Primers for the detection and quantification of sexually transmitted pathogens and a multiplex real-time PCR testing kit for the same purpose

Abstract

The present application relates a set of primers for the detection and quantification of sexually transmitted pathogens, which are a set of 28 forward and reverse sequences that are specific for several pathogens associated with sexually transmitted infections. Herein is also disclosed a multiplex real-time PCR testing kit suitable to be used as a syndromic panel for the detection and quantification of sexually transmitted pathogens.

Description

PRIMERS FOR THE DETECTION AND QUANTIFICATION OF SEXUALLY TRANSMITTED PATHOGENS AND A MULTIPLEX REAL-TIME PCR TESTING KIT FOR THE SAME PURPOSE

[0001] This application relates to primers for the detection and quantification of sexually transmitted pathogens and a multiplex real-time PCR testing kit for the detection and quantification of sexually transmitted disease pathogens.

[0002] Many infectious diseases remain serious health issues and are responsible for high morbidity and mortality worldwide. More than one million sexually transmitted infections (STIs) are acquired each day worldwide, most of which are asymptomatic. The most common symptoms involved vaginal and urethral discharge or burning in men, genital ulcers and abdominal pain. Each year, there are an estimated 374 million new infections and novel agents have emerged, as is the case withChlamydia trachomatis(serovar L) or Monkeypox virus. Efforts to contain the spread of STIs recommended by health authorities, such as the WHO, and those already implemented by several countries, have proved to be insufficient. Health services that provide STIs screening and treatment face numerous problems, in particular low diagnostic laboratory standards, lack of specific and sensitive diagnostic tools, low follow-up rates of cases and their sexual partners.

[0003] Diagnosis of STIs is widely available in developed countries as opposed to underdeveloped countries, where tests are expensive and largely inaccessible.

[0004] Given the current challenges regarding the detection of these pathogens, because they often cause asymptomatic infections, the development of fast, highly accurate, cost-effective, and lab-friendly diagnostic tools are essential for an early detection to guide effective treatment, also preventing reproductive sequelae.

[0005] Syndromic panels are molecular tests that can detect more than one pathogen associated with similar and overlapping clinical manifestations, enabling better patient management. Syndromic panels offer a solution of simplicity, sensitivity, and specificity, with panel size ranging from a few to dozens of pathogens that can be detected simultaneously. Panels need to be carefully designed to incorporate the most appropriate targets to fit differences in patient populations, pathogen prevalence, and clinical management protocols. Furthermore,Neisseria gonorrhoeae,C. trachomatis, among others pathogens, not only cause similar clinical syndromes, but can also coexist in many patients, highlighting the need for panel testing.

[0006] Methods using PCR as tools to detect DNA and RNA molecules have been highlighted in terms of accuracy. However, PCR methods sometimes gives false-positive results associated with non-specific annealing of primers, in particular the conventional PCR that produce much more false-positive results. In this way, multiplex real-time PCR amplification is conducted for detecting simultaneously pathogens and is more accurate.

[0007] There are many different protocols and kits for specific sample types currently available on the market.

[0008] Document WO2018158618A1 discloses a kit for detecting silent sexually transmitted diseases (sstds) in a urine sample. This invention claims the simultaneous detection of 7 STD-causing pathogens comprising 8 probes, and 14 primers based on multiplex real time PCR to detect herpes virus type 1, herpes virus type 2,Chlamydia trachomatis, Ureaplasma urealitycum, Mycoplasma hominis, Mycoplasma genitalium, and Human papillomavirus(HPV).

[0009] Document US20160017442A1 discloses a multiplex Real Time PCR Testing Kit for the simultaneous detection of Hepatitis Virus. This invention claims the detection of Hepatitis B virus and Hepatitis C virus in a blood sample, comprising probes and primers based on multiplex real time PCR.

[0010] Document US20090280486A1 discloses oligonucleotides for Detecting Nucleic Acids of Pathogen Causing Sexually Transmitted Diseases. This invention claims the detection of 12 STD-causing pathogens comprising primers based on multiplex real time PCR to detectMycoplasma hominis, Ureaplasma urealyticum, Neisseria gonorrhoeae, Chlamydia trachomatis, Herpes simplex virus 1 or 2, Candida albicans, Haemophilus ducreyi, Trichomonas vaginalis, Mycoplasma genitalium, Treponema pallidumandGardnerella vaginalis.

[0011] The AnyplexTM II STI-7 Detection kit (Seegene, Korea) exhibited high sensitivity in the detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma urealyticum, Ureaplasma parvum, and Trichomonas vaginalis in urine, liquid-based cytology and swab samples (urethral, vaginal and cervical).

[0012] The Real-Q STIs Kit assay can simultaneously detect six STD pathogens. It showed 100% sensitivity and specificity in the detection ofMycoplasma hominis, Mycoplasma genitalium, Chlamydia trachomatis, Trichomonas vaginalis,andNeisseria gonorrhoeae, and 94.1% sensitivity and 100% specificity in the detection ofUreaplasma urealyticum.

[0013] The FTD STD9 kit had high sensitivity and specificity for in detecting seven pathogens, including Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma urealyticum / Ureaplasma parvum, Trichomonas vaginalis, and HSV-1 / 2 from urine samples and genital or rectal swabs of human origin.

