctcccctcagtccctctagacaataaaatccgagatgtcccaaagtcaacatgaaa aaaacaggcaacaccactgataaaatgaacctcctacgtaagatagtgaaaaaccgcagggacgaggacactcaaaaatcctctcccgcg tcagcccctctggatgacgatgacttgtggcttccaccccctgaatacgtcccgctgaaagaacttacaggcaagaagaacatgaggaactt ttgtatcaacggaagggttaaagtgtgtagcccgaatggttactcgttcaggatcctgcggcacattctgaaatcattcgacgagatatattctg ggaatcataggatgatcgggttagtcaaagtggttattggactggctttgtcaggatctccagtccctgagggcctgaactgggtatacaaatt gaggagaacctttatcttccagtgggctgattccaggggccctcttgaaggggaggagttggaatactctcaggagatcacttgggatgatg atactgagttcgtcggattgcaaataagagtgattgcaaaacagtgtcatatccagggcagagtctggtgtatcaacatgaacccgagagcat gtcaactatggtctgacatgtctcttcagacacaaaggtccgaagaggacaaagattcctctctgcttctagaataatcagattatatcccgcaa atttatcacttgtttacctctggaggagagaacatatgggctcaactccaacccttgggagcaatataacaaaaaacatgttatggtgccattaa accgctgcatttcatcaaagtcaagttgattacctttacattttgatcctcttggatgtgaaaaaaactattaacatccctcaaaagaccccggga aagatggttcctcaggctctcctgtttgtaccccttctggtttttccattgtgttttgggaaattccctatttacacgataccagacaagcttggtcc ctggagtccgattgacatacatcacctcagctgcccaaacaatttggtagtggaggacgaaggatgcaccaacctgtcagggttctcctaca tggaacttaaagttggatacatcttagccataaaagtgaacgggttcacttgcacaggcgttgtgacggaggctgaaacctacactaacttcg ttggttatgtcacaaccacgttcaaaagaaagcatttccgcccaacaccagatgcatgtagagccgcgtacaactggaagatggccggtga ccccagatatgaagagtctctacacaatccgtaccctgactaccgctggcttcgaactgtaaaaaccaccaaggagtctctcgttatcatatct ccaagtgtggcagatttggacccatatgacagatcccttcactcgagggtcttccctagcgggaagtgctcaggagtagcggtgtcttctacc tactgctccactaaccacgattacaccatttggatgcccgagaatccgagactagggatgtctgtgacatttttaccaatagtagagggaaga gagcatccaaagggagtgagacttgcggctttgtagatgaaagaggcctatataagtctttaaaaggagcatgcaaactcaagttatgtgga gttctaggacttagacttatggatggaacatgggtctcgatgcaaacatcaaatgaaaccaaatggtgccctcccgataagttggtgaacctg cacgactttcgctcagacgaaattgagcaccttgttgtagaggagttggtcaggaagagagaggagtgtctggatgcactagagtccatcat gacaaccaagtcagtgagtttcagacgtctcagtcatttaagaaaacttgtccctgggtttggaaaagcatataccatattcaacaagaccttg atggaagccgatgctcactacaagtcagtcgagacttggaatgagatcctcccttcaaaagggtgtttaagagttggggggaggtgtcatcc tcatgtgaacggggtgtttttcaatggtataatattaggacctgacggcaatgtcttaatcccagagatgcaatcatccctcctccagcaacata tggagttgttggaatcctcggttatcccccttgtgcaccccctggcagacccgtctaccgttttcaaggacggtgacgaggctgaggattttgt tgaagttcaccttcccgatgtgcacaatcaggtctcaggagttgacttgggtctcccgaactgggggaagtatgtattactgagtgcaggggc cctgactgccttgatgttgataattttcctgatgacatgttgtagaagagtcaatcgatcagaacctacgcaacacaatctcagagggacaggg agggaggtgtcagtcactccccaaagcgggaagatcatatcttcatgggaatcacacaagagtgggggtgagaccagactgtaattaatta acgtcctttcaacgatccaagtccatgaaaaaaactaacacccctcccgtacctagcttataaagtgctgggtcatctaagcttttcagtcgag aaaaaaacattagatcagaagaacaactggcaacacttctcaacctgagacttacttcaagatgctcgatcctggagaggtctatgatgaccc tattgacccaatcgagttagaggctgaacccagaggaacccccattgtccccaacatcttgaggaactctgactacaatctcaactctcctttg atagaagatcctgctagactaatgttagaatggttaaaaacagggaatagaccttatcggatgactctaacagacaattgctccaggtctttca gagttttgaaagattatttcaagaaggtagatttgggttctctcaaggtgggcggaatggctgcacagtcaatgatttctctctggttatatggtg cccactctgaatccaacaggagccggagatgtataacagacttggcccatttctattccaagtcgtcccccatagagaagctgttgaatctca cgctaggaaatagagggctgagaatccccccagagggagtgttaagttgccttgagagggttgattatgataatgcatttggaaggtatcttg ccaacacgtattcctcttacttgttcttccatgtaatcaccttatacatgaacgccctagactgggatgaagaaaagaccatcctagcattatgga aagatttaacctcagtggacatcgggaaggacttggtaaagttcaaagaccaaatatggggactgctgatcgtgacaaaggactttgttact cccaaagttccaattgtctttttgacagaaactacacacttatgctaaaagatcttttcttgtctcgcttcaactccttaatggtcttgctctctcccc cagagccccgatactcagatgacttgatatctcaactatgccagctgtacattgctggggatcaagtcttgtctatgtgtggaaactccggctat gaagtcatcaaaatattggagccatatgtcgtgaatagtttagtccagagagcagaaaagtttaggcctctcattcattccttgggagactttcct gtatttataaaagacaaggtaagtcaacttgaagagacgttcggtccctgtgcaagaaggttctttagggctctggatcaattcgacaacatac atgacttggtttttgtgtttggctgttacaggcattgggggcacccatatatagattatcgaaagggtctgtcaaaactatatgatcaggttcacct taaaaaaatgatagataagtcctaccaggagtgcttagcaagcgacctagccaggaggatccttagatggggttttgataagtactccaagtg gtatctggattcaagattcctagcccgagaccaccccttgactccttatatcaaaacccaaacatggccacccaaacatattgtagacttggtg ggggatacatggcacaagctcccgatcacgcagatcttgagattcctgaatcaatggatccgtcagaaatattggatgacaaatcacattct tcaccagaacgagactagcttcttggctgtcagaaaaccgaggggggcctgttcctagcgaaaaagttattatcacggccctgtctaagccg cctgtcaatccccgagagtttctgaggtctatagacctcggaggattgccagatgaagacttgataattggcctcaagccaaaggaacggga attgaagattgaaggtcgattctttgctctaatgtcatggaatctaagattgtattttgtcatcactgaaaaactcttggccaactacatcttgccac tttttgacgcgctgactatgacagacaacctgaacaaggtgtttaaaaagctgatcgacagggtcaccgggcaagggcttttggactattcaa gggtcacatatgcatttcacctggactatgaaaagtggaacaaccatcaaagattagagtcaacagaggatgtattttctgtcctagatcaagt gtttggattgaagagagtgttttctagaacacacgagttttttcaaaaggcctggatctattattcagacagatcagacctcatcgggttacggg aggatcaaatatactgcttagatgcgtccaacggcccaacctgttggaatggccaggatggcgggctagaaggcttacggcagaagggct ggagtctagtcagcttattgatgatagatagagaatctcaaatcaggaacacaagaaccaaaatactagctcaaggagacaaccaggttttat gtccgacatacatgttgtcgccagggctatctcaagaggggctcctctatgaattggagagaatatcaaggaatgcactttcgatatacagag ccgtcgaggaaggggcatctaagctagggctgatcatcaagaaagaagagaccatgtgtagttatgacttcctcatctatggaaaaacccct ttgtttagaggtaacatattggtgcctgagtccaaaagatgggccagagtctcttgcgtctctaatgaccaaatagtcaacctcgccaatataat gtcgacagtgtccaccaatgcgctaacagtggcacaacactctcaatctttgatcaaaccgatgagggattttctgctcatgtcagtacaggc agtctttcactacctgctatttagcccaatcttaaagggaagagtttacaagattctgagcgctgaaggggagagctttctcctagccatgtcaa ggataatctatctagatccttctttgggagggatatctggaatgtccctcggaagattccatatacgacagttctcagaccctgtctctgaaggg ttatccttctggagagagatctggttaagctcccaagagtcctggattcacgcgttgtgtcaagaggctggaaacccagatcttggagagaga acactcgagagcttcactcgccttctagaagatccgaccaccttaaatatcagaggaggggccagtcctaccattctactcaaggatgcaatc agaaaggctttatatgacgaggtggacaaggtggaaaattcagagtttcgagaggcaatcctgttgtccaagacccatagagataattttata ctcttcttaatatctgttgagcctctgtttcctcgatttctcagtgagctattcagttcgtcttttttgggaatccccgagtcaatcattggattgatac aaaactcccgaacgataagaaggcagtttagaaagagtctctcaaaaacttagaagaatccttctacaactcagagatccacgggattagtc ggatgacccagacacctcagagggttgggggggtgtggccttgctcttcagagagggcagatctacttagggagatctcttggggaagaa aagtggtaggcacgacagttcctcacccttctgagatgttgggattacttcccaagtcctctatttcttgcacttgtggagcaacaggaggagg caatcctagagtttctgtatcagtactcccgtcctttgatcagtcatttttttcacgaggccccctaaagggatacttgggctcgtccacctctatg