Gene therapy for protein c deficiency

Abstract

The invention concerns compositions and methods for treating protein C deficiency comprising adeno associated virus (AAV) vectors comprising a nucleic acid sequence encoding protein C (AAV -PC). The invention further provides non-human animal models for screening and assessing the efficacy of potential therapeutic agents for treating pro- thrombotic disorders, such as protein C deficiency.

Description

[0001] GENE THERAPY FOR PROTEIN C DEFICIENCY

[0002] TECHNOLOGICAL FIELD

[0003] The present disclosure relates to therapeutic compositions and methods for treating protein C deficiency using Adeno Associated Virus as a delivery vector, as well as to animal models for screening potential therapeutic modalities for treating pro-thrombotic disorders, such as protein C deficiency therapeutics.

[0004] BACKGROUND ART

[0005] References considered to be relevant as background to the presently disclosed subject matter are listed below:

[0006] Bouwenset al., J ThrombHaemost . 2013;! 1 Suppl 1(0 l):242-53

[0007] Cai et al., J Clin Invest 1998, 101(12) :2831-41

[0008] D'Ursiet al., BMC Bioinformatics Suppl 1 (Suppl 1): Si l

[0009] Ellen Shrock and Marc Guell, Progress in Molecular Biology and Translational Science, Chapter Six, Vol. 152, pages 95-114 (2017)

[0010] Goldenberg and Manco-Johnson / Haemophilia 2008; 14(6): 1214-21

[0011] Golderman V. et al., JntJMolSci. (2020) 21(7):2422

[0012] Griffin et al., Blood 2015 ; 125(19):2898-907

[0013] Hanson et al., J Clin Invest. 1993;92(4):2003-12

[0014] High and Roncaroio N Engl J Med 2019;381(5):455-464

[0015] .Talbert et al., J Clin Invest. 1998; 102(8): 1481 -8

[0016] Margaritis et al., J Clin Invest. 2004; 113(7): 1025-31

[0017] Martos et al., Thromb Haemost. 2019; 119(9): 1409-1418

[0018] Mingozzi F., et al., The Journal of clinical investigation, 2003; 11 / (9), 1347—1356

[0019] Samelson-Jones and Arruda Mol Ther Methods Clin Dev 2018; 12: 184-201

[0020] Shall et al., Pedialr Blood Cancer 2016;63(8): 1488-90

[0021] Steams-Kurosawa DJ, et al., Proc Natl Acad Sci USA 1996;93(19): 10212-6

[0022] Vetrano et al., Proc Natl Acad Sci USA 201 1 ; 108(49): 19830-5

[0023] Wang L, et al., Proc. Natl. Acad. Sci. USA. 1997;94(21): 11563-6

[0024] Xie et al., Drug Discovery Today 2006, 11(1): 67-73 BACKGROUND

[0025] Severe protein C deficiency (SPCD) is a devastating disease associated with high morbidity and mortality. It is an autosomal recessive disorder. Type I deficiency is characterized by decreased levels of both protein C (PC) antigen and anticoagulant activity, whereas in type II deficiency the level of PC antigen is within the normal range, but PC anticoagulant activity is reduced, potentially due to mutations that affect PC binding interactions with its cofactors.

[0026] The importance of PC’s anticoagulant activities is manifested by SPCD, a devastating disease, caused by homozygous or compound heterozygous mutations in the PC gene (referred to herein as the “PROC gene ” or “PROC”). SPCD is usually diagnosed in infants shortly after birth, as they present with rapidly progressive Purpura Fulminans (PF), skin necrosis, DIC (disseminated intravascular coagulation) and life-threatening thrombosis. Moreover, SPCD may be documented already in utero, presenting with cerebral infarctions and blindness. Following the initial presentation of PF, these children may further suffer from recurrent deep vein thrombosis (DVT), pulmonary emboli (PE), parenchymal thrombi and a proclivity to DIC. The surviving children require lifelong anticoagulant therapy.

[0027] Long-term treatment of SPCD patients includes indefinite administration of anticoagulation agents, required to avoid spontaneous thrombosis and repeated PF, as well as replacement therapy with either fresh frozen plasma (FFP) or PC concentrate (Goldenberg and Manco-Johnson Haemophilia 2008; 14(6): 1214-21). The latter has been approved in the United States and Europe; however, it is not routinely available and entails potential complications as being a plasma derived product with a potential risk of blood-borne diseases, as well as exhibiting a short half- life (6 hours). As PC is produced by hepatocytes, liver transplantation may cure SPCD, however, this surgery is not feasible for most patients and lifelong immunosuppression may be required following successful transplantation surgery (Shall et al., Pediatr Blood Cancer 2016;63(8): 1488-90).

[0028] Cai et al (J Clin Invest. 1998 Jun 15; 101( 12):2831 -41) increased the levels of human protein C in normal rats after retroviral vector-mediated hepatic gene therapy. However, retrovirus is not an ideal vector for gene therapy as it may induce oncogenesis and indeed, it is no longer used for in vivo or ex vivo gene therapy.

[0029] As SPCD is a devastating disease, there is an unmet need to find suitable therapies to improve patients’ care. GENERAL DESCRIPTION

[0030] In a first of its aspects, the present invention provides a method of treating, preventing, or ameliorating the symptoms of protein C deficiency in an individual in need thereof comprising administering an adeno associated virus (AAV) vector comprising a nucleic acid sequence encoding protein C (AAV-PC) to said individual.

[0031] In another aspect, the present invention provides a method of increasing protein C levels in the blood or plasma of an individual in need thereof comprising administering an adeno associated virus (AAV) vector comprising a nucleic acid sequence encoding protein C (AAV-PC) to said individual.

[0032] In another aspect, the present invention provides a pharmaceutical composition comprising an adeno associated virus (AAV) vector comprising a nucleic acid sequence encoding protein C (AAV-PC), and a pharmaceutically acceptable carrier.

[0033] In one embodiment, the pharmaceutical composition is for treating, preventing, or ameliorating the symptoms of protein C deficiency in an individual, and / or for increasing protein C levels in the blood or plasma of an individual.

[0034] In one embodiment, the protein C deficiency is severe protein C deficiency (SPCD).

[0035] In one embodiment, the protein C is a protein C zymogen or an activated protein C (APC).

[0036] In one embodiment, said nucleic acid sequence encodes a protein C zymogen and is about 90-100% identical to SEQ ID No. 2.

[0037] In one embodiment, said AAV vector is AAV-8.