[0014] The present application relates to a primer for the detection and quantification of sexually transmitted pathogens in a biological sample selected from at least one of the following:

[0015] a) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:1 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:1, wherein said nucleotide of SEQID NO:1 represents forward primer to amplifyMycoplasma genitalium;

[0016] b) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:2 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:2, wherein said nucleotide of SEQID NO:2 represents reverse primer to amplifyMycoplasma genitalium;

[0017] c) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:3 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:3, wherein said nucleotide of SEQID NO:3 represents forward primer to amplifyNeisseria gonorrhoeae;

[0018] d) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:4 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:4, wherein said nucleotide of SEQID NO:4 represents reverse primer to amplifyNeisseria gonorrhoeae;

[0019] e) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:5 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:5, wherein said nucleotide of SEQID NO:5 represents forward primer to amplifyTrichomonas vaginalis;

[0020] f) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:6 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:6, wherein said nucleotide of SEQID NO:6 represents reverse primer to amplifyTrichomonas vaginalis;

[0021] g) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:7 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:7, wherein said nucleotide of SEQID NO:7 represents forward primer to amplifyChlamydia trachomatis,A – K strains;

[0022] h) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:8 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:8, wherein said nucleotide of SEQID NO:8 represents reverse primer to amplifyChlamydia trachomatis,A – K strains;

[0023] i) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:9 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:9, wherein said nucleotide of SEQID NO:9 represents forward primer to amplifyChlamydia trachomatis,serovar L;

[0024] j) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:10 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:10, wherein said nucleotide of SEQID NO:10 represents reverse primer to amplifyChlamydia trachomatis,serovar L;

[0025] k) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:11 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:11, wherein said nucleotide of SEQID NO:11 represents forward primer to amplifyTreponema pallidum;

[0026] l) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:12 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:12, wherein said nucleotide of SEQID NO:12 represents reverse primer to amplifyTreponema pallidum;

[0027] m) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:13 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:13, wherein said nucleotide of SEQID NO:13 represents forward primer to amplifyHaemophilus ducreyi;

[0028] n) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:14 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:14, wherein said nucleotide of SEQID NO:14 represents reverse primer to amplifyHaemophilus ducreyi;

[0029] o) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:15 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:15, wherein said nucleotide of SEQID NO:15 represents forward primer to amplifyHerpes simplex type 1;

[0030] p) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:16 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:16, wherein said nucleotide of SEQID NO:16 represents reverse primer to amplifyHerpes simplex type 1;

[0031] q) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:17 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:17, wherein said nucleotide of SEQID NO:17 represents forward primer to amplifyHerpes simplex type 2;

[0032] r) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:18 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:18, wherein said nucleotide of SEQID NO:18 represents reverse primer to amplifyHerpes simplex type 2;

[0033] s) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:19 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:19, wherein said nucleotide of SEQID NO:19 represents forward primer to amplifyCandida albicans;

[0034] t) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:20 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:20, wherein said nucleotide of SEQID NO:20 represents reverse primer to amplifyCandida albicans;

[0035] u) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:21 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:21, wherein said nucleotide of SEQID NO:21 represents forward primer to amplifyCandida glabrata;

[0036] v) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:22 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:22, wherein said nucleotide of SEQID NO:22 represents reverse primer to amplifyCandida glabrata;

[0037] w) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:23 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:23, wherein said nucleotide of SEQID NO:23 represents forward primer to amplifyCandida krusei;

[0038] x) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:24 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:24, wherein said nucleotide of SEQID NO:24 represents reverse primer to amplifyCandida krusei;

[0039] y) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:25 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:25, wherein said nucleotide of SEQID NO:25 represents forward primer to amplifyCandida tropicalis;

[0040] z) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:26 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:26, wherein said nucleotide of SEQID NO:26 represents reverse primer to amplifyCandida tropicalis;

[0041] aa) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:27 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:27, wherein said nucleotide of SEQID NO:27 represents forward primer to amplifyCandida parapsilosis;

[0042] bb) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:28 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:28, wherein said nucleotide of SEQID NO:28 represents reverse primer to amplifyCandida parapsilosis.

[0043] The invention also relates to a primer pair for the detection and quantification of sexually transmitted pathogens in a biological sample wherein each pair comprises:

[0044] - each of the sequence SEQID NO:1 and SEQID NO:2, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0045] - each of the sequence SEQID NO:3 and SEQID NO:4, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0046] - each of the sequence SEQID NO:5 and SEQID NO:6, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0047] - each of the sequence SEQID NO:7 and SEQID NO:8, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0048] - each of the sequence SEQID NO:9 and SEQID NO:10, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0049] - each of the sequence SEQID NO:11 and SEQID NO:12, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0050] - each of the sequence SEQID NO:13 and SEQID NO:14, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0051] - each of the sequence SEQID NO:15 and SEQID NO:16, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0052] - each of the sequence SEQID NO:17 and SEQID NO:18, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0053] - each of the sequence SEQID NO:19 and SEQID NO:20, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0054] - each of the sequence SEQID NO:21 and SEQID NO:22, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0055] - each of the sequence SEQID NO:23 and SEQID NO:24, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0056] - each of the sequence SEQID NO:25 and SEQID NO:26, or a part of it or a nucleotide having 90% sequence identity with said sequences; or

[0057] - each of the sequence SEQID NO:27 and SEQID NO:28, or a part of it or a nucleotide having 90% sequence identity with said sequences.

[0058] The invention also relates to a reaction mixture for multiplex real-time PCR for the detection and quantification of sexually transmitted pathogens in a biological sample comprising:

[0059] - nuclease free water;

[0060] - reaction mixture for qPCR containing DNA polymerase;

[0061] - at least one primer sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 as described in claim 1 or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or

[0062] - at least one primer pair sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 as described in claim 3 or a part of it or a nucleotide having 90% sequence identity with said selected sequence;

[0063] - Internal control gene.

[0064] In one embodiment, the internal control gene is at least one sequence selected from the list comprising sequences SEQID NO: 29 to SEQID NO:32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence.