tcgacccagctattccatgcatgggaaaaagtcactaatgttcatgtggtgaagagagctctatcgttaaaagaatctataaactggttcattac tagagattccaacttggctcaagctctaattaggaacattatgtctctgacaggccctgatttccctctagaggaggcccctgtcttcaaaagga cggggtcagccttgcataggttcaagtctgccagatacagcgaaggagggtattcttctgtctgcccgaacctcctctctcatatttctgttagt acagacaccatgtctgatttgacccaagacgggaagaactacgatttcatgttccagccattgatgctttatgcacagacatggacatcagag ctggtacagagagacacaaggctaagagactctacgtttcattggcacctccgatgcaacaggtgtgtgagacccattgacgacgtgaccc tggagacctctcagatcttcgagtttccggatgtgtcgaaaagaatatccagaatggtttctggggctgtgcctcacttccagaggcttcccga tatccgtctgagaccaggagattttgaatctctaagcggtagagaaaagtctcaccatatcggatcagctcaggggctcttatactcaatctta gtggcaattcacgactcaggatacaatgatggaaccatcttccctgtcaacatatacggcaaggtttcccctagagactatttgagagggctc gcaaggggagtattgataggatcctcgatttgcttcttgacaagaatgacaaatatcaatattaatagacctcttgaattggtctcaggggtaat ctcatatattctcctgaggctagataaccatccctccttgtacataatgctcagagaaccgtctcttagaggagagatattttctatccctcagaa aatccccgccgcttatccaaccactatgaaagaaggcaacagatcaatcttgtgttatctccaacatgtgctacgctatgagcgagagataat cacggcgtctccagagaatgactggctatggatcttttcagactttagaagtgccaaaatgacgtacctatccctcattacttaccagtctcatct tctactccagagggttgagagaaacctatctaagagtatgagagataacctgcgacaattgagttctttgatgaggcaggtgctgggcgggc acggagaagataccttagagtcagacgacaacattcaacgactgctaaaagactctttacgaaggacaagatgggtggatcaagaggtgc gccatgcagctagaaccatgactggagattacagccccaacaagaaggtgtcccgtaaggtaggatgttcagaatgggtctgctctgctca acaggttgcagtctctacctcagcaaacccggcccctgtctcggagcttgacataagggccctctctaagaggttccagaaccctttgatctc gggcttgagagtggttcagtgggcaaccggtgctcattataagcttaagcctattctagatgatctcaatgttttcccatctctctgccttgtagtt ggggacgggtcaggggggatatcaagggcagtcctcaacatgtttccagatgccaagcttgtgttcaacagtcttttagaggtgaatgacct gatggcttccggaacacatccactgcctccttcagcaatcatgaggggaggaaatgatatcgtctccagagtgatagatcttgactcaatctg ggaaaaaccgtccgacttgagaaacttggcaacctggaaatacttccagtcagtccaaaagcaggtcaacatgtcctatgacctcattatttg cgatgcagaagttactgacattgcatctatcaaccggatcaccctgttaatgtccgattttgcattgtctatagatggaccactctatttggtcttc aaaacttatgggactatgctagtaaatccaaactacaaggctattcaacacctgtcaagagcgttcccctcggtcacagggtttatcacccaa gtaacttcgtcttttcatctgagctctacctccgattctccaaacgagggaagtttttcagagatgctgagtacttgacctcttccacccttcgag aaatgagccttgtgttattcaatgtagcagccccaagagtgagatgcagagagctcgttccttgaactatcaggatcttgtgagaggattcct gaagaaatcatatcaaatccttacaatgagatgatcataactctgattgacagtgatgtagaatcttttctagtccacaagatggttgatgatcttg agttacagaggggaactctgtctaaagtggctatcattatagccatcatgatagttttctccaacagagtcttcaacgtttccaaacccctaactg acccctcgttctatccaccgtctgatcccaaaatcctgaggcacttcaacatatgttgcagtactatgatgtatctatctactgctttaggtgacgt ccctagcttcgcaagacttcacgacctgtataacagacctataacttattacttcagaaagcaagtcattcgagggaacgtttatctatcttgga gttggtccaacgacacctcagtgttcaaaagggtagcctgtaattctagcctgagtctgtcatctcactggatcaggttgatttacaagatagtg aagactaccagactcgttggcagcatcaaggatctatccagagaagtggaaagacaccttcataggtacaacaggtggatcaccctagag gatatcagatctagatcatccctactagactacagttgcctgtgaaccggatactcctggaagcctgcccatgctaagactcttgtgtgatgtat cttgaaaaaaacaagatcctaaatctgaacctttggttgtttgattgtttttctcatttttgttgtttatttgttaagcgtgggtcggcatggcatctcca cctcctcgcggtccgacctgggcatccgaaggaggacgcacgtccactcggatggctaagggagagccagaaggatccggctgctaac aaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggtt ttttgctgaaagtcgcgcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccgga agcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctg tcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttacgcttcctcgctcactgactcgct gcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaa gaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacg agcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcg tgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtagg tatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactat cgtcttgagtccaacccggtaagacacgactatcgccactggcagcagccactggtaacaggatagcagagcgaggtatgtaggcggt gctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaa aaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaa ggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaa aaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaa tcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggctta ccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggcc gagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagttt gcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcga gttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcat ggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaata gtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaa aacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatc ttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaata ctcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaatag gggttccgcgcacatttccccgaaaagtgccac
[0168] BNSP333-GP58-ED51 (SEQ ID N0:8) ctgacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgccc gctcctttcgcttcttcccttccttctcgccacgtcgccggctttccccgtcaagctctaaatcgggggctcccttagggtccgattagtgc tttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttg gagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatt tcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttccattcgccattcaggct gcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttg ggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgccctagttattaatagtaatcaattacggggtcatta gttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtc aataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagta catcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgg gactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggttt gactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaaca actccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgc ttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagattaagcgtctgatgagtccgtgaggacgaaacccgg cgtaccgggtcacgcttaacaaccagatcaaagaaaaaacagacattgtcaattgcaaagcaaaaatgtaacacccctacaatggatgccg acaagattgtattcaaagtcaataatcaggtggtctctttgaagcctgagattatcgtggatcaatatgagtacaagtaccctgccatcaaagat ttgaaaaagccctgtataaccctaggaaaggctcccgatttaaataaagcatacaagtcagttttgtcaggcatgagcgccgccaaacttaat cctgacgatgtatgttcctatttggcagcggcaatgcagttttttgaggggacatgtccggaagactggaccagctatggaattgtgattgcac gaaaaggagataagatcaccccaggttctctggtggagataaaacgtactgatgtagaagggaattgggctctgacaggaggcatggaac