Novel protein that secretes 1,3-propanediol and method for producing 1,3-propanediol using same

Abstract

The present invention relates to a novel protein that secretes 1,3-propanediol and a method for producing 1,3-propanediol, using same and, more specifically, provides: a recombinant protein or functional fragment thereof that exhibits the activity of secreting 1,3-propanediol produced and accumulated in cells to the outside of the cells; a polynucleotide encoding the recombinant protein or a functional fragment thereof; a recombinant expression vector comprising the polynucleotide; a microorganism for producing 1,3-propanediol, overexpressing the recombinant protein or a functional fragment thereof; and a method for producing 1,3-propanediol, using same.

Description

Novel 1,3-propanediol secreting protein and method for producing 1,3-propanediol using the same

[0001] The present invention relates to a novel 1,3-propanediol secretory protein and a method for producing 1,3-propanediol using the same, and more specifically, to a recombinant protein or a functional fragment thereof that exhibits an activity of secreting 1,3-propanediol produced and accumulated inside a cell to the outside of the cell, a polynucleotide encoding the recombinant protein or the functional fragment thereof, a recombinant expression vector comprising the polynucleotide, a microorganism for producing 1,3-propanediol that overexpresses the recombinant protein or the functional fragment thereof, and a method for producing 1,3-propanediol using the same.

[0002] 1,3-Propanediol (1,3-PDO) is a chemical used as a monomer in the synthesis of polymers such as polyethers, polyurethanes, and polytrimethylene terephthalate (PTT). Conventional production methods for 1,3-PDO have primarily involved chemical synthesis, including the hydration of acrolein, the hydroformylation of ethylene oxide in the presence of phosphine, and the enzymatic conversion of glycerol. However, these chemical production methods have limitations due to their high cost and environmentally hazardous production processes (Non-patent Document 1 and Patent Document 1).

[0003] Biological methods include a method of producing 1,3-PDO using microorganisms, and a study has been reported on Corynebacterium glutamicum using glucose and glycerol as carbon sources to promote cell growth with glucose and produce 1,3-PDO with glycerol, thereby simultaneously producing glutamic acid (Non-patent Document 2).

[0004] However, the accumulation of 1,3-PDO within cells is problematic as it exhibits toxicity, causing a decrease in cell growth and productivity, and since it is produced while accumulating within cells, various separation / purification methods are required, such as subsequent cell disruption and extraction of 1,3-PDO from cell debris.

[0005] Accordingly, research is being conducted to address the aforementioned issues by introducing and overexpressing efflux pumps to secrete products outside the cell. Recent studies have identified some efflux pumps for short-chain or medium-chain alcohols, but research on identifying and introducing specific efflux pumps for the substances to be secreted and produced remains rare.

[0006] Accordingly, the present inventors discovered the NCgl2647 protein, which is a secretory protein (exporter) that induces the secretion and production of 1,3-PDO among the proteins present in the Corynebacterium glutamicum strain, and after overexpressing it in Corynebacterium glutamicum and observing the productivity of 1,3-PDO, confirmed that the productivity of 1,3-PDO was greatly increased without inhibition of cell growth compared to the control group, thereby completing the present invention.

[0007] [Prior Art Literature]

[0008] [Patent Document]

[0009] (Patent Document 1) U.S. Patent No. 8,236,994

[0010] [Non-patent literature]

[0011] (Non-patent Document 1) Lee, CS, et al. “A review: conversion of bioglycerol into 1, 3-propanediol via biological and chemical method.” Renewable and Sustainable Energy Reviews 42 (2015): 963-972.

[0012] (Non-patent Document 2) Huang, Jinhai, et al. “Cofactor recycling for co-production of 1, 3-propanediol and glutamate by metabolically engineered Corynebacterium glutamicum.” Scientific Reports 7.1 (2017): 1-10.

[0013] The present invention aims to provide a recombinant protein exhibiting 1,3-propanediol secretion activity.

[0014] Another object of the present invention is to provide a polynucleotide encoding the recombinant protein and a recombinant expression vector comprising the nucleic acid molecule.

[0015] Another object of the present invention is to provide a microorganism for producing 1,3-propanediol expressing the recombinant protein.

[0016] Another object of the present invention is to provide a method for producing 1,3-propanediol using the above microorganism.

