Recombinant vector for high expression of gene

Abstract

The present application relates to a DNA construct for high expression of a target gene in a microorganism of the genus Schizochytrium, and a method for expressing a target gene in a microorganism of the genus Schizochytrium using same. The DNA construct comprises a 5' homology arm and a 3' homology arm hybridizable with a high-expression site of a microbial genome of the genus Schizochytrium.

Description

Recombinant vector for high gene expression

[0001] Cross-citation with related applications

[0002] This application claims the benefit of priority from Republic of Korea Patent Application No. 10-2023-0079290, dated June 20, 2023, the entire contents of which are incorporated herein by reference.

[0003] The present application relates to a DNA structure for high expression of a target gene in a microorganism of the genus Schizochytrium and a method for expressing a target gene in a microorganism of the genus Schizochytrium using the same.

[0004]

[0005] Recent rapid advancements in synthetic biology and metabolic engineering have facilitated the development and optimization of microbial cell factories based on more sophisticated gene editing technologies. While these gene editing technologies are rapidly being applied to various microbial cell factories, efficient strain development based on these technologies has so far been limited to model organisms such as Escherichia coli, Corynebacterium, and yeast. Microalgae strain development technology is also lacking, with the exception of a few species considered model organisms. While some results have been reported on transduction of microalgal strains in the Schizochytrium family, breakthrough high-expression of introduced genes has yet to be reported.

[0006] If the expression level of the introduced gene is not guaranteed, the confirmation of phenotypic changes due to the introduced gene may be ambiguous due to insufficient gene expression. In addition, in the case of microalgae of the family Schizochytrium, genes are randomly inserted into any position throughout the microalgal genome when introduced, and in such cases, the expression level may differ for each transformant depending on the position of the introduced gene. The difference in expression level depending on the position of the gene inserted has been studied in various microorganisms such as Escherichia coli, yeast, and the microalga Nanochloropsis, and based on this, a strategy to successfully high-express the introduced gene through 'specific gene insertion into a high-gene expression position' has been reported (Bioresource Technology 340 (2021) 125676).

[0007] 'High gene expression' is essential for securing gene expression levels and reducing differences in gene expression levels between transformants during Schizochytrium strain development, enabling more stable expression of the introduced gene and accurate confirmation of phenotypic changes. Our research team transformed Schizochytrium microalgae with the green fluorescent protein gene and then analyzed the genome of the microalgal transformants that highly expressed green fluorescent protein to identify the insertion site of the green fluorescent protein gene in the transformants. In addition, they selected the identified gene site as the 'high gene expression site' and developed a vector composition that can specifically insert the gene into that site based on homologous recombination technology. Based on the vector composition, they ultimately developed a novel microalga that is differentiated from the parent strain through high expression of various microalgal genes.

[0008]

[0009] [Prior Art Literature]

[0010] (Non-patent Document 1) Ae Jin Ryu, Byeong-ryool Jeong, Nam Kyu Kang, Seungjib Jeon, Min Gi Sohn, Hyo Jin Yun, Jong Min Lim, Seok Won Jeong, Youn-Il Park, Won Joong Jeong, Sunghoon Park, Yong Keun Chang, Ki Jun Jeong, Safe-Harboring based novel genetic toolkit for Nannochloropsis salina CCMP1776: Efficient overexpression of transgene via CRISPR / Cas9-Mediated Knock-in at the transcriptional hotspot, Bioresource Technology, Volume 340, 2021, 125676, ISSN 0960-8524

[0011]

[0012] An example provides a DNA construct for high expression of a target gene in a Schizochytrium microorganism.

[0013] The above structure is for inserting the target gene into a target site in the genome of a microorganism of the genus Schizochytrium, and the target site may be a highly expressed site in the genome of a microorganism of the genus Schizochytrium.

[0014] More specifically, the DNA construct comprises a 5' homology arm, a target gene, and a 3' homology arm, and the 5' homology arm and the 3' homology arm may be capable of hybridizing to the 5' portion and the 3' portion of the target region (high-expression region), respectively.

[0015] In one example, the target region is a region corresponding to sequence number 1, sequence number 2, or a nucleic acid sequence having 95% or more homology thereto in the genome of a microorganism of the genus Schizochytrium.

[0016] The 5' homology arm is capable of hybridizing to a region within 20,000 bp upstream of the target gene insertion site within the target region, and / or

[0017] The above 3' homology arm is capable of hybridizing to a region within 20,000 bp downstream of the target gene insertion site within the target region.

[0018] It could be.

[0019] Another example provides a microorganism of the genus Schizochytrium comprising the above DNA structure.

[0020] Another example provides a composition for expression of a target gene and / or production of a target protein in a Schizochytrium microorganism, comprising the DNA construct, a Schizochytrium microorganism comprising the DNA construct, or a combination thereof.

[0021] Other examples provide uses of the DNA construct, a Schizochytrium microorganism comprising the DNA construct, or a combination thereof, for expression of a target gene in a Schizochytrium microorganism and / or for production of a target protein.

[0022] Another example provides a method for producing a microorganism of the genus Schizochytrium for use in expression of a target gene and / or production of a target protein, comprising the step of introducing the DNA construct into the microorganism of the genus Schizochytrium.

[0023] Another example provides a method for expressing a target gene and / or producing a target protein in a microorganism of the genus Schizochytrium, comprising the step of culturing a microorganism of the genus Schizochytrium comprising the above DNA structure.

[0024]

[0025] The present application provides a technology for highly expressing a target gene in a microorganism of the genus Schizochytrium and / or a technology for producing a target protein in a microorganism of the genus Schizochytrium by discovering a highly expressed region in the genome of a microorganism of the genus Schizochytrium and designing a DNA structure capable of introducing a target gene into the highly expressed region.