tgacaagagaccccactgtccctgagcatgcgtccttagtcggtcttctcttgagtctgtataggttgagcaaaatatccgggcaaaacactg gtaactataagacaaacattgcagacaggatagagcagatttttgagacagccccttttgttaaaatcgtggaacaccatactctaatgacaac tcacaaaatgtgtgctaattggagtactataccaaacttcagatttttggccggaacctatgacatgtttttctcccggattgagcatctatattca gcaatcagagtgggcacagttgtcactgcttatgaagactgttcaggactggtatcatttactgggttcataaaacaaatcaatctcaccgcta gagaggcaatactatatttcttccacaagaactttgaggaagagataagaagaatgtttgagccagggcaggagacagctgttcctcactctt atttcatccacttccgttcactaggcttgagtgggaaatctccttattcatcaaatgctgttggtcacgtgttcaatctcattcactttgtaggatgct atatgggtcaagtcagatccctaaatgcaacggttattgctgcatgtgctcctcatgaaatgtctgttctagggggctatctgggagaggaattc ttcgggaaagggacatttgaaagaagattcttcagagatgagaaagaacttcaagaatacgaggcggctgaactgacaaagactgacgta gcactggcagatgatggaactgtcaactctgacgacgaggactacttttcaggtgaaaccagaagtccggaggctgtttatactcgaatcat gatgaatggaggtcgactaaagagatctcacatacggagatatgtctcagtcagttccaatcatcaagcccgtccaaactcattcgccgagtt tctaaacaagacatattcgagtgactcataacatgaaaaaaactaacacccctcccgtacggccaccatgcacatcagcctgatgtacgcca tcctgtgcctgcagctgtgcggcctgggcgagacccacggcagccacaatgagacccggcacaacaagaccgacaccatgaccacccc tggcgacaaccccagcagcgagccccctgtgagcaccgccctgagcatcaccctggatcctagcaccgtgacccccaccacccctgcca gcggcctggagggcagcggcgaagtgtacaccagcccccccatcaccaccggcagcctgcccctgagcgagaccacccccgagctgc ccgtgaccaccggcaccgataccctgagcgccggagatgtggaccccagcacccagacagccggcggaaccagcgcccccacagtg agaaccagcctgcccaatagccctagcaccccaagcacccctcaggacacccaccaccctgtgagaaacctgctgagcgtgaccagccc tggccccgacgagaccagcacccccagcggcaccggcaaggagagcagcgccacctccagcccccacccagtgagcaatagacccc ctacccctcccgccaccgcccagggccccaccgagaacgacagccacaacgccaccgagcaccccgagagcctgacccagagcgcc accccaggcctgatgaccagcccaacccagatcgtgcacccccagtccgccacccctatcaccgtgcaggatacccaccccagccccac caacaggagcaagcggaacctgaagatggagatcatcctgaccctgagccagggcctgaagaagtactacggcaagatcctgaggctg ctgcagctgaccctggaggaggacaccgagggcctgctggagtggtgcaagagaaacctgggcctggactgcgacgataccttcttcca gaagcggatcgaggagttcttcatcaccggcgagggccacttcaatgaagtgctgcagttcagaacccccggcaccctgagcaccaccg agtctacccctgccggcctgcccaccgccgagcccttcaagagctacttcgccaagggcttcctgagcatcgacagcggctactacagcg ccaagtgctacagcggcacctccaacagcggactgcagctgatcaacatcacccggcacagcaccagaatcgtggatacccctggcccc aagatcaccaacctgaaaaccatcaactgcatcaacctgaaggccagcatcttcaaggagcaccgggaagtggagatcaacgtgctgctg ccccaggtggccgtgaatctgagcaactgccacgtggtgatcaagagccatgtgtgcgactacagcctggatatcgacggcgctgtgaga ctgccccacatctaccacgagggcgtgttcatccctggcacctacaagatcgtgatcgacaagaagaacaagctgaacgaccggtgcacc ctgttcaccgactgcgtgatcaagggccgggaagtgagaaagggccagagcgtgctgagacagtacaagaccgagatccggatcggca aggccagcaccgggtccgaatcctcggttatcccccttgtgcaccccctggcagacccgtctaccgtttcaaggacggtgacgaggctga ggattttgttgaagttcaccttcccgatgtgcacaatcaggtctcaggagttgacttgggtctcccgaactgggggaagtatgtattactgagtg caggggccctgactgccttgatgttgataattttcctgatgacatgttgtagaagagtcaatcgatcagaacctacgcaacacaatctcagagg gacagggagggaggtgtcagtcactccccaaagcgggaagatcatatcttcatgggaatcacacaagagtgggggtgagaccagactgt aagctagccatgaaaaaaactaacacccctcctttcgaaccatcccaaacatgagcaagatctttgtcaatcctagtgctattagagccggtct ggccgatcttgagatggctgaagaaactgttgatctgatcaatagaaatatcgaagacaatcaggctcatctccaaggggaacccatagag gtggacaatctccctgaggatatggggcgacttcacctggatgatggaaaatcgcccaaccatggtgagatagccaaggtgggagaaggc aagtatcgagaggactttcagatggatgaaggagaggatcctagcttcctgttccagtcatacctggaaaatgttggagtccaaatagtcaga caaatgaggtcaggagagagatttctcaagatatggtcacagaccgtagaagagattatatcctatgtcgcggtcaactttcccaaccctcca ggaaagtcttcagaggataaatcaacccagactactggccgagagctcaagaaggagacaacacccactccttctcagagagaaagcca atcatcgaaagccaggatggcggctcaaattgcttctggccctccagcccttgaatggtcggctaccaatgaagaggatgatctatcagtgg aggctgagatcgctcaccagattgcagaaagtttctccaaaaaatataagtttccctctcgatcctcagggatactcttgtataattttgagcaat tgaaaatgaaccttgatgatatagttaaagaggcaaaaaatgtaccaggtgtgacccgtttagcccatgacgggtccaaactccccctaagat gtgtactgggatgggtcgctttggccaactctaagaaattccagttgttagtcgaatccgacaagctgagtaaaatcatgcaagatgacttgaa tcgctatacatcttgctaaccgaacctctcccctcagtccctctagacaataaaatccgagatgtcccaaagtcaacatgaaaaaaacaggca acaccactgataaaatgaacctcctacgtaagatagtgaaaaaccgcagggacgaggacactcaaaaatcctctcccgcgtcagcccctct ggatgacgatgacttgtggcttccaccccctgaatacgtcccgctgaaagaacttacaggcaagaagaacatgaggaacttttgtatcaacg gaagggttaaagtgtgtagcccgaatggttactcgttcaggatcctgcggcacattctgaaatcattcgacgagatatattctgggaatcatag gatgatcgggttagtcaaagtggttattggactggctttgtcaggatctccagtccctgagggcctgaactgggtatacaaattgaggagaac ctttatcttccagtgggctgattccaggggccctcttgaaggggaggagttggaatactctcaggagatcacttgggatgatgatactgagttc gtcggattgcaaataagagtgattgcaaaacagtgtcatatccagggcagagtctggtgtatcaacatgaacccgagagcatgtcaactatg gtctgacatgtctcttcagacacaaaggtccgaagaggacaaagattcctctctgcttctagaataatcagattatatcccgcaaatttatcactt gtttacctctggaggagagaacatatgggctcaactccaacccttgggagcaatataacaaaaaacatgttatggtgccattaaaccgctgca tttcatcaaagtcaagttgattacctttacattttgatcctcttggatgtgaaaaaaactattaacatccctcaaaagaccccgggaaagatggttc ctcaggctctcctgtttgtaccccttctggtttttccattgtgttttgggaaattccctatttacacgataccagacaagcttggtccctggagtccg attgacatacatcacctcagctgcccaaacaatttggtagtggaggacgaaggatgcaccaacctgtcagggttctcctacatggaacttaaa gttggatacatcttagccataaaagtgaacgggttcacttgcacaggcgttgtgacggaggctgaaacctacactaacttcgttggttatgtca caaccacgttcaaaagaaagcattccgcccaacaccagatgcatgtagagccgcgtacaactggaagatggccggtgaccccagatatg aagagtctctacacaatccgtaccctgactaccgctggcttcgaactgtaaaaaccaccaaggagtctctcgttatcatatctccaagtgtggc agatttggacccatatgacagatcccttcactcgagggtcttccctagcgggaagtgctcaggagtagcggtgtcttctacctactgctccact aaccacgattacaccatttggatgcccgagaatccgagactagggatgtcttgtgacatttttaccaatagtagagggaagagagcatccaa agggagtgagacttgcggctttgtagatgaaagaggcctatataagtctttaaaaggagcatgcaaactcaagttatgtggagttctaggactt agacttatggatggaacatgggtctcgatgcaaacatcaaatgaaaccaaatggtgccctcccgataagttggtgaacctgcacgactttcg ctcagacgaaattgagcaccttgttgtagaggagttggtcaggaagagagaggagtgtctggatgcactagagtccatcatgacaaccaag tcagtgagtttcagacgtctcagtcatttaagaaaacttgtccctgggtttggaaaagcatataccatattcaacaagaccttgatggaagccga tgctcactacaagtcagtcgagacttggaatgagatcctcccttcaaaagggtgtttaagagttggggggaggtgtcatcctcatgtgaacgg ggtgtttttcaatggtataatattaggacctgacggcaatgtcttaatcccagagatgcaatcatccctcctccagcaacatatggagttgttgga atcctcggttatcccccttgtgcaccccctggcagacccgtctaccgttttcaaggacggtgacgaggctgaggattttgttgaagttcaccttc