Targeted feedback-controlled high efficiency single cell electroporation for gene and cell therapy

Abstract

An exemplary embodiment of the present disclosure provides a system for cell engineering, the system comprising an aperture and at least one sensor. The aperture can comprise a sensing zone and an electroporation zone. The at least one sensor can be disposed proximate the sensing zone. The sensor can be configured to sense an electrical property of a cell in the sensing zone and deliver electroporation energy to the cell based on the sensed electrical property of the cell.

Description

011529.114558 (GTRC9086PCT) TARGETED FEEDBACK-CONTROLLED HIGH EFFICIENCY SINGLE CELL ELECTROPORATION FOR GENE AND CELL THERAPY CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 521,249, filed on 15 June 2023, which is incorporated herein by reference in its entirety as if fully set forth below. FIELD OF THE DISCLOSURE

[0002] The various embodiments of the present disclosure relate generally to cell engineering, and more particularly to cell engineering via reversible electroporation. BACKGROUND

[0003] Intracellular delivery of cell-membrane impermeant macromolecules is a basic need across biological research and clinical and biomanufacturing applications. A variety of delivery techniques, based on various biological, chemical, and physical principles, have been developed over the years, some of which are commonly used in the research context. These methods provide different levels of cell-type and payload dependent performance in terms of the different parameters of interest such as delivery efficiency, post-delivery cell viability, ability to target specific cells for delivery, throughput, ease-of-use, cost, and versatility across target cell and payload types. However, a plethora of limitations hinder the use of existing delivery techniques in the context of cell-based therapies, whose discovery, development, and manufacture all involve intracellular delivery as a key step.

[0004] Most recently, the use of CRISPR-based gene editing techniques for creating higher efficacy and safer cell therapies has underscored the need for new methods which can deliver large payloads to cells with high delivery efficiency, while maintaining cell viability and function and which can be scaled and applied to a variety of payloads and target cells in a cost- effective manner. Viral vector-based delivery methods are currently most commonly used in cell therapy manufacturing. However, viral vectors have limited payload capacity and there still remain concerns about immunogenicity, mutagenicity and oncogenicity that have been raised in their past clinical trials and use. Additionally, viral vector development and manufacturing remains costly and complex as well and contributes to the current high cost of 1 172332660v2011529.114558 (GTRC9086PCT) cell-based therapies. This has led to the increasing use of non-viral delivery methods such as electroporation in the development of cell therapies.

[0005] Electroporation is a method of intracellular delivery in which an applied external electric field raises the transmembrane potential (TMP) of a cell and causes temporary pores to form across the cellular membrane that allow macromolecules in a surrounding fluid to enter the interior of the cell. Electroporation can achieve high delivery efficiencies across cell types and payload sizes and types and is thus often the method of choice for cells that are considered “difficult-to-transfect” by other methods. Traditionally, electroporation is performed by applying a voltage across parallel metal plates dipped in a cell suspension in a vial. However, this can be toxic to cells resulting in significant cell death and low post-electroporation cell viability. Losing a significant fraction of the starting cell population this way is a critical flaw especially when precious, low abundance, patient-derived primary cells are used as the source for target cells which are then engineered and need to be expanded before delivering back to the patient. Past efforts on improving electroporation have focused on trading off delivery efficiency and cell viability which results in the requirement for laborious empirical optimization on a per cell type or payload basis. Again, such efforts are further complicated to carry out with limited availability of primary cells.

[0006] Accordingly, there is a need for improved systems and methods for intracellular delivery of cell-membrane impermeant macromolecules. BRIEF SUMMARY

[0007] An exemplary embodiment of the present disclosure provides a system for cell engineering, the system comprising an aperture and at least one sensor. The aperture can comprise a sensing zone and an electroporation zone. The at least one sensor can be disposed proximate the sensing zone. The sensor can be configured to sense an electrical property of a cell in the sensing zone and deliver electroporation energy to the cell based on the sensed electrical property of the cell.

[0008] In any of the embodiments disclosed herein, the aperture can further comprise an inlet and an outlet, the sensing zone and the electroporation zone can be disposed between the inlet and the outlet, and the aperture can be configured to pass a fluid comprising a plurality of cells from the inlet, through the sensing zone and electroporation zone, and to the outlet.

[0009] In any of the embodiments disclosed herein, the sensing zone can comprise a first end proximate the inlet having a first cross-sectional area and a second end having a second cross- 2 172332660v2011529.114558 (GTRC9086PCT) sectional area, in which the second cross-sectional area can be less than the first cross-sectional area.

[0010] In any of the embodiments disclosed herein, the electroporation zone can comprise a first end proximate the second end of the sensing zone having a third cross-sectional area and a second end proximate the outlet having a fourth cross-sectional area, in which the third cross- sectional area can be less than the fourth cross-sectional area.

[0011] In any of the embodiments disclosed herein, the sensor can comprise a first electrode disposed proximate the inlet and a second electrode disposed proximate the outlet.

[0012] In any of the embodiments disclosed herein, the sensor can further comprise a lock-in amplifier configured to simultaneously measure an impedance of the cell in the sensing zone at a plurality of frequencies.

[0013] In any of the embodiments disclosed herein, the sensor can comprise a controller configured to adjust a characteristic of the electroporation energy based at least in part on the electrical property and prompt the electrode to deliver the electroporation energy to the cell responsive to the electrical property.

[0014] In any of the embodiments disclosed herein, the characteristic of the electroporation energy can be a voltage level.

[0015] In any of the embodiments disclosed herein, the electrical property can be an impedance, and the voltage level of the electroporation energy can be proportional to the impedance.

[0016] In any of the embodiments disclosed herein, the electrical property can be an impedance spectrum.

[0017] Another embodiment of the present disclosure provides a method for cell engineering. The method can comprise: sensing an electrical property of a cell; and applying electroporation energy to the cell responsive to the sensed electrical property.

[0018] In any of the embodiments disclosed herein, the method can further comprise flowing a fluid containing a plurality of cells through an aperture, and the aperture can comprise an inlet configured to receive the fluid, an outlet configured to eject the fluid, a sensing zone disposed between the inlet and outlet, such that the fluid passes through the sensing zone, and an electroporation zone disposed between the inlet and outlet, such that the fluid passes through the electroporation zone. 3 172332660v2011529.114558 (GTRC9086PCT)

[0019] In any of the embodiments disclosed herein, sensing the electrical property of the cell can comprise: passing the cell through the sensing zone; and measuring an impedance across the sensing zone.

[0020] In any of the embodiments disclosed herein, the method can further comprise adjusting a characteristic of the electroporation energy based on the measured impedance.

[0021] In any of the embodiments disclosed herein, the characteristic of the electroporation energy can be a magnitude of a voltage level.

[0022] In any of the embodiments disclosed herein, sensing the electrical property of the cell can be performed with a sensor comprising a first electrode disposed proximate the inlet and a second electrode disposed proximate the outlet.

[0023] In any of the embodiments disclosed herein, the cell can be bound to a microparticle.

[0024] In any of the embodiments disclosed herein, the microparticle can alter the electrical property of the cell.

[0025] In any of the embodiments disclosed herein, the electrical property is an impedance spectrum, and the microparticle can increase a magnitude of the impedance spectrum of the cell.

[0026] In any of the embodiments disclosed herein, the microparticle can comprise an antibody.

[0027] These and other aspects of the present disclosure are described in the Detailed Description below and the accompanying drawings. Other aspects and features of embodiments will become apparent to those of ordinary skill in the art upon reviewing the following description of specific, exemplary embodiments in concert with the drawings. While features of the present disclosure may be discussed relative to certain embodiments and figures, all embodiments of the present disclosure can include one or more of the features discussed herein. Further, while one or more embodiments may be discussed as having certain advantageous features, one or more of such features may also be used with the various embodiments discussed herein. In similar fashion, while exemplary embodiments may be discussed below as device, system, or method embodiments, it is to be understood that such exemplary embodiments can be implemented in various devices, systems, and methods of the present disclosure. BRIEF DESCRIPTION OF THE FIGURES 4 172332660v2011529.114558 (GTRC9086PCT)

[0028] FIGs. 1A provides a schematic of a system for cell engineering, in accordance with some embodiments of the present disclosure.

[0029] FIG. 1B provides an exploded view of a system for cell engineering, in accordance with some embodiments of the present disclosure.

[0030] FIG.1C provides a block diagram of control circuitry for a system for cell engineering, in accordance with some embodiments of the present disclosure.