[0026]

[0027] Definition of terms

[0028] In the present application, the term “corresponding to” may refer to an amino acid sequence or nucleic acid sequence of a corresponding region identified by aligning the amino acid sequence or nucleic acid sequence of the polypeptide or polynucleotide with a specific amino acid sequence or nucleic acid sequence provided in the present application, in any polypeptide or polynucleotide. Such sequence alignment may be performed using a conventional sequence alignment method, and for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277), etc. may be used, but is not limited thereto, and a sequence alignment program known in the art, a pairwise sequence comparison algorithm, etc. may be appropriately used.

[0029] In the present application, the phrase “a polynucleotide or polypeptide comprises or consists of a specific nucleic acid sequence (base sequence) or amino acid sequence” may mean that the polynucleotide or polypeptide essentially comprises the specific nucleic acid sequence (base sequence) or amino acid sequence, and may be interpreted as including (or not excluding) a “substantially equivalent sequence” in which a mutation (deletion, substitution, modification, and / or addition) is added to the specific nucleic acid sequence (base sequence) or amino acid sequence to the extent that the original function and / or desired function of the polynucleotide or polypeptide is maintained. In one example, a polynucleotide or polypeptide “comprises or consists of a specific nucleic acid sequence (base sequence) or amino acid sequence” may mean that the polynucleotide or polypeptide (i) essentially comprises the specific nucleic acid sequence (base sequence) or amino acid sequence, or (ii) essentially comprises or consists of a nucleic acid sequence or amino acid sequence that has at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% homology or identity with the specific nucleic acid sequence (base sequence) or amino acid sequence, and maintains its original function and / or desired function. In one example, the desired function may refer to a high gene expression function in a microorganism of the genus Schizochytrium.

[0030] In this application, "homology" means the percentage of identity between two polynucleotides or polypeptide moieties. The sequence homology from one moiety to another moiety can be determined by known techniques. For example, homology can be determined by directly aligning sequence information and aligning parameters such as score, identity, and similarity between two polynucleotide molecules or two polypeptide molecules using readily available computer programs. The computer programs may be BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlign™ (DNASTAR Inc), etc. In addition, homology between polynucleotides can be determined by hybridizing polynucleotides under conditions that form a stable duplex between homologous regions, then digesting them with a single-strand-specific nuclease and determining the size of the digested fragments.

[0031] In this application, 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0032] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0033] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.

[0034] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0035] In this application, "polynucleotide" means a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the variant.

[0036] In the present application, the term "homologous arm (homologous arm or homology arm)" refers to a nucleic acid sequence used to insert a gene into a target site, and may refer to, for example, a nucleic acid sequence used for gene insertion by homologous recombination (HR). More specifically, the homology arm may refer to a sequence that can hybridize with the 5'-terminal (or left or upstream) region of the target nucleic acid sequence site (5' homology arm, left arm, or upstream arm) and / or a sequence that can hybridize with the 3'-terminal (or right or downstream) region (3' homology arm, right arm, or downstream arm)). The 5'-terminal (or left or upstream) region and the 3'-terminal (or right or downstream) region may refer to a region within about 100 kbp toward the 5'-terminal (or left or upstream) side of the target region and a region within about 100 kbp toward the 3'-terminal (or right or downstream) side, respectively, but are not limited thereto. The 5'-terminal (or left or upstream) arm and the 3'-terminal (or right or downstream) arm may each independently have a length of about 10 bp to about 5000 bp, but are not limited thereto.

[0037] In the present application, “capable of hybridization with or hybridizable with” a given nucleic acid sequence portion may mean a state in which a nucleic acid sequence can form a duplex with the nucleic acid sequence, including a sequence complementary to all or part of the nucleic acid sequence portion.

[0038] In the present application, when the term “hybridization” is used in relation to a homologous arm, it may be interpreted as having an equivalent meaning to “homologous recombination,” and the two terms may be used interchangeably.

[0039] In this application, the term “about” described before a numerical value may be used to comprehensively mean a numerical value in a range equal to or similar to the numerical value described later, and in one example, the equal to or similar range may mean a range of ±20%, ±15%, ±10%, ±5%, ±3%, ±2%, ±1%, etc. of the described numerical value, but is not limited thereto.

[0040]

[0041] Hereinafter, the present invention will be described in more detail.

[0042]

[0043] One example provides a DNA construct for inserting a gene of interest into a target site (high expression region) within the genome of a Schizochytrium microbial organism.

[0044] More specifically, the DNA construct may comprise a 5' homology arm, a gene of interest, and a 3' homology arm.

[0045] In other words, the DNA structure may have the following structure:

[0046] 5'-[X]-[Y]-[Z]-3' (Structural formula 1)

[0047] In the above formula, X represents the 5' homology arm, Y represents the target gene, and Z represents the 3' homology arm.

[0048] The above DNA construct may be for inserting the target gene into a target site in the genome of a microorganism of the genus Schizochytrium.

[0049] The above target site may be a highly expressed gene site within the genome of a microorganism of the genus Schizochytrium.

[0050] In one example, the target region may be a region corresponding to a nucleic acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% homology thereto in the genome of a microorganism of the genus Schizochytrium.