[0065] In one embodiment, the internal control gene is a sequence pair selected from:

[0066] - a sequence pair selected from SEQID NO: 29 and SEQID NO: 30 or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or

[0067] - a sequence pair selected from sequences SEQID NO: 31 and SEQID NO: 32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence.

[0068] The invention also relates to a multiplex real-time PCR test kit for the detection and quantification of sexually transmitted pathogens in a biological sample, comprising:

[0069] - at least one primer sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 as described in claim 1 or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or

[0070] - at least one primer pair sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 as described in claim 3 or a part of it or a nucleotide having 90% sequence identity with said selected sequence;

[0071] - and an internal control gene.

[0072] In one embodiment, the internal control gene is at least one sequence selected from the list comprising sequences SEQID NO: 29 to SEQID NO:32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence.

[0073] In one embodiment, the internal control gene is a sequence pair selected from:

[0074] - a sequence pair selected from SEQID NO: 29 and SEQID NO: 30 or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or

[0075] - a sequence pair selected from sequences SEQID NO: 31 and SEQID NO: 32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence.

[0076] The invention also relates to a method for the detection and quantification of sexually transmitted pathogens in a biological sample comprising the steps of:

[0077] - Providing an isolated biological sample from a subject;

[0078] - Extracting a DNA or RNA sample from said biological sample;

[0079] - Amplifying the DNA or RNA sample by multiplex PCR using:

[0080] - at least one primer sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 described in claim 1 or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or

[0081] - at least one primer pair sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 as described in claim 3 or a part of it or a nucleotide having 90% sequence identity with said selected sequence;

[0082] - and an internal control gene;

[0083] - Detecting the presence or absence of at least one sexually transmitted pathogen.

[0084] In one embodiment, the internal control gene is selected from:

[0085] - at least one sequence selected from the list comprising sequences SEQID NO: 29 to SEQID NO:32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or

[0086] - a sequence pair selected from SEQID NO: 29 and SEQID NO: 30 or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or

[0087] - a sequence pair selected from sequences SEQID NO: 31 and SEQID NO: 32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence.

[0088] In one embodiment, the pathogens are selected from Mycoplasma genitalium, Neisseria gonorrhoeae, Trichomonas vaginalis, Chlamydia trachomatis: A – K strains, Chlamydia trachomatis: serovar L, Treponema pallidum, Haemophilus ducreyi, Herpes simplex type 1, Herpes simplex type 2, Monkeypox virus, Candida albicans, Candida glabrata, Candida krusei, Candida tropicalis or Candida parapsilosis.

[0089] In one embodiment, the biological sample is a non-invasive test sample selected from urine, genital or oropharynx exudates.

[0090] In one embodiment, the biological sample is genitourinary biopsy.General Description

[0091] The present invention describes oligonucleotides hybridizable with nucleic acids, i.e., primers, a PCR reaction mixture comprising at least one primer selected from a list, and a testing kit comprising at least one primer selected from a list for the detection and quantification of sexually transmitted pathogens based on multiplex real-time PCR, resulting in a novel test kit for clinical testing for sexually transmitted pathogens in a biological sample. It is also disclosed a method for detection and quantification of sexually transmitted pathogens in a biological sample.

[0092] The difference of the presently disclosed invention and the prior art is mainly in the target microorganisms which is much more comprehensive and clinically relevant, supporting its use as a syndromic diagnostic panel in a broader scope or targeting 2 or 3 specific organisms. Besides detecting and quantifyingChlamydia trachomatis, Trichomonas vaginalis, Neisseria gonorrhoeae, Haemophilus ducreyi, Mycoplasma genitalium, Treponema pallidum, Herpes simplex virus 1 or 2, andCandida albicans, it is also possible to distinguish the two major biovars ofC. trachomatis: A – K strains, and serovar L, and detect and quantify the Monkeypox virus and otherCandidaspecies, such asC. glabrata, C. krusei, C. tropicalis and C. parapsilosis.

[0093] The present invention is intended for the fast, automated and convenient diagnostic approach for prevention, and management of STD by screening microbiological risk factors.

[0094] Using novel and specific DNA primers, this invention detects and quantifies sexually transmitted pathogens present in multiple types of biological samples, such as in non-invasive (e.g., urine, genital and oropharynx exudates), and invasive test samples (e.g., genitourinary biopsies). These types of samples usually have a low load of microbial DNA, making the present invention a very sensitive and quantitative approach on sexually transmitted pathogens diagnostics.

[0095] Thus, this invention relates to primers for the detection and quantification of sexually transmitted pathogens and a multiplex real-time PCR testing kit suitable to be used as a syndromic panel for the detection and quantification of sexually transmitted pathogens.

[0096] This invention further relates to a reaction mixture, a testing kit and a method for the multiplex PCR which enables the detection and quantification of sexually transmitted pathogens.

[0097] The testing kit comprises the primers for the detection and quantification of sexually transmitted pathogens with a reaction mixture containing DNA polymerase and an internal control gene for checking the validity of the reaction. The kit advantageously helps in the detection and quantification of sexually transmitted pathogens, given the efficiency of the primers to detect samples with low copy number.

[0098] This invention allows for the single or simultaneous detection and quantification of sexually transmitted pathogens.