[0038] In one embodiment, said AAV-PC vector is administered by intravenous injection, intramuscular injection, or intraperitoneal injection.

[0039] In one embodiment, the AAV-PC vector is administered in combination with an additional therapeutic agent.

[0040] In another aspect, the present invention provides a method for assessing the efficacy of potential therapeutic agents for treating, preventing or ameliorating the symptoms of a pro- thrombotic disorder comprising:

[0041] (a) obtaining a non-human animal with hemophilia A or hemophilia B deficiency and protein C deficiency;

[0042] (b) administering said potential therapeutic agent to said non-human animal; and (c) assessing the effect of said potential therapeutic agent on a physiological parameter of said non-human animal. In an embodiment, said step (a) is performed by breeding a non-human animal having Factor VIII and / or Factor IX deficiency with a non- human animal heterozygous for PC deficiency and selecting animals which are homozygous for the PC deficiency.

[0043] In another aspect, the present invention provides a non-human animal for use in assessing the efficacy of potential therapeutic agents for treating, preventing or ameliorating the symptoms of a pro-thrombotic disorder, wherein said non-human animal has Factor VIII and / or Factor IX deficiency and is homozygous for PC deficiency.

[0044] In an embodiment, said Factor VIII and / or Factor IX deficiency is an inherited genetic deficiency or an induced deficiency.

[0045] In an embodiment, said induced deficiency is performed by knocking out the Factor VIII and / or Factor IX gene using siRNA, shRNA or CRISPR-CAS9 gene editing.

[0046] In an embodiment, the pro-thrombotic disorder is protein C deficiency (PCD).

[0047] In an embodiment, said physiological parameter is any one of: PC levels in the blood, animal survival and / or clinical thrombosis.

[0048] In an embodiment, said non-human animals are selected from a group consisting of a zebra fish, a mouse, a rat, a rabbit, a non-human primate and a dog.

[0049] In an embodiment, the PCD is severe protein C deficiency (SPCD).

[0050] BRIEF DESCRIPTION OF THE DRAWINGS

[0051] To better understand the subject matter that is disclosed herein and to exemplify how it may be carried out, embodiments will now be described, by way of non-limiting example only, with reference to the accompanying drawings, in which:

[0052] Fig. 1 is a schematic representation of an AAV expression cassette (plasmid) encoding protein C (PC). The PC cDNA transgene is under the control of a hepatocyte-specific promoter (alpha- 1 -anti -trypsin, AAT) with 3 copies of the Apolipoprotein E (ApoE) enhancer. The expression cassette consists of a short intronic sequence of the human P-globin gene, poly (A) sequence flanked by inverted terminal repeat (ITR) derived from AAV serotype 2.

[0053] Fig. 2 is a graph showing measurement of activated protein C (APC) using fluorescence intensity over time in supernatant of HepG2 cells that were infected with protein C-AAV8 vector, HepG2 that were not infected and medium containing FBS in which the cells were grown. (Hep+V refers to supernatant of virus infected HepG2 cells, Hep -V refers to the supernatant of non-infected HepG2 cells).

[0054] Fig. 3 is a graph showing human PC zymogen levels (ng / ml) in normal mice following injection of AAV8-vector encoding human PC zymogen at 3 different doses (n=number of mice).

[0055] Fig. 4 shows PCR results of genotyping heterozygous, homozygous, and wild type (WT) mice using appropriate primers for detection of PC. As can be seen in the upper panel, heterozygous PC deficient mice show two bands representing the wild type and the PC deficient PCR product, while WT mice show one band representing the WT PC PCR product. As can be seen in the lower panel, homozygous PC deficient mice show one band representing the PC deficient PCR product. Homozygous mice examples are marked by arrows and denoted as 4362, 4361, 4360, 4355. In both the upper and lower panels, the left lane contains an oligonucleotides ladder for defining the PCR product size.

[0056] Fig. 5A-C are graphs showing PC antigen and activity following gene therapy (GT). Fig. 5A is a graph showing antigen level (ng / ml) in PROC- / -7F8- mice at baseline before receiving GT (Pre GT) and following GT at week 6-8 (Post GT). Fig. 5B is a graph showing the time in weeks to increase and peak of plasma PC antigen following GT. The left bar presents the time range in weeks to initial PC increase following GT. The right bar presents the time range to plasma PC peak level. Fig. 5C is a graph showing activated PC level as percent of control in PROC- / -7F8- mice before receiving GT (Pre GT) and following GT at week 6-8 (Post GT).

[0057] Fig. 6A-B are representative images showing immunofluorescence staining for protein C in the liver of PC-deficient mice without PC gene therapy (6A) and in mice that received PC gene therapy (6B). Scale bar = 50 μm; magnification = x400.

[0058] DETAILED DESCRIPTION OF EMBODIMENTS

[0059] The present invention partly concerns protein C (PC) gene therapy (GT) for patients suffering from protein C deficiency, including severe protein C deficiency (SPCD) patients. In addition, the present invention concerns a unique non-human animal model that can be used for screening and assessing the efficacy of potential therapies for treating patients suffering from a pro-thrombotic disorder, e.g., PC deficiency, or SPCD.

[0060] The invention is based in part on the finding that delivery of the protein C (PC) gene using a recombinant adeno-associated viral (AAV) vector into mouse models of homozygous SPCD with comorbid severe hemophilia A induced endogenous PC synthesis in the mice’ liver and resulted in survival of the SPCD mice.

[0061] The study of putative SPCD therapeutics largely depends on the existence of an appropriate animal model. Homozygous PC- / -tg535mice which have PC levels of <1% have a similar phenotype to humans with SPCD, presenting at birth with skin necrosis of legs and tails (Jaibert et al., J Clin Invest. 1998; 102(8): 1481 -8). However, the PC - / -lg535mice have a high mortality rate. Only 2% of these mice survive for 6 months after delivery, and thus there are difficulties in using these mice as animal models to study SPCD.

[0062] In one of its aspects, the present invention provides a unique animal model for the study of pro-thrombotic disorders and potential therapeutics, in particular SPCD and potential SPCD therapeutics. The inventors generated a novel model creating protein C deficiency in mice with a background of hemophilia A. Without wishing to be bound by theory the hemophilic background partly counteracts the devastating effects of PC deficiency allowing PC deficiency homozygous mice to survive for long periods of time. Specifically, Hemophilia A mice with a C57B1 / 6 background (female harboring both X chromosomes with knock out for FVIII gene) were breed with heterozygous PC mice with a C57B1 / 6 background, allowing the selection and generation of a homozygous PC / Hemophilia A murine colony.

