Method for producing selective methane monooxygenase with high efficiency through sigma-54 and mmor

Abstract

The present invention relates to a water-soluble methane monooxygenase transcription initiation factor and a transcription regulatory gene. The present invention provides amino acid sequences of sigma-54 and MmoR, which are a transcription initiation factor derived from a microorganism of the genus Methylosinus and a transcription regulatory factor, respectively, genes coding therefore, and a promoter and enhancer nucleotide sequence of a water-soluble methane monooxygenase operon. The change in transcription regulation mechanism according to molecular biological and atomic copper ions of the present invention enables selective methane monooxygenase production of methanogenic bacteria, and thus has an advantage of being applicable to industrial processes.

Description

High-efficiency production method of selective methane monooxygenase using sigma-54 and MmoR

[0001] The present invention relates to the elucidation of the transcriptional regulation mechanism of methanogenic bacteria according to the interaction between the transcription factor of water-soluble methane monooxygenase and DNA.

[0002]

[0003] Methanogenic bacteria use methane, a greenhouse gas that causes global warming, as their main energy source, and research on this topic is increasing as it can be applied as a biological process to solve global warming. Methanogenic bacteria can easily convert methane to methanol under room temperature and atmospheric pressure using methane monooxygenase (MMO) within their cells, and they have the characteristic of not producing reaction by-products. Methane oxidation processes used in industrial fields require high temperature and high pressure to activate carbon-hydrogen bonds (104.9 kcal / mol) and also produce reaction by-products. Therefore, the application of biological processes using methanogenic bacteria is a suitable solution to these problems.

[0004] Methane monooxygenase is expressed in the form of particulate methane monooxygenase and soluble methane monooxygenase depending on the intracellular copper ion concentration, and has the characteristic of being expressed as soluble methane monooxygenase only in the type 2 methanogenic state where copper ions are excluded in the culture of methane strains. Particulate methane monooxygenase is expressed in the form of a membrane protein and can convert substrates stably, but the expression and purification of the protein are not easy, so there are limitations in the elucidation of its biochemical structure and mechanism. On the other hand, soluble methane monooxygenase can be isolated using a commercially available process, and its value in catalyst simulation is highly evaluated, so active research and development on the structure and function of the protein are being conducted.

[0005] Until now, studies on the precise transcriptional regulatory mechanism of methane monooxygenase have been limited due to the difficulty in studying the enzyme at the molecular biological level. Previous studies to elucidate the expression mechanism of methane monooxygenase could only confirm whether intracellular expression was regulated by copper concentration, and it was difficult to specifically identify the transcription factors and genetic sequences that determine protein expression, making it insufficient for industrial applications. Therefore, research and development are needed to elucidate the transcriptional regulatory mechanisms that control the expression of soluble and particulate methane monooxygenase for efficient substrate conversion and industrial applications through catalyst mimicry using methanotrophs.

[0006] Accordingly, the present inventors selected the transcription initiation factor sigma-54 and the transcription regulator MmoR involved in the transcription regulation of methane monooxygenase, and the promoter and enhancer regions that bind to them, constructed mutants, and discovered genes involved in transcription regulation, and studied the effect of copper ions on the transcription regulation process.

[0007]

[0008] The problem to be solved by the present invention relates to a water-soluble methane monooxygenase transcription initiation factor and a transcription regulatory gene, and provides the amino acid sequences of sigma-54, a transcription initiation factor derived from a microorganism of the genus Methylosinus, and MmoR, a transcription regulatory factor, and a gene encoding the same, and provides the promoter and enhancer base sequences of the water-soluble methane monooxygenase operon.

[0009] In addition, the challenge of the present invention is to clarify the molecular biological and atomic level transcription mechanism through high purity purification of transcription factors, to identify soluble methane monooxygenase transcription factors and transcription regulatory genes, and to provide an understanding of the selective expression of soluble methane monooxygenase in methanotrophs using the same, thereby realizing economic value through application to greenhouse gas reduction and methanol production processes.

[0010] The problems to be solved by the present invention are not limited to the problems mentioned above, and other technical problems not mentioned can be clearly understood by a person having ordinary skill in the technical field to which the present invention belongs from the description below.

[0011]

[0012] In order to solve the above problem, according to one aspect of the present invention, an expression vector is provided that includes a gene represented by SEQ ID NO: 1 encoding sigma-54, a transcription initiation factor of methane monooxygenase (MMO).

[0013] According to another aspect of the present invention, a host cell comprising the expression vector is provided.

[0014] According to another aspect of the present invention, a method for mass producing sigma-54, a transcription initiation factor of methane monooxygenase, by culturing the host cell is provided.

[0015] In order to solve the above problem, according to another aspect of the present invention, an expression vector is provided that includes a gene represented by SEQ ID NO: 2 encoding MmoR, a transcriptional regulator of methane monooxygenase.

[0016] According to another aspect of the present invention, a host cell comprising the expression vector is provided.

[0017] According to another aspect of the present invention, a method for mass producing MmoR, a transcriptional regulator of methane monooxygenase, by culturing the host cell is provided.

[0018] According to another aspect of the present invention, an expression vector for increasing the expression of methane monooxygenase is provided, comprising: a gene encoding methane monooxygenase; a promoter represented by SEQ ID NO: 6 operably linked to methane monooxygenase; and an enhancer represented by SEQ ID NO: 14.