[0099] For easier understanding of this application, figures are attached in the annex that represent the preferred forms of implementation which nevertheless are not intended to limit the technique disclosed herein.Fig.1

[0100] shows some aligned sequences of the 16S rRNA gene ofM. genitaliumstrains (in grey). The forward and reverse primers are highlighted in the box.Fig.2

[0101] shows some aligned sequences of the act gene ofT. vaginalisstrains (in grey). The forward and reverse primers are highlighted in the box.Fig.3

[0102] shows the amplification curve for a clinical isolate ofM. genitaliumusing the primer set SEQID NO:1 and SEQID NO:2.Fig.4

[0103] shows the amplification curve for a clinical isolate ofN. gonorrhoeaeusing the primer set SEQID NO:3 and SEQID NO:4.Fig.5

[0104] shows the amplification curve for a clinical isolate ofC. trachomatis(A – K strains) using the primer set SEQID NO:7 and SEQID NO:8.Fig.6

[0105] shows the amplification curve for a clinical isolate ofC. trachomatis(serovar L) using the primer set SEQID NO:9 and SEQID NO:10. The figure denotes an amplification peak with a Tm = 88.58.

[0106] Now, preferred embodiments of the present application will be described in detail with reference to the annexed drawings. However, they are not intended to limit the scope of this application.

[0107] The present invention relates to a primer for the detection and quantification of sexually transmitted pathogens in a biological sample, to a reaction mixture comprising at least one primer selected from a list, a multiplex real-time PCR test kit for the detection and quantification of sexually transmitted pathogens comprising at least one primer, and a method for the detection and quantification of sexually transmitted pathogens in a biological sample.

[0108] Primer design

[0109] The sequences representing all sexually transmitted pathogens were downloaded from the GenBank nucleotide database and aligned using the online program Clustal Omega. A highly conserved region of each chosen genes was selected for the design of real-time PCR primers. The primer sequences for use in the present invention are mentioned in Table 1.

[0110] Table 1.Sequence IDPathogenPrimer nameOligonucleotide sequence 5’ – 3’Gene nameLengthProduct size (bp)SEQID NO:1M. genitaliumMg_FCTGAGACACGGCCCATACTC16S rRNA20156SEQID NO:2M. genitaliumMg_RTCTAGCAGGCAATGGCTGGA16S rRNA20SEQID NO:3N. gonorrhoeaeNg_FGGCGTGTTCAGCAAAGACTglnA19132SEQID NO:4N. gonorrhoeaeNg_RAAACCGTCGGGTTTCAGTAGglnA20SEQID NO:5T. vaginalisTv_FCATCACAATCGGCAATGAGCact20152SEQID NO:6T. vaginalisTv_RAGGATCTCTACGCTAACATCGact21SEQID NO:7C. trachomatisCt_FGCCATAACGCCGTGAATACG16S rRNA20127SEQID NO:8C. trachomatisCt_RCCAAGGTGAGGCTGATGAC16S rRNA19SEQID NO:9C. trachomatisLGV_FCCACTTGGTGTGACGCTATComp20112SEQID NO:10C. trachomatisLGV_RAAATGGGTGCCAAGCCTAComp19SEQID NO:11T. pallidumTp_FCGTTCGCAATCAAAGTCAGCtpp4720156SEQID NO:12T. pallidumTp_RCTCGCCATCAGATTGGTGTtpp4719SEQID NO:13H. ducreyiHd_FCGTGATAACGTGTATGGCTCpolA20164SEQID NO:14H. ducreyiHd_RTTGGTAATCCGGTGACACGpolA19SEQID NO:15Herpes simplex 1HSV1_FCGTTACTCCATGGGTCCGTglyC19178SEQID NO:16Herpes simplex 1HSV1_RCCGACCCTCCGTTGTATTCglyC19SEQID NO:17Herpes simplex 2HSV2_FGCCAACTGGTGTATGACAGCglyC19167SEQID NO:18Herpes simplex 2HSV2_RCCAGGGCATGTACTACTGGglyC19SEQID NO:19C. albicansCalb_FCTGACGCCCAAACTAAGGCCS119182SEQID NO:20C. albicansCalb_RGCTTATGCTAAAGGTGCCAACCS121SEQID NO:21C. glabrataCgla_FCGTGCTAGACCCTGAGGAACS119149SEQID NO:22C. glabrataCgla_RTGAAGTCCCAACCGAATCTCCS120SEQID NO:23C. kruseiCkru_FGTTTCTGCTCATACCACCCACS120120SEQID NO:24C. kruseiCkru_RAGAGCCAACCAAGAAGTTTTGCS121SEQID NO:25C. tropicalisCtro_FGAAGTTGCTCCAGGTGTCTTCS120163SEQID NO:26C. tropicalisCtro_RTTCGGTGTCTTGCCACAATCS119SEQID NO:27C. parapsilosisCpara_FGCTCCAGGTGTATTGACCAAACS121134SEQID NO:28C. parapsilosisCpara_RGTTTTGTTCGGTGTTGCCAGCS120SEQID NO:33MonkeypoxMpox_F----SEQID NO:34MonkeypoxMpox_R----

[0111] The present invention also aims to include at least one primer for the detection and quantification of Monkeypox defined as SEQID NO: 33 or SEQID NO: 34, or both.

[0112] A variety of internal control genes can be used in the context of the present invention as well. For example, Human β-actin gene is expressed at relatively constant levels and highly conserved that are involved in cell motility, structure, and integrity. Housekeeping gene is typically a constitutive gene that is required for the maintenance of basic cellular functions and expressed in all cells of an organism. The primers sequences for non-limitative examples of internal control genes are mentioned in Table 2.