[0063] In an embodiment, the non-human animal (e.g., a mouse) is generated by creating protein C deficiency in a non-human animal with hemophilia B (i.e. a non-human animal with knock out for the Factor IX gene).

[0064] As an alternative to using mice with a genetic hemophilia background, hemophilia may also be induced in normal mice by knocking-out Factor VIII or IX, for example using short interfering RNA (siRNA), Short hairpin RNA (shRNA) molecules or CRISPR-CAS9 gene editing.

[0065] Factor VIII or Factor IX knock-out animals can be produced based on the RNA interference (RNAi) approach, e.g., siRNA or shRNA, using methods well known to the skilled artisan. For methods of delivery of the iRNA molecules into the animals see for example, Xie et al., Drug Discovery Today (2006), 11(1): 67-73.

[0066] CRISPR-CAS9 is largely used to knock out or modify DNA in research animals, e.g., in mice or rats. The knock-out animals can be produced by genetic transfer into the genomic locus of Factor VIII or Factor IX in embryos or embryonic stem cells using methods well known to the skilled artisan. For methods of producing knock-out animals using CRISPR-CAS9 editing, see for example, Ellen Shrock and Marc Guell, Progress in Molecular Biology and Translational Science, Chapter Six, Vol. 152, pages 95-114 (2017).

[0067] Accordingly, the present invention provides non-human animals with severe protein C deficiency combined with hemophilia A or B (also referred to as PROC_ / 7F8’ or PROC_ / 7F9' respectively), wherein these non-human animals have a prolonged life expectancy as compared with PROC- / -mice (mice homozygous to PC deficiency with a normal Factor VIII or Factor IX genetic background), for example a life expectancy of at least 6 months.

[0068] Such PROC- / -7F8' or PROC' 7F9- non-human animals may have any modification in the protein C genetic locus that results in a decrease or lack of expression of the PC gene, and / or a decrease or lack of activity / fiinction (e.g., anti-coagulation activity) of the PC protein. The expression level of PC may be measured directly, for example by assaying the level of PC in the animal’s plasma e.g., using ELISA. The activity / fiinction of PC may be measured directly, for example by assaying substrate cleavage by plasma PC using a labelled substrate, or by performing a tail bleeding test to quantify blood loss.

[0069] In general, the expression level and / or activity of PC is considered decreased if the PC expression level and / or activity is statistically lower (p<0.05) than the PC level in a control non-human animal that is homozygous or heterozygous to the PC gene (i.e., PROC+ / +or PROC+ / -). A decreased level is defined as below 60% for heterozygous non-human animals. Homozygous non-human animals have no PC at all. In specific embodiments, the concentration and / or activity of the PC is decreased by at least 90%, 95%, 99% or more relative to the control non-human animal. In an embodiment, the concentration and / or activity of the PC is decreased by 100%, relative to the control non-human animal.

[0070] The PROC- / - / F8- or PROC 7F9- non-human animals may have any modification in the Factor 8 (also referred to herein as F8, Factor VIII or FVIII) or Factor 9 (also referred to herein as F9, Factor IX or FIX) genetic locus that results in a decrease or lack of expression of the F8 or F9 gene, and / or a decrease or lack of activity / fiinction of the F8 or F9 protein. The expression level of F8 or F9 may be measured directly, for example by assaying the level of F8 or F9 in the animal’s plasma e.g., using ELISA. The activity / fiinction of F8 or F9 may be measured directly, for example by a functional ELISA for F8 or F9 which detects the presence of functional proteins by assaying their specific activity characteristics.

[0071] In general, the expression level and / or activity of F8 or F9 is considered decreased if the F8 or F9 expression level and / or activity is statistically lower (p<0.05) than the F8 or F9 level in a control non-human animal that is homozygous or heterozygous to the F8 or F9 gene (i.e., F8+ / +, F8+ / ", F9+ / +or F9+ / "). In specific embodiments, the concentration and / or activity of the F8 or F9 is decreased by at least 90%, 95%, 99% or more relative to the control non-human animal. In an embodiment, the concentration and / or activity of Factor 8 or Factor 9 is decreased by 100%, relative to the control non-human animal.

[0072] The non-human animals of the invention may also be selected using methods that include, but are not limited to, Southern blot analysis, DNA sequencing, PCR analysis, or phenotypic analysis. Such non-human animals are then employed in the methods of screening and assessment described herein.

[0073] As used herein the term “assessing the efficacy” refers to the screening of therapeutic agents potentially suitable for treating, preventing or ameliorating the symptoms of a pro- thrombotic disorder. Specifically, but not limited to, the term “assessing the efficacy” refers to the screening of potential anti protein C therapeutic agents to assess their ability to increase protein C levels or activity in treated animals.

[0074] As the non-human animals of the invention are characterized by a combination of hemophilia and protein C deficiency, they can be used for assessing the efficacy of therapeutic agents for treating other severe pro-thrombotic and potentially lethal disorders, e.g., antithrombin deficiency or severe protein S deficiency, as their bleeding coagulopathy can be temporarily corrected. The correction of the coagulopathy can be done for example by administering a blood clotting coagulation concentrate, (e.g., isolated Factor VIII or Factor IX depending on the type of hemophilia), to enable further research, therapy and potential cure of the pro-thrombotic disorder.

[0075] As used herein the terms “pro-thrombotic disorder”, “pro-thrombotic disease” or “pro-thrombotic condition” refers to disorders associated with blood clotting complications, including, but not limited to protein C deficiency (PCD), severe protein C deficiency (SPCD), antithrombin deficiency and protein S deficiency.

[0076] Protein C (PC) is a vitamin K-dependent protein synthesized in the liver (Bouwenset al., J ThrombHaemost . 2013;l l Suppl 1(0 l):242-53). The protein circulates in plasma as an inactive form (zymogen), composed of a light polypeptide chain and a heavy polypeptide chain, connected by a disulfide bond. PC activation takes place on the surface of endothelial cells when it binds to its membrane receptor, the endothelial cell protein C receptor (EPCR) (Stearns-Kurosawa DJ, et al., Proc Natl Acad Set USA 1996;93(19): 10212.-6), The endothelial cell protein C receptor augments protein C activation by the thrombin-thrombomodulin complex. Activation is enhanced by the thrombin-thrombomodulin complex. Activated PC (APC) serves as a natural anticoagulant that cleaves coagulation factors Va and Villa, thereby inhibiting thrombin formation (Hanson et al., J Clin Invest. 1993;92(4):2003-12).