[0031] FIG. 1D provides an SEM image of an aperture of a system for cell engineering, in accordance with some embodiments of the present disclosure.

[0032] FIG.1E provides an FEM simulation of the electric field in an aperture of a system for cell engineering, in accordance with some embodiments of the present disclosure.

[0033] FIGs.2A-2E provide electrical characterization of cells, in which FIGs.2A-B provide time series change in impedance as a cell passes through the aperture, magnitude and phase respectively, FIGs.2C-D provide bode plots of the impedance change for different cell types, magnitude and phase respectively, and FIG.2E provides a pair-wise classification between cell types using an LDA with cell spectra as features.

[0034] FIGS. 3A-E illustrate single cell electroporation capabilities, in which FIG. 3A provides a representative FACS plot showing delivery of 150kDa FITC-dextran to HEK293’s without decrease in viability as assayed by propidium iodide, FIG. 3B illustrates delivery of 150kDa FITC-dextran to HEK293’s at several voltages, FIG.3C illustrates delivery of several sizes of FITC-dextran to HEK293’s, FIG. 3D illustrates knockdown of GFP expressing HEK293’s by delivering Cas9 ribonucleoprotein with a system for cell engineering, and FIG. 3E illustrates delivery of propidium iodide to primary PBMC’s with the system for cell engineering.

[0035] FIGS. 4A-F provide plots and circuitry for feedback-controlled electroporation, in accordance with some embodiments of the present disclosure. FIG. 4A provides a plot of the output from the lock-in amplifier, in which the lock-in amplifier internally digitally amplifies and subtracts the baseline voltage of the demodulator output to result in the auxiliary output. FIG. 4B shows an active, first-order, analog high pass filter is used to remove drift in the auxiliary output, wherein this signal can be digitized and analyzed by a microcontroller to control the switch connections to the lock-in amplifier or the electroporation voltage. FIGs. 4C-D provides plots of voltage over time, in which to determine the peak value in real time, the digitized voltage can be averaged and differenced, and when this discrete derivative crosses 5 172332660v2011529.114558 (GTRC9086PCT) zero, the value of the moving average can be compared to a threshold to control the switching. FIG. 4E-F provide plots of the precise voltages on the electrodes measured by the microcontroller for an electroporation event, in which the voltage on the electrode starts as a sine wave used for the lock-in measurement, and when a cell passes, the lock-in amplifier output (as measured by the microcontroller) changes, the peak value is detected, and the switch is flipped so the voltage on the electrode jumps to the electroporation voltage; after the event, the switch can be flipped back to the lock-in amplifier to continue measuring.

[0036] FIGS. 5A-E illustrate results of selective electroporation using systems and methods for cell engineering in accordance with some embodiments of the present disclosure. FIG.5A provides plots of impedance values for PBMC’s and HEK293’s passing through an exemplary cell engineering system measured in real time, in which these measurements are the basis for selection. FIG.5B illustrates selective delivery to either PBMCs or HEK293’s in a mixture of the two. FIG.5C illustrates selective delivery to either lymphocytes or monocytes in PBMCs. FIGS. 5D-E provide representative FACS plots showing the delivery of propidium iodide to subsets of cell types.

[0037] FIGS. 6A-B provides a cross section of a system for cell engineering and a magnified view of the same, respectively, in accordance with an exemplary embodiment of the present invention.

[0038] FIG. 7 provides a plot relating to systems and methods for cell engineering, in accordance with an exemplary embodiment of the present invention.

[0039] FIGS.8A-B provides voltage gradients for the system shown in FIGS.6A-B.

[0040] FIGS. 8C-D provides plots relating to systems and methods for cell engineering, in accordance with an exemplary embodiment of the present invention.

[0041] FIGS. 9A-B provides plots relating to systems and methods for cell engineering, in accordance with an exemplary embodiment of the present invention.

[0042] FIGS. 10A-C provides plots relating to systems and methods for cell engineering, in accordance with an exemplary embodiment of the present invention.

[0043] FIGS. 11A-C provides plots relating to systems and methods for cell engineering, in accordance with an exemplary embodiment of the present invention.

[0044] FIG.12 provides a schematic of in-flow single cell sensing using impedance cytometry and subsequent selective electroporation using a switched selectively t4riggered 6 172332660v2011529.114558 (GTRC9086PCT) electroporation voltage in a microaperture, in accordance with some embodiments of the present disclosure.

[0045] FIG.13A provides COMSOL simulated impedance (∆Z) and phase (∆Φ(Z) spectra of different particle-cell configurations. FIG.13B provides simulated ∆Z vs. location of particle- bound cells flowing through an aperture. FIG.13C provides a change in impedance at different total particle-to-cell volume ratios.

[0046] FIG. 14A illustrates an anti-CD45 particle binding scheme for Jurkat cells. FIG. 14B illustrates Jurkat cells bound to ~5 µm beads. FIG.14C illustrates anti-CD14 particle binding scheme for monocytes. FIGs.14D-E provides flow cytometry plot of target monocyte binding with cells exposed to beads compared to controls without bead binding.

[0047] FIGs.15A-B provide impedance (∆Z) and phase (∆ΦZ) spectra, respectively, for Jurkat cells with and without anti-CD45 beads bound. FIG.15C provide cell population identification using peak impedance at 45 kHz as a size estimator, and opacity, or the ratio of 5 MHz to 45 kHz peak impedance. FIGs. 15D-F provide corresponding plots as in FIGs. 15A-C but anti- CD14 beads bound to monocytes in PBMCs. Bound cells were electronically gated, and controls are all cells in PBMCs.

[0048] FIG.16A provides a plot of LDA for Jurkat cells bound to beads compared to unbound controls. FIG.16B plots a ROC curve for bound vs unbound Jurkat cells. FIG. 16C provides a plot of LDA for monocytes bound to beads, determined by electronic gating, compared to controls (all cells in PBMCS). FIG.16D plots a ROC curve for the targeted monocyte LDA.

[0049] FIG.17A provides a plot of peak change in voltage at 45 kHz with PBMCs exposed or not to anti-CD14 bound beads, in which if a cell is within the thresholds for electroporation, as indicated by the highlighted section, the electroporation voltage is applied. FIG.17B indicates PI+ composition of electroporated cells vs non-electroporated controls showing lymphocyte selection. DETAILED DESCRIPTION

[0050] To facilitate an understanding of the principles and features of the present disclosure, various illustrative embodiments are explained below. The components, steps, and materials described hereinafter as making up various elements of the embodiments disclosed herein are intended to be illustrative and not restrictive. Many suitable components, steps, and materials that would perform the same or similar functions as the components, steps, and materials 7 172332660v2011529.114558 (GTRC9086PCT) described herein are intended to be embraced within the scope of the disclosure. Such other components, steps, and materials not described herein can include, but are not limited to, similar components or steps that are developed after development of the embodiments disclosed herein.

[0051] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural references unless the context clearly dictates otherwise. For example, reference to a component is intended also to include composition of a plurality of components. References to a composition containing “a” constituent is intended to include other constituents in addition to the one named. In other words, the terms a, an, and the do not denote a limitation of quantity, but rather denote the presence of at least one of the referenced items.

[0052] As used herein, the term “and / or” may mean “and,” it may mean “or,” it may mean exclusive-or,” it may mean “one,” it may mean “some, but not all,” it may mean “neither,” and / or it may mean “both.” The term “or” is intended to mean an inclusive “or.”

[0053] Also, in describing the exemplary embodiments, terminology will be resorted to for the sake of clarity. It is intended that each term contemplates its broadest meaning as understood by those skilled in the art and includes all technical equivalents which operate in a similar manner to accomplish a similar purpose. It is to be understood that embodiments of the disclosed technology may be practiced without these specific details. In other instances, well- known methods, structures, and techniques have not been shown in detail in order not to obscure an understanding of this description. References to “one embodiment,” “an embodiment,” “example embodiment,” “some embodiments,” “certain embodiments,” “various embodiments,” etc., indicate that the embodiment(s) of the disclosed technology so described may include a particular feature, structure, or characteristic, but not every embodiment necessarily includes the particular feature, structure, or characteristic. Further, repeated use of the phrase “in one embodiment” does not necessarily refer to the same embodiment, although it may.