ccgatgtgcacaatcaggtctcaggagttgacttgggtctcccgaactgggggaagtatgtattactgagtgcaggggccctgactgccttg atgttgataattttcctgatgacatgttgtagaagagtcaatcgatcagaacctacgcaacacaatctcagagggacagggagggaggtgtc agtcactccccaaagcgggaagatcatatcttcatgggaatcacacaagagtgggggtgagaccagactgtaattaattaacgtcctttcaac gatccaagtccatgaaaaaaactaacacccctcccgtacctagcttataaagtgctgggtcatctaagcttttcagtcgagaaaaaaacattag atcagaagaacaactggcaacacttctcaacctgagacttacttcaagatgctcgatcctggagaggtctatgatgaccctattgacccaatc gagttagaggctgaacccagaggaacccccattgtccccaacatcttgaggaactctgactacaatctcaactctcctttgatagaagatcct gctagactaatgttagaatggttaaaaacagggaatagaccttatcggatgactctaacagacaattgctccaggtctttcagagttttgaaag attatttcaagaaggtagatttgggttctctcaaggtgggcggaatggctgcacagtcaatgatttctctctggttatatggtgcccactctgaat ccaacaggagccggagatgtataacagactggcccattctattccaagtcgtcccccatagagaagctgtgaatctcacgctaggaaata gagggctgagaatccccccagagggagtgttaagttgccttgagagggttgattatgataatgcatttggaaggtatcttgccaacacgtattc ctcttacttgttcttccatgtaatcaccttatacatgaacgccctagactgggatgaagaaaagaccatcctagcattatggaaagatttaacctc agtggacatcgggaaggacttggtaaagttcaaagaccaaatatggggactgctgatcgtgacaaaggactttgtttactcccaaagttccaa ttgtctttttgacagaaactacacacttatgctaaaagatcttttcttgtctcgcttcaactccttaatggtcttgctctctcccccagagccccgata ctcagatgacttgatatctcaactatgccagctgtacattgctggggatcaagtcttgtctatgtgtggaaactccggctatgaagtcatcaaaat attggagccatatgtcgtgaatagtttagtccagagagcagaaaagtttaggcctctcattcattccttgggagactttcctgtatttataaaaga caaggtaagtcaacttgaagagacgttcggtccctgtgcaagaaggttctttagggctctggatcaattcgacaacatacatgacttggtttttg tgtttggctgttacaggcattgggggcacccatatatagatatcgaaagggtctgtcaaaactatatgatcaggttcaccttaaaaaaatgata gataagtcctaccaggagtgcttagcaagcgacctagccaggaggatccttagatggggttttgataagtactccaagtggtatctggattca agattcctagcccgagaccaccccttgactccttatatcaaaacccaaacatggccacccaaacatattgtagacttggtgggggatacatgg cacaagctcccgatcacgcagatctttgagattcctgaatcaatggatccgtcagaaatattggatgacaaatcacattctttcaccagaacga gactagcttcttggctgtcagaaaaccgaggggggcctgttcctagcgaaaaagttattatcacggccctgtctaagccgcctgtcaatcccc gagagtttctgaggtctatagacctcggaggattgccagatgaagacttgataattggcctcaagccaaaggaacgggaattgaagattgaa ggtcgattctttgctctaatgtcatggaatctaagattgtattttgtcatcactgaaaaactcttggccaactacatcttgccactttttgacgcgctg actatgacagacaacctgaacaaggtgtttaaaaagctgatcgacagggtcaccgggcaagggcttttggactattcaagggtcacatatgc atttcacctggactatgaaaagtggaacaaccatcaaagattagagtcaacagaggatgtattttctgtcctagatcaagtgtttggattgaaga gagtgttttctagaacacacgagttttttcaaaaggcctggatctattattcagacagatcagacctcatcgggttacgggaggatcaaatatac tgcttagatgcgtccaacggcccaacctgttggaatggccaggatggcgggctagaaggcttacggcagaagggctggagtctagtcagc ttattgatgatagatagagaatctcaaatcaggaacacaagaaccaaaatactagctcaaggagacaaccaggttttatgtccgacatacatg ttgtcgccagggctatctcaagaggggctcctctatgaattggagagaatatcaaggaatgcactttcgatatacagagccgtcgaggaagg ggcatctaagctagggctgatcatcaagaaagaagagaccatgtgtagttatgacttcctcatctatggaaaaacccctttgtttagaggtaac atattggtgcctgagtccaaaagatgggccagagtctcttgcgtctctaatgaccaaatagtcaacctcgccaatataatgtcgacagtgtcca ccaatgcgctaacagtggcacaacactctcaatctttgatcaaaccgatgagggattttctgctcatgtcagtacaggcagtctttcactacctg ctatttagcccaatcttaaagggaagagtttacaagattctgagcgctgaaggggagagctttctcctagccatgtcaaggataatctatctag atccttctttgggagggatatctggaatgtccctcggaagattccatatacgacagttctcagaccctgtctctgaagggttatccttctggaga gagatctggttaagctcccaagagtcctggattcacgcgttgtgtcaagaggctggaaacccagatcttggagagagaacactcgagagct tcactcgccttctagaagatccgaccacctaaatatcagaggaggggccagtcctaccatctactcaaggatgcaatcagaaaggctttat atgacgaggtggacaaggtggaaaattcagagtttcgagaggcaatcctgttgtccaagacccatagagataattttatactcttcttaatatct gttgagcctctgtttcctcgatttctcagtgagctattcagttcgtcttttttgggaatccccgagtcaatcattggattgatacaaaactcccgaac gataagaaggcagtttagaaagagtctctcaaaaactttagaagaatccttctacaactcagagatccacgggattagtcggatgacccaga cacctcagagggttgggggggtgtggccttgctcttcagagagggcagatctacttagggagatctcttggggaagaaaagtggtaggca cgacagttcctcacccttctgagatgttgggattacttcccaagtcctctatttcttgcacttgtggagcaacaggaggaggcaatcctagagtt tctgtatcagtactcccgtcctttgatcagtcatttttttcacgaggccccctaaagggatacttgggctcgtccacctctatgtcgacccagctat tccatgcatgggaaaaagtcactaatgttcatgtggtgaagagagctctatcgttaaaagaatctataaactggttcattactagagattccaac ttggctcaagctctaattaggaacattatgtctctgacaggccctgatttccctctagaggaggcccctgtcttcaaaaggacggggtcagcct tgcataggttcaagtctgccagatacagcgaaggagggtattcttctgtctgcccgaacctcctctctcatatttctgttagtacagacaccatgt ctgatttgacccaagacgggaagaactacgatttcatgttccagccattgatgctttatgcacagacatggacatcagagctggtacagagag acacaaggctaagagactctacgtttcattggcacctccgatgcaacaggtgtgtgagacccattgacgacgtgaccctggagacctctcag atcttcgagtttccggatgtgtcgaaaagaatatccagaatggtttctggggctgtgcctcacttccagaggcttcccgatatccgtctgagac caggagattttgaatctctaagcggtagagaaaagtctcaccatatcggatcagctcaggggctcttatactcaatcttagtggcaattcacga ctcaggatacaatgatggaaccatcttccctgtcaacatatacggcaaggtttcccctagagactatttgagagggctcgcaaggggagtatt gataggatcctcgatttgcttcttgacaagaatgacaaatatcaatattaatagacctcttgaattggtctcaggggtaatctcatatattctcctga ggctagataaccatccctccttgtacataatgctcagagaaccgtctcttagaggagagatattttctatccctcagaaaatccccgccgcttat ccaaccactatgaaagaaggcaacagatcaatcttgtgttatctccaacatgtgctacgctatgagcgagagataatcacggcgtctccaga gaatgactggctatggatcttttcagactttagaagtgccaaaatgacgtacctatccctcattacttaccagtctcatcttctactccagagggtt gagagaaacctatctaagagtatgagagataacctgcgacaattgagttctttgatgaggcaggtgctgggcgggcacggagaagatacct tagagtcagacgacaacattcaacgactgctaaaagactctttacgaaggacaagatgggtggatcaagaggtgcgccatgcagctagaa ccatgactggagattacagccccaacaagaaggtgtcccgtaaggtaggatgttcagaatgggtctgctctgctcaacaggttgcagtctct acctcagcaaacccggcccctgtctcggagcttgacataagggccctctctaagaggttccagaaccctttgatctcgggcttgagagtggtt cagtgggcaaccggtgctcattataagcttaagcctattctagatgatctcaatgttttcccatctctctgccttgtagttggggacgggtcagg ggggatatcaagggcagtcctcaacatgtttccagatgccaagcttgtgttcaacagtcttttagaggtgaatgacctgatggcttccggaaca catccactgcctccttcagcaatcatgaggggaggaaatgatatcgtctccagagtgatagatcttgactcaatctgggaaaaaccgtccgac ttgagaaacttggcaacctggaaatacttccagtcagtccaaaagcaggtcaacatgtcctatgacctcattatttgcgatgcagaagttactg acattgcatctatcaaccggatcaccctgttaatgtccgatttgcatgtctatagatggaccactctattggtctcaaaacttatgggactatg ctagtaaatccaaactacaaggctattcaacacctgtcaagagcgttcccctcggtcacagggtttatcacccaagtaacttcgtctttttcatct gagctctacctccgattctccaaacgagggaagtttttcagagatgctgagtacttgacctcttccacccttcgagaaatgagccttgtgttattc