[0077] Independently, APC also induces diverse cell signaling pathways involved in anti- apoptotic and anti-inflammatory activities, as well as stabilization of endothelial and epithelial barriers (Griffin et al., Blood 2015;125(19):2898-907; Vetrano et al., Proc Natl Acad Set USA 2011 ; 108(49): 19830-5).

[0078] The human protein C (PROC) gene is located on chromosome 2 at position 2ql3-14 and consists of 9 exons with a 1.4kb cDNA (D'Ursiet al., BMC Bioinformalics 2007;8 Suppl 1 (Suppl 1 ):S 11 ), encoding a PC zymogen which is 461 amino acids long. Exon 1 is not translated, exon 2 encodes for the signal peptide, exon 3 encodes for the pro-peptide and Gia domain, exon 4 encodes for a short helical aromatic motif, exons 5 and 6 encode for the 2 epidermal growth factor-like domains (EGF-1 and EGF-2), exon 7 encodes for the binding and activation peptides, and exons 8 and 9 encode for the serine protease domain with the catalytic site, the hydrophobic pocket, the binding sites for factor Va and for an exosite region (Martos et al.,Thrornb Haemost. 2019; 119(9): 1409-1418).

[0079] The aim of gene therapy is to attain durable expression of the deficient gene at a level sufficient to ameliorate or cure disease symptoms with minimal adverse events (High and Roncarolo N Engl J Med 20 J 9;38 J (5):455-464).

[0080] In accordance with the invention, addition of a normal copy of the PC gene to patients suffering from SPCD counteracts the disfunction of the native mutated gene. Without wishing to be bound by theory, a small increase in PC in SPCD patients may significantly alter the clinical presentation by preventing PF, making SPCD an ideal candidate for gene therapy. Furthermore, most SPCD patients do have some residual PC (antigen and / or activity, cross reacting material (CRM) positive); thus, the likelihood of developing immune responses against a neoantigen is minimal.

[0081] As described in detail in the Examples below, PROC cDNA was inserted into an AAV serotype 8 (AAV-8) vector to enable its transfer into liver cells. AAV-8 has high tropism for liver of mice, dogs, and humans, thus enhancing the targeted clinical translational potential of the transcript. As shown below, AAV8-PROC gene therapy improved and retained PC levels in a murine SPCD model, namely in PC deficient mice. Optimal vector dose was established to achieve efficiency, safety profiles and optimal effect on coagulation parameters. Accordingly, the present invention provides a method of treating, preventing, or ameliorating the symptoms of protein C deficiency in an individual in need thereof comprising administering an adeno associated virus (AAV) vector comprising a nucleic acid sequence encoding protein C (AAV-PC) to said individual.

[0082] It is to be understood that the terms "treat”, "treating . "treatment" or forms thereof, as used herein, mean reducing, preventing, curing, reversing, ameliorating, attenuating, alleviating, minimizing, suppressing, or halting the deleterious effects of a disease or a condition or delaying the onset of one or more clinical indications of protein C deficiency, as defined herein. In some embodiments the methods according to the invention are wherein said methods further comprise administering to a subject in need thereof an additional therapeutic agent.

[0083] In another aspect, the present invention provides a method of increasing protein C levels in the blood or plasma of an individual in need thereof comprising administering an adeno associated virus (AAV) vector comprising a nucleic acid sequence encoding protein C (AAV-PC) to said individual.

[0084] The terms “individual in need thereof’ and “subject in need thereof” are used interchangeably herein and refer to a mammal (e.g., a human) suffering from Protein C deficiency.

[0085] In general, the level of PC is considered increased if the PC level is statistically higher (p<0.05) than the PC level prior to treatment with AAV-PC. In specific embodiments, the PC level is increased to at least 10%, 12%, 15%, or more relative to the PC level of said individual prior to treatment PC levels may be measured for example in plasma.

[0086] As set forth herein, adeno-associated virus (AAV) provides a means for delivery of polynucleotide sequences encoding protein C into cells (either ex vivo, in vitro or in vivo). The cells to which the polynucleotides are delivered express the encoded protein.

[0087] Thus, provided herein in accordance with the invention AAV vectors (also referred to herein as AAV recombinant vectors) that include (e.g., package) expression cassettes (also referred to herein as plasmids) comprising polynucleotide sequences encoding protein C.

[0088] The terms “expression cassette” and “plasmid” are used interchangeably herein. The plasmids are derived from a replication deficient virus of the parvoviridiae family with a ~5 kb genome. Parvoviruses are small viruses with a single -stranded DNA genome. The plasmid can have one or more of the wild-type AAV genes deleted in whole or in part, for example, a replication and / or capsid gene, but retain at least one functional flanking ITR sequence, as necessary for the rescue, replication, and packaging of the recombinant plasmid (expression cassette) into an AAV vector particle or capsid. The wild-type AAG genes can be of any AAV serotype, for example, but not limited to AAV-1, -2, -3, -4, -5, -6, -7, -8, -9, -10, or -11. In one embodiment, the ITR sequences are of AAV serotype 2.

[0089] In an embodiment, the plasmid of the invention lacks all viral genes, ~ 96% (replication and capsid genes), and retains only the short 145 bp inverted terminal repeats (ITRs) sequences from the wild-type components. The ITRs flank the PC gene and its regulatory elements such as (promoter / enhancer, poly(A) tail). Thus, in the plasmid, all viral coding sequences are replaced with a transgene, a promoter, and intronic enhancer elements; the ITRs are retained as they are required for DNA packaging into the capsid and for conversion of the single -stranded plasmid genome to the transcription-competent latent form for persistent transgene expression. The viral capsid determines tissue tropism and the promoter grants specificity to the target cell or tissue.

[0090] As used herein recombinant "AA V vectors" (rAAV) are produced by packaging the plasmid into an AAV vector. Namely, a plasmid sequence can be packaged into an AAV (also referred to herein as a "particle " or “virion ") for subsequent infection (transformation) of a cell, ex vivo, in vitro, or in vivo. Where a plasmid sequence is packaged into an AAV particle, such particles or virions will typically include proteins that package the vector genome. Examples include viral envelope proteins, or capsid proteins.