[0054] Ranges may be expressed herein as from “about” or “approximately” or “substantially” one particular value and / or to “about” or “approximately” or “substantially” another particular value. When such a range is expressed, other exemplary embodiments include from the one particular value and / or to the other particular value. Further, the term “about” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, 8 172332660v2011529.114558 (GTRC9086PCT) which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within an acceptable standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to ±20%, preferably up to ±10%, more preferably up to ±5%, and more preferably still up to ±1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated, the term “about” is implicit and in this context means within an acceptable error range for the particular value.

[0055] Ranges: throughout this disclosure, various aspects of the disclosure can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

[0056] By “comprising” or “containing” or “including” is meant that at least the named compound, element, particle, or method step is present in the composition or article or method, but does not exclude the presence of other compounds, materials, particles, method steps, even if the other such compounds, material, particles, method steps have the same function as what is named.

[0057] As discussed above, a problem with conventional electroporation approaches is that it typically leads to poor long-term viability of electroporated cells and inconsistent efficiencies among different cell types. These disadvantages are owed to the same bruteness that is the source of the technique’s advantages: the application of a macroscopic force across a bath of many cells does not allow for any fine control over the transfection process. Naturally, some cells experience a higher than ideal electric field and suffer from its toxicity, while others experience a lower than ideal electric field and are not electroporated. Accordingly, some embodiments of the present disclosure utilize techniques for measuring cell heterogeneity to control electroporation at a single cell resolution. This can be performed, for example, by 9 172332660v2011529.114558 (GTRC9086PCT) flowing a cell between two electrodes to measure its impedance and electroporate that cell based on its impedance in a real-time, label-free manner.

[0058] As shown in FIGs.1A-B, some embodiments of the present disclosure provide systems for cell engineering. The system can comprise an aperture 105 and a sensor 110. The system can be configured to pass a cell 115a 115b through the aperture 105. As the cell 115a 115b traverses through the aperture 105, the sensor 110 can measure an electrical property of the cell 115a 115b and, based on the measured electrical property, apply an electroporation energy to the cell 115a 115b.

[0059] The sensor 110 can be many different sensors known in the art capable of measuring an electrical property, including, but not limited to, impedance (which includes impedance spectrum). In some embodiments, the sensor 110 can comprise one or more electrodes 111112. For example, in some embodiments, the sensor can comprise a first electrode 111 disposed on a first side of the aperture 105 and a second electrode 112 disposed on a second side of the aperture 1050. The electrodes 111112 can be many different electrodes known in the art.

[0060] In some embodiments, as shown in FIG. 1C, the sensor 110 can further comprise one or more electrical components, including, but not limited to, a microcontroller, a lock-in amplifier, a switch, and / or an electroporation voltage source. For example, in some embodiments, the first electrode can be connected to either the lock-in amplifier used for measurement of the electrical property (e.g., impedance) or the voltage source used for electroporation. The signal from the lock-in amplifier can be analyzed by the microcontroller which can control the switch. The use of the lock-in amplifier can allow for the simultaneous measurement of impedance of the cell at a plurality of frequencies. In some embodiments, the plurality of frequencies can be many different numbers of frequencies. In some embodiments, the lock-in amplifier can allow for measurement of impedance at six frequencies in the range of 45 KHz to about 35 MHz, though the disclosure is not so limited.

[0061] In some embodiments, the aperture 105 can further comprise an inlet 120 and an outlet 125. The inlet 120 can be configured to receive a fluid containing one or more cells 115a 115b and direct the fluid through the aperture 105 and to the outlet 125.

[0062] The aperture 105 can comprise a sensing zone 130 and an electroporation zone 135. In some embodiments, the sensor 110 can be configured to measure an electrical property (e.g., impedance) of the cell 115a 115b as the cell 115a 115b passes through the sensing zone 130. Based on the measured electrical property, electroporation energy can be applied to the cell 10 172332660v2011529.114558 (GTRC9086PCT) 115a 115b when the cell 115a 115b passes through the electroporation zone 135. For example, in some embodiments, the magnitude and / or duration of the electroporation energy (e.g., voltage level) can be altered based on the measured electrical property. Thus, this can allow the electroporation energy applied to a particular cell to be tailored to that particular cell (or type of cell). This can result in a more uniform electroporation energy for certain cells (or cell types), thus overcoming many of the deficiencies of conventional electroporation techniques discussed above.

[0063] In some embodiments, the aperture 105 can be shaped such that the electrical property measured is associated with a single cell. For example, in some embodiments, the sensing zone 130 can have a tapered or pyramid shape such that a first end 131 of the sensing zone 130 proximate the inlet 120 has a larger cross-sectional area than that of a second end 132 proximate the electroporation zone 135. Thus, as the fluid moves through the sensing zone 130, the aperture 105 can taper to a smaller cross-sectional area such that the measured electrical property can correspond to a single cell located in the sensing zone 130. Similarly, the electroporation zone 135 can also have a tapered (or reverse tapered / reverse pyramid) shape, such that the electroporation energy is delivered to a single cell (as opposed to multiple cells in bulk), thus allowing for tailored electroporation energy to a particular cell based on the measured electrical property. For example, the electroporation zone 135 can have a third cross- sectional area at a first end 136 where the cell 115a 115b enters the electroporation zone 135 and a fourth cross-sectional area larger than the third cross-sectional area at a second end 137 where the cell 115a 115b exits electroporation zone 135.

[0064] Though the embodiment shown in FIG. 1A shows the aperture 105 (with the sensing zone 130 and electroporation zone 135) having an hourglass-like shape (combination of pyramid and reverse pyramid), the disclosure is not so limited. Rather, as those skilled in the art would appreciate, the aperture 105 can have many different shapes, including, but not limited to, a square shape, curved shapes, and the like. It can be advantageous to provide the aperture with a shape such that only a single cell at a time passes through the sensing zone and then the electroporation zone, thus allowing tailored electroporation energy for each cell (or cell type). As those skilled in the art would appreciate, the dimensions of the aperture can be selected based on the intended cells that will pass through the aperture.

[0065] As discussed above, in some embodiments, the sensor can further comprise a controller. The controller can be many different controllers known in the art, including, but not limited to, 11 172332660v2011529.114558 (GTRC9086PCT) microcontrollers, CPUs, and the like. The controller can be configured to adjust a characteristic of the electroporation energy, including, but not limited to, voltage level, duration of applied energy, and the like, based at least in part on the measured electrical property (e.g., impedance or impedance spectrum). The controller can then prompt the voltage source to deliver (e.g., via the electrodes) the electroporation energy to the cell in the electroporation zone.

[0066] In some embodiments of the present disclosure, cells can be altered prior to flowing through the aperture to enhance the presence of the electrical property sensed. For example, in some embodiments, the cell can be bound to a microparticle. The microparticle can be many different microparticles known in the art. In some embodiments, the microparticle can comprise an antibody. The microparticle can alter the electrical property of the cell. For example, the microparticle can increase a magnitude of the impedance spectrum sensed by the sensor as the cell passes through the sensing zone. This increase in magnitude can further assist in differentiating one cell type from another, such that the electroporation energy can be more easily tailored to the specific cell passing through the sensing zone.

[0067] In some embodiments, the sensed electrical property, e.g., impedance spectrum, can be inputted into a machine learning process to determine whether electroporation energy should be applied to a particular cell, the magnitude of that energy, and / or the duration of that energy. Many machine learning processes can be employed, as would be appreciated by those skilled in the art. Thus, in some embodiments, the controller can be in communication with or otherwise utilize such a machine learning process. EXAMPLES AND DISCUSSION

[0068] Below, exemplary methods and systems for cell engineering are disclosed.

[0069] It can be helpful to understand the multi-domain physics arising through the use of non- uniform electric field and fluid flow in the tapered aperture during the electroporation process. Simplifying assumptions can be used to first develop an approximate analytical model and then a multi-physics computational model to explore and optimize the working of the exemplary systems disclosed herein. This reveals certain design guidelines and limits for its operation – including the dependence of the TMP and time spent in electroporation for each cell on the cell size and aperture dimensions. Also provided herein is a novel electronic feedback control scheme to overcome the variation of electroporation parameters with cell-size. This can be done by predictively optimizing electroporation parameters based on the estimated cell size from the impedance measured across the aperture as a cell flows through it. This dynamic 12 172332660v2011529.114558 (GTRC9086PCT) control of electroporation parameters to control the TMP and electroporation time across cells of different sizes can enable higher efficiency in electroporation of patient-derived primary cells, which can vary significantly in size.