[0113] Sequence IDInternal controlPrimer nameOligonucleotide sequence 5’ – 3’Gene nameLengthProduct size (bp)SEQID NO:29Human β-actinactin_FACAGAGCCTCGCCTTTGACTB17110SEQID NO:30Human β-actinactin_RCTCCGGCATGTGCAAGGACTB17SEQID NO:31glyceraldehyde-3-phosphate dehydrogenaseGAPDH_FGTCTCCTCTGACTTCAACAGCGGAPDH22131SEQID NO:32glyceraldehyde-3-phosphate dehydrogenaseGAPDH_RACCACCCTGTTGCTGTAGCCAAGAPDH22

[0114] Primer

[0115] Thus, the present invention relates to a primer for the detection and quantification of sexually transmitted pathogens in a biological sample selected from at least one of the following:

[0116] a) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:1 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:1, wherein said nucleotide of SEQID NO:1 represents forward primer to amplifyMycoplasma genitalium;

[0117] b) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:2 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:2, wherein said nucleotide of SEQID NO:2 represents reverse primer to amplifyMycoplasma genitalium;

[0118] c) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:3 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:3, wherein said nucleotide of SEQID NO:3 represents forward primer to amplifyNeisseria gonorrhoeae;

[0119] d) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:4 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:4, wherein said nucleotide of SEQID NO:4 represents reverse primer to amplifyNeisseria gonorrhoeae;

[0120] e) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:5 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:5, wherein said nucleotide of SEQID NO:5 represents forward primer to amplifyTrichomonas vaginalis;

[0121] f) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:6 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:6, wherein said nucleotide of SEQID NO:6 represents reverse primer to amplifyTrichomonas vaginalis;

[0122] g) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:7 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:7, wherein said nucleotide of SEQID NO:7 represents forward primer to amplifyChlamydia trachomatis(A – K strains);

[0123] h) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:8 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:8, wherein said nucleotide of SEQID NO:8 represents reverse primer to amplifyChlamydia trachomatis(A – K strains);

[0124] i) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:9 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:9, wherein said nucleotide of SEQID NO:9 represents forward primer to amplifyChlamydia trachomatis(serovar L);

[0125] j) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:10 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:10, wherein said nucleotide of SEQID NO:10 represents reverse primer to amplifyChlamydia trachomatis(serovar L);

[0126] k) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:11 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:11, wherein said nucleotide of SEQID NO:11 represents forward primer to amplifyTreponema pallidum;

[0127] l) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:12 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:12, wherein said nucleotide of SEQID NO:12 represents reverse primer to amplifyTreponema pallidum;

[0128] m) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:13 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:13, wherein said nucleotide of SEQID NO:13 represents forward primer to amplifyHaemophilus ducreyi;

[0129] n) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:14 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:14, wherein said nucleotide of SEQID NO:14 represents reverse primer to amplifyHaemophilus ducreyi;

[0130] o) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:15 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:15, wherein said nucleotide of SEQID NO:15 represents forward primer to amplifyHerpes simplex type 1;

[0131] p) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:16 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:16, wherein said nucleotide of SEQID NO:16 represents reverse primer to amplifyHerpes simplex type 1;

[0132] q) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:17 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:17, wherein said nucleotide of SEQID NO:17 represents forward primer to amplifyHerpes simplex type 2;

[0133] r) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:18 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:18, wherein said nucleotide of SEQID NO:18 represents reverse primer to amplifyHerpes simplex type 2;

[0134] s) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:19 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:19, wherein said nucleotide of SEQID NO:19 represents forward primer to amplifyCandida albicans;

[0135] t) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:20 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:20, wherein said nucleotide of SEQID NO:20 represents reverse primer to amplifyCandida albicans;

[0136] u) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:21 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:21, wherein said nucleotide of SEQID NO:21 represents forward primer to amplifyCandida glabrata;

[0137] v) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:22 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:22, wherein said nucleotide of SEQID NO:22 represents reverse primer to amplifyCandida glabrata;

[0138] w) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:23 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:23, wherein said nucleotide of SEQID NO:23 represents forward primer to amplifyCandida krusei;

[0139] x) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:24 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:24, wherein said nucleotide of SEQID NO:24 represents reverse primer to amplifyCandida krusei;

[0140] y) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:25 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:25, wherein said nucleotide of SEQID NO:25 represents forward primer to amplifyCandida tropicalis;

[0141] z) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:26 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:26, wherein said nucleotide of SEQID NO:26 represents reverse primer to amplifyCandida tropicalis;

[0142] aa) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:27 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:27, wherein said nucleotide of SEQID NO:27 represents forward primer to amplifyCandida parapsilosis;

[0143] bb) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:28 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:28, wherein said nucleotide of SEQID NO:28 represents reverse primer to amplifyCandida parapsilosis;

[0144] cc) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:33 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:33, wherein said nucleotide of SEQID NO:33 represents forward primer to amplifyMonkeypox virus;

[0145] dd) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:34 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:34, wherein said nucleotide of SEQID NO:34 represents reverse primer to amplifyMonkeypox virus.

[0146] Primer pair

[0147] Also disclosed is a primer pair for the detection and quantification of sexually transmitted pathogens in a biological sample wherein each pair comprises:

[0148] - each of the sequence SEQID NO:1 and SEQID NO:2, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0149] - each of the sequence SEQID NO:3 and SEQID NO:4, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0150] - each of the sequence SEQID NO:5 and SEQID NO:6, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0151] - each of the sequence SEQID NO:7 and SEQID NO:8, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0152] - each of the sequence SEQID NO:9 and SEQID NO:10, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0153] - each of the sequence SEQID NO:11 and SEQID NO:12, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0154] - each of the sequence SEQID NO:13 and SEQID NO:14, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0155] - each of the sequence SEQID NO:15 and SEQID NO:16, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0156] - each of the sequence SEQID NO:17 and SEQID NO:18, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0157] - each of the sequence SEQID NO:19 and SEQID NO:20, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0158] - each of the sequence SEQID NO:21 and SEQID NO:22, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0159] - each of the sequence SEQID NO:23 and SEQID NO:24, or a part of it or a nucleotide having 90% sequence identity with said sequences;

[0160] - each of the sequence SEQID NO:25 and SEQID NO:26, or a part of it or a nucleotide having 90% sequence identity with said sequences; or

[0161] - each of the sequence SEQID NO:27 and SEQID NO:28, or a part of it or a nucleotide having 90% sequence identity with said sequences.