[0091] Parvoviruses including AAV are useful as gene therapy vectors as they can penetrate cells and introduce nucleic acid / genetic material so that the nucleic acid / genetic material may be stably maintained in cells. Because adeno associated viruses are not associated with pathogenic disease in humans, AAV vectors are able to deliver heterologous polynucleotide sequences (e.g. protein C) to human patients without causing substantial AAV pathogenesis or disease.

[0092] As used herein the term “AAV-PC” refers to an AAV vector comprising polynucleotide sequences encoding protein C.

[0093] As used herein, the term "serotype " is a distinction used to refer to an AAV having a capsid that is serologically distinct from other AAV serotypes. Serologic distinctiveness is determined based on the lack of cross-reactivity between antibodies to one AAV as compared to another AAV. Such cross-reactivity differences are usually due to differences in capsid protein sequence s / antigenic determinants. Recombinant AAV vectors, as well as methods and uses thereof, include any AAV serotype. As a non-limiting example, a recombinant AAV vector can be based upon any AAV genome, such as AAV-1, -2, -3, -4, -5, -6, -7, -8, -9, -10, or -11.

[0094] In some embodiments, the AAV-vectors are AAV-5 or AAV -2 serotype vectors.

[0095] In an embodiment, the AAV-vectors are AAV-8 serotype vectors.

[0096] The AAV vector of the invention can be used to introduce / deliver polynucleotides stably or transiently into cells and progeny thereof. The term “transgene” is used herein to conventionally refer to a heterologous polynucleotide encoding protein C that has been introduced into a cell or an organism by way of transfection with the AAV vector of the invention.

[0097] The transfection of the cells with the AAV-PC vector leads to “transformation” of the cell. The terms “transform” and “transfer” refer to introduction of a molecule such as a polynucleotide encoding protein C into a cell or host organism.

[0098] A cell into which the protein C transgene has been introduced is referred to as a “transformed cell”.

[0099] Accordingly, a “transformed” or “transfected” cell, means a genetic change occurred in that cell following incorporation of an exogenous polypeptide encoding protein C into the cell. The introduced polynucleotide encoding protein C may or may not be integrated into nucleic acid of the recipient cell. If an introduced polynucleotide encoding protein C becomes integrated into the nucleic acid (i.e., genomic DNA) of the recipient cell it can be stably maintained in that cell and further passed on to progeny cells. Alternatively, the introduced polynucleotide encoding protein C may exist in the recipient cell only transiently.

[0100] The use of rAAV can mediate stable and long-term transgene expression in most mammalian tissues without pathogenicity and minimal integration into the host genome.

[0101] The terms “Protein C” and “protein C zymogen ” are used interchangeably herein and refer to the inactive form of the protein. The zymogen form differs from the activated protein C (APC) form which is generated for example upon binding of protein C to its membrane receptor and is mediated by the thrombin-thrombomodulin complex or may be produced recombinantly. For example, the AAV-PC vector of the invention may encode the activated PC form.

[0102] The sequence of protein C zymogen is well known to the skilled artisan. In one embodiment the nucleic acid encoding PC zymogen is at least 90% or more identical to SEQ ID No. 2, e.g., at least 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc. identical to SEQ ID No. 2. In one embodiment the nucleic acid encoding PC zymogen is SEQ ID No. 2.

[0103] In one embodiment the AAV vector encoding PC is the vector denoted by SEQ ID No. 1, or vector having at least 80% or more identity with SEQ ID No. 1, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc. identity with SEQ ID No. 1.

[0104] The terms “nucleic acid” and “polynucleotide” are used interchangeably herein to refer to all forms of nucleic acid, oligonucleotides, including deoxyribonucleic acid (DNA) (including genomic DNA and cDNA), and ribonucleic acid (RNA) (including spliced or unspliced mRNA). Polynucleotides include naturally occurring, synthetic, and intentionally altered or modified polynucleotides as well as analogues and derivatives. Polynucleotides can be single, double, or triplex, and can be of any length. When referring to a specific nucleic acid sequence, the sequence is shown according to the acceptable 5’ to 3’ direction.

[0105] Recombinant AAV vectors can be constructed using recombinant techniques that are known to the skilled artisan, for example, but not limited to, as described in the Examples section.

[0106] In one embodiment, an expression cassette including a heterologous polynucleotide sequence encoding protein C flanked with one or more functional AAV ITR sequences and additional regulatory elements (e.g., a promoter, an enhancer etc.) is produced using recombinant methods. The expression cassette may be introduced into bacteria (e.g., E. Coli) to amplify the number of plasmids. Next, to generate the AAV-PC vector, suitable cells (e.g., HEK293 cells) are transfected with the PC expression cassette, an AAV vector (e.g., AAV8) and a helper plasmid (e.g., PX-680 or pPLUS) to obtain a transformed cell comprising the AAV-PC vector. The AAV-PC vector is collected from the transformed cell and may be used for gene therapy by injecting into a subject in need thereof.

[0107] The transfection into bacteria or cells can be performed using any method known in the art, using for example calcium phosphate, Lipofectamin or other transfection reagents, electroporation, artificial liposomes, DEAH or Dextran.

[0108] Administration according to the present invention may be performed by any of the following administration routes: oral, intravenous, intramuscular, intraperitoneal, intrathecal, subcutaneous, intra-rectal, intranasal, ocular, intracranial, or topical administration.

[0109] In specific embodiments administration according to the present invention may be performed intravenously. In other specific embodiments administration may be performed intraperitoneally. In other specific embodiments administration may be performed intramuscularly.

[0110] In one embodiment, the AAV-PC vector is administered to patients by intravenous injection via a peripheral vein.

[0111] In accordance with the invention, the AAV8-PC is administered to patients with PC deficiency, including patients with severe PC deficiency (SPCD). Without wishing to be bound by theory, the administration of AAV8-PC will lead to sufficient and sustained production of PC by liver-cells.

[0112] In an aspect, the present invention provides a pharmaceutical composition comprising an adeno associated virus (AAV) vector comprising a nucleic acid sequence encoding protein C (AAV-PC) as herein defined, and one or more pharmaceutically acceptable carriers excipients and / or diluents as known in the art.

[0113] As used herein the term "pharmaceutically acceptable carrier, excipient or diluent” includes any solvents, dispersion media, coatings, antibacterial and antifungal agents and the like, as known in the art. The carrier can be solvent or dispersion medium containing, for example, water, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof. Each carrier should be both pharmaceutically and physiologically acceptable in the sense of being compatible with the other ingredients and not injurious to the subject. Except as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic composition of the invention is contemplated.