[0051] The sequence of the target region of the present application is listed in Table 1 below:

[0052]

[0053]

[0054]

[0055]

[0056] The 5' homology arm is within about 100,000 bp (e.g., about 1 bp to about 100,000 bp, about 1 bp to about 50,000 bp, about 1 bp to about 10,000 bp, about 1 bp to about 7,500 bp, about 1 bp to about 5,000 bp, about 1 bp to about 2,500 bp, about 1 bp to about 2,000 bp, about 1 bp to about 1,500 bp, about 1 bp to about 1,400 bp, about 1 bp to about 1,300 bp, about 1 bp to about It may be capable of hybridizing (homologous recombination) with all or part of a region of about 1,200 bp, about 1 bp to about 1,100 bp, about 1 bp to about 1,000 bp, about 1 bp to about 750 bp, or about 1 bp to about 500 bp (e.g., a portion having a length corresponding to the length of the homology arm and capable of hybridizing (homologous recombination) with the homology arm). The 5' homology arm may be about 10 bp to about 5,000 bp, about 10 bp to about 4,000 bp, about 10 bp to about 3,000 bp, about 10 bp to about 2,000 bp, about 10 bp to about 1,500 bp, about 10 bp to about 1,400 bp, about 10 bp to about 1,300 bp, about 10 bp to about 1,200 bp, about 10 bp to about 1,100 bp, about 10 bp to about 1,000 bp, about 20 bp to about 5,000 bp, about 20 bp to about 4,000 bp, about 20 bp to about 3,000 bp, about 20 bp to about 2,000 bp, about 20 bp to about 1,500 bp, about 20 bp to about 1,400 bp, about 20 bp to about 1,300 bp, about 20 bp to about 1,200 bp, about 20 bp to about 1,100 bp, about 20 bp to about 1,000 bp,About 23bp to about 5,000bp, about 23bp to about 4,000bp, about 23bp to about 3,000bp, about 23bp to about 2,000bp, about 23bp to about 1,500bp, about 23bp to about 1,400bp, about 23bp to about 1,300bp, about 23bp to about 1,200bp, about 23bp to about 1,100bp, about 23bp to about 1,000bp, about 100bp to about 5,000bp, about 100bp to about 4,000bp, about 100bp to about 3,000bp, about 100bp to about 2,000bp, about 100bp to about 1,500bp, about 100bp to about 1,400bp, about 100bp to about 1,300bp, about 100bp to about 1,200bp, about 100bp to about 1,100bp, about 100bp to about 1,000bp, about 250bp to about 5,000bp, about 250bp to about 4,000bp, about 250bp to about 3,000bp, about 250bp to about 2,000bp, about 250bp to about 1,500bp, about 250bp to about 1,400bp, about 250bp to about 1,300bp, about 250bp to about 1,200bp, about 250bp to about 1,100bp, about 250bp to about 1,000bp, about 500bp to about 5,000bp, about 500bp to about 4,000bp, about 500bp to about 3,000bp, about 500bp to about 2,000bp, about 500bp to about 1,500bp, about 500bp to about 1,400bp, about 500bp to about 1,300bp, about 500bp to about 1,200bp, about 500bp to about 1,100bp, about 500bp to about 1,000bp, about 750bp to about 5,000bp, about 750bp to about 4,000bp, about 750bp to about 3,000bp, about 750bp to about 2,000bp, about 750bp to about 1,500bp, about 750bp to about 1,400bp, about 750bp to about 1,300bp, about 750bp to about 1,200bp, about 750bp to about 1,100bp, about 750bp to about 1,000bp, about 900bp to about 5,000bp, about 900bp to about 4,000bp, about 900bp to about 3,000bp, about 900bp to about 2,000bp, about 900bp to about 1,500bp, about 900bp to about 1,400bp, about 900bp to about 1,300bp, about 900bp to about 1,200bp, about 900bp to about 1,100bp, or about It may have a size of, but is not limited to, 900 bp to about 1,000 bp.

[0057] In addition, the 3' homology arm is within about 100,000 bp (e.g., about 1 bp to about 100,000 bp, about 1 bp to about 50,000 bp, about 1 bp to about 10,000 bp, about 1 bp to about 7,500 bp, about 1 bp to about 5,000 bp, about 1 bp to about 2,500 bp, about 1 bp to about 2,000 bp, about 1 bp to about 1,500 bp, about 1 bp to about 1,400 bp, about 1 bp to about 1,300 bp, about 1 bp) in the 3' direction or downstream of the target site (high gene expression site; more specifically, based on the target gene insertion site within the target site (high gene expression site)). It may be capable of hybridizing with all or part of a region of about 1,200 bp, about 1 bp to about 1,100 bp, about 1 bp to about 1,000 bp, about 1 bp to about 750 bp, or about 1 bp to about 500 bp (e.g., a portion having a length corresponding to the length of the homology arm and hybridizing with the homology arm). The 3' homology arm is about 10 bp to about 5,000 bp, about 10 bp to about 4,000 bp, about 10 bp to about 3,000 bp, about 10 bp to about 2,000 bp, about 10 bp to about 1,500 bp, about 10 bp to about 1,400 bp, about 10 bp to about 1,300 bp, about 10 bp to about 1,200 bp, about 10 bp to about 1,100 bp, about 10 bp to about 1,000 bp, about 20 bp to about 5,000 bp, about 20 bp to about 4,000 bp, about 20 bp to about 3,000 bp, about 20 bp to about 2,000bp, about 20bp to about 1,500bp, about 20bp to about 1,400bp, about 20bp to about 1,300bp, about 20bp to about 1,200bp, about 20bp to about 1,100bp, about 20bp to about 1,000bp, about 23bp to about 5,000bp,About 23bp to about 4,000bp, about 23bp to about 3,000bp, about 23bp to about 2,000bp, about 23bp to about 1,500bp, about 23bp to about 1,400bp, about 23bp to about 1,300bp, about 23bp to about 1,200bp, about 23bp to about 1,100bp, about 23bp to about 1,000bp, about 100bp to about 5,000bp, about 100bp to about 4,000bp, about 100bp to about 3,000bp, about 100bp to about 2,000bp, about 100bp to about 1,500bp, About 100bp to about 1,400bp, about 100bp to about 1,300bp, about 100bp to about 1,200bp, about 100bp to about 1,100bp, about 100bp to about 1,000bp, about 250bp to about 5,000bp, about 250bp to about 4,000bp, about 250bp to about 3,000bp, about 250bp to about 2,000bp, about 250bp to about 1,500bp, about 250bp to about 1,400bp, about 250bp to about 1,300bp, about 250bp to about 1,200bp, about 250bp to about 1,100bp, about 250bp to about 1,000bp, about 500bp to about 5,000bp, about 500bp to about 4,000bp, about 500bp to about 3,000bp, about 500bp to about 2,000bp, about 500bp to about 1,500bp, about 500bp to about 1,400bp, about 500bp to about 1,300bp, about 500bp to about 1,200bp, about 500bp to about 1,100bp, about 500bp to about 1,000bp, about 750bp to about 5,000bp, about 750bp to about 4,000bp, about 750bp to about 3,000bp, about 750bp to about 2,000bp, about 750bp to about 1,500bp, about 750bp to about 1,400bp, about 750bp to about 1,A size of about 300 bp, about 750 bp to about 1,200 bp, about 750 bp to about 1,100 bp, about 750 bp to about 1,000 bp, about 900 bp to about 5,000 bp, about 900 bp to about 4,000 bp, about 900 bp to about 3,000 bp, about 900 bp to about 2,000 bp, about 900 bp to about 1,500 bp, about 900 bp to about 1,400 bp, about 900 bp to about 1,300 bp, about 900 bp to about 1,200 bp, about 900 bp to about 1,100 bp, or about 900 bp to about 1,000 bp May include, but is not limited to,