[0070] MATHEMATICAL MODEL

[0071] The formation of pores and the survival of a cell during electroporation can be related to the magnitude of the TMP across time. Parameters of specific interest are the maximum TMP experienced, and the electroporation time which is the time duration for which the TMP is above the threshold for electroporation. The maximum TMP can be controlled to prevent irreversible electroporation that lyses the cell membrane, killing the cell. Through controlling the maximum TMP and electroporation time, design guidelines can be provided that ensure cells are precisely electroporated for intracellular delivery without causing cell lysis. Herein there is provided a simplified analytical model of an exemplary in-flow electroporation scheme (FIGS. 6A-B) to understand the major relations between controllable variables and the electroporation parameters of interest. A COMSOL Multiphysics model is used to verify the accuracy of the present analytical model and to offer further information beyond the bounds of assumptions made in building the analytical model.

[0072] FIG. 6A shows a 3D model of the tapered square pyramidal aperture, sandwiched between the electrodes which are used to apply the electroporation voltage pulses. FIG.6B also shows a 2D cross-section of the aperture, the co-ordinate system used and illustrates the variables that determine the microscale aperture geometry. Here w(z) represents the side length of the square made by the intersection of the square pyramid with a plane of constant z- coordinate and worepresents the minimum w, i.e., the width of the narrower end of the aperture, and Wmax represents the maximum w, i.e., the width of the wider end of the aperture. The center of the narrowest end of the aperture is taken to be the origin of the axes, with the positive z- axis pointing towards the wider ‘base’ of the pyramid. z, represents the overall height of the pyramid. z, is the thickness of a silicon wafer while the angle θ is set by the etching process.

[0073] SIMPLIFIED ANALYTICAL MODEL

[0074] It can be assumed that single cells in suspension arrive at the aperture centered on the z-axis. Note that this can be experimentally achieved by prior flow-focusing of cells. Due to symmetry around the z-axis, a simplifying assumption can be made that the cell velocity, v(z), which is further assumed to be identical to the fluid velocity, depends only on the z-coordinate 13 172332660v2011529.114558 (GTRC9086PCT) of the cell and the cross-sectional area of the aperture, A(z), at that z-coordinate, which is defined in equations 1 and 2.

[0075] Equation 1: k = 2*tan(90 − θ)

[0076] Equation 2: A(z) = w2= (wo+ kz )2(0 < z < zo)

[0077] Using the equation of continuity of incompressible fluid flow, the magnitude of the fluid velocity v(z) is derived, at a particular z as simply the total rate of fluid flow, Q, divided by the cross-sectional area of the aperture at that z. Note that any effects on the fluid flow due to the cell itself are neglected here. Also, any entrance or exit effects are neglected and steady- state, fully developed flow is assumed. Thus:

[0078] Equation 3: v(z) = Q / (wo+kz)2

[0079] The cell transit time and its location versus time as it passes through the aperture can then be determined. To do this, the above cell velocity, v(z) can be integrated. Note that in the co-ordinate system used, cells pass through the aperture flowing in the negative z direction. The bounds of the integral are set such that the time at which zc, the cell center, is at z = 0, the time is set as t = 0 and also for simplicity of further analysis, time is assumed to start at a positive value when the cell starts at the wider end of the aperture and decrease to= 0 as the cell travels in the negative z direction. Then, the time t(zc) at which the cell center will be at various z positions, obtained after integration, is as shown in equation 4.

[0080] Equation 4: t(zc) = (1 / (3kQ))[(w0 + kzc)3– w03]

[0081] Analogous to the above fluid flow model, making simplifying assumptions, then the equation of continuity of electrical current can be used to derive the electric field and its variation in the aperture. The electric field can be assumed to be proportional to the current density which is set by the total current and the cross-sectional area, A(z), of the aperture at a particular z. To find the total current, it is assumed that a steady-state DC voltage is applied across the aperture with insulating walls, filled with a conducting liquid with resistivity. The bulk electrical resistance (R) of the buffer-filled aperture is then as shown in equation 5 and the total current flowing through it is as shown in equation 6. The electric field, E(zc), at a given z-coordinate, is then obtained as shown in equation 7.

[0082] Equation 5: R = (ρz0) / (w0(w0 + kz0))

[0083] Equation 6: I = V / R = (Vw0(w0+ kz0) / (ρz0))

[0084] Equation 7: E(zc) = ρI / (A(zc) = (vw0(w0 + kz0) / (z0(w0 + kzc)214 172332660v2011529.114558 (GTRC9086PCT)

[0085] Next, modeling the cell as sphere of radius, rc, with a thin non-conducting membrane and a conducting interior cytoplasm, the TMP of the cell at a position zcin the aperture can be directly proportional to the electric field and cell radius rc and is obtained as shown in equation 8.

[0086] Equation 8: VTMP(zc) = (3rc / 2)E(zc) = (3 / 2)(rcVw0(w0 + kz0) / (z0(w0 + kzc)2

[0087] The maximum value of this TMP, V0, which occurs at zc= 0 where the electric field is the strongest, is calculated in equation 9.

[0088] Equation 9: V0= VTMP(0) = (3 / 2)(Vrc(w0+ kz0) / (z0w0) = (3 / 2)rc(V / z0)(w0+ kz0) / wo= V0(k = 0)(wmax / w0)

[0089] This expression above for V0makes it clear that there is an enhancement of maximum TMP due to the taper of the aperture, compared to a non-tapered aperture of constant width (i.e. = 0). The ratio of widths of wider and narrower ends of the tapered aperture (wmax / w0) represent this TMP enhancement factor or equivalently an electric field enhancement factor. Also, using this V0as a parameter, equation 8 can be rewritten as:

[0090] Equation 10: VTMP(zc) = V0w02 / (w0 + kzc)2

[0091] This expression above makes it clear that as the cell travels towards the narrow end of the aperture, and zc → 0, VTMP rises monotonically to V0. For simplicity, it is also assumed, that after exiting the narrow end of the aperture into wide open buffer solution outside, the TMP immediately falls rapidly to a very low value. Equation 10 can also be rearranged to obtain equation 11 below relating the cell location, more simply, to the TMP at that location.

[0092] Equation 11: zc = ((V0 / VTMP)0.5– 1)(w0 / k)

[0093] This expression is useful in obtaining the electroporation time, i.e. the total time duration for which a cell experiences a TMP above a particular threshold needed for electroporation, Vth. Note that the time t(zth) at which a cell reaches the particular threshold TMP, Vth, is here also the total time duration that the TMP of the cell will remain above Vth. This is because, as described above, time runs down from t(un) to 0 at the narrow end of the aperture at which the drop in TMP after exiting the narrow end is assumed to be rapid and thus the TMP reduces below Vthimmediately. So using equation 11 in equation 4, with VTMP= Vth, equation 12 is obtained.

[0094] Equation 12: t(zth) = w03 / (3kQ)[(v0 / vth)1.5– 1]

[0095] Note that this expression predicts, as is to be intuitively expected, that this electroporation time is inversely proportional to the fluid flow rate. Faster fluid flow drives the 15 172332660v2011529.114558 (GTRC9086PCT) cells through the high electric field electroporation zone more rapidly and thus reduces the electroporation time. Note also that if V0= Vth, i.e., the maximum TMP barely reaches threshold value at its peak at the narrow end, then there is no time for electroporation to occur before the cell exits the aperture and the electroporation time is predicted to be zero, as expected.

[0096] Additionally, and perhaps, most strikingly, this expression shows that in this scheme, the electroporation time, t(zth) and the maximum TMP, V0, are related to each other. Also, given the cell radius and applied voltage dependence of V0itself (equation 9), this equation shows that the electroporation time can be dependent on both cell size and the applied voltage as well. It is noted that from the perspective of traditional bulk electroporation, some of these dependences (e.g. TMP vs. cell size & TMP vs. applied voltage) are as expected while others (e.g. electroporation time vs. cell size & electroporation time vs. applied voltage) are unique to this in-flow focused electric field electroporation scheme.

[0097] NUMERICAL MODEL

[0098] A numerical model of the in-flow electroporation scheme was implemented in COMSOL Multiphysics 5.4. The model utilized the AC / DC and fluid flow modules to analyze the physical properties of significance in the electroporation device as a cell flows through the aperture.