[0162] Reaction mixture for multiplex real-time PCR

[0163] The present invention also relates to reaction mixture for multiplex real-time PCR for the detection and quantification of sexually transmitted pathogens in a biological sample comprising:

[0164] - nuclease free water;

[0165] - reaction mixture for qPCR containing DNA polymerase;

[0166] - at least one primer sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 as described above, or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or

[0167] - at least one primer pair sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 as described above, or a part of it or a nucleotide having 90% sequence identity with said selected sequence;

[0168] - Internal control gene.

[0169] In one embodiment, the reaction mixture comprises all sequences SEQID NO: 1 to SEQID NO:28, or a part of them or a nucleotide having 90% sequence identity with said sequences.

[0170] In one embodiment, the internal control gene is at least one sequence selected from the list comprising sequences SEQID NO: 29 to SEQID NO:32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence.

[0171] In one embodiment, the internal control gene is a sequence pair selected from:

[0172] - a sequence pair selected from SEQID NO: 29 and SEQID NO: 30, or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or

[0173] - a sequence pair selected from sequences SEQID NO: 31 and SEQID NO: 32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence.

[0174] Multiplex real-time PCR test kit

[0175] Moreover, the present invention also relates to a multiplex real-time PCR test kit for the detection and quantification of sexually transmitted pathogens in a biological sample, comprising:

[0176] - at least one primer sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 as described above, or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or

[0177] - at least one primer pair sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 as described above, or a part of it or a nucleotide having 90% sequence identity with said selected sequence;

[0178] - and an internal control gene.

[0179] In one embodiment, the kit comprises all the primer sequences SEQID NO: 1 to SEQID NO:28, or a part of them or a nucleotide having 90% sequence identity with said sequences.

[0180] In one embodiment, the internal control gene is at least one sequence selected from the list comprising sequences SEQID NO: 29 to SEQID NO:32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence.

[0181] In one embodiment, the internal control gene is a sequence pair selected from:

[0182] - a sequence pair selected from SEQID NO: 29 and SEQID NO: 30, or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or

[0183] - a sequence pair selected from sequences SEQID NO: 31 and SEQID NO: 32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence.

[0184] Method for the detection and quantification of sexually transmitted pathogens

[0185] Additionally, is also provided a method for the detection and quantification of sexually transmitted pathogens in a biological sample comprising the steps of:

[0186] - Providing an isolated biological sample from a subject;

[0187] - Extracting a DNA or RNA sample from said biological sample;

[0188] - Amplifying the DNA or RNA sample by multiplex PCR using:

[0189] - at least one primer sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 described above, or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or

[0190] - at least one primer pair sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 as described above, or a part of it or a nucleotide having 90% sequence identity with said selected sequence;

[0191] - and an internal control gene;

[0192] - Detecting the presence or absence of at least one sexually transmitted pathogen.

[0193] In one embodiment, the internal control gene is at least one sequence selected from the list comprising sequences SEQID NO: 29 to SEQID NO:32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence.

[0194] In one embodiment, the internal control gene is a sequence pair selected from:

[0195] - a sequence pair selected from SEQID NO: 29 and SEQID NO: 30, or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or

[0196] - a sequence pair selected from sequences SEQID NO: 31 and SEQID NO: 32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence.

[0197] In one embodiment, the listed primer sequences, the method, and testing kit are suitable to detect and quantify in a biological sample the presence of microbial DNA fromMycoplasma genitalium, Neisseria gonorrhoeae, Trichomonas vaginalis, Chlamydia trachomatis (A – K strains), Chlamydia trachomatis (serovar L), Treponema pallidum, Haemophilus ducreyi, Herpessimplex type 1, Herpes simplex type 2, Monkeypox virus, Candida albicans, Candida glabrata, Candida krusei, Candida tropicalisorCandida parapsilosis.

[0198] In one embodiment, the biological sample is a non-invasive test samples selected from, but not limited to, urine, genital or oropharynx exudates.

[0199] In another embodiment, the biological sample is an invasive test sample selected from, but not limited to, genitourinary biopsy.

[0200] The present invention for amplifying nucleic acids may be applied to the amplification of nucleic acids of any sexually transmitted pathogens. The nucleic acid as starting material is the DNA or RNA molecule. General methods for extracting DNA from a biological sample are available on the market and known in the art. Where a mRNA is employed as starting material sample, a reverse transcription step is necessary prior to performing annealing step.

[0201] A variety of DNA polymerases can be used in the amplification step of the present method. Preferably, the polymerase is a thermostable DNA polymerase which may be isolated from a variety of bacterial species or obtained commercially.

[0202] The amplification step of the present method can be done in a single reaction.

[0203] Annealing or hybridization in the present method is performed under strict conditions that allow for specific binding between the selected primer sequence and the template nucleic acid. Most preferably, the annealing temperature ranges from 60°C to 64° C.

[0204] The advantages of this invention are the disclosed primer sequences ensure to completely overcome problems of false-negative and false-positive products because of their higher specificity; and the present primers work in multiplex PCR, enabling to detect and quantify various sexually transmitted pathogens in a single PCR reaction.Examples

[0205] 1. Primers design

[0206] Conserved sequences were discovered by comparing the nucleotide sequences of isolates or strains in a target pathogen species. The conserved sequences were specific in the target pathogen species and distinctly different from other pathogen species.