[0058] The insertion site of the target gene within the above target site (high gene expression site) may be any site included in the sequence of SEQ ID NO: 1 or SEQ ID NO: 2 described herein, and a person having ordinary skill in the art to which the present application pertains can appropriately set the insertion site of the target gene in consideration of the purpose, conditions, desired effects, etc. For example, a gene insertion site belonging to an intermediate position within the sequence of SEQ ID NO: 1 or SEQ ID NO: 2 (for example, within a position of 800 bp to 1200 bp in the 3' end starting from the 5' end) may be arbitrarily determined, and a vector including an upstream sequence (5' homology arm) and a downstream sequence (3' homology arm) based on the position may be constructed and used, but is not limited thereto.

[0059] The above target gene refers to a gene to be inserted into the genome of a microorganism of the genus Schizochytrium, and may be a gene to be expressed in a microorganism of the genus Schizochytrium and / or a coding gene for a protein (target protein) to be produced in a microorganism of the genus Schizochytrium. In the DNA construct provided in the present application, the number of target genes may be one or two or more (e.g., two, three, four, five, six, seven, eight, nine, or ten).

[0060] In one example, the target gene may be a coding gene for a target protein, a non-coding sequence such as a regulatory sequence (e.g., a transcription factor), or a combination thereof.

[0061] In one example, the target protein may mean any protein that can be usefully used in various industrial fields such as medicine, pharmaceuticals, food, cosmetics, agriculture, feed, and fertilizer. In one example, the target protein may be at least one selected from the group consisting of antibodies (e.g., mammalian (e.g., human) derived immunoglobulins (IgG (e.g., IgG1, IgG2, IgG3, IgG4, etc.), IgA, IgD, IgM, IgE, etc.)), antibody portions (e.g., heavy chain variable region and / or light chain variable region, heavy chain and / or light chain, Fc, CH3, CH2-CH3, hinge, etc.), antibody fragments (e.g., Fab fragments, F(ab)2 fragments, Fv, scFv, scFv-Fc, etc.), antibody analogs (e.g., multibodies comprising multiple antigen-binding domains (e.g., diabody, triabody, tetrabody, etc.), single domain antibodies, affibodies, etc.), receptors, growth factors, enzymes, hormones, transport (or efflux) proteins, fluorescent proteins, etc.), but It is not limited.

[0062] The target gene is, considering the genome size of the host cell (microorganism of the genus Schizochytrium), approximately 30 to 100,000 bp, 30 to 75,000 bp, 30 to 5,000 bp, 30 to 25,000 bp, 30 to 20,000 bp, 30 to 15,000 bp, 30 to 10,000 bp, 30 to 7,500 bp, 30 to 5,000 bp, 30 to 2,500 bp, 30 to 1,000 bp, 100 to 100,000 bp, 100 to 75,000 bp, 100 to 5,000 bp, 100 to 25,000 bp, 100 to It may have a size of, but is not limited to, 20,000 bp, 100 to 15,000 bp, 100 to 10,000 bp, 100 to 7,500 bp, 100 to 5,000 bp, 100 to 2,500 bp, or 100 to 1,000 bp.

[0063] In one example, the DNA construct may be an expression vector for expression of the target gene in a microorganism of the genus Schizochytrium.

[0064] In one example, when the target gene is a protein coding sequence, the DNA construct may further include at least one selected from the group consisting of expression regulatory sequences (transcription and / or translation regulatory elements), for example, a replication origin, a promoter, an enhancer, a polyadenylation signal, a terminator, a protein transport and / or degradation signal, etc. In this case, the regulatory element may be operatively (operably) linked to the target gene. In another example, the DNA construct may further include at least one selected from the group consisting of a selection marker, a reporter gene, etc., in order to confirm insertion into the genome.