[0019] In addition, according to another aspect of the present invention, a methanogenic strain for expressing methane monooxygenase transformed with the expression vector is provided.

[0020] In addition, according to another aspect of the present invention, a method for mass producing methane monooxygenase is provided, comprising the steps of: preparing the expression vector; transforming the expression vector into a methanotroph; culturing the transformed strain to obtain a culture; and purifying the methane monooxygenase.

[0021] According to another aspect of the present invention, a method for regulating expression of methane monooxygenase is provided, comprising the step of transforming a host cell with a recombinant expression vector comprising a sigma-54 transcription initiation factor coding gene having an amino acid sequence of SEQ ID NO: 3, thereby regulating expression of a sigma-54 transcription initiation factor.

[0022] According to another aspect of the present invention, a method for regulating the expression of methane monooxygenase is provided, comprising the step of transforming a host cell with a recombinant expression vector comprising a MmoR transcription regulator coding gene having an amino acid sequence of SEQ ID NO: 4, thereby regulating the expression of the MmoR transcription regulator.

[0023]

[0024] The genetic sequence involved in the transcriptional regulation of soluble methane monooxygenase was identified from sigma-54, a transcription factor of the soluble methane monooxygenase of the present invention, and the transcriptional regulatory factor MmoR, and can be used to selectively express soluble methane monooxygenase or particulate methane monooxygenase in the process of expressing methane monooxygenase in methanotrophs.

[0025] According to the present invention, the copper ion concentration that causes the expression of water-soluble methane monooxygenase under optimal conditions is quantitatively quantified, and through this, the expression of water-soluble and particulate methane monooxygenase can be controlled, which can be usefully utilized in industrial processes.

[0026] The effects of the present invention are not limited to the effects described above, and should be understood to include all effects that can be inferred from the composition of the invention described in the description or claims of the present invention.

[0027]

[0028] Figure 1 is a schematic diagram illustrating the binding of transcription factors of water-soluble methane monooxygenase and transcription regulatory genes and the effect of copper ion concentration on the transcription regulatory process.

[0029] Figure 2 is a drawing showing the protein having the amino acid sequence of sequence numbers 3 and 4, which was overexpressed in a transformant, purified and isolated, confirmed by SDS-PAGE and UV-Vis.

[0030] Figure 3 is a graph showing the binding between a protein having an amino acid sequence of sequence number 3 and promoter DNA.

[0031] Figure 4 is a graph confirming the binding between a protein having an amino acid sequence of sequence number 4 and enhancer DNA.

[0032] Figure 5 is a graph comparing the binding strength between MmoR, a transcriptional regulator, and enhancer DNA according to the addition of copper ions.

[0033]

[0034] As used herein, the term 'sigma-54' refers to one of the sigma factors, a transcription initiation factor, which interacts with the promoter genome in a complex with RNA polymerase and is involved in transcription initiation.

[0035] In this specification, 'MmoR' refers to a methane monooxygenase regulator (MmoR), which is an enhancer binding protein that is a transcriptional regulatory factor, interacts with the enhancer genome, and is involved in the transcriptional regulation of sigma factors through ATP hydrolysis.

[0036] The term 'methane monooxygenase (MMO)' of the present invention refers to an enzyme capable of catalyzing an oxidation reaction that oxidizes methane to produce methanol. The methane monooxygenase is not particularly limited thereto, as long as it exhibits activity catalyzing a reaction that produces methanol from methane, but may be, for example, a methane oxidase derived from a microorganism such as Pseudomonas sp., Rhodococcus sp., Brevibacterium sp., Comanonas sp., Acinetobacter sp., Arthrobacter sp., Brachymonas sp., or Methylosinus sp.

[0037] The term 'expression vector' used in this term includes, but is not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, and viral vectors.

[0038] In the present specification, the 'recombinant expression vector' may appropriately combine expression control sequences such as a promoter, terminator, enhancer, or sequences for secretion, depending on the type of host cell in which the methane monooxygenase transcription factor of the present invention is to be expressed or produced, according to the purpose.

[0039] The above expression vector may additionally include a selection marker for selecting a host cell into which the vector has been introduced, and if it is a replicable expression vector, may include an origin of replication.

[0040] In addition, the recombinant expression vector may include a sequence for facilitating purification of the expressed protein, and specifically, a gene encoding a tag for separation and purification may be linked to a gene encoding the methane monooxygenase transcription factor of the present invention so that the gene can operate. At this time, the tag for separation and purification may be GST, poly-Arg, FLAG, histidine-tag (His-tag), MBP, c-myc, etc., used alone, or two or more of them may be sequentially linked and used.

[0041] The gene encoding the above-mentioned water-soluble methane monooxygenase transcription factor can be cloned through a restriction enzyme cleavage site, and when a gene encoding a protein cleavage enzyme recognition site is used in the above-mentioned vector, it can be linked in frame with the gene of the water-soluble methane monooxygenase transcription factor, so that when the enzyme is obtained and then cleaved with a protein cleavage enzyme, the water-soluble methane monooxygenase transcription factor of the present form can be produced.