[0017] To solve the above-described problem, the present invention provides a recombinant protein or a functional fragment thereof exhibiting 1,3-propanediol secretion activity, comprising an amino acid sequence of SEQ ID NO: 1.

[0018] In the present invention, the recombinant protein can exhibit an activity of secreting intracellular 1,3-propanediol to the outside of the cell.

[0019] Additionally, the present invention provides a polynucleotide encoding the aforementioned recombinant protein or a functional fragment thereof.

[0020] In the present invention, the polynucleotide may include a nucleotide sequence of sequence number 2.

[0021] The present invention also provides a Corynebacterium sp. microorganism for producing 1,3-propanediol expressing the recombinant protein or a functional fragment thereof as described above.

[0022] In the present invention, the above Corynebacterium genus microorganism may be one into which a recombinant expression vector that overexpresses a recombinant protein comprising the amino acid sequence of sequence number 1 or a functional fragment thereof has been introduced.

[0023] In the present invention, the microorganism of the genus Corynebacterium may be one into which a gene encoding a recombinant protein comprising the amino acid sequence of sequence number 1 or a functional fragment thereof has been introduced and overexpressed by a strong promoter.

[0024] In the present invention, the microorganism of the genus Corynebacterium may be one into which a recombinant vector is additionally introduced, which includes a gene encoding glycerol dehydratase, a gene encoding glycerol reactivase, and a gene encoding 1,3-PDO oxidoreducductase to convert glycerol into 1,3-propanediol.

[0025] In the present invention, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0026] In the present invention, the Corynebacterium glutamicum may be Corynebacterium glutamicum HCC1 (Accession No. KCTC 15479BP).

[0027] Furthermore, the present invention provides a method for producing 1,3-propanediol, which comprises a step of culturing various types of microorganisms of the genus Corynebacterium as described above.

[0028] In the present invention, the production method may additionally include a step of isolating and purifying 1,3-propanediol from a medium in which the Corynebacterium genus microorganism is cultured without cell disruption.

[0029] The present invention also provides a use of a recombinant protein comprising the amino acid sequence of SEQ ID NO: 1 or a functional fragment thereof for secretion and production of 1,3-propanediol.

[0030] In addition, the present invention provides a use of a Corynebacterium sp. microorganism expressing a recombinant protein comprising the amino acid sequence of SEQ ID NO: 1 or a functional fragment thereof for secretion and production of 1,3-propanediol.

[0031] The recombinant protein or functional fragment thereof exhibiting 1,3-PDO secretion activity according to the present invention, when overexpressed in a Corynebacterium genus microorganism, secretes 1,3-PDO produced and accumulated inside the cell to the outside of the cell, thereby alleviating cytotoxicity and increasing secretion production of 1,3-PDO. In addition, since 1,3-PDO is secreted to the outside of the cell, 1,3-PDO can be efficiently produced through a more simplified separation and purification process without a process of disrupting the cell.

[0032] Figure 1 is a schematic diagram showing the metabolic process by which 1,3-PDO is produced from glycerol inside a cell.

[0033] Figure 2 shows the cleavage map of the pCES208s-Exp vector for overexpression of a recombinant protein exhibiting 1,3-PDO secretion activity and the ppcoXL vector for converting glycerol into 1,3-PDO.

[0034] FIG. 3 is a graph comparing glycerol concentration, 1,3-PDO concentration, and cell growth in each culture medium of Corynebacterium glutamicum HCC1 (accession number KCTC 15479BP) overexpressing the 1,3-PDO secretion protein according to the present invention and the control group without the 1,3-PDO secretion protein.

[0035] Hereinafter, the present invention will be described in more detail.

[0036] All technical terms used in this invention, unless otherwise defined, have the same meaning as commonly understood by those skilled in the art. While preferred methods and samples are described herein, similar or equivalent methods are also included within the scope of this invention.

[0037] All numbers expressing sizes, amounts, and physical properties of features used in this specification and claims are to be understood as being modified in all instances by the term "about." Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and claims are approximations that may vary depending on the desired properties sought to be obtained by those skilled in the art utilizing the teachings disclosed herein.

[0038] As shown in Fig. 1, glycerol inside Corynebacterium glutamicum cells is converted into 3-hydroxypropionaldehyde (3-HPA) by the action of glycerol dehydratase enzyme, which is then ultimately converted into 1,3-PDO by aldehyde dehydrogenase enzyme. At this time, 1,3-PDO accumulated within the cell can cause cytotoxicity, and additional separation and purification processes, such as cell disruption, are essential to recover it.