[0065] The above selection marker is used to confirm whether the DNA structure is inserted into the genome of a microorganism of the genus Schizochytrium or to select a Schizochytrium strain into which the DNA structure is inserted, and can be appropriately selected and used among all selection markers available for selection of a Schizochytrium strain. For example, markers that confer selectable phenotypes such as drug (antibiotic) resistance, nutritional requirements (metabolism-related enzymes), resistance to cytotoxic agents, or expression of surface variant proteins can be used, but are not limited thereto. For example, the selection marker may be at least one selected from the group consisting of an ampicillin resistance gene, a tetracycline resistance gene, a kanamycin resistance gene, a chloroamphenicol resistance gene, a streptomycin resistance gene, a neomycin resistance gene, a blasticidin resistance gene, a zeocin resistance gene, a hygromycin resistance gene, a puromycin resistance gene, a paromomycin resistance gene, a thymidine kinase (TK) gene, a dihydrofolate reductase (DHFR) gene, a glutamine synthetase (GS) gene, and the like, but is not limited thereto. Examples of the reporter gene include, but are not limited to, one or more selected from the group consisting of fluorescent proteins such as green fluorescent protein (GFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), and luciferase.

[0066] Insertion of the above DNA structure into the genome of a microorganism of the genus Schizochytrium may be by one or more selected from the group consisting of, but not limited to, homologous recombination (e.g., homology directed repair (HDR)), non-homologous end joining (NHEJ), etc.

[0067]

[0068] The above DNA construct may be for transfer and / or insertion of the target gene into the genome of a microorganism of the genus Schizochytrium (e.g., into a high-expression region), and / or for expression of the target gene in the microorganism of the genus Schizochytrium.

[0069] In addition, as described above, the DNA construct can insert a target gene into a highly expressed region in the genome of a microorganism of the genus Schizochytrium, and thus can have the function of expressing (e.g., highly expressing) the target gene in the microorganism of the genus Schizochytrium or producing (e.g., producing at a high level) “a target protein encoded by the target gene and / or a metabolite (intermediate product and / or final product) of a metabolic pathway in which the target protein is involved” (hereinafter, “target product”).

[0070] Therefore, the above DNA structure is,

[0071] Transfer and / or insertion of the target gene into the genome of a Schizochytrium microbial organism (e.g., into the target site (high expression region)),

[0072] Expression of the target gene in a Schizochytrium microorganism,

[0073] Production of target products in microorganisms of the genus Schizochytrium,

[0074] or a combination of two or more of these

[0075] It may have the function of .

[0076]

[0077] Accordingly, another example provides a composition for insertion and / or delivery of a target gene into the genome of a Schizochytrium microorganism (e.g., into a target site (high expression region)), and / or a composition for expression of a target gene in said Schizochytrium microorganism, comprising the DNA construct described above.

[0078] Other examples provide uses of the DNA construct for insertion and / or transfer of a gene of interest within the genome of a microorganism of the genus Schizochytrium (e.g., within a target region (high expression region)), and / or for expression of a gene of interest in the microorganism of the genus Schizochytrium.

[0079] Other examples include a method for inserting and / or transferring a gene of interest into the genome of a Schizochytrium microorganism (e.g., into a target site (high expression region)), a method for expressing a gene of interest in the Schizochytrium microorganism, and / or a method for preparing a Schizochytrium microorganism for use in producing a product of interest, comprising introducing the DNA construct into the Schizochytrium microorganism.

[0080]

[0081] Another example provides a microorganism of the genus Schizochytrium comprising the DNA structure described above.

[0082] In the present application, the microorganism of the genus Schizochytrium may be at least one species selected from the group consisting of Schizochytrium limacinum, Schizochytrium mangrovei, Schizochytrium aggregatum, Schizochytrium minutum, etc., but is not limited thereto. More specifically, the microorganism of the genus Schizochytrium may be at least one species selected from the following strains, but is not limited thereto:

[0083] Schizochytrium sp. CD01-5000 (KCTC 14344BP),

[0084] Schizochytrium sp. CD01-5004 (KCTC 14345BP),

[0085] Schizochytrium sp. CD01-1821 (KCTC 14660BP),

[0086] Schizochytrium sp. CD01-2147 (KCTC 14661BP),

[0087] Schizochytrium sp. CD01-1003 (KCTC 15201BP),

[0088] Schizochytrium sp. CD02-8025 (KCTC 15246BP), and

[0089] Schizochytrium sp. CD03-7004 (KCTC 15006BP).

[0090]

[0091] A Schizochytrium microorganism comprising a DNA construct provided in the present application may have increased expression of a target gene included in the DNA construct and / or production of a target product related to the target gene (a target protein encoded by the target gene and / or a metabolite (intermediate product and / or final product) of a metabolic pathway in which the target protein is involved) compared to a Schizochytrium microorganism that does not include the DNA construct (e.g., a wild-type Schizochytrium microorganism and / or a Schizochytrium microorganism that includes the DNA construct at a site other than the target site).

[0092]

[0093] Another example provides a composition for producing a target product comprising the DNA construct described above, a microorganism of the genus Schizochytrium comprising the DNA construct, or a combination thereof.

[0094] Another example provides a use of the DNA construct, a Schizochytrium microorganism comprising the DNA construct, or a combination thereof, for producing a desired product.

[0095] Another example provides a method for producing a target product from a microorganism of the genus Schizochytrium, comprising a step of culturing a microorganism of the genus Schizochytrium comprising the DNA construct. The method may further comprise a step of preparing a microorganism of the genus Schizochytrium comprising the DNA construct prior to the culturing step.

[0096] The preparing step may include a step of producing or obtaining a microorganism of the genus Schizochytrium comprising the DNA construct. In one example, the preparing step of a microorganism of the genus Schizochytrium comprising the DNA construct may include a step of introducing the DNA construct into the microorganism of the genus Schizochytrium. In one example, when the introduction is by an endonuclease system specific for a target site, the step of introducing the DNA construct into the microorganism of the genus Schizochytrium may further include a step of introducing an endonuclease system specific for a target site into the microorganism of the genus Schizochytrium.