[0042] A transformant can be produced by transforming the recombinant expression vector according to the present invention into any one suitable host cell selected from the group consisting of bacteria, yeast, Escherichia coli, fungi, plant cells, and animal cells, depending on the purpose of expression. For example, the host cell can be Escherichia coli (E. coliBL21(DE3), DH5α, etc.) or yeast cells (Hansenula genus, Saccharomyces genus, etc.). At this time, a person skilled in the art can easily select an appropriate culture method and medium conditions, etc., depending on the type of host cell, from known techniques in the field.

[0043] The method for introducing a recombinant expression vector for producing a transformant of the present invention can use a known technique, such as a heat shock method or an electric shock method.

[0044]

[0045] Hereinafter, the present invention will be described in detail.

[0046] One aspect of the present invention provides sigma-54, a transcription initiation factor of water-soluble methane monooxygenase, and MmoR, a transcription regulatory factor.

[0047] The amino acid sequences of the above sequence numbers 3 and 4 are derived from a microorganism of the genus Methylosinus, more specifically, Methylosinus sporium5, and are methane monooxygenase transcription factors.

[0048] In the present invention, the expression and purification of sigma-54, a transcription initiation factor, and MmoR, a transcriptional regulator, of Methylosinus sporium 5 strain, which have not been purified before, were completed, and the gene sequence related to transcriptional regulation of the strain was identified.

[0049] The present invention provides genes for MmoR, a transcription regulatory factor of the water-soluble methane monooxygenase, and sigma factor, a transcription initiation factor, wherein the gene sequences of sequence numbers 1 and 2 are water-soluble methane monooxygenase transcription factors, and the gene sequences may be codon optimized to facilitate expression in a host cell.

[0050] In a specific embodiment of the present invention, a recombinant cloning vector was prepared by inserting the gene of the water-soluble methane monooxygenase transcription factor of the present invention into the plasmid vector pET30a(+). In addition to pET30a(+) used for the preparation of the cloning vector, various vectors for prokaryotic cells or eukaryotic cells (such as pPIC and pPICZ) are known, and therefore, various expression vectors other than the above vectors can be used depending on the purpose of expression.

[0051] The recombinant expression vector of the present invention contains a gene for a water-soluble methane monooxygenase transcription factor, and can be usefully used as a vector capable of producing the same. A recombinant expression vector containing a gene encoding a transcription factor for water-soluble methane monooxygenase is introduced into the transformant of the present invention.

[0052] In a specific embodiment of the present invention, a transformant was prepared by transforming E. coli as a host cell with a recombinant expression vector including a gene encoding the methane monooxygenase transcription factor of the present invention, and the protein expressed from the transformant can facilitate mass production of the methane monooxygenase transcription factor by mass-culturing the transformant to express the gene.

[0053] Another aspect of the present invention provides a method for producing a methane monooxygenase transcription factor using a transformant introduced with a recombinant expression vector comprising a gene encoding a water-soluble methane monooxygenase transcription factor of the present invention.

[0054] The method for producing a methane monooxygenase transcription factor according to the present invention comprises the steps of: 1) culturing a transformant into which a recombinant expression vector including a gene encoding a water-soluble methane monooxygenase transcription factor of the present invention has been introduced; 2) inducing expression of a gene encoding the water-soluble methane monooxygenase transcription factor in the transformant cultured in step 1); and 3) isolating the water-soluble methane monooxygenase transcription factor from a culture of the transformant in which gene expression of the water-soluble methane monooxygenase transcription factor has been induced in step 2.

[0055] A gene encoding a tag for separation and purification or a protein cleavage enzyme cleavage site may be additionally linked to the N-terminus and C-terminus of the gene encoding the water-soluble methane monooxygenase transcription factor of step 1), thereby enabling purification of the recombinant water-soluble methane monooxygenase transcription factor or obtaining the water-soluble methane monooxygenase transcription factor of the present form.

[0056] The cultivation of the transformant of step 1) above can be performed according to a known method, and conditions such as culture temperature, culture time, and pH of the medium can be appropriately controlled. In addition, the culture method may include batch culture, continuous culture, and fed-batch culture. The culture medium used must appropriately meet the requirements of a specific strain.

[0057] The separation of the water-soluble methane monooxygenase transcription factor from the culture produced by the above-mentioned cultivation in step 3) can be performed by a method commonly performed in the art, such as centrifugation or filtration. In addition, the water-soluble methane monooxygenase transcription factor separated by the above-mentioned method can be purified by a conventional method, and for example, the water-soluble methane monooxygenase transcription factor of the present invention can be purified by using techniques such as salting out (e.g., ammonium sulfate precipitation, sodium phosphate precipitation, etc.), solvent precipitation (protein fraction precipitation using acetone, ethanol, etc.), dialysis, gel filtration, ion exchange, chromatography such as reversed-phase column chromatography, and ultrafiltration, alone or in combination.

[0058] In addition, a method for producing methane monooxygenase using a recombinant vector comprising a sequence encoding methane monooxygenase, a promoter of SEQ ID NO: 6 operably linked thereto, and an enhancer of SEQ ID NO: 14 comprises the steps of: 1) preparing a recombinant vector comprising a gene encoding methane monooxygenase, a promoter, and an enhancer; 2) transforming the expression vector into a methanotroph; 3) culturing the transformed strain to obtain a culture; and 4) purifying the methane monooxygenase, and the same cleavage enzyme position, transformant culture, etc. as described above are applied.