[0099] The electric currents interface was used to model the focused electric field by setting boundary conditions of an applied electric potential and ground plane to model the presence of electrodes across the aperture. The walls of the aperture were set as electrically insulating. The cell is modeled as a small sphere moving along the centerline of the aperture along the z-axis toward the narrowest end of the aperture. Due to limits on meshing and thus computational resources arising from the large difference in size-scale of the cell membrane (~nm) and the overall aperture (~µm), the internal structures of the cell and the cell membrane are ignored. Rather, the cell is simulated as a sphere of conducting cytoplasm contained in a thin, 1nm, highly resistive layer with electrical impedance of 1e-8 S / m. Through multiple stationary, or steady-state simulations using the COMSOL parametric sweep function, the TMP for different combinations of cell sizes in different aperture sizes was calculated for incremental positions of the cell along the z-axis. The TMP is calculated as the electric potential difference across the thin resistive layer modeling the membrane, using 3D cut points and point evaluations of electric potential outside and inside the cell. 16 172332660v2011529.114558 (GTRC9086PCT)

[0100] The fluid flow modeling was conducted through the laminar flow interface of the fluid flow module. An incompressible laminar flow (Q = 1.2µL / min, based on an experimental flow rate) with no-slip wall boundary conditions was simulated. The fluid simulated was assumed to be 1XPBS with conductivity of 1.5 S / m and dynamic viscosity of 0.08882 Pa∙s. To simplify the model, the particle tracing interface was then used to calculate the time the cell takes to move through the aperture in flow, assuming that the cell velocity as it travels through the aperture is equal to the velocity of the fluid alone. Note that this matches the corresponding assumptions made for the analytical model above.

[0101] The simulations conducted to model the impedance change as cells flow through the aperture also used the electric currents interface. For further accuracy, mesh adaptations and decreased tolerance levels were used in these simulations, reducing noise due to poor meshing from the microscale nature of the present model. The results analysis features of COMSOL were utilized to calculate the current as cells of different sized flowed through the aperture. MATLAB was used for further analysis and plotting of the numerical results obtained from the COMSOL simulation.

[0102] Mesh Study

[0103] COMSOL breaks up the simulated domain into smaller elements through meshing. These elements are used to calculate the numerical solution, which is ultimately mesh dependent. A mesh independence test is performed on the maximum TMP of a cell, as shown in FIG. 7, to determine the necessary number of mesh elements. The mesh used for the simulations was defined using the extra fine mode in COMSOL for a total of 123981 domain elements.

[0104] FIG. 7 shows mesh independency test for the peak cell TMP, 5 V applied voltage, 20 µm diameter cell, z, = 0.

[0105] FOCUSED ELECTRIC FIELD EFFECTS

[0106] COMSOL Multiphysics simulations allowed for the modeling of the change in TMP as a cell travels through the aperture. The simulate focused electric field generated by an applied voltage (5V) across the aperture (wo = 40tm) can be seen in FIG. 8A. Note that the highest electric field here reaches a V / m at which in a traditional bulk-scale electroporator would take an applied voltage applied across the parallel plate electrodes of a standard cuvette (electrode gap ~ 4mm). This focused high electric field zone thus allows for the use of much 17 172332660v2011529.114558 (GTRC9086PCT) lower applied voltage for electroporation here than in conventional electroporators. This relates to the electric field enhancement effect of the aperture as described above.

[0107] FIG. 8A illustrates COMSOL simulation of the electric field generated by voltage of 5V across a 40 µm aperture with no cell flowing through. A high focused electric field is seen at the narrowest part of the aperture. FIG. 8B illustrates COMSOL simulation of the electric field around a cell at its maximum TMP. FIG. 8C provides COMSOL simulation of the TMP of a 20 µm cell in a 40 µm aperture with a 5 V electric potential applied. The highlighted area is the portion of the aperture in which the cell’s TMP is within electroporation thresholds. The maximum TMP is reached as the cell flows through the narrowest part of the aperture. FIG.8D provides COMSOL simulation of TMP of the 20 µm cell in a 40 µm aperture with a 5 V electric potential applied as it flows through the aperture in real time.

[0108] Placing the cell (diameter=20µm) along the z-axis in this electric field (FIG. 8B), its TMP is maximum at its poles along this axis. FIG. 8C shows the simulated variation of this TMP of the forward and backward poles of the cell center moves (+z → −z) through the narrowest part of the aperture. Note that this narrowest part of the aperture (z = 0), is where the electric field is strongest and thus this is where the cell experiences the maximum TMP, as was predicted using the approximate analytical model (equation 9). However, it is worth noting that the simulations reveal that forward and backward poles experience the maximum TMP at slightly different points. Also, considering the threshold TMP (uv~0.2) for electroporation, the spatial extent of the electroporation zone can be defined as shown by the highlighted area in FIG. 8C. It is found to be ~125 µm in length. It is also seen that while most of the electroporation zone lies upstream of the narrowest end of the aperture, there is indeed a small part of it extending beyond.

[0109] Next, the time the cell spends traversing this zone is calculated. The simulated fluid flow through the aperture is shown in FIG. 8D. As described above, the cell is assumed to have the same velocity as the flow. Using the data from FIG.8C, the variation of TMP versus time is obtained. From this, an estimate of the electroporation time (~15ms) can be obtained.

[0110] TMP AND RESIDENCE TIME PARAMETERIZATION

[0111] The extent of this field focusing effect may be viewed as the ratio of the maximum TMP, V0, to the applied voltage V, evident through equation 10 to be dependent on both the radius of the cell, rc, and the minimum aperture width, wo. The analytical model displays a linear relationship, with the slope determined by purely geometric parameters of the 18 172332660v2011529.114558 (GTRC9086PCT) aperture: the minimum aperture width, the etching angle, and the etching depth. To parameterize the simulation data to this ratio, the maximum TMP was divided by the applied voltage of 5V, using data from simulations of different cell sizes, ranging from 12.5-87.5% of the minimum aperture width as the cell diameter, and apertures, 10, 20, 30, and 40 µm. Results across a range cell sizes and minimum aperture widths confirm this relationship to match the analytical equation very closely, further verifying the ability to optimize electroporation through design decisions.

[0112] The residence time, defined as the time a cell spends above the TMP threshold necessary for electroporation, Vth, is only a small portion of the time spent in the aperture. Since the TMP varies in time and space, it is useful to think of an ‘electroporation zone’ bounded by the positions in the aperture at which a cell’s TMP will be at Vth, and the residence time to be the time it takes for the cell to flow through this electroporation zone. The residence time, as modeled by equation 12, can be a function of the cell size, aperture dimensions, and flow rate. FIG. 9A shows how the residence time varies as a function of the ratio of rcto wo, displaying an approximately linear relationship for a given wo. The analytical model demonstrates considerable accuracy compared to the COMSOL numerical model.

[0113] FIG. 9A illustrates the ratio of the maximum TMP and applied voltage and its dependence on cell radius and aperture size. Analytical solution, equation 10, is compared to numerical results from COMSOL for a range of cell and aperture sizes. FIG. 9B provides the residence time and its dependence on the cell radius and aperture size. Analytical solutions, equation 12, for each multiple aperture sizes are compared to numerical results for a range of cell and aperture sizes.

[0114] With respect to practical design considerations, the average size of a cell type and an upper bound on the TMP, V0, can be considered given. The aperture dimensions can be readily chosen, but not adjusted dynamically. Finally, the flow rate and applied voltage can be dynamically changed, however, dynamic control of the flow rate is outside the scope of the present consideration, leaving the applied voltage as the present controlled variable.

[0115] The parameterization in FIGs. 22A-B serve as a reference to narrow down a design space based on these practical constraints. For a desired residence time and average cell size, the rcto w0ratio can be found from FIG. 9B. Then, V0and FIG. 9A can be used to determine the applied voltage level needed for this desired residence time. A low residence time may occur when w0is small, due to w0L term in the numerator in equation 12. 19 172332660v2011529.114558 (GTRC9086PCT) Additionally, given a constant flow rate, a small w0 increases the velocity of the fluid and cell, equation 3, so it moves through the electroporation zone quicker, thereby reducing residence time. A low flow rate may be chosen to offset this effect and increase residence time. As seen in FIG. 9B, given a constant applied electric field, a small rcto w0ratio will result in a low residence time. This is due to the need for the cell to move further through the aperture before achieving a threshold TMP, leaving less available time in the electroporation zone. Essentially, the volume of the residence zone decreases, thereby reducing the residence time. This can be minimized by increasing the applied voltage and flow rate and can be modeled by equation 9 and 12.