[0097] The above culturing step can be performed under typical conditions suitable for culturing Schizochytrium microorganisms and / or gene expression in Schizochytrium microorganisms. The above culturing means growing Schizochytrium microorganisms under suitably controlled environmental conditions. The above culturing can be performed according to suitable media and culture conditions for Schizochytrium microorganisms known in the art, and can be appropriately modified by a person skilled in the art. The culturing method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof. The above medium refers to a material mixed as a main component with nutrients required for culturing the Schizochytrium microorganism of the present application, and may be for supplying water essential for survival and growth, as well as nutrients and growth factors. Specifically, the above medium and other culture conditions can be applied without any special limitation as long as they are the medium and culture conditions commonly used for the culture of microorganisms of the genus Schizochytrium. However, in one example, the culture can be performed while controlling temperature, pH, humidity, atmospheric conditions, etc. in a common medium containing carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids, and / or vitamins suitable for the culture of microorganisms of the genus Schizochytrium.

[0098] The method for producing the above target product may further include, after the culturing step, a step of isolating, recovering, and / or purifying the target product. The separation, recovery, and / or purification may be performed under conditions typical for microorganisms of the genus Schizochytrium.

[0099]

[0100] The novel vector composition of the present invention comprises sequences homologous within +20 kbp and -20 kbp of a high-expression locus of a gene discovered in a Schizochytrium strain. The vector for high-expression of a gene comprises a left-side homologous sequence and a right-side homologous sequence, respectively, of the high-expression locus, and comprises a promoter, target gene, and terminator for high-expression of the gene between the two sequences. The vector for high-expression of a gene utilizing such a high-expression locus of a gene will contribute to the expansion of Schizochytrium-based gene expression technology and the acceleration of strain development.

[0101]

[0102] Figure 1 is a graph showing the results of fluorescence analysis of a Schizochytrium green fluorescent protein transformant.

[0103] Figure 2 is a gel electrophoresis image showing the results of PCR performed to confirm whether homologous recombination occurred at each high gene expression location.

[0104] Figure 3 is a graph showing the results of comparing the fluorescence intensity of transformants in which a green fluorescent protein gene was inserted into a high-gene expression site (Site 1) based on homologous recombination.

[0105] Figure 4 is a graph showing the results of comparing the fluorescence intensity of transformants in which a green fluorescent protein gene was inserted into a high-gene expression site (Site 2) based on homologous recombination.

[0106] Figure 5 is a cleavage map of pUC19-sfGFP-Zeo.

[0107] Figure 6 is a cleavage map of pUC19-HR(site1)-GsfGFPZeoG-HR(site1).

[0108]

[0109] Hereinafter, this application will be described in more detail through examples and experimental examples. However, these examples and experimental examples are intended to exemplify this application and the scope of this application is not limited to these examples and experimental examples.

[0110]

[0111] Example 1. Securing high-expression sites of Schizochytrium microalgae genes

[0112] To identify the site of high gene expression in Schizochytrium microalgae, a gene encoding green fluorescent protein was inserted into pUC19 (Plasmid #50005, Addgene) to produce a vector composition (pUC19-sfGFP-Zeo) expressing green fluorescent protein (see Fig. 5), which was then transformed into microalgae.

[0113] The nucleic acid sequence (SEQ ID NO: 3) of the green fluorescent protein (GFP) coding gene is as follows:

[0114] cgtgggggcgggagttcgccctgcgcgacccggccggcaactgcgtgcacttcgtggccgaggagcaggac

[0115]

[0116] ​A 250 mL flask was filled with 50 mL of GYPS medium (Glucose 20 g / L, Peptone 6 g / L, Yeast extract 2 g / L, Sea Salt 12.5 g / L, Sucrose 17.1 g / L), and the microalgae Schizochytrium sp. CD01-2147 (KCTC 14661BP) was inoculated and cultured for 48 hours. The cultured microalgae were transferred to two EP tubes (1 mL each), and centrifuged for 1 minute. After removing the supernatant of the centrifuged microalgae culture, the separated microalgae sediment was dissolved in 1X BSS solution (10 mM KCl, 10 mM NaCl, and 3 mM CaCl2) and centrifuged. After removing the supernatant from the centrifuged sample, the microalgae sediment was dissolved in 50 mM sucrose and centrifuged. This process was repeated three times. After removing the supernatant, 0.1 mL of 50 mM sucrose was added to the microalgae sediment to dissolve it.

[0117] The prepared microalgae were transformed with the prepared green fluorescent protein expression vector (Fig. 5) by electroporation, and a total of 105 Schizochytrium transformants into which the green fluorescent protein gene was introduced were obtained. The transformants are transformants in which the green fluorescent protein gene is inserted into any genetic location, and may have different fluorescence expression levels.

[0118] To analyze the expression level of green fluorescent protein in the 105 tested transformants, the fluorescence intensity of each transformant was measured and compared. More specifically, a filter capable of detecting the 509 nm fluorescence emission wavelength of green fluorescent protein was set using a flow cytometer, and the fluorescence intensity emitted near the corresponding wavelength was measured for each transformant, and the results are shown in Figure 1.

[0119] Based on the above fluorescence intensity measurement results, the top six transformants showing high fluorescence intensity were selected.

[0120]

[0121] By analyzing the gene insertion sites of the top six transformants with high fluorescence expression levels, the high gene expression sites were finally identified.

[0122] To this end, through genetic analysis of the six transformants selected above, it was confirmed that the foreign gene (green fluorescent protein gene) was inserted into the same location, Contig 3, 2001468 (SEQ ID NO: 1) (HindIII, SCH_00001433, Similar to AIH: Aginatine deaminase (Arabidopsis thaliana)) (hereinafter, the high-expression location of the gene is designated as site 1), in five of the six transformants, and into Contig 3, 1116023 (SEQ ID NO: 2) (HindIII, SCH_00001298, Similar to cyc: Cytochrome C (Lampetra tridentata)) (hereinafter, the high-expression location of the gene is designated as site 2).