[0059] It can be seen that mass production of a water-soluble methane monooxygenase transcription factor is possible according to the production method of the present invention.

[0060] The above water-soluble methane monooxygenase can be overexpressed by introducing a recombinant vector containing the above enhancer and promoter into a host cell, culturing a transformant, and expressing the above gene.

[0061] In addition, another aspect of the present invention provides a method for measuring in vitro the interaction of a water-soluble methane monooxygenase transcription factor of the present invention with DNA associated with the transcription of water-soluble methane monooxygenase and a specific DNA sequence that interacts with the water-soluble methane monooxygenase transcription factor.

[0062] The transcription-related DNA of the present invention is located upstream of the water-soluble methane monooxygenase transcription start point, and has sequence number 5, and plays a role in initiating and regulating transcription by interacting with the water-soluble methane monooxygenase transcription factor, and includes, but is not limited to, a promoter, an enhancer, and an operator.

[0063] The DNA sequence of the above sequence number 5 is derived from a microorganism of the genus Methylosinus, more specifically, Methylosinus sporium5.

[0064] In addition, the present invention provides an upstream activator sequence (UAS) including an enhancer DNA sequence in a DNA sequence of SEQ ID NO: 5, wherein the UAS may be included from about -70th to -200th positions from a promoter DNA sequence, preferably from -100th to -150th positions, but is not limited thereto. The UAS of SEQ ID NO: 5 may be divided into four equal-length DNA sequences. Specifically, the divided UAS may have the DNA sequences of SEQ ID NOs: 11 to 14.

[0065] The present invention discovered genes involved in transcriptional regulation by selecting promoter and enhancer gene sequences of a water-soluble methane monooxygenase operon and constructing mutants, and in a specific example, identified important binding sites by confirming binding affinity and binding characteristics between a water-soluble methane monooxygenase transcription factor and transcription-related DNA.

[0066] As shown in Fig. 1, it was confirmed through the mutant that sigma-54 is attached to the promoter region, and that the GG-TGG sequence is an important sequence at this time. It was also confirmed that after the transcription initiation factor sigma-54 binds, MmoR is attached to the enhancer region, and that the ACA TGT sequence is an important sequence at this time.

[0067] Specifically, the DNA sequence of SEQ ID NO. 5 includes a promoter DNA base sequence, and a promoter DNA mutant having a different base in the promoter DNA sequence of SEQ ID NO. 6 is provided, and an enhancer DNA mutant having a different base in the DNA sequence of SEQ ID NO. 14 is produced and the binding strength is measured. As a result, the WT binding strength was the highest, accurately identifying the sequence region of the promoter that is important for binding to sigma-54 and the sequence region of the enhancer that is important for binding to MmoR.

[0068] Originally, methane monooxygenase is a biochemical catalyst that oxidizes methane to methanol expressed in methanotrophs, and is expressed in the form of particulate methane monooxygenase (pMMO) and soluble methane monooxygenase (sMMO). It has the characteristic of being selectively expressed as soluble methane monooxygenase only in the type 2 methanogenic state where copper ions are excluded during the cultivation of methane strains.

[0069] In a specific embodiment of the present invention, it was confirmed that when the copper ion concentration is 80 μM or higher, the expression of water-soluble methane monooxygenase is suppressed, and when the copper ion concentration is 80 μM or higher, it was found that particulate methane monooxygenase is selectively expressed. In addition, the presence of an enhancer region is required for high MmoR binding affinity, and when the enhancer is deleted, particulate methane monooxygenase is selectively expressed.

[0070] Through this, it was confirmed that when a recombinant vector containing the sigma-54 factor, MmoR factor, promoter, and enhancer was transformed into a methanotroph, soluble methane monooxygenase was well expressed at less than 80 μM of copper ions. Through this, it was found that, unlike the original expression of soluble methane monooxygenase in an environment without copper ions, it showed selectivity for soluble methane monooxygenase at less than 80 μM of copper ions. In addition, it was found that when the enhancer region was deleted, particulate methane monooxygenase had selectivity over soluble methane monooxygenase.

[0071] In addition, the method for measuring the interaction between the transcription factor of the water-soluble methane monooxygenase of the present invention and the transcription-related DNA in vitro includes 1) a step of preparing a DNA fragment including a transcription-related DNA sequence to which a fluorescent substance is bound, and 2) a step of measuring the interaction between the DNA sequence to which the fluorescent substance is bound in step 1) and the water-soluble methane monooxygenase transcription factor.

[0072] The measurement of the interaction between the DNA sequence to which the fluorescent substance is bound and the water-soluble methane monooxygenase transcription factor is performed by measuring the polarization bias of the fluorescent molecule using the fluorescence anisotropy technique to obtain information about the molecular rotational motion, thereby measuring the interaction.

[0073] The DNA bound to the fluorescent material in step 1) above is small and rotates quickly, so it has a relatively low fluorescence anisotropy value. When a large, slow-rotating transcription factor protein binds, the fluorescence anisotropy value increases.

[0074] The fluorescent substance bound to the DNA in the above step 1) may include, but is not limited to, 2-aminobenzamide (2-AB), 6-carboxyfluorescein (6-FAM), and procainamide (PROC).