[0116] Since the maximum TMP and residence time both can depend on a cell’s size, variation in the size of cells under constant electroporation parameters leads to inequal electroporation treatment. Considering a single cell type can display a range of cell sizes, such as lymphocytes that vary between 8 to 13 µm, adjusting the applied voltage to an individual cell’s size could result in appreciable gains in cell viability and delivery efficiency across heterogeneous cell populations.

[0117] CORRELATING CELL SIZE TO AN IMPEDANCE-BASED BIOMARKER

[0118] To address the limitations presented above by cell size, some embodiments of the present disclosure can utilize the Coulter principle, which monitors cells in flow through detecting the impedance change between electrodes filled with buffer. As cells pass through the aperture a change in electric current is detected proportional to cell size allowing for the estimation of cell size, creating an impedance-based biomarker. This biomarker can allow effective estimation of the cell size of a cell in-flow before electroporation, establishing a basis for feedback-controlled electroporation.

[0119] In the present scheme, as the cells flow through the narrowing aperture, they reach an electrically detectable change in impedance. FIG.10A shows the absolute and percent impedance change for 6 different cell sizes in a 40 µm aperture, with the maximum impedance change being reached as the cells approach the narrowest end of the aperture. Based on this model a sensing zone is proposed, within which there is an integration of impedance measurements bounded by two impedance thresholds for increased sensitivity for cell size identification. FIG.10A offers visualization of this scheme with impedance bounds of 75 and 125 ohms. 20 172332660v2011529.114558 (GTRC9086PCT)

[0120] FIG.10B shows that the maximum impedance change varies considerably with cell size and that larger ratios of rcto w0increase the sensitivity. The analytical fit to this data is provided by Deblois. Unfortunately, this maximum impedance change occurs when the cell has nearly passed through the aperture. Any single impedance measurement could be mapped to a large cell far away from the end of the aperture, or a smaller cell nearer the end of the aperture depending on the thresholds set for the impedance integration and chosen aperture size. The relationship between increasing cell size and increasing detected impedance change can be see FIG.10C, showing the integrated impedance change of different size cells with the same bounds used in FIG.10A. When small cells (<15 µm) flow through a considerably larger aperture, the change in impedance is not detectable within the set integration at this voltage, 5V. Consequently, they miss detection in large aperture sizes, low rc to w0 ratio, as seen in FIG. 10B. In this case, the ratio of rcto w0should be increased by decreasing the minimum aperture width w0. With regard to practical design considerations, the geometrical dimensions should be chosen based on knowledge of the average expected cell size, as outlined above, so the minimum expected cell size triggers the upper integration limit.

[0121] FIG.10A illustrates COMSOL simulation of impedance change as various cell sizes move through aperture. Visual of the impedance-bounded integration scheme for impedance-based cell size biomarker. FIG. 10B illustrates maximum impedance as a function of the ratio of cell radius and minimum aperture width. FIG.10C provides result of impedance- bounded integration scheme across cell sizes.

[0122] DYNAMIC CONTROL OF ELECTROPORATION PARAMETERS

[0123] Based on the estimated cell size attained by the integrated impedance values, the applied voltage can be altered to ensure that cells of different sizes receive near equal electroporation treatments, as quantified by the maximum TMP experienced and the residence time. Equation 9 is rearranged to find the applied voltage, V, with the desired electroporation parameters, the desired maximum TMP, V0, the aperture size, w0, maximum aperture height, z0, and the estimated cell radius, rc.

[0124] Equation 13: V = (2V0z0w0) / (3rc(w0+ kz0))

[0125] The cell radius would be replaced with the integrated impedance value divided by a factor to estimate the cell radius during experiments. This new optimized feedback- controlled voltage equation was tested in COMSOL and is plotted in relation to the integrated impedance values in FIG. 11A, exhibiting a simple way to control electroporation efficiency, 21 172332660v2011529.114558 (GTRC9086PCT) showing both the experimental and fitted values based. FIG. 11B demonstrates the effectiveness of this optimized voltage control of the maximum TMP for wo= 40 µm, and a desired maximum TMP of 0.5 V, where the maximum TMP is maintained across cell sizes. Due to the residence time, as shown in equation 12, being a direct function of V0the control of the maximum TMP also equalizes the residence time for cells of different sizes, as shown in FIG.11C for a maximum TMP of 0.5 V.

[0126] FIG. 11A illustrates feedback-Controlled voltage across multiple cell sizes plotted against their respective integrated impedance values in a 40 µm aperture. FIG. 11B illustrates the maximum TMP experienced by a range of cell sizes with adjusted applied voltage in a 40 µm aperture. FIG.11C illustrates residence time experienced by a range of cell sizes in a 40 µm aperture.

[0127] The integration feedback scheme used to sense cells across the aperture allows for a simple yet effective method to control electroporation, being able to distinguish between cell sizes and electroporate them based on a user desired outcome. This could be used to efficiently electroporate a range of cell sizes of a single cell type, or to selectively electroporate between multiple cell types that differ in size. Future impedance-based biomarkers could further optimize this feedback scheme.

[0128] Design and testing of an exemplary system will now be described.

[0129] Materials and Methods

[0130] Aperture Fabrication

[0131] An aperture was fabricated by 3-dimensional two-photon-lithography. The geometry was defined in CAD software (Fusion 360) and exported for 3D printing by a Nanoscribe Photonic Professional GT2. After laser exposure, the print was developed by a 5- minute bath in SU-8 developer, a 5-minute bath in isopropanol, detachment from the silicon substrate, a 5-minute bath in SU-8 developer, a 5 minute bath in isopropanol, and set under a UV lamp overnight before assembly with other components. The reservoir, electrodes, aperture, and luer lock were all bonded together with the aperture by epoxy.

[0132] Impedance Measurement

[0133] A lock-in amplifier and transimpedance amplifier (HF2LI, HF2TA, Zurich Instruments) were used for impedance measurements. For generating bode plots of different cell types the impedance was measured at six different frequencies ranging from 45 kHz to 35 MHz. The phase and magnitude time series is saved at 57,000 per second for each frequency. 22 172332660v2011529.114558 (GTRC9086PCT) A first order filter is applied to remove the baseline and low frequency components of the signal. Next, a peak finding algorithm is used on the impedance magnitude at 45 kHz and the resulting peak indices are used to index the remaining five magnitude and six phase time series.

[0134] For the selective electroporation experiments, the magnitude of the impedance at 45 kHz was used. A 5V sine wave was applied to the top electrode by the lock-in amplifier. Internal to the lock-in amplifier, the demodulated signal is digitally amplified by 500 times and its DC offset is removed before being output by a DAC. This output of the lock-in amplifier is passed through an analog first-order active high pass filter (f_c = 70 Hz) and digitized by an AD7366 (Analog Devices) in serial communication with a Teensy 4.1 microcontroller (PJRC) at 160,000 samples per second.

[0135] Electroporation Control

[0136] The digitized signal from the lock-in amplifier was fed into control logic on the microcontroller. First, a moving average of n=10 was applied. When the moving average passes a threshold, a peak finding algorithm began. This algorithm takes a moving difference of n=10 applied on the moving average. When this moving difference changed from a positive to a negative value the value of the moving average was compared to some threshold to determine if electroporation was to be applied to that particular cell.

[0137] If electroporation is triggered, a switch is thrown that connects the top electrode to a voltage source and the bottom electrode to ground for 1 millisecond before switching back to the measurement mode of operation.

[0138] Cell Preparations

[0139] All cell cultures are maintained according to ATCC recommendations. The GFP-expressing HEK293 cell line was bought from GenTarget Inc. (SC058). The PBMC’s were bought from STEMCELL Technologies (70025), aliquoted, and re-frozen. For delivery experiments, cells were taken from culture or frozen aliquot and stained for cell type if relevant. Then they were washed once in delivery buffer and re-suspended in delivery buffer at a concentration of 1.5e6 / mL. The delivery buffer is 90% Opti-MEM (Thermofisher, 31985070), and 10% OptiPrep (STEMCELL Technologies, 07820). An additional 1% of its weight in BSA is added as well as the delivery material: either FITC-dextran (Sigma Aldrich, 46946), propidium iodide (ThermoFisher, P1304MP), or Cas9 (ThermoFisher, A36490) with sgRNA (ACCGCCGACAAGCAGAAGAA, custom from Sigma Aldrich custom) designed with CRISPick (Doench et al., 2016; Sanson et al., 2018). FITC-dextran delivery buffers were 23 172332660v2011529.114558 (GTRC9086PCT) prepared at a concentration of 1 mg FITC-dextran per milliliter of buffer. Propidium iodide delivery buffers were prepared at a concentration of 50 ug propidium iodide per milliliter of buffer. Cas9 and sgRNA delivery buffer was prepared by first incubating 1ug of Cas9 and 90 picomoles of sgRNA according to manufacturer instructions before adding to the delivery buffer for a final volume of 100ul per sample.