[0114] In other embodiments the pharmaceutical composition according to the invention further comprises an additional therapeutic agent. Non-limiting examples of additional therapeutic agents include additional anti coagulation agents. Thus, in specific embodiments the pharmaceutical composition according to the invention further comprises, or is administered in combination with, an additional therapeutic agent for example, but not limited to an anti-coagulant. The anti-coagulant may be heparin or DOACs (Direct oral anticoagulant medications) including for example dabigatran, rivaroxaban, apixaban or edoxaban.

[0115] The term "about" as used herein indicates values that may deviate up to 1%, more specifically 5%, more specifically 10%, more specifically 15%, and in some cases up to 20% higher or lower than the value referred to, the deviation range including integer values, and, if applicable, non-integer values as well, constituting a continuous range. Disclosed and described, it is to be understood that this invention is not limited to the specific examples, methods steps, and compositions disclosed herein as such methods steps and compositions may vary somewhat. It is also to be understood that the terminology used herein is used for the purpose of describing specific embodiments only and not intended to be limiting since the scope of the present invention will be limited only by the appended claims and equivalents thereof.

[0116] It must be noted that, as used in this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise.

[0117] Throughout this specification and the Examples and claims which follow, unless the context requires otherwise, the word "comprise ", and variations such as "comprises " and "comprising , will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[0118] EXAMPLES

[0119] Materials and Methods

[0120] Protein C plasmid preparation

[0121] The sequence of the plasmid comprising murine PC zymogen hereby denoted as SEQ ID NO: 1 is:

[0122] The expression cassete contained cDNA of wild type murine protein C with three copies of the liver-specific ApoE enhancer region and the liver-specific human alpha- 1 antitrypsin (hAAT) promoter (Figure 1), a chimeric P-globin / CMV intron, and the human growth hormone polyadenylation (hGH poly A) signal flanked by inverted terminal repeats (ITR) derived from AAV serotype 2. To upscale the quantity of the protein C plasmid, transformation was performed in E. coli cells (Sure cells AGILETE catalogue number 200152) according to the standard protocol, followed by overnight incubation on ampicillin agar plates at 37°C. Following incubation, the plates were placed in 4°C for 10 hours. Colonies were chosen and were each incubated in 3 ml NZY+ medium with ampicillin. The tubes were shaken overnight at 225 rpm at 37°C.

[0123] Purification of the colonies' plasmids was done using QIAprep spin Mega kit (Qiagen), according to the manufacturer's protocol. Sequencing was done to verify the plasmid sequence.

[0124] H293 cell line

[0125] H293 (HEK 293) cells were grown in DMEM (Invitrogen Cat# 11995-065) with 10% FBS (Thermo Fischer Gibco A4766801). The cells were split two days prior to transfection by PBS (Invitrogen Cat 11995065) washing followed by trypsin treatment (Invitrogen # 25300-054) to detach them. The cells were incubated at 37°C and 5% CO2. No antibiotics were used in the culture plates.

[0126] Production of rAAV containing protein C

[0127] To produce rAAV containing protein C, HEK 293 cells were transfected at 70% confluence with the PC plasmid (as described above), AAV 8 and PX-680 (used as a rAAV helper) using the calcium-phosphate method, as previously described (Jalbertet al., J Clin Invest 1998; 102(8): 1481-8). Harvesting the AAV-protein C product was done 48 hours following transfection by cell scraping followed by centrifugation at 1500 rpm for 15 min. Following centrifugation, the fluid was removed under sterile conditions and the remaining supernatant (the recombinant cells with the virus) is frozen at -80°C.

[0128] Extraction and purification of rAAV

[0129] Vectors were purified by commercial AAV purification kit (Takara, Japan). Vector was osmotically stabilized in Hepes-buffered saline, pH 7.8, filter-sterilized, and stored at -80°C prior to use. Vector titers were determined by quantitative commercial PCR (Takara, Japan).

[0130] The products were divided into aliquots of 200 microliter / tube for animal injection and stored at -80°C.

[0131] Administration of PC-rAAV

[0132] Six- to eight-week-old PROC- / 7F8“ mice were administered 1012vg / kg of AAV8-PC via tail vein injection. Blood was collected via facial vein into 3.8% sodium citrate (1: 1 ratio), and plasma was frozen for further analyses.

[0133] PC antigen and activity levels were sequentially monitored for 12 weeks.

[0134] Quantification of murine PC antigen

[0135] Plasma samples were taken sequentially every 2 weeks. Murine PC antigen levels were measured using a commercial ELISA (Lsbio, USA) based on colorimetric detection at 450 nm, according to the manufacturer’s instructions. PC antigen levels were determined by comparison of the samples to the known standard curve, supplied by the kit.

[0136] Quantification of murine PC activity PC activity (Activated protein C (APC)) was assessed in plasma using a Anorogenic substrate as previously described (Golderman V. et al., Int J Moi Sci. (2020) 21(7):2422). BrieHy, the reactions were carried out in black 96-well microplates (Greiner, Austria). The plasma was diluted (1:5) in Tris buffer (150 mM NaCl, 1 mM CaCh, 50 mM Tris-HCl, pH 8.0) and activated using 3mM CaCh before addition of the substrate. Protein C was activated using PROTAC. Cleavage of the Auorogenic substrate (Pyr-Pro-Arg-AMC, 20 pM, GL Biochem Shanghai Ltd., Minhang district, Shanghai, China) was measured at 37 °C every 2 min over 25 cycles (excitation at 360 ± 9 nm and emission at 465 ± 20 nm) using a microplate reader (Tecan; Infinite 200; Mannedorf, Switzerland). The activity was calculated according to the linear increase in Auorescence intensity over time. Results are presented as percentages relative to control.

[0137] Bleeding phenotype

[0138] Tail clip assays are performed as previously described (Samelson-Jones and Arruda Mol Ther Methods Clin Dev 2018; 12: 184-201). BrieAy, tails are placed in 37°C normal saline for two minutes and then transected at a 3 mm diameter. The tail was immediately placed in 14 mL 37°C saline and allowed to bleed / clot freely for 10 minutes. The tail was then removed and sutured. Blood was pelleted, then lysed in 6 mL lysis buffer, and blood loss was quantified by measuring absorbance of 575 nm light as previously described (Margaritis et al., J Clin Invest. 2004; 113(7): 1025-31).