[0075] The reaction of step 2) above may be performed at a temperature range of 15°C to 35°C, preferably at a temperature range of 20°C to 30°C, but is not limited thereto. In addition, the reaction of step 1) above may be performed at a pH range of 5 to 8, preferably at a pH range of 6 to 7.5, and more preferably at a pH of 6.5 to 7, but is not limited thereto.

[0076] In addition, the reaction of the above step 2) may include, but is not limited to, dithiothreitol (DTT) or tris(2-chloroethyl)phosphate (TCEP) to prevent oxidation of the water-soluble methane monooxygenase transcription factor.

[0077] In the reaction of the above step 2), it is desirable to provide a certain reaction time to stabilize the binding between the transcription-related DNA and the transcription factor protein, and the reaction time can be performed in a time range of 1 to 5 minutes, preferably 2 to 3 minutes, but is not limited thereto.

[0078]

[0079] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples specifically illustrate the present invention, and the content of the present invention is not limited by the following examples.

[0080]

[0081] Example 1: Preparation of water-soluble methane monooxygenase sigma-54 and MmoR

[0082] Example 1-1. Cloning and transformation of the sigma-54 gene, a transcription initiation factor.

[0083] To obtain a water-soluble methane monooxygenase sigma-54 protein having an amino acid sequence of sequence number 3, we commissioned Bionics to synthesize a gene having a base sequence of sequence number 1, and produced a recombinant expression vector using NcoI and HindIII restriction enzymes.

[0084] As a result of performing base sequence analysis on the recombinant expression vector constructed as above, it was confirmed that the base sequence of SEQ ID NO: 1 was correctly inserted, and it was transformed into E. coli BL21 (DE3) strain (Novagen, USA). The sigma-54 protein expressed from the transformant obtained as above is expressed in a state in which a His-tag is fused at the N-terminus. The transformant obtained as above was pre-inoculated into 10 mL of LK solid medium (LB medium + 50 μg / mL kanamycin) and cultured at 37°C for more than 12 hours. One colony appearing on the solid medium was inoculated into a test tube containing 5 mL of LB medium and 50 μg / mL kanamycin through a single colony isolation process, and the seed culture was performed in a shaking incubator at 37°C for more than 12 hours. The transformant obtained as above was stored frozen by adding a 15% glycerin solution before use.

[0085] Example 1-2. Overexpression and purification of sigma-54, a transcription initiation factor.

[0086] In the above Example [1-1], the transformant stored frozen was inoculated into a test tube containing 200 mL of LB medium and 50 μg / mL kanamycin, and the seed culture was performed for more than 12 hours in a shaking incubator at 37°C. Thereafter, 5 mL of the culture solution from the seed culture was added to a 2,000 mL flask containing 500 mL of LK medium, and a total of 2 L of main culture was performed. When the absorbance at 600 nm was 0.6 to 0.7, IPTG (isopropyl-1-thio-β-D-galactopyranoside) was added to a final concentration of 0.1 mM to induce overexpression of the protein having the amino acid sequence of SEQ ID NO: 3. In the process of inducing a protein having the amino acid sequence of sequence number 3 as described above, the stirring speed was adjusted to 200 rpm and the culture temperature was maintained at 37°C. After the addition of IPTG, the stirring speed was adjusted to 200 rpm and the culture temperature was adjusted to 25°C, and the culture was incubated for 6 hours.

[0087] In addition, the culture medium of the transformant in which overexpression of the protein having the amino acid sequence of SEQ ID NO: 3 was induced as described above was dispensed into a 500 mL PP tube (PP tube, Hanil Scientific Inc., Korea), centrifuged at 8,000 rpm at 4°C for 20 minutes to separate the supernatant, and 50 mL of buffer solution A (25 mM MOPS, 50 mM NaCl, 1 mM DTT, 0.01 μL / mL DNase I, 0.002 mg / mL, pH 6.5) was added to the pellet, and the cells were disrupted by sonication to obtain a cell lysate of the transformant.

[0088] The cell lysate obtained as described above was centrifuged at 14,000 rpm at 4°C for 1 hour to obtain a supernatant, and a protein having the amino acid sequence of SEQ ID NO: 3 that was overexpressed was isolated from the supernatant obtained as described above using Fast Protein Liquid Chromatography (Cytiva, Germany) equipped with a Q sepharose ion exchange column (Cytiva, Germany) and Superdex 75 (Cytiva, Germany).

[0089] As a result of confirming the protein separated in this way through SDS-PAGE, it was confirmed that a protein having an amino acid sequence of sequence number 3 of approximately 61 kDa was overexpressed through the above series of processes, and purified and isolated from the cell lysate of the transformant. It was confirmed that the purified and isolated Sigma-54 did not contain a cofactor and therefore did not show a characteristic peak through UV-visible spectroscopy (see Fig. 2).

[0090] Example 1-3. Cloning and transformation of the MmoR gene, a transcriptional regulator.

[0091] To obtain the MmoR protein, a water-soluble methane monooxygenase transcriptional regulator having the amino acid sequence of sequence number 4, the gene synthesis having the nucleotide sequence of sequence number 2 was commissioned to Bionics. Using the plasmid commissioned as above as a template, a polymerase chain reaction was performed using the primer pairs described in Table 1 to produce a recombinant expression vector having a PCR product including the nucleotide sequence of sequence number 4 inserted therein.