[0140] Viability and Delivery Efficiency Measurements

[0141] For FITC-dextran delivery, cells are washed twice after electroporation and propidium iodide is added to measure viability. For propidium iodide delivery, cells are not washed after electroporation and calcein blue (ThermoFisher, 65-0855-39) is added to measure viability. For Cas9 knockdown of GFP, the cells are washed once after electroporation, plated, and placed in an incubator for 72 hours. Then they are trypsinized, washed and re-suspended in PBS with propidium iodide to measure viability. Flow cytometry was performed on a Cytek Aurora and fcs file analysis was performed in FlowJo.

[0142] Results and Discussion

[0143] Microfluidic System for Single-Cell Impedance Spectroscopy and Electroporation

[0144] As shown in FIGs. 1A-C, the device comprises a fluidic system coupled to an electronic system. Cells are pipetted into a reservoir on top of the device. At the bottom of this reservoir is an aperture epoxied between two electrodes. These electrodes are gold-plated through-holes defined on a standard PCB board (FIGs. 1A-B). The aperture is a conical hole that narrows to a square cross-section (25x25 µm) before widening in a symmetric fashion (FIG. 1D). At the bottom of the device is a luer-lock connected to a syringe pump via tygon tubing. Cells are loaded into the top reservoir and pulled down through the top electrode, aperture, bottom electrode, and finally into the syringe.

[0145] A lock-in amplifier is used to measure the impedance between the two electrodes. As a cell passes through the aperture, the impedance increases assuming the cell displaces a more conductive fluid that would otherwise fill the aperture. While there are many cells in the fluid between the two electrodes, the geometry of the aperture focuses the electric field to a small region so that only one cell at a time significantly impacts the impedance measured between the electrodes (FIG.1E).

[0146] The same electrodes that are used to measure the impedance of cells can also electroporate cells by applying a DC voltage (FIG 1A). This suggests that a cell can have its 24 172332660v2011529.114558 (GTRC9086PCT) impedance analyzed and be electroporated as it passes through the aperture if the electronic signal can be switched between the lock-in amplifier measurement and the electroporation voltage. This can be done by sensing the presence of a cell and switching to the electroporation voltage while the cell is still within the focused electric field. As a direct extension, rather than just sensing the presence of a cell, the impedance measurement itself can be used to control the switching (FIG. 1C). Therefore impedance-based feedback control of electroporation at a single cell resolution is implemented.

[0147] Electrical Characterization of Cells

[0148] To demonstrate a capability of the system, a subset of cell types were selectively electroporated in a mixture of cell types, meaning an impedance difference between different cell types was determined. The lock-in amplifier is capable of measuring the phase and magnitude of the impedance at six different frequencies up to 50 MHz. Times series of these measurements were acquired at 57,000 samples per second. FIGs.2A-B show the data acquired for a single cell passing through the aperture. The time series impedance magnitude at 45 kHz is used in a peak-finding algorithm and the indices at the peak values are used to index the remaining time series signals. Plotting these peak values against the frequency yields a bode plot for each cell type (FIG. 2C-D). These bode plot were input as features into a linear- discriminant classifier to show the ability for the impedance signatures to distinguish between two cell types. However, for the case of real-time acquisition and analysis of impedance data to enable selective electroporation, only the magnitude of the impedance at 45 kHz was used. This choice was made to significantly reduce the hardware and software needed to demonstrate SPICy. This single measure is sufficient to distinguish between cells such as HEK293’s versus PBMC’s, as well as monocytes versus lymphocytes as evidenced by the selective delivery experiments.

[0149] Single-Cell In-Flow Electroporation of Cells

[0150] Before demonstrating SPICy, the electroporation capabilities of the system were explored. Here the SPICy switching hardware and algorithm are fully in place, but every impedance peak triggers an electroporation event, rather than being compared to some threshold. Initial investigation was conducted by delivering 150kDa FITC-dextran to HEK293’s with propidium iodide as a viability marker (FIG. 3A). To establish that delivery was being caused by the electroporation event, the voltage of the event was varied from 0 to 13 volts. As the voltage increased, the number of FITC positive cells increased (FIG.3B). This 25 172332660v2011529.114558 (GTRC9086PCT) highlights the innate heterogeneity in these cells, where a voltage that is sufficient to electroporate some, is not sufficient to electroporate others. FITC positive cells were classified as those cells with FITC fluorescence greater than 95% of a control incubated with the FITC- dextran molecule.

[0151] Of major interest in practical intracellular delivery applications is the size of molecule that can be delivered. FIG. 3C shows the percentage of FITC positive cells with different sizes of FITC-dextran molecules in the delivery buffer, ranging from 4 to 500 kDa. The increase in FITC positive cells with larger FITC-dextran molecule size was surprising, but further investigation revealed two major caveats. First, despite all FITC-dextran sizes being purchased from the same vendor, they have different ratios of fluorescent molecules to dextran molecules. Second, each of the trials with different FITC-dextran sizes has its own incubation control used for FITC positive gating and the smaller FITC-dextran molecules had higher background levels fluorescence. Therefore, the main importance of FIG.3D is simply to show that molecule sizes greater than a Cas9 RNP complex can be successfully delivered with system.

[0152] Next, functional Cas9 delivery was directly demonstrated. Cas9-sgRNA RNP was delivered to a GFP expressing HEK293 cell line resulting in significant knockdown of GFP expression after a 72-hour incubation (FIG.3D). While delivery to cell lines has practical applications to research and experimental work, for electroporation to truly compete in the cell therapy field, delivery to primary cells is of utmost importance. FIG. 3E shows that SPICy’s delivery efficiency and viability performs well when delivering to PBMC’s, whether lymphocytes or monocytes.

[0153] Control Scheme to Enable Selective Delivery

[0154] After characterizing the innate electroporation capabilities of SPICy, the main novelty of the device was investigated: the ability to selectively electroporate cell types. FIG. 4 provides an overview of the hardware and software of SPICy. The impedance signal from the lock-in amplifier is filtered to remove baseline drift, and then digitized for analysis in a microcontroller (FIG.4A-B). The microcontroller calculates a moving average to remove high frequency noise and a moving difference to identify when a peak in the signal has occurred. FIGs. 4C-D plot the signal analysis occurring inside the microcontroller. The voltage is digitized from the lock-in-amplifier output, then a moving average is taken to smooth out high frequency noise. Next, a moving difference is taken on the moving average, and when this 26 172332660v2011529.114558 (GTRC9086PCT) moving difference cross zero, the moving average is indexed to approximate the peak height. FIG. 4C shows these signals where the peak height identified does not meet the threshold to trigger electroporation. FIG. 4D shows these signals when the peak height exceeds the threshold causing the algorithm to trigger an electroporation event. This trigger switches the electrodes from their connection to the lock-in amplifier, to a connection to the electroporation voltage (FIG.4B). When the switch is flipped, the voltage across the electrodes switches from the 45 kHz probe frequency of the lock-in amplifier to a DC voltage for electroporation (FIG. 4F). After approximately 1 millisecond, the switch is flipped back and resumes measurement. A case where electroporation is not triggered is also shown (FIG.4E).

[0155] Selective Electroporation at Single-Cell Resolution

[0156] To demonstrate selective delivery, PBMCs and HEK293s were measured in the system separately, to note the differences in their impedances (FIG. 5A). Based on this a threshold to trigger electroporation was chosen and propidium iodide was delivered to either PBMCs or HEK293s (FIG. 5B). Forward scatter was used to determine the true identify of cells as either PBMCs or HEK293s. Delivery of 150 kDa FITC-dextran was initially investigated, but the monocytes in the incubation control had extremely high levels of FITC background. This is expected to be due to the endocytic propensity of monocytes.

[0157] Next, PBMCs in the system were measured, it was noted that the distribution was bimodal, and it is expected the larger impedance mode to correspond to monocytes and the rest, lymphocytes. A threshold was drawn between the two modes and electroporation was triggered for peaks either below or over that threshold. Propidium iodide was delivered to mark which cells were electroporated, and an anti-CD-14 antibody stain was used to determine the true identity of cells as either lymphocyte or monocyte. Figure 5c shows the results of this. Representative FACS plots for these selective delivery schemes and quantification are shown in FIGs.5D-E.