[0123]

[0124] Example 2. High expression of foreign genes through homologous recombination into high-expression loci of Schizochytrium microalgae genes.

[0125] The possibility of high gene expression using the high gene expression sites discovered in Example 1 was confirmed through transformation based on homologous recombination technology. The green fluorescent protein gene was inserted into Site 1 (SEQ ID NO: 1) and Site 2 (SEQ ID NO: 2) discovered in Example 1 using homologous recombination technology or random insertion.

[0126] The vector for the above homologous recombination was designed as follows: Based on the insertion site within the high gene expression site Site 1 or Site 2, a sequence with a length range of 800-1500 bp on each side was amplified to secure an arm sequence for homologous recombination.

[0127] The arm sequences typically used in this example are listed in Table 2:

[0128]

[0129]

[0130]

[0131]

[0132] In addition, the green fluorescent protein coding gene and the antibiotic resistance gene expression site and backbone were each amplified from the vector for random insertion used in Example 1 (pUC19-sfGFP-Zeo; Fig. 5). The amplified sequences were cloned using the Gibson assembly method (Gibson Assembly®; NEB) together with the arm sequences for homologous recombination amplified from Site 1 and Site 2, thereby obtaining homologous recombination vectors targeting Site 1 and Site 2, respectively. To illustrate the structure of the homologous recombination vector, the homologous recombination vector targeting Site 1 (pUC19-HR(site1)-GsfGFPZeoG-HR(site1)) is illustrated in Fig. 6.

[0133] The primer sequences used to construct the above homologous recombination vector are described below:

[0134] (Primer for amplifying green fluorescent protein coding gene or antibiotic resistance gene)

[0135] Forward primer: CCTCCTCTTCTGTTCGTGCAAGCATATGACGGTACCCTTGATCTTGTG (SEQ ID NO: 8)

[0136] Reverse primer: AGGGGCCATGTGGAGTTTCAGAATATTGGCATGCCTTGAAGC (SEQ ID NO: 9)

[0137]

[0138] (Backbone)

[0139] Forward primer: ATCATCATTGACACATCTAATGTTGTTAAGCTTGGCGTAATCATG (SEQ ID NO: 10)

[0140] Reverse primer: CCGGTTATGAGATCGGGCCTCGTGCACTGAGCTCGAATTCACTGG (SEQ ID NO: 11)

[0141]

[0142] To produce the above random insertion vector, the sequence from the promoter to the terminator was amplified through a PCR reaction from the vector (pUC1 9-sfGFP-Zeo) produced in Example 1.

[0143] Using the above-prepared vector and amplified PCR reaction product, transformation of Schizochytrium microalgae was performed based on electroporation, and transformants were obtained by screening on a medium containing antibiotic (zeocin).

[0144] Through genotypic and phenotypic analysis of homologous recombination transformants transformed with the vector for homologous recombination prepared above and random insertion transformants transformed with the vector for random insertion, the expression level (fluorescence intensity) according to the presence or absence of gene insertion into a high gene expression site was measured and compared (see Example 1).

[0145] Transformants were obtained by inserting green fluorescent protein into high-gene expression sites through homologous recombination, 30 types for each site, and polymerase chain reaction (PCR)-based genotyping was performed on a total of 60 transformants. One of the two oligomers for PCR was designed to selectively bind to the high-gene expression site, and the other to selectively bind to the inserted green fluorescent protein gene, and PCR was performed using the oligomer pair.

[0146] The Site 1 transformation verification primer sequences are as follows:

[0147] Forward primer: TTCCTTCTGAAGAAGGGTCGTTGGTCT (SEQ ID NO: 12)

[0148] Reverse primer: CCAGGAAAGGACTTGAGATG (SEQ ID NO: 13)

[0149] The Site 2 transformation verification primer sequences are as follows:

[0150] Forward primer: GAAAAGGACTTGTGCCTC (SEQ ID NO: 14)

[0151] Reverse primer: CCAGGAAAGGACTTGAGATG (SEQ ID NO: 15)

[0152] PCR reaction conditions are as follows:

[0153] Tm: 53℃, Cycle: 35, Taq polymerase used

[0154]

[0155] Through this PCR, a DNA fragment of approximately 1500 bp can be obtained when the green fluorescent protein gene is inserted into each high-expression site (Site 1 and Site 2) through homologous recombination.

[0156] The PCR results are shown in Fig. 2. As shown in Fig. 2, when homologous recombination-based transformation of green fluorescent protein was attempted at Site 1, it was confirmed that the gene was inserted into Site 1 based on homologous recombination in 2 (No. 1 and No. 7) out of a total of 30 transformants. In addition, for Site 2, it was confirmed that the gene was inserted into Site 1 based on homologous recombination in 11 (No. 2, 5, 6, 8, 13, 14, 16, 18, 19, 20, and 29) out of a total of 30 transformants.

[0157]

[0158] As described above, the green fluorescent protein expression levels of 30 transformants (60 in total) obtained for each high-gene expression site through homologous recombination attempts were measured and compared. The green fluorescent protein expression level was measured by inoculating each microalgae Schizochytrium transformant into 50 mL GYPS medium in a 250 mL flask, culturing for 48 hours, and observing the fluorescence intensity. For comparison, a wild-type (WT) strain without an inserted green fluorescent protein gene was used as a control.

[0159] The results obtained above are shown in Fig. 3 (fluorescence intensity of a transformant in which a green fluorescent protein gene was inserted into a high gene expression site (Site 1)) and Fig. 4 (fluorescence intensity of a transformant in which a green fluorescent protein gene was inserted into a high gene expression site (Site 2)).