[0092] Amplification target primer pair sequence (5'->3') MmoR forward primer aagaagcatatgctggatcgtgcgg MmoR reverse primer aggcggaagctttcaacgtttagaaacg

[0093] As a result of performing base sequence analysis on the recombinant expression vector constructed as above, it was confirmed that the base sequence of the above sequence number 2 was correctly inserted, and it was transformed into E. coli BL21 (DE3) strain (Novagen, USA). The transformant obtained as above was pre-inoculated into 10 mL of LK solid medium (LB medium + 50 μg / mL kanamycin) and cultured at 37°C for more than 12 hours. One colony appearing on the solid medium was inoculated into a test tube containing 5 mL of LB medium and 50 μg / mL kanamycin through a single colony isolation process, and the seed culture was performed in a shaking incubator at 37°C for more than 12 hours. The transformant obtained as above was stored frozen by adding a 15% glycerin solution before use.

[0094] Example 1-4. Overexpression and purification of MmoR, a transcriptional regulator.

[0095] In the above Example [1-3], the transformant stored frozen was inoculated into a test tube containing 200 mL of LB medium and 50 μg / mL kanamycin, and the seed culture was performed for more than 12 hours in a shaking incubator at 37°C. Thereafter, 5 mL of the above seed culture solution was added to a 2,000 mL flask containing 500 mL of LK medium, and a total of 2 L of main culture was performed. When the absorbance at 600 nm was 0.6 to 0.7, IPTG (isopropyl-1-thio-β-D-galactopyranoside) was added to a final concentration of 0.1 mM to induce overexpression of the protein having the amino acid sequence of SEQ ID NO: 4. In the process of inducing a protein having the amino acid sequence of sequence number 4 as described above, the stirring speed was adjusted to 200 rpm and the culture temperature was maintained at 37°C. After the addition of IPTG, the stirring speed was adjusted to 180 rpm and the culture temperature was adjusted to 25°C, and the culture was incubated for 6 hours.

[0096] In addition, the culture medium of the transformant in which overexpression of the protein having the amino acid sequence of SEQ ID NO: 4 was induced as described above was dispensed into a 500 mL PP tube (PP tube, Hanil Scientific Inc., Korea), centrifuged at 8,000 rpm at 4°C for 20 minutes to separate the supernatant, and 50 mL of buffer solution A (25 mM MOPS, 50 mM NaCl, 1 mM DTT, 0.01 μL / mL DNase I, 0.002 mg / mL, pH 7.5) was added to the pellet, and the cells were disrupted by sonication to obtain a cell lysate of the transformant.

[0097] The cell lysate obtained as described above was centrifuged at 4°C and 14,000 rpm for 1 hour to obtain a supernatant, and a protein having the amino acid sequence of SEQ ID NO: 4 that was overexpressed was isolated from the supernatant obtained as described above using Fast Protein Liquid Chromatography (Cytiva, Germany) equipped with a DEAE sepharose ion exchange column (Cytiva, Germany), a Q sepharose ion exchange column (Cytiva, Germany), and Superdex 75 (Cytiva, Germany).

[0098] As a result of confirming the protein separated in this way through SDS-PAGE, it was confirmed that a protein having an amino acid sequence of sequence number 4 of approximately 74 kDa was overexpressed through the above series of processes, and purified and isolated from the cell lysate of the transformant. The purified and isolated MmoR contained iron ions as a cofactor, and it was confirmed that a peak appeared at a wavelength of 408 nm through UV-visible spectroscopy (see Fig. 2).

[0099]

[0100] Example 2. Confirmation of the interaction between the water-soluble methane monooxygenase transcription factor and transcription-related DNA.

[0101] Example 2-1. Fluorescence anisotropy measurement of sigma-54, a transcription initiation factor, and sequence numbers 6 to 10.

[0102] The water-soluble methane monooxygenase sigma-54 protein isolated and purified in the above Example 1-2, i.e., the protein having the amino acid sequence of SEQ ID NO: 3, was titrated in a buffer solution (25 mM MOPS, 50 mM NaCl, 1 mM DTT, pH 7.4) containing 5 nM of the wild-type promoter DNA of SEQ ID NO: 6 conjugated to a fluorescent substance. Fluorescence anisotropy measurement was performed using a spectrofluorometer (FP-8300, JASCO Inc., Japan) to confirm the binding affinity and binding characteristics between the water-soluble methane monooxygenase transcription initiation factor sigma-54 and the DNA conjugated to the fluorescent substance having the DNA sequence of SEQ ID NO: 6.

[0103] The same experiment as above was performed on the promoter DNA mutants, which are DNAs conjugated with the fluorescent substances of the above sequence numbers 7 to 10, to confirm changes in binding strength (see Fig. 3).

[0104] Promoter DNA sequence (5'->3') Binding affinity with sigma-54 (nM) SEQ ID NO: 6 (WT) aatcagtggcacgaggcttgccataacaataagcgtcgtaa 184.6 ± 6.2 SEQ ID NO: 7 (P1) aatcagtaacacgaggcttgccataacaataagcgtcgtaa 221.5 ± 10.7 SEQ ID NO: 8 (P2) aatcagtggcacgaggctaaacataacaataagcgtcgtaa 237.4 ± 12.0 SEQ ID NO: 9 (P3) aatcagtaacacgaggctaaacataacaataagcgtcgtaa 697.6 ± 19.2 SEQ ID NO: 10 (P4) aatcaaaaaaacgaggaaaaaaataacaataagcgtcgtaa 1,233.8 ± 38.6

[0105] As a result, it was confirmed that the binding affinity between the wild-type promoter DNA having the DNA sequence of sequence number 6 and the water-soluble methane monooxygenase sigma-54 was the highest, and it was confirmed that it was similar to the binding affinity of the promoter DNA mutants of sequence numbers 7 and 8, in which only one of the two promoter binding sites was substituted.