aattgtagcagccccaagagtgagatgcagagagctcgttccttgaactatcaggatcttgtgagaggatttcctgaagaaatcatatcaaatc cttacaatgagatgatcataactctgattgacagtgatgtagaatcttttctagtccacaagatggttgatgatcttgagttacagaggggaactc tgtctaaagtggctatcattatagccatcatgatagttttctccaacagagtcttcaacgtttccaaacccctaactgacccctcgttctatccacc gtctgatcccaaaatcctgaggcacttcaacatatgttgcagtactatgatgtatctatctactgctttaggtgacgtccctagcttcgcaagactt cacgacctgtataacagacctataacttattacttcagaaagcaagtcattcgagggaacgtttatctatcttggagttggtccaacgacacctc agtgttcaaaagggtagcctgtaattctagcctgagtctgtcatctcactggatcaggttgatttacaagatagtgaagactaccagactcgttg gcagcatcaaggatctatccagagaagtggaaagacaccttcataggtacaacaggtggatcaccctagaggatatcagatctagatcatc cctactagactacagttgcctgtgaaccggatactcctggaagcctgcccatgctaagactcttgtgtgatgtatcttgaaaaaaacaagatcc taaatctgaacctttggttgtttgattgtttttctcatttttgttgtttatttgttaagcgtgggtcggcatggcatctccacctcctcgcggtccgacct gggcatccgaaggaggacgcacgtccactcggatggctaagggagagccagaaggatccggctgctaacaaagcccgaaaggaagct gagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaagtcgcgctt ggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcc tggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaat gaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttacgcttcctcgctcactgactcgctgcgctcggtcgttcggctg cggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaagg ccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacg ctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgttccccctggaagctccctcgtgcgctctcctgtccgacc ctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggt cgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccgg taagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtg gtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttga tccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttg atcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatcctt ttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcag cgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgca atgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgc aactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgct acaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgt gcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataa ttctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttg ctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaact ctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgg gtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatatt attgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttcccc gaaaagtgccac pCAGGS-SUB (SEQ ID N0:9) gtcgacattgattattgactagctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttac ggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggact ttccattgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgt caatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgcta ttaccatgggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattatttt gtgcagcgatgggggcgggggggggggggccgcgcgccagccggggcggggcggggcgaggggcggggcggggcgaggcgg agaggtgcggcggcagccaatcagagcggcgcgctccgaaagttcctttatggcgaggcggcggcggcggcggccctataaaaagc gaagcgcgcggcgggcgggagtcgctgcgttgccttcgccccgtgccccgctccgcgccgcctcgcgccgcccgccccggctctgact gaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagcgcttggtttaatgacggctcgtttcttttctg tggctgcgtgaaagccttaaagggctccgggagggccctttgtgcgggggggagcggctcggggggtgcgtgcgtgtgtgtgtgcgtgg ggagcgccgcgtgcggcccgcgctgcccggcggctgtgagcgctgcgggcgcggcgcggggctttgtgcgctccgcgtgtgcgcgag gggagcgcggccgggggcggtgccccggtgcgggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggt gagcagggggtgtgggcgcggcggtcgggctgtaacccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtg cggggctccgtgcggggcgtggcgcggggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggc cgcctcgggccggggagggctcgggggaggggcgcggcggccccggagcgccggccggggcggctgtcgaggcgcggcgagcc gcagccattgccttttatggtaatcgtgcgagagggcgcagggacttcctttgtcccaaatctggcggagccgaaatctgggaggcgcgcg ccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccatctccagcctcggggctgccgcag ggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgtgaccggcggctctagagcctctgctaaccatgt tcatgccttcttctttttcctacagctcctgggcaacgtgctggttgttgtgctgtctcatcattttggcaaagaattccggaacgtacggccacca tggagacggacacacttcttctttgggtgctcctgctgtgggtccctgggtccactggagatgcatgtgccaccctgaaaagaacacatgact gggaccccctgcacagcccaaatgggcgcagccccaagcggcgccggtgcatgcctttgtccccacctgccccgccaacgcgagccca ccagatgaacccctctccttttggagaagtgccccccaaaatgacatcagaagaaattgctgccaacatccgagaggagatgaggcgactg cagaggagaaagcagctgtgtttccagggcactgatccagaatcccagcagaccagcggtctcctaagtccggtaaggcgggaccagcc gctcttcacattccggcaagtgggcctcatctgtgagcgcatgatgaaggaaagggagtctcaaatacgtgaagagtacgatcacgtgctg agcaccaagctggcaggccagtatgacacctttgtcaagttcacctatgatcaagagagctctgttatcccactggtgcatcctttggctgacc catcaactgtatttaaagatggagatgaagcagaggactttgtggaggtacatctgcctgatgtgcacaaccaggtcagcggcgtggacctg ggcctacccaactggggcaagtacgtgcttctcagtgctggggcgttgacagccctgatgctgatcattttcctcatgacctgctgcaggcgc gtcaatagatcagagcccacccagcacaatttaagaggtacaggccgggaagtttcagtcacgccccagtctggaaaaattatatcgtcctg ggagtcccataaaagtggtggggaaactcgtttatgaggctagcagatctttttccctctgccaaaaattatggggacatcatgaagccccttg agcatctgacttctggctaataaaggaaatttattttcattgcaatagtgtgttggaattttttgtgtctctcactcggaaggacatatgggagggc aaatcatttaaaacatcagaatgagtatttggtttagagtttggcaacatatgccatatgctggctgccatgaacaaaggtggctataaagaggt catcagtatatgaaacagccccctgctgtccattccttattccatagaaaagccttgacttgaggttagattttttttatattttgttttgtgttattttttt ctttaacatccctaaaattttccttacatgttttactagccagatttttcctcctctcctgactactcccagtcatagctgtccctcttctcttatgaaga tccctcgaccgcccaagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccg gaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacc tgtcgtgccagcggatccgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccg cccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggagg cttttttggaggcctaggcttttgcaaaaagctaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaata aagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatccgctgcattaatgaatcggccaacgcg cggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatca gctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggcca ggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtg gcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggat acctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctg ggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatc gccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacgg ctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaac caccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggt ctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatga agttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcg ttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgaga cccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctc catccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtgg tgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggtt agctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatg ccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgt caatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttac cgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaaca ggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatc agggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacct g
[0169] Enumerated Embodiments
[0170] The following exemplary embodiments are provided, the numbering of which is not to be construed as designating levels of importance:
[0171] Embodiment 1 provides an isolated nucleic acid encoding a recombinant virus comprising subolesin (SUB), or a portion thereof.
[0172] Embodiment 2 provides the isolated nucleic acid of Embodiment 1, wherein the virus is a rhabdovirus or paramyxovirus.
[0173] Embodiment 3 provides the isolated nucleic acid of Embodiment 1 or 2, wherein the virus is selected from the group consisting of a rabies virus (RABV), a vesicular stomatitis virus (VSV), and a measles virus (MV).
[0174] Embodiment 4 provides the isolated nucleic acid of any one of Embodiments 1-3, wherein the isolated nucleic acid comprises a nucleic acid sequence encoding at least a portion of the genome of the virus.
[0175] Embodiment 5 provides the isolated nucleic acid of any one of Embodiments 1-4, wherein the isolated nucleic acid comprises:
[0176] (a) a nucleic acid sequence encoding at least a portion of the genome of a RABV; and
[0177] (b) a nucleic acid sequence encoding subolesin or a portion thereof.
[0178] Embodiment 6 provides the isolated nucleic acid of Embodiment 5, wherein the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a nucleoprotein (N) and a nucleic acid sequence encoding a phosphoprotein (P).
[0179] Embodiment 7 provides the isolated nucleic acid of Embodiment 6, wherein the nucleic acid sequence encoding the subolesin, or a portion thereof, is inserted into a position between the nucleic acid sequence encoding the nucleoprotein (N) and the nucleic acid sequence encoding the phosphoprotein (P).
[0180] Embodiment 8 provides the isolated nucleic acid of Embodiment 7, wherein a nucleic acid sequence encoding one or more of a 51 -residue ectodomain of rabies virus glycoprotein (RABV-G) (ED51), a RABV-G transmembrane domain (TM), and a RABV-G cytoplasmic domain (CD) is inserted into a position between the nucleic acid sequence encoding the nucleoprotein (N) and the nucleic acid sequence encoding the phosphoprotein (P).
[0181] Embodiment 9 provides the isolated nucleic acid of Embodiment 8, wherein the nucleic acid sequence comprises sequences encoding each of ED51, TM, and CD, wherein the nucleic acid sequence encoding the ED51, the nucleic acid sequence encoding the TM, and the nucleic acid sequence encoding the CD are each inserted into a position between the nucleic acid sequence encoding the nucleoprotein (N) and the nucleic acid sequence encoding the phosphoprotein (P).
[0182] Embodiment 10 provides the isolated nucleic acid of Embodiment 9, wherein the nucleic acid sequence encoding the ED51, the nucleic acid sequence encoding the TM, and the nucleic acid sequence encoding the CD are inserted into a position between the nucleic acid sequence encoding the subolesin (SUB) and the nucleic acid sequence encoding the phosphoprotein (P).
[0183] Embodiment 11 provides the isolated nucleic acid of any one of Embodiments 5-10, wherein the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a matrix protein (M).
[0184] Embodiment 12 provides the isolated nucleic acid of any one of Embodiments 5-11, wherein the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a glycoprotein (G).
[0185] Embodiment 13 provides the isolated nucleic acid of Embodiment 12, wherein the glycoprotein (G) comprises an attenuating mutation.
[0186] Embodiment 14 provides the isolated nucleic acid of Embodiment 13, wherein the mutation is R333E.
[0187] Embodiment 15 provides the isolated nucleic acid of any one of Embodiments 5-14, wherein the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a RNA-dependent RNA polymerase (L). Embodiment 16 provides the isolated nucleic acid of any one of Embodiments 6-15, wherein at least one of the following applies:
[0188] (a) the nucleic acid sequence encoding the subolesin (SUB), or a portion thereof, is positioned immediately 3’ to the nucleic acid sequence encoding the nucleoprotein (N) (z.e., 5’-N and 3 ’-SUB);
[0189] (b) the nucleic acid sequence encoding the ED51 is positioned immediately 3’ to the nucleic acid sequence encoding the subolesin (SUB) (i.e., 5’-SUB and 3’-ED51);
[0190] (c) the nucleic acid sequence encoding the TM is positioned immediately 3’ to the nucleic acid sequence encoding the ED51 (i.e., 5’-ED51 and 3’-TM);
[0191] (d) the nucleic acid sequence encoding the CD is positioned immediately 3’ to the nucleic acid sequence encoding the TM (i.e., 5’-TM and 3 ’-CD);
[0192] (e) the nucleic acid sequence encoding the phosphoprotein (P) is immediately 3’ to the nucleic acid sequence encoding the CD (i.e., 5’-CD and 3’-P);
[0193] (f) the nucleic acid sequence encoding the matrix protein (M) is immediately 3’ to the nucleic acid sequence encoding the phosphoprotein (P) (i.e., 5’-P and 3’-M);
[0194] (g) the nucleic acid sequence encoding the glycoprotein (G) is immediately 3’ to the nucleic acid sequence encoding the matrix protein (M) (i.e., 5’-M and 3’-G); and
[0195] (h) the nucleic acid sequence encoding the RNA-dependent RNA polymerase (L) is immediately 3’ to the nucleic acid sequence encoding the glycoprotein (G) (i.e., 5’-G and 3’-L).