[0139] Liver histology, local transgene expression levels and vector copy DNA

[0140] Potential liver toxicity and viral integration are assessed by liver biopsies once animals are sacrificed, as previously described (Golderman et al. Int J Mol Sci 2020;21(7):2422). Liver tissue for nucleic acid and protein isolation, as well as pathological assessment, is collected and frozen in liquid nitrogen immediately to detect the transgene expression aAer vector delivery.

[0141] PC gene expression in murine liver prior to and after GT

[0142] Total RNA was extracted from homogenized murine livers using Rneasy Mini Kit (Qiagen, Germany) and reverse-transcribed into cDNA using cDNA Reverse Transcription Kit (ThermoFisher Scientific, Lithuania) according to the manufacturers’ instructions. cDNA samples were analyzed for PC RNA levels by quantitative real-time PCR analysis using the ABI 7500 Fast device (Applied Biosystems, USA), using the following primers: Forward: TGAATTTTCCATGTGGGAAACTGG (SEQ ID MO: 11)

[0143] Reverse: CTGCCAAGGACTGTCACCCTG (SEQ ID NO: 12)

[0144] Fragment size: 146 bp

[0145] PC immunostaining in murine liver biopsy

[0146] A total of 2 mice of each group (PC deficient and PC deficient following gene therapy) were used to evaluate the presence of protein C. Six weeks post-treatment, mice were sacrificed, livers were removed and fixed in 4% PFA for 2 hours at room temperature (RT). Tissues were incubated with 30% sucrose in PBS overnight at 4°C, embedded in OCT compound (Sakura Finetek, Japan) on dry ice and kept at -80 °C. Serial sections of 10 μm thickness were cut using a cryostat (Leica Biosystems, Germany). Sequential cryosections of each liver were incubated in citric acid lOmM for 10 minutes at 95 °C, blocked with 10% NDS for 1 hour at RT, and then incubated with rabbit anti-protein c (1:250, Abeam, UK) at 4°C overnight. The next day, sections were incubated with Alexa Fluor 488 conjugated donkey anti -rabbit secondary antibody (1: 100, Invitrogen, USA). Nuclei were counterstained with DAPI (Nucblue fixed cell stain, Molecular Probes, USA). Images were captured using a confocal microscope (Nikon Ax, Nikon, Japan) under the same conditions.

[0147] Statistical analysis

[0148] Commercial software is used for statistical analysis (SPSS, IL, USAand / or GraphPad Prism, CA, USA). Comparisons between two groups (protein C deficient mice and controls) are performed using Student’s t tests and comparisons among multiple groups - using 1-way ANOVA followed by Bonferroni’s or Dunnett’s post hoc tests. p<0.05 is considered statistically significant.

[0149] Example 1: Production of PC in HepG2 cells transfected with PC-AAV8

[0150] A PC-AAV8 vector was produced as described above. Following initial production, QT-PCR was performed to quantify the virus as described above. To examine the function of the virus, HEPG2 cells were infected with the virus by diluting the vector with 1 ml of DMEM medium and placing it on 50% confluent plates of HEPG2 cells. The medium (DMEM+10%FBS) was changed 2 hours prior to the experiment. The levels of zymogen PC in supernatant from hepG2 that have been infected with the vims were compared to control HepG2 cells without infection with the vims, however 1 ml of medium was added as control. It should be noted that HepG2 cells produce endogenous PC. Figure 2 demonstrates fluorescence measurement of APC in the supernatant taken from HEPG2 cell line infected with AAV8-PC zymogen compared to HepG2 cell line with no vims. Significantly higher levels of PC were found in the supernatant from HepG2 cells that were infected with the vims (Figure 2).

[0151] Example 2: Levels of PC in wild type mice infused with PC-AAV8

[0152] AAV8-PC was injected via the tail vein into 6-8 weeks old Black-CBL-6 wild type mice (whose PC activity was normal) at 3 different doses: 2x10 viral genomes (vg) / kg

[0153] (n=4), 1x10 vg / kg (n=4), 5x10 vg / kg (n=4). In all mice increased levels of PC were demonstrated overtime (Figure 3).

[0154] Example 3: Preparation of viable homozygous Protein C deficient mice

[0155] Breeding of heterozygous PC mice yielded only 3 / 200 homozygous SPCD mice (undetectable PC levels), instead of 50 / 200 expected by Mendelian inheritance, indicative of near embryonic lethality. Homozygous SPCD mice survived for less than 24 hours in concordance with previous reports (Wang L, et al., Proc. Natl. Acad. Sei. U S A. 1997;94(21): 1 1563-6).

[0156] To generate homozygous PC deficient mice that can serve as a viable animal model for studying PC deficiency and potential therapeutics for PC, C57B1 / 6 mice which are heterozygous for PC were bred with C57B1 / 6 mice with Hemophilia A (females harboring both X chromosomes with knock out for FVIII gene) purchased from Jackson Laboratories to create a homozygous PC mice / Hemophilia A (PROC' / F8_) murine colony. Wild type C57B1 / 6 mice (Envigo, Israel) served as controls. Genotyping of the mice was performed with purified DNA from an ear tag, using polymerase chain reaction (PCR) with appropriate primers for both WT PC and PC deficient, as well as primers for detecting hemophilia, namely for detecting the mutant allele lacking factor VIII, and primers for the WT allele.

[0157] Cycles 2-4 were repeated 35 times.

[0158] Tm= 65°C

[0159] All animal experiments were approved by the Institutional Animal Care and IRB Committee at Sheba Medical center.

[0160] This approach yielded homozygous SPCD mice with severe HA (PROC 7F8-). These animals exhibited a substantially prolonged survival compared to homozygous SPCD mice with normal F8 levels (>90% survived for >6 months (n=20)).

[0161] The WT mice (n=20) and HA mice (n=20) exhibited comparable PC antigen levels. In PROC- / - / F8- mice, neither PC nor FVIII antigens were detected, and mRNA extracted from the liver confirmed the absence of both PC and FVIII expression, validating the SPCD / HA murine model.

[0162] As demonstrated for example in Fig. 4, showing the presence of a single band representing the PC deficient PCR product in the PROC- / 7F8“ mice, as opposed to the double band typical to the heterozygous mice or the single band of the wildtype mice.

[0163] Example 4: Levels of PC homozygous PC mice infused with PC-AAV8 Ten 6-8-week-old PROC-7F8” mice were administered 1012vg / kg of AAV8-PC via tail vein injection. PC antigen and activity levels were sequentially monitored for 12 weeks.