[0106] Through this, it was confirmed that the binding characteristics were also similar, and on the other hand, it was confirmed that the binding strength was significantly reduced in the case of the promoter DNA mutants of SEQ ID NO. 9 and SEQ ID NO. 10, in which both promoter binding sites were substituted.

[0107] From the above results, it was confirmed that sigma-54, a water-soluble methane monooxygenase transcription initiation factor of the present invention, performs a specific interaction with the promoter binding sequence found in the present invention, and biophysical binding characteristics were confirmed through the fact that at least one promoter binding site is required for interaction between sigma-54 and the promoter.

[0108] Example 2-2. Fluorescence anisotropy measurement of MmoR, a transcriptional regulator, and sequence numbers 11 to 15.

[0109] The water-soluble methane monooxygenase MmoR protein isolated and purified in the above Examples 1-4, i.e., the protein having the amino acid sequence of SEQ ID NO: 4, was titrated in a buffer solution (25 mM MOPS, 50 mM NaCl, 1 mM DTT, pH 7.4) containing 5 nM of enhancer DNA of SEQ ID NO: 11-14 conjugated to a fluorescent substance, and fluorescence anisotropy was measured using a spectrofluorometer (FP-8300, JASCO Inc., Japan).

[0110] Through the above examples, the binding affinity and binding characteristics between MmoR, a water-soluble methane monooxygenase transcription regulator, and DNA bound to a fluorescent substance having a DNA sequence of SEQ ID NO: 11 to 14 were confirmed, and the same experiment as above was performed for an enhancer DNA variant, which is DNA bound to a fluorescent substance of SEQ ID NO: 15, to confirm changes in the binding strength between DNAs (see Fig. 4).

[0111] Enhancer DNA sequence (5'->3') Binding affinity to MmoR (nM) SEQ ID NO: 11 (E1) aatcaggccctcgatcgccgcgaccatgaa 135.1 ± 6.9 SEQ ID NO: 12 (E2) aacatggatcgcggcgatcgaaacagtcaa 158.2 ± 7.3 SEQ ID NO: 13 (E3) aagatgaaattcgtgcgtatgcttatttaa 147.5 ± 9.7 SEQ ID NO: 14 (E4) aagacaactgtatcgagcgccgccttcgaa 12.6 ± 0.5 SEQ ID NO: 15 (E4`) aagcccaccccatcgagcgccgccttcgaa 147.8 ± 6.3

[0112] Looking at Table 3, it was confirmed that the binding affinity between the enhancer DNA having the DNA sequence of SEQ ID NO: 14, which includes the enhancer binding sequence, and the water-soluble methane monooxygenase MmoR was the highest, and it was confirmed that the binding affinity of the enhancer DNA having the DNA sequence of SEQ ID NO: 11 to 13 and the enhancer DNA variant having the DNA sequence of SEQ ID NO: 15 was lower than that of SEQ ID NO: 14.

[0113] Therefore, it was confirmed that MmoR, a water-soluble methane monooxygenase transcription regulator of the present invention, specifically interacts with sequence number 14 including an enhancer binding sequence, and when the enhancer binding sequence is replaced with a different base, it was confirmed that the binding affinity decreases to a similar level as other enhancer DNAs.

[0114]

[0115] Example 3. Confirmation of the copper effect on MmoR, a water-soluble methane monooxygenase transcription regulator.

[0116] Example 3-1. Confirmation of copper coordination characteristics of water-soluble methane monooxygenase MmoR.

[0117] Copper ions were titrated in equivalent amounts into a buffer solution (25 mM MOPS, 50 mM NaCl, 1 mM DTT, pH 7.4) containing 1.0 μM of the water-soluble methane monooxygenase MmoR protein isolated and purified in the above Examples 1-4, i.e., MmoR having an amino acid sequence of SEQ ID NO: 4, and the coordination environment of the copper ions to MmoR was investigated using a UV / Vis spectrophotometer (Cary60, Agilent Technologies Inc., USA) (see Fig. 5).

[0118] Looking at Figure 5, it was confirmed that MmoR does not directly bind to copper ions, as no characteristic peak due to metal coordination was observed in the copper ion titration.

[0119] Example 3-2. Evaluation of the binding ability of copper ions to the transcriptional regulator MmoR and enhancer DNA.

[0120] The water-soluble methane monooxygenase MmoR protein isolated and purified in the above Example [1-4], i.e., the protein having the amino acid sequence of SEQ ID NO: 4, was titrated in a buffer solution (25 mM MOPS, 50 mM NaCl, 1 mM DTT, pH 7.4) containing 5 nM of the enhancer DNA of SEQ ID NO: 14 conjugated to a fluorescent substance and copper ions. (See Fig. 4).