[0196] Embodiment 17 provides the isolated nucleic acid of any one of Embodiments 1-16, wherein the nucleic acid comprises a nucleotide sequence having at least 85% sequence homology with SEQ ID NO:7.
[0197] Embodiment 18 provides the isolated nucleic acid of any one of Embodiments 1-17, wherein the nucleic acid encoding the recombinant virus is codon optimized for expression in a host cell, optionally wherein the host cell is a mammalian cell.
[0198] Embodiment 19 provides a recombinant virus comprising a nucleic acid sequence encoding subolesin (SUB), or a portion thereof.
[0199] Embodiment 20 provides the recombinant virus of Embodiment 19, wherein the virus is a rhabdovirus or paramyxovirus. Embodiment 21 provides the recombinant virus of Embodiment 19 or 20, wherein the virus selected from the group consisting of a rabies virus (RABV), a vesicular stomatitis virus (VSV), and a measles virus (MV).
[0200] Embodiment 22 provides the recombinant virus of any one of Embodiments 19-21, wherein the recombinant virus comprises a nucleic acid sequence encoding at least a portion of the genome of the virus.
[0201] Embodiment 23 provides the recombinant virus of any one of Embodiments 19-22, wherein the isolated nucleic acid comprises:
[0202] (a) a nucleic acid sequence encoding at least a portion of the genome of a RABV; and
[0203] (b) a nucleic acid sequence encoding subolesin or a portion thereof.
[0204] Embodiment 24 provides a vector comprising the isolated nucleic acid of any one of Embodiments 1-18.
[0205] Embodiment 25 provides a vaccine comprising the isolated nucleic acid of any one of Embodiments 1-18 or the recombinant virus of any one of Embodiments 19-23 and a pharmaceutically acceptable carrier.
[0206] Embodiment 26 provides the vaccine of Embodiment 25, further comprising an adjuvant.
[0207] Embodiment 27 provides a method for controlling, reducing, or eliminating a tick infestation in a subject, the method comprising administering to the subject an effective amount of the isolated nucleic acid of any one of Embodiments 1-18, the recombinant virus of any one of Embodiments 19-23, the vector of Embodiment 24, or the vaccine of Embodiments 25 or 26.
[0208] Embodiment 28 provides a method for controlling, reducing, or eliminating a tick infestation in a group of subjects, the method comprising administering to at least one subject in the group an effective amount of the isolated nucleic acid of any one of Embodiments 1-18, the recombinant virus of any one of Embodiments 19-23, the vector of Embodiment 24, or the vaccine of Embodiments 25 or 26.
[0209] Embodiment 29 provides the method of Embodiment 27 or 28, wherein the tick is at least one selected from the group consisting of Ixodes scapularis (blacklegged tick), Amblyomma americanum (lone star tick), Dermacentor variabilis (American dog tick), Hyalomma marginatum Rhipicephalus sanguineus (brown dog tick), and Haemaphysalis longicornis (Asian longhorned tick). Embodiment 30 provides a method for decreasing risk of a tick-borne infection, disease, or disorder in a subject, the method comprising administering to the subject an effective amount of the isolated nucleic acid of any one of Embodiments 1-18, the recombinant virus of any one of Embodiments 19-23, the vector of Embodiment 24, or the vaccine of Embodiments 25 or 26.
[0210] Embodiment 31 provides a method for decreasing risk of a tick-borne infection, disease, or disorder in each subject in a group of subjects, the method comprising administering to at least one subject in the group an effective amount of the isolated nucleic acid of any one of Embodiments 1-18, the recombinant virus of any one of Embodiments 19-23, the vector of Embodiment 24, or the vaccine of Embodiments 25 or 26.
[0211] Embodiment 32 provides the method of Embodiment 30 or 31, wherein the infection, disease, or disorder is at least one selected from the group consisting of Lyme disease, rocky mountain spotted fever, ehrlichiosis, anaplasmosis, babesiosis, Powassan virus disease, Crimean- Congo Hemorrhagic Fever Virus (CCHFV), tularemia, Colorado tick fever, malaria, and dengue fever.
[0212] Embodiment 33 provides the method of any one of Embodiments 27-32, wherein each subject is a mammal.
[0213] Embodiment 34 provides the method of Embodiment 33, wherein the mammal is selected from the group consisting of human, cattle (e.g., cows, bulls, and oxen), sheep, goats, pigs, horses, mice, rats, and dogs.
[0214] Embodiment 35 provides the method of Embodiment 34, wherein the mammal is a human.
[0215] Embodiment 36 provides an antiserum reactive with subolesin (SUB).
[0216] Embodiment 37 provides the antiserum of Embodiment 36, wherein the antiserum is obtained from a subject administered an effective amount of the isolated nucleic acid of any one of Embodiments 1-18, the recombinant virus of any one of Embodiments 19-23, the vector of Embodiment 24, or the vaccine of Embodiment 25 or 26.
[0217] Embodiment 38 provides a method for preparing the antiserum of Embodiment 36, the method comprising administering to a subject an effective amount of the isolated nucleic acid of any one of Embodiments 1-18, the recombinant virus of any one of Embodiments 19-23, the vector of Embodiment 24, or the vaccine of Embodiment 25 or 26. The terms and expressions employed herein are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the embodiments of the present application. Thus, it should be understood that although the present application describes specific embodiments and optional features, modification and variation of the compositions, methods, and concepts herein disclosed may be resorted to by those of ordinary skill in the art, and that such modifications and variations are considered to be within the scope of embodiments of the present application.
Claims
CLAIMSWhat is claimed is:
1. An isolated nucleic acid encoding a recombinant virus comprising subolesin (SUB), or a portion thereof.
2. The isolated nucleic acid of claim 1, wherein the virus is a rhabdovirus or paramyxovirus.
3. The isolated nucleic acid of claim 1 or 2, wherein the virus is selected from the group consisting of a rabies virus (RABV), a vesicular stomatitis virus (VSV), and a measles virus (MV).
4. The isolated nucleic acid of any one of claims 1-3, wherein the isolated nucleic acid comprises a nucleic acid sequence encoding at least a portion of the genome of the virus.
5. The isolated nucleic acid of any one of claims 1-4, wherein the isolated nucleic acid comprises:(a) a nucleic acid sequence encoding at least a portion of the genome of a RABV; and(b) a nucleic acid sequence encoding subolesin or a portion thereof.
6. The isolated nucleic acid of claim 5, wherein the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a nucleoprotein (N) and a nucleic acid sequence encoding a phosphoprotein (P).
7. The isolated nucleic acid of claim 6, wherein the nucleic acid sequence encoding the subolesin, or a portion thereof, is inserted into a position between the nucleic acid sequence encoding the nucleoprotein (N) and the nucleic acid sequence encoding the phosphoprotein (P).