[0164] The plasma PC antigen levels increased following rAAV8-PC gene therapy in all 10 animals, though with variable kinetics. Initial detection of PC antigen levels occurred 2-5 weeks post-vector infusion. Individual maximal PC levels ranged from 166 to 2488 ng / ml, with a median of 714 ng / ml (Figure 5 A), measured between 2-10 weeks post-GT.

[0165] Mice exhibited a variable time from the injection of rAAV8-PC until the initial detection of PC antigen in plasma (Figure 5B). Peak plasma PC were reached at a median of 6 weeks like FIX gene transfer in mice (Mingozzi F., et al., (2003) The Journal of clinical investigation, 7 / 7(9), 1347-1356). As expected, PROC7F8" mice (n=10) that did not receive rAAV8-PC had undetectable PC antigen levels. After reaching peak PC levels, all mice maintained high levels of PC until at least 12 weeks after GT.

[0166] Similarly, significantly higher PC activity was measured in rAAV8-PC treated mice (Figure 5C). Peak PC activity levels were 300 ± 60%, compared to 100 ± 20% in the WT control group (p=0.0034) and undetectable in the untreated-control PROC 7F8' mice. Combined, these results demonstrate that rAAV8-PC administration results in functional PC at therapeutically relevant levels.

[0167] Example 5: Confirmation of gene therapy by PC staining in the liver post-GT

[0168] PC presence in the liver following GT was further confirmed by immunofluorescence staining with an anti-protein C antibody. Figure 6 illustrates PC staining in livers from representative mice: an untreated PC deficient mouse (PC deficient) (Fig. 6A) and a PC deficient mouse post-GT (PC gene therapy) (Fig. 6B). No PC protein was detected in the liver of PROC- / ” mice prior to gene therapy. In contrast, a pronounced PC staining was detected in the liver of the mice that underwent gene therapy, which was consistent with a high plasma PC antigen level. The representative mouse shown in Figure 6 had a PC antigen plasma level of 560 ng / ml at the time of sacrifice.

Claims

CLAIMS:

1. A method of treating, preventing, or ameliorating the symptoms of protein C deficiency in an individual in need thereof comprising administering an adeno associated virus (AAV) vector comprising a nucleic acid sequence encoding protein C (AAV-PC) to said individual.

2. The method of claim 1, wherein the protein C deficiency is severe protein C deficiency (SPCD).

3. A method of increasing protein C levels in the blood or plasma of an individual in need thereof comprising administering an adeno associated virus (AAV) vector comprising a nucleic acid sequence encoding protein C (AAV-PC) to said individual.

4. The method of any one of the preceding claims, wherein the protein C is a protein C zymogen or an activated protein C (APC).

5. The method according to any one of the preceding claims, wherein said nucleic acid sequence encodes a protein C zymogen and wherein said nucleic acid is about 90-100% identical to SEQ ID No. 2.

6. The method according to any one of the preceding claims, wherein said AAV vector is AAV-8.

7. The method according to any one of the preceding claims, wherein said AAV-PC vector is administered by intravenous injection, intramuscular injection, or intraperitoneal injection.

8. The method according to any one of the preceding claims, wherein the AAV-PC vector is administered in combination with an additional therapeutic agent.

9. A pharmaceutical composition comprising an adeno associated virus (AAV) vector comprising a nucleic acid sequence encoding protein C (AAV-PC), and one or more pharmaceutically acceptable carriers.

10. The pharmaceutical composition according to claim 9 for treating, preventing, or ameliorating the symptoms of protein C deficiency in an individual, and / or for increasing protein C levels in the blood or plasma of an individual.

11. The pharmaceutical composition of claim 9, wherein the protein C deficiency is severe protein C deficiency (SPCD).

12. The pharmaceutical composition of any one of claims 9 to 11, wherein the protein C is a protein C zymogen or activated protein C (APC).

13. The pharmaceutical composition according to any one of claims 9 to 12, wherein said nucleic acid sequence encodes protein C zymogen and wherein said nucleic acid sequence is about 90-100% identical to SEQ ID No. 2.

14. The pharmaceutical composition according to any one of claims 9 to 13, wherein said AAV vector is AAV-8.

15. The pharmaceutical composition according to any one of claims 9 to 14, wherein said AAV-PC vector is administered by intravenous injection, intramuscular injection, or intraperitoneal injection.

16. The pharmaceutical composition according to any one of claims 9 to 15, wherein the AAV-PC vector is administered in combination with an additional therapeutic agent.

17. A method for assessing the efficacy of potential therapeutic agents for treating, preventing or ameliorating the symptoms of a pro-thrombotic disorder comprising:(a) obtaining a non-human animal with hemophilia A or hemophilia B deficiency and protein C deficiency;(b) administering said potential therapeutic agent to said non-human animal; and(c) assessing the effect of said potential therapeutic agent on a physiological parameter of said non-human animal.

18. The method of claim 17, wherein said step (a) is performed by breeding a non-human animal having Factor VIII and / or Factor IX deficiency with a non-human animal heterozygous for PC deficiency and selecting animals which are homozygous for the PC deficiency.

19. The method of claim 18 wherein said Factor VIII and / or Factor IX deficiency is an inherited genetic deficiency or an induced deficiency.

20. The method of claim 19 wherein said induced deficiency is performed by knocking out the Factor VIII and / or Factor IX gene using siRNA, shRNA or CRISPR-CAS9 gene editing.

21. The method of any one of claims 17-20 wherein said pro-thrombotic disorder is protein C deficiency (PCD).

22. The method of claim 21, wherein the protein C deficiency is severe protein C deficiency (SPCD).

23. The method of any one of claims 17-22 wherein said physiological parameter is any one of: PC levels in the blood, animal survival and / or clinical thrombosis.

24. The method of any one of claims 17 to 23 wherein said non-human animal is selected from a group consisting of a zebra fish, a mouse, a rat, a rabbit, a non-human primate and a dog.

25. A non-human animal for use in assessing the efficacy of potential therapeutic agents for treating, preventing or ameliorating the symptoms of a pro-thrombotic disorder, wherein said non-human animal has Factor VIII and / or Factor IX deficiency and is homozygous for PC deficiency.

26. The non-human animal for use of claim 25 wherein said non-human animal is selected from a group consisting of a mouse, a rat, a rabbit, a non-human primate and a dog.

27. The non-human animal for use of claim 25 or 26, wherein the pro-thrombotic disorder is protein C deficiency (PCD).

28. The non-human animal for use of claim 27, wherein the protein C deficiency is severe protein C deficiency (SPCD).

Images