[0121] Enhancer DNA Added copper concentration (μM) Binding affinity to MmoR (nM) SEQ ID NO: 1401 2.6 ± 0.5 SEQ ID NO: 1412 3.9 ± 2.0 SEQ ID NO: 1420 9 2.0 ± 2.1 SEQ ID NO: 1480 N / A

[0122] Looking at Table 4, we confirmed that when the buffer solution contained 1.0 μM copper ions, the binding affinity decreased approximately 2-fold, and when it contained 20.0 μM copper ions, the binding affinity decreased approximately 7-fold. Furthermore, when the buffer solution contained 80.0 μM copper ions, binding was completely lost, confirming that copper ions affect the interaction between enhancer DNAs by causing changes in the local environment within MmoR.

[0123] As a result, the copper ion concentration that limits the expression of soluble methane monooxygenase in vitro in an environment where copper ions are present was identified, and through this, it was confirmed that the expression of soluble methane monooxygenase is selectively performed.

[0124]

[0125] The foregoing description of the present invention is for illustrative purposes only, and those skilled in the art will readily appreciate that the present invention can be readily modified into other specific forms without altering the technical spirit or essential characteristics of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive. For example, each component described as a single entity may be implemented in a distributed manner, and similarly, components described as distributed may be implemented in a combined manner.

[0126] The scope of the present invention is indicated by the claims set forth below, and all changes or modifications derived from the meaning and scope of the claims and their equivalent concepts should be interpreted as being included in the scope of the present invention.

[0127]

[0128] The present invention relates to a water-soluble methane monooxygenase transcription initiation factor and a transcription regulatory gene, and provides amino acid sequences of sigma-54, a transcription initiation factor derived from a microorganism of the genus Methylosinus, and MmoR, a transcription regulatory factor, and genes encoding the same, and also provides promoter and enhancer base sequences of a water-soluble methane monooxygenase operon. The change in the transcription regulatory mechanism according to copper ions at the molecular biological and atomic level of the present invention enables selective methane monooxygenase production by methanotrophs, and thus can be utilized in various ways in industrial processes, etc.

[0129] Therefore, the water-soluble methane monooxygenase transcription initiation factor and transcription control gene according to one embodiment of the present invention can be considered to have industrial applicability.

Claims

1. An expression vector comprising a gene represented by sequence number 1 encoding sigma-54, a transcription initiation factor of methane monooxygenase (MMO).

2. A host cell containing the expression vector of paragraph 1.

3. A method for mass producing sigma-54, a transcription initiation factor of methane monooxygenase, by culturing the host cell of paragraph 2.

4. An expression vector comprising a gene represented by SEQ ID NO: 2 encoding MmoR, a transcriptional regulator of methane monooxygenase.

5. A host cell containing the expression vector of paragraph 4.

6. A method for mass producing MmoR, a transcriptional regulator of methane monooxygenase, by culturing the host cell of Article 5.

7. An expression vector for increasing the expression of methane monooxygenase, comprising: a gene encoding methane monooxygenase; a promoter represented by SEQ ID NO: 6 operably linked to methane monooxygenase; and an enhancer represented by SEQ ID NO:

14.

8. A methanogenic strain for expressing methane monooxygenase transformed with the expression vector of Article 7.

9. In paragraph 8, The above methanogenic bacteria are Methylomonas, Methylobacter, Methylococcus, Methylosphaera, Methylocaldum, Methyloglobus, Methylosarcina, Methyloprofundus, Methylothermus, Methylohalobius, Methylogaea, Methylomarinum, Methylovulum, Methylomarinovum, Methylorubrum, Methyloparacoccus, Methylrosinus A methanogenic strain for expressing methane monooxygenase, characterized in that it is selected from the group consisting of the genera Methylosinus, Methylocystis, Methylocella, Methylocapsa, Methylofurula, Methylacidiphilum, Methylacidimicrobium and Methylomicrobium.

10. Step of preparing the expression vector of clause 7; A step of transforming the above expression vector into a methanogenic bacterium; A step of culturing the transformed strain to obtain a culture; and A step of purifying the above methane monooxygenase; A method for mass producing methane monooxygenase comprising:

11. In paragraph 10, A method for mass producing methane monooxygenase, characterized in that the methane monooxygenase is soluble methane monooxygenase (sMMO) or particulate methane monooxygenase (pMMO).

12. In paragraph 10, A method for mass-producing selective water-soluble methane monooxygenase when the transformed strain is cultured at a copper ion concentration of 1 μM to 80 μM.

13. A method for regulating the expression of methane monooxygenase, comprising the step of transforming a host cell with a recombinant expression vector containing a sigma-54 transcription initiation factor coding gene consisting of an amino acid sequence of sequence number 3, thereby regulating the expression of a sigma-54 transcription initiation factor.

14. In paragraph 14, A method for regulating the expression of methane monooxygenase, characterized in that the above sigma-54 transcription initiation factor binds to the promoter of sequence number 6.

15. A method for regulating the expression of methane monooxygenase, comprising the step of transforming a host cell with a recombinant expression vector containing a MmoR transcription regulator coding gene consisting of an amino acid sequence of SEQ ID NO: 4, thereby regulating the expression of the MmoR transcription regulator.

16. In paragraph 15, A method for regulating the expression of methane monooxygenase, characterized in that the above MmoR transcription regulator binds to an enhancer of sequence number 14.

Images