[0207] Example 1.1.

[0208] In the selected sequence of the 16S rRNA gene ofM. genitalium(), a suitable sequence to prepare primers of this invention was determined. Forward and reverse primers highlighted in the box were designed using the determined sequence. Sequences in grey representM. genitaliumstrains.

[0209] Example 1.2.

[0210] In the selected sequence of the act gene ofT. vaginalis(), a suitable sequence to prepare primers of this invention was determined. Forward and reverse primers highlighted in the box were designed using the determined sequence. Sequences in grey representT. vaginalisstrains.

[0211] 2. Primers test withDNA strains (individually)

[0212] The designed primers were tested (individually) with DNA strains from local isolates and reference type strains from American Type Culture Collection (ATCC).

[0213] Example 2.1.

[0214] represents the results of qPCR for a clinical isolate ofM. genitaliumusing the primer set SEQID NO:1 and SEQID NO:2. The figure denotes an amplification peak with a Tm = 83.36.

[0215] Example 2.2.

[0216] represents the results of qPCR for a clinical isolate ofN. gonorrhoeaeusing the primer set SEQID NO:3 and SEQID NO:4. The figure denotes an amplification peak with a Tm = 84.71.

[0217] Example 2.3.

[0218] represents the results of qPCR for a clinical isolate ofC. trachomatis(A – K strains) using the primer set SEQID NO:7 and SEQID NO:8. The figure denotes an amplification peak with a Tm = 90.06.

[0219] Example 2.4.

[0220] represents the results of qPCR for a clinical isolate of C. trachomatis (serovar L) using the primer set SEQID NO:9 and SEQID NO:10. The figure denotes an amplification peak with a Tm = 88.58.

[0221] This description is of course not in any way restricted to the forms of implementation presented herein and any person with an average knowledge of the area can provide many possibilities for modification thereof without departing from the general idea as defined by the claims. The preferred forms of implementation described above can obviously be combined with each other. The following claims further define the preferred forms of implementation.