8. The isolated nucleic acid of claim 7, wherein a nucleic acid sequence encoding one or more of a 51-residue ectodomain of rabies virus glycoprotein (RABV-G) (ED51), a RABV-G transmembrane domain (TM), and a RABV-G cytoplasmic domain (CD) is inserted into aposition between the nucleic acid sequence encoding the nucleoprotein (N) and the nucleic acid sequence encoding the phosphoprotein (P).
9. The isolated nucleic acid of claim 8, wherein the nucleic acid sequence comprises sequences encoding each of ED51, TM, and CD, wherein the nucleic acid sequence encoding the ED51, the nucleic acid sequence encoding the TM, and the nucleic acid sequence encoding the CD are each inserted into a position between the nucleic acid sequence encoding the nucleoprotein (N) and the nucleic acid sequence encoding the phosphoprotein (P).
10. The isolated nucleic acid of claim 9, wherein the nucleic acid sequence encoding the ED51, the nucleic acid sequence encoding the TM, and the nucleic acid sequence encoding the CD are inserted into a position between the nucleic acid sequence encoding the subolesin (SUB) and the nucleic acid sequence encoding the phosphoprotein (P).
11. The isolated nucleic acid of any one of claims 5-10, wherein the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a matrix protein (M).
12. The isolated nucleic acid of any one of claims 5-11, wherein the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a glycoprotein (G).
13. The isolated nucleic acid of claim 12, wherein the glycoprotein (G) comprises an attenuating mutation.
14. The isolated nucleic acid of claim 13, wherein the mutation is R333E.
15. The isolated nucleic acid of any one of claims 5-14, wherein the at least a portion of the genome of the rabies virus comprises a nucleic acid sequence encoding a RNA-dependent RNA polymerase (L).
16. The isolated nucleic acid of any one of claims 6-15, wherein at least one of the following applies:(a) the nucleic acid sequence encoding the subolesin (SUB), or a portion thereof, is positioned immediately 3’ to the nucleic acid sequence encoding the nucleoprotein (N) (i.e., 5’-N and 3 ’-SUB);(b) the nucleic acid sequence encoding the ED51 is positioned immediately 3’ to the nucleic acid sequence encoding the subolesin (SUB) (i.e., 5’-SUB and 3’-ED51);(c) the nucleic acid sequence encoding the TM is positioned immediately 3’ to the nucleic acid sequence encoding the ED51 i.e., 5’-ED51 and 3’-TM);(d) the nucleic acid sequence encoding the CD is positioned immediately 3’ to the nucleic acid sequence encoding the TM i.e., 5’-TM and 3 ’-CD);(e) the nucleic acid sequence encoding the phosphoprotein (P) is immediately 3’ to the nucleic acid sequence encoding the CD i.e., 5’-CD and 3’-P);(f) the nucleic acid sequence encoding the matrix protein (M) is immediately 3’ to the nucleic acid sequence encoding the phosphoprotein (P) i.e., 5’-P and 3’-M);(g) the nucleic acid sequence encoding the glycoprotein (G) is immediately 3’ to the nucleic acid sequence encoding the matrix protein (M) i.e., 5’-M and 3’-G); and(h) the nucleic acid sequence encoding the RNA-dependent RNA polymerase (L) is immediately 3’ to the nucleic acid sequence encoding the glycoprotein (G) (i.e., 5’-G and 3’-L).
17. The isolated nucleic acid of any one of claims 1-16, wherein the nucleic acid comprises a nucleotide sequence having at least 85% sequence homology with SEQ ID NO:7.
18. The isolated nucleic acid of any one of claims 1-17, wherein the nucleic acid encoding the recombinant virus is codon optimized for expression in a host cell, optionally wherein the host cell is a mammalian cell.
19. A recombinant virus comprising a nucleic acid sequence encoding subolesin (SUB), or a portion thereof.
20. The recombinant virus of claim 19, wherein the virus is a rhabdovirus or paramyxovirus.21 . The recombinant virus of claim 19 or 20, wherein the virus selected from the group consisting of a rabies virus (RABV), a vesicular stomatitis virus (VSV), and a measles virus (MV).
22. The recombinant virus of any one of claims 19-21, wherein the recombinant virus comprises a nucleic acid sequence encoding at least a portion of the genome of the virus.
23. The recombinant virus of any one of claims 19-22, wherein the isolated nucleic acid comprises:(a) a nucleic acid sequence encoding at least a portion of the genome of a RABV; and(b) a nucleic acid sequence encoding subolesin or a portion thereof.
24. A vector comprising the isolated nucleic acid of any one of claims 1-18.
25. A vaccine comprising the isolated nucleic acid of any one of claims 1-18 or the recombinant virus of any one of claims 19-23 and a pharmaceutically acceptable carrier.
26. The vaccine of claim 25, further comprising an adjuvant.
27. A method for controlling, reducing, or eliminating a tick infestation in a subject, the method comprising administering to the subject an effective amount of the isolated nucleic acid of any one of claims 1-18, the recombinant virus of any one of claims 19-23, the vector of claim 24, or the vaccine of claims 25 or 26.
28. A method for controlling, reducing, or eliminating a tick infestation in a group of subjects, the method comprising administering to at least one subject in the group an effective amount of the isolated nucleic acid of any one of claims 1-18, the recombinant virus of any one of claims 19-23, the vector of claim 24, or the vaccine of claims 25 or 26.
29. The method of claim 27 or 28, wherein the tick is at least one selected from the group consisting of Ixodes scapularis (blacklegged tick), Amblyomma americantim (lone star tick),Dermacentor variahilis (American dog tick), Hyalomma marginatum Rhipicephalus sanguineus (brown dog tick), and Haemaphysalis longicornis (Asian longhomed tick).
30. A method for decreasing risk of a tick-borne infection, disease, or disorder in a subject, the method comprising administering to the subject an effective amount of the isolated nucleic acid of any one of claims 1-18, the recombinant virus of any one of claims 19-23, the vector of claim 24, or the vaccine of claims 25 or 26.
31. A method for decreasing risk of a tick-borne infection, disease, or disorder in each subject in a group of subjects, the method comprising administering to at least one subject in the group an effective amount of the isolated nucleic acid of any one of claims 1-18, the recombinant virus of any one of claims 19-23, the vector of claim 24, or the vaccine of claims 25 or 26.
32. The method of claim 30 or 31, wherein the infection, disease, or disorder is at least one selected from the group consisting of Lyme disease, rocky mountain spotted fever, ehrlichiosis, anaplasmosis, babesiosis, Powassan virus disease, Crimean-Congo Hemorrhagic Fever Virus (CCHFV), tularemia, Colorado tick fever, malaria, and dengue fever.
33. The method of any one of claims 27-32, wherein each subject is a mammal.
34. The method of claim 33, wherein the mammal is selected from the group consisting of human, cattle (e.g., cows, bulls, and oxen), sheep, goats, pigs, horses, mice, rats, and dogs.
35. The method of claim 34, wherein the mammal is a human.
36. An antiserum reactive with subolesin (SUB).
37. The antiserum of claim 36, wherein the antiserum is obtained from a subject administered an effective amount of the isolated nucleic acid of any one of claims 1-18, the recombinant virus of any one of claims 19-23, the vector of claim 24, or the vaccine of claims 25 or 26.
38. A method for preparing the antiserum of claim 36, the method comprising administering to a subject an effective amount of the isolated nucleic acid of any one of claims 1-18, the recombinant virus of any one of claims 19-23, the vector of claim 24, or the vaccine of claims 25
Citation Information
Patent Citations
Vaccine Against Rhipicephalus Ticks
US20160051649A1
Multivalent vaccines for rabies virus and coronaviruses
US20220072697A1