[0158] Microparticle-Enabled Single Cell Electronic Immunophenotyping and Selective Electroporation

[0159] As discussed above, in some embodiments of the present disclosure, cells can be labeled with microparticles for the purpose of electronically detecting and selectively electroporating specific subpopulations within a heterogenous cell mixture. An exemplary embodiment of such a technique is now disclosed. In particular, the sensing capabilities of the device were confirmed using cell lines and primary cells with various cell receptor targets for 27 172332660v2011529.114558 (GTRC9086PCT) microparticle binding. A machine learning algorithm was then used to differentiate between populations of bound and unbound cells. Leveraging this differentiation, lymphocytes within peripheral blood mononuclear cells (PBMCs) were selectively electroporated. This approach differs from existing microfluidic electronic cell sensing and electroporation approaches in that it goes beyond using electronic sensing for purely diagnostic purposes or to optimize and monitor electroporation alone by use cellular electronic immunophenotyping for targeted electroporation.

[0160] The device, a 3D printed biconical micro-aperture, detects and analyzes cells, using multifrequency impedance cytometry, as they flow through a 25-micron constriction (FIG. 12) which creates a focused electric field region for in-flow single cell sensing. This is then used to identify target cells and selectively trigger an electroporation voltage. Antibody-labeled microparticles are used to transduce the presence of specific cell surface receptors to an electronic signature for cell immunophenotyping and targeting. COMSOL simulations were performed to confirm the change in impedance spectrum expected for microparticle-bound cells. It was found that the impedance change depended on the location of the microparticle on the cell as it flows through the aperture as well as the microparticle-to-cell volume ratio (FIGs.13A-C).

[0161] Because larger microparticles increased the change in impedance (FIG.13C), we used 5-micron microparticles coated with anti-CD45 antibodies to bind Jurkat cells (FIGs.14A- B). We analyzed impedance and phase change between unbound and bound cells (FIGs. 15A- B). This was then repeated with PBMCs with anti-CD14-coated microparticles to selectively bind monocytes (FIGs. 14C-E). Flow cytometry showed microparticle binding was most prevalent in CD3- / CD14+ population, indicating monocyte binding. Bound cells had a significant increase in single-cell impedance spectra across measurement frequencies. Linear discriminant analysis (LDA) on these impedance spectra differentiated between the populations (AUC >0.9) for both bound Jurkat cells and primary monocytes (FIGs. 16A-D). We then, for simplicity, used impedance at a single selected frequency to sense and selectively electroporate unbound lymphocytes from PBMCs. Anti-CD14 bead-binding of monocytes increased the separation in impedance between the lymphocyte and monocyte populations allowing for negative lymphocyte selection with a cutoff threshold voltage of 2.2 V (FIG. 17A). Flow cytometry indicated that ~90% of the electroporated cells, indicated by propidium iodide uptake (PI)+, were lymphocytes (FIG.17B). 28 172332660v2011529.114558 (GTRC9086PCT)

[0162] This microfluidic device can be integrated into the larger cell manufacturing workflow to help meet the growing demand for cell-based therapies. By replacing costly viral vectors with electroporation, reducing the need for costly manual handling and cell sorting, and offering an alternative to gold standard flow cytometry-based immunophenotyping, this low- cost device can decentralize cell manufacturing to increase access to cell therapies.

[0163] It is to be understood that the embodiments and claims disclosed herein are not limited in their application to the details of construction and arrangement of the components set forth in the description and illustrated in the drawings. Rather, the description and the drawings provide examples of the embodiments envisioned. The embodiments and claims disclosed herein are further capable of other embodiments and of being practiced and carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein are for the purposes of description and should not be regarded as limiting the claims.

[0164] Accordingly, those skilled in the art will appreciate that the conception upon which the application and claims are based may be readily utilized as a basis for the design of other structures, methods, and systems for carrying out the several purposes of the embodiments and claims presented in this application. It is important, therefore, that the claims be regarded as including such equivalent constructions.

[0165] Furthermore, the purpose of the foregoing Abstract is to enable the United States Patent and Trademark Office and the public generally, and especially including the practitioners in the art who are not familiar with patent and legal terms or phraseology, to determine quickly from a cursory inspection the nature and essence of the technical disclosure of the application. The Abstract is neither intended to define the claims of the application, nor is it intended to be limiting to the scope of the claims in any way. 29 172332660v2

Claims

011529.114558 (GTRC9086PCT) CLAIMS What is claimed is:

1. A system for cell engineering, the system comprising: an aperture comprising: a sensing zone; and an electroporation zone; and at least one sensor disposed proximate the sensing zone, the sensor configured to: sense an electrical property of a cell in the sensing zone; and deliver electroporation energy to the cell based on the sensed electrical property of the cell.

2. The system of claim 1, wherein the aperture further comprises an inlet and an outlet, the sensing zone and the electroporation zone disposed between the inlet and the outlet, and wherein the aperture is configured to pass a fluid comprising a plurality of cells from the inlet, through the sensing zone and electroporation zone, and to the outlet.

3. The system of claim 2, wherein the sensing zone comprises a first end proximate the inlet having a first cross-sectional area and a second end having a second cross-sectional area, the second cross-sectional area less than the first cross-sectional area.

4. The system of claim 3, wherein the electroporation zone comprises a first end proximate the second end of the sensing zone having a third cross-sectional area and a second end proximate the outlet having a fourth cross-sectional area, the third cross-sectional area less than the fourth cross-sectional area.

5. The system of claim 1, wherein the sensor comprises a first electrode disposed proximate the inlet and a second electrode disposed proximate the outlet.

6. The system of claim 5, wherein the sensor further comprises a lock-in amplifier configured to simultaneously measure an impedance of the cell in the sensing zone at a plurality of frequencies.

7. The system of claim 1, wherein the sensor comprises a controller configured to: adjust a characteristic of the electroporation energy based at least in part on the electrical property; and prompt the electrode to deliver the electroporation energy to the cell responsive to the electrical property. 30 172332660v2011529.114558 (GTRC9086PCT) 8. The system of claim 7, wherein the characteristic of the electroporation energy is a voltage level.

9. The system of claim 8, wherein the electrical property is an impedance, and wherein the voltage level of the electroporation energy is proportional to the impedance.

10. The system of claim 1, wherein the electrical property is an impedance spectrum.

11. A method for cell engineering, the method comprising: sensing an electrical property of a cell; and applying electroporation energy to the cell responsive to the sensed electrical property.

12. The method of claim 11, further comprising flowing a fluid containing a plurality of cells through an aperture, the aperture comprising: an inlet configured to receive the fluid; an outlet configured to eject the fluid; a sensing zone disposed between the inlet and outlet, such that the fluid passes through the sensing zone; and an electroporation zone disposed between the inlet and outlet, such that the fluid passes through the electroporation zone.

13. The method of claim 12, wherein sensing the electrical property of the cell comprises: passing the cell through the sensing zone; and measuring an impedance across the sensing zone.

14. The method of claim 13, further comprising adjusting a characteristic of the electroporation energy based on the measured impedance.

15. The method of claim 14, wherein the characteristic of the electroporation energy is a magnitude of a voltage level.

16. The method of claim 12, wherein the sensing zone comprises a first end proximate the inlet having a first cross-sectional area and a second end having a second cross-sectional area, the second cross-sectional area less than the first cross-sectional area.

17. The method of claim 14, wherein the electroporation zone comprises a first end proximate the second end of the sensing zone having a third cross-sectional area and a second end proximate the outlet having a fourth cross-sectional area, the third cross-sectional area less than the fourth cross-sectional area. 31 172332660v2011529.114558 (GTRC9086PCT) 18. The method of claim 12, wherein sensing the electrical property of the cell is performed with a sensor comprising a first electrode disposed proximate the inlet and a second electrode disposed proximate the outlet.

19. The method of claim 16, wherein the sensor further comprises a lock-in amplifier configured to simultaneously measure an impedance of the cell in the sensing zone at a plurality of frequencies.

20. The method of claim 11, wherein the cell is bound to a microparticle.

21. The method of claim 20, wherein the microparticle alters the electrical property of the cell.

22. The method of claim 21, wherein the electrical property is an impedance spectrum.

23. The method of claim 22, wherein the microparticle increases a magnitude of the impedance spectrum of the cell.

24. The method of claim 20, wherein the microparticle can comprise an antibody. 32 172332660v2

Images