Claims

A primer for the detection and quantification of sexually transmitted pathogens in a biological sample selected from at least one of the following:a) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:1 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:1, wherein said nucleotide of SEQID NO:1 represents forward primer to amplifyMycoplasma genitalium;b) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:2 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:2, wherein said nucleotide of SEQID NO:2 represents reverse primer to amplifyMycoplasma genitalium;c) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:3 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:3, wherein said nucleotide of SEQID NO:3 represents forward primer to amplifyNeisseria gonorrhoeae;d) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:4 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:4, wherein said nucleotide of SEQID NO:4 represents reverse primer to amplifyNeisseria gonorrhoeae;e) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:5 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:5, wherein said nucleotide of SEQID NO:5 represents forward primer to amplifyTrichomonas vaginalis;f) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:6 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:6, wherein said nucleotide of SEQID NO:6 represents reverse primer to amplifyTrichomonas vaginalis;g) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:7 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:7, wherein said nucleotide of SEQID NO:7 represents forward primer to amplifyChlamydia trachomatis,A – K strains;h) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:8 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:8, wherein said nucleotide of SEQID NO:8 represents reverse primer to amplifyChlamydia trachomatis,A – K strains;i) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:9 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:9, wherein said nucleotide of SEQID NO:9 represents forward primer to amplifyChlamydia trachomatis,serovar L;j) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:10 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:10, wherein said nucleotide of SEQID NO:10 represents reverse primer to amplifyChlamydia trachomatis,serovar L;k) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:11 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:11, wherein said nucleotide of SEQID NO:11 represents forward primer to amplifyTreponema pallidum;l) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:12 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:12, wherein said nucleotide of SEQID NO:12 represents reverse primer to amplifyTreponema pallidum;m) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:13 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:13, wherein said nucleotide of SEQID NO:13 represents forward primer to amplifyHaemophilus ducreyi;n) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:14 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:14, wherein said nucleotide of SEQID NO:14 represents reverse primer to amplifyHaemophilus ducreyi;o) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:15 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:15, wherein said nucleotide of SEQID NO:15 represents forward primer to amplifyHerpes simplex type 1;p) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:16 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:16, wherein said nucleotide of SEQID NO:16 represents reverse primer to amplifyHerpes simplex type 1;q) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:17 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:17, wherein said nucleotide of SEQID NO:17 represents forward primer to amplifyHerpes simplex type 2;r) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:18 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:18, wherein said nucleotide of SEQID NO:18 represents reverse primer to amplifyHerpes simplex type 2;s) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:19 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:19, wherein said nucleotide of SEQID NO:19 represents forward primer to amplifyCandida albicans;t) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:20 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:20, wherein said nucleotide of SEQID NO:20 represents reverse primer to amplifyCandida albicans;u) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:21 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:21, wherein said nucleotide of SEQID NO:21 represents forward primer to amplifyCandida glabrata;v) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:22 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:22, wherein said nucleotide of SEQID NO:22 represents reverse primer to amplifyCandida glabrata;w) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:23 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:23, wherein said nucleotide of SEQID NO:23 represents forward primer to amplifyCandida krusei;x) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:24 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:24, wherein said nucleotide of SEQID NO:24 represents reverse primer to amplifyCandida krusei;y) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:25 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:25, wherein said nucleotide of SEQID NO:25 represents forward primer to amplifyCandida tropicalis;z) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:26 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:26, wherein said nucleotide of SEQID NO:26 represents reverse primer to amplifyCandida tropicalis;aa) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:27 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:27, wherein said nucleotide of SEQID NO:27 represents forward primer to amplifyCandida parapsilosis;bb) a nucleic acid molecule that encodes a nucleotide sequence of SEQID NO:28 or a part of it or a nucleotide having 90% sequence identity with said SEQID NO:28, wherein said nucleotide of SEQID NO:28 represents reverse primer to amplifyCandida parapsilosis.A primer pair for the detection and quantification of sexually transmitted pathogens in a biological sample wherein each pair comprises:- each of the sequence SEQID NO:1 and SEQID NO:2, or a part of it or a nucleotide having 90% sequence identity with said sequences;- each of the sequence SEQID NO:3 and SEQID NO:4, or a part of it or a nucleotide having 90% sequence identity with said sequences;- each of the sequence SEQID NO:5 and SEQID NO:6, or a part of it or a nucleotide having 90% sequence identity with said sequences;- each of the sequence SEQID NO:7 and SEQID NO:8, or a part of it or a nucleotide having 90% sequence identity with said sequences;- each of the sequence SEQID NO:9 and SEQID NO:10, or a part of it or a nucleotide having 90% sequence identity with said sequences;- each of the sequence SEQID NO:11 and SEQID NO:12, or a part of it or a nucleotide having 90% sequence identity with said sequences;- each of the sequence SEQID NO:13 and SEQID NO:14, or a part of it or a nucleotide having 90% sequence identity with said sequences;- each of the sequence SEQID NO:15 and SEQID NO:16, or a part of it or a nucleotide having 90% sequence identity with said sequences;- each of the sequence SEQID NO:17 and SEQID NO:18, or a part of it or a nucleotide having 90% sequence identity with said sequences;- each of the sequence SEQID NO:19 and SEQID NO:20, or a part of it or a nucleotide having 90% sequence identity with said sequences;- each of the sequence SEQID NO:21 and SEQID NO:22, or a part of it or a nucleotide having 90% sequence identity with said sequences;- each of the sequence SEQID NO:23 and SEQID NO:24, or a part of it or a nucleotide having 90% sequence identity with said sequences;- each of the sequence SEQID NO:25 and SEQID NO:26, or a part of it or a nucleotide having 90% sequence identity with said sequences; or- each of the sequence SEQID NO:27 and SEQID NO:28, or a part of it or a nucleotide having 90% sequence identity with said sequences.A reaction mixture for multiplex real-time PCR for the detection and quantification of sexually transmitted pathogens in a biological sample comprising:- nuclease free water;- reaction mixture for qPCR containing DNA polymerase;- at least one primer sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 as described in claim 1 or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or- at least one primer pair sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 as described in claim 3 or a part of it or a nucleotide having 90% sequence identity with said selected sequence;- Internal control gene.A reaction mixture according to the previous claim, wherein the internal control gene is at least one sequence selected from the list comprising sequences SEQID NO: 29 to SEQID NO:32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence.A reaction mixture according to claim 3, wherein the internal control gene is a sequence pair selected from:- a sequence pair selected from SEQID NO: 29 and SEQID NO: 30 or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or- a sequence pair selected from sequences SEQID NO: 31 and SEQID NO: 32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence.A multiplex real-time PCR test kit for the detection and quantification of sexually transmitted pathogens in a biological sample, comprising:at least one primer sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 as described in claim 1 or a part of it or a nucleotide having 90% sequence identity with said selected sequence; orat least one primer pair sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 as described in claim 3 or a part of it or a nucleotide having 90% sequence identity with said selected sequence;and an internal control gene.A test kit according to the previous claim, wherein the internal control gene is at least one sequence selected from the list comprising sequences SEQID NO: 29 to SEQID NO:32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence.A test kit according to claim 6, wherein the internal control gene is a sequence pair selected from:- a sequence pair selected from SEQID NO: 29 and SEQID NO: 30 or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or- a sequence pair selected from sequences SEQID NO: 31 and SEQID NO: 32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence.A method for the detection and quantification of sexually transmitted pathogens in a biological sample comprising the steps of:Providing an isolated biological sample from a subject;Extracting a DNA or RNA sample from said biological sample;Amplifying the DNA or RNA sample by multiplex PCR using:- at least one primer sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 described in claim 1 or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or- at least one primer pair sequence selected from the list comprising sequences SEQID NO: 1 to SEQID NO:28 as described in claim 3 or a part of it or a nucleotide having 90% sequence identity with said selected sequence;- and an internal control gene;- Detecting the presence or absence of at least one sexually transmitted pathogen.Method according to the previous claim, wherein the internal control gene is selected from:at least one sequence selected from the list comprising sequences SEQID NO: 29 to SEQID NO:32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence; ora sequence pair selected from SEQID NO: 29 and SEQID NO: 30 or a part of it or a nucleotide having 90% sequence identity with said selected sequence; or- a sequence pair selected from sequences SEQID NO: 31 and SEQID NO: 32, or a part of it or a nucleotide having 90% sequence identity with said selected sequence.A method according to any of the claims 9 to 10, wherein the pathogens are selected fromMycoplasma genitalium, Neisseria gonorrhoeae, Trichomonas vaginalis, Chlamydia trachomatis: A – K strains, Chlamydiatrachomatis:serovar L, Treponema pallidum, Haemophilus ducreyi, Herpes simplex type 1, Herpes simplex type 2, Monkeypox virus, Candida albicans, Candida glabrata, Candida krusei, Candida tropicalis or Candida parapsilosis.A method according to any of the claims 9 to 11, wherein the biological sample is a non-invasive test sample selected from urine, genital or oropharynx exudates.A method according to any of the claims 9 to 12, wherein the biological sample is genitourinary biopsy.

Images