[0160] As shown in Figure 3, the average fluorescence expression level (AU) of Site 1 gene high-expression site-based homologous recombination transformants 1 and 7 was 714.61, which was confirmed to be superior to the average fluorescence expression level (499.51) of 28 transformants in which genes were randomly inserted into other gene positions.

[0161] In addition, as shown in Fig. 4, the average fluorescence expression level (AU) of a total of 11 types of homologous recombination transformants based on the high expression location of the Site 2 gene was 841.54, which was confirmed to be superior to the average fluorescence expression level (657.05) of 19 transformants in which genes were randomly inserted into other gene locations.

[0162] In addition, when the transformants were sorted in descending order based on the fluorescence expression level, it was confirmed that the transformants in which the green fluorescent protein gene was specifically inserted into the high gene expression site (Site 1, Site 2) through homologous recombination had an overall superior fluorescence expression level.

[0163]

[0164] [Accession number]

[0165] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0166] Accession number: KCTC14344BP

[0167] Date of acceptance: 20201026

[0168]

[0169] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0170] Accession number: KCTC14345BP

[0171] Date of acceptance: 20201026

[0172]

[0173] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0174] Accession number: KCTC14660BP

[0175] Date of acceptance: 20210823

[0176]

[0177] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0178] Accession number: KCTC14661BP

[0179] Date of acceptance: 20210823

[0180]

[0181] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0182] Accession number: KCTC15201BP

[0183] Date of acceptance: 202211121

[0184]

[0185] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0186] Accession number: KCTC15246BP

[0187] Date of acceptance: 20221215

[0188]

[0189] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0190] Accession number: KCTC15006BP

[0191] Date of acceptance: 20220620

[0192]

[0193]

[0194]

[0195]

[0196]

[0197]

[0198]

Claims

A DNA structure comprising a 1.5' homology arm, a target gene, and a 3' homology arm, The above DNA structure is for inserting the target gene into a target site in the genome of a Schizochytrium microorganism, The above target region is a region corresponding to the sequence number 1, sequence number 2, or a nucleic acid sequence having 95% or more homology thereto in the genome of a microorganism of the genus Schizochytrium, The above 5' homology arm is capable of hybridizing to a region within 100,000 bp upstream of the target gene insertion site within the target region, The above 3' homology arm is capable of hybridizing to a region within 100,000 bp downstream of the target gene insertion site within the target region. DNA structure.

2. A DNA structure according to claim 1, wherein the 5' homology arm and the 3' homology arm each independently have a size of 20 to 5000 bp.

3. A DNA structure according to claim 1, wherein the 5' homology arm and the 3' homology arm each independently have a size of 500 to 2,000 bp.

4. A DNA structure according to claim 1, wherein the target gene has a size of 30 to 100,000 bp.

5. A DNA structure according to claim 1, further comprising at least one selected from the group consisting of an expression control sequence, a selection marker, and a reporter gene.

6. A DNA structure according to claim 1, wherein the insertion is by at least one selected from the group consisting of homologous recombination (e.g., homology directed repair (HDR)) and non-homologous end joining (NHEJ).

7. A DNA structure according to any one of claims 1 to 6, wherein the microorganism of the genus Schizochytrium is at least one species selected from the group consisting of Schizochytrium limacinum, Schizochytrium mangrovei, Schizochytrium aggregatum, and Schizochytrium minutum.

8. In any one of paragraphs 1 to 6, the DNA structure is Transfer of the target gene into the genome of the above-mentioned Schizochytrium microbial species, Expression of the target gene in the above-mentioned Schizochytrium microorganism, or All of these DNA structure for .

9. A composition for expression of a target gene in a microorganism of the genus Schizochytrium, comprising a DNA structure of any one of claims 1 to 6.

10. A microorganism of the genus Schizochytrium comprising a DNA structure according to any one of claims 1 to 6.

11. In the 10th paragraph, the Schizochytrium microorganism is at least one species selected from the group consisting of Schizochytrium limacinum, Schizochytrium mangrovei, Schizochytrium aggregatum, and Schizochytrium minutum.

12. A composition for producing a target product, comprising a DNA structure of any one of claims 1 to 6, a microorganism of the genus Schizochytrium comprising the DNA structure, or a combination thereof.

13. A method for producing a microorganism of the genus Schizochytrium for use in producing a target product, comprising the step of introducing a DNA structure of any one of claims 1 to 6 into a microorganism of the genus Schizochytrium.

14. A method for producing a microorganism of the genus Schizochytrium for use in producing a target product, wherein the microorganism of the genus Schizochytrium in paragraph 13 is at least one species selected from the group consisting of Schizochytrium limacinum, Schizochytrium mangrovei, Schizochytrium aggregatum, and Schizochytrium minutum.

15. A step of culturing a microorganism of the genus Schizochytrium containing a DNA structure of any one of claims 1 to 6. A method for producing a target product from a microorganism of the genus Schizochytrium, comprising:

16. A method for producing a target product in a microorganism of the genus Schizochytrium, further comprising, prior to the culturing step, a step of preparing a microorganism of the genus Schizochytrium containing the DNA structure.

17. A method for producing a target product in a Schizochytrium microorganism, wherein the step of preparing a Schizochytrium microorganism containing the DNA structure in paragraph 16 includes a step of introducing the DNA structure into the Schizochytrium microorganism.

18. A method for producing a target product from a microorganism of the genus Schizochytrium, wherein the microorganism of the genus Schizochytrium is at least one species selected from the group consisting of Schizochytrium limacinum, Schizochytrium mangrovei, Schizochytrium aggregatum, and Schizochytrium minutum.

Images