[0039] Against this backdrop, the present inventors sought to identify a 1,3-PDO secretion protein capable of secreting intracellularly accumulated 1,3-PDO to the outside of the cell to alleviate cytotoxicity caused by 1,3-PDO and simplify further separation and purification processes. As a result, among the proteins present in Corynebacterium glutamicum strains, the NCgl2647 protein, a secretion protein (exporter) that induces the secretion and production of 1,3-PDO, was identified, and the enhanced 1,3-PDO production ability of a Corynebacterium sp. microorganism overexpressing the secretion protein was confirmed.

[0040] Accordingly, the first aspect of the present invention relates to a novel 1,3-PDO secretion protein that induces the production of 1,3-PDO by secretion from inside the cell to outside the cell, a polynucleotide encoding the same, and a recombinant expression vector.

[0041] Specifically, the novel 1,3-PDO secretion protein according to the present invention is based on the NCgl2647 protein having 30% sequence identity with the amino acid sequence of the BCR protein (NCBI Reference Sequence: NP_416687.1), which is a 1,3-PDO secretion protein of E. coli, and the NCgl2647 protein may be a protein encoded by the nucleotide sequence of KEGG Reference Sequence: Cgl2743, or a protein including the amino acid sequence of the MFS transporter (NCBI sequence: NII98656.1) in Corynebacterium glutamicum or a part thereof, but is not limited thereto.

[0042] The novel 1,3-PDO secretion protein according to the present invention may be a recombinant protein or a functional fragment thereof comprising or consisting of a part of the amino acid sequence of the NCgl2647 protein, and the recombinant protein or a functional fragment thereof may, for example, comprise or consist of the amino acid sequence of the following SEQ ID NO: 1 or a part of the amino acid sequence thereof.

[0043]

[0044] In the present invention, the recombinant protein may include a functional equivalent to the amino acid sequence of SEQ ID NO: 1.

[0045] The above "functional equivalent" refers to a protein or peptide that has at least 70%, preferably 80%, more preferably 90%, and even more preferably 95% sequence homology with the amino acid sequence of SEQ ID NO: 1 of the present invention due to addition, substitution, or deletion of amino acids in the protein or peptide, and exhibits substantially the same physiological activity as a recombinant protein or peptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1.

[0046] In the present invention, the term "homology" refers to the degree of identity or correspondence between given polypeptide sequences or polynucleotide sequences that may or may not share a common evolutionary origin, and may be expressed as a percentage. In the present specification, a homologous sequence having the same or similar activity as a given polypeptide sequence or polynucleotide sequence is expressed as "% homology." For example, this can be confirmed by using standard software that calculates parameters such as score, identity, and similarity, specifically BLAST 2.0, or by comparing sequences through Southern hybridization experiments under defined stringent conditions, and the defined appropriate hybridization conditions can be determined by methods well known to those skilled in the art. In one embodiment, two amino acid sequences are “substantially homologous” or “substantially similar” when the polypeptide matches at least 21% (specifically at least about 50%, particularly about 75%, 90%, 95%, 96%, 97% or 99%) over a given length of the amino acid sequences.

[0047] Specifically, the recombinant protein according to the present invention may include not only a protein or peptide having its wild-type amino acid sequence, but also an amino acid sequence variant thereof within the scope of the present invention. The amino acid sequence variant refers to a protein or peptide having a sequence that differs from the amino acid sequence of SEQ ID NO: 1 by deletion, insertion, non-conservative or conservative substitution of one or more amino acid residues, or a combination thereof.

[0048] Amino acid exchanges that can occur in proteins and peptides without altering their overall activity are well known in the art (H.Neurath, RLHill, The Proteins, Academic Press, New York, 1979). The most common exchanges are between amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, Asp / Gly. In some cases, modifications such as phosphorylation, sulfation, acetylation, glycosylation, methylation, and farnesylation can also occur.

[0049] In the present invention, the term "functional fragment" refers to a fragment that comprises or consists of a part of the amino acid sequence of SEQ ID NO: 1, but can function substantially identically or similarly to a 1,3-PDO secretory protein comprising or consisting of the amino acids of SEQ ID NO: 1.

[0050] The recombinant protein of the present invention, its functional equivalent, variant or functional fragment can be extracted from nature, synthesized or produced by a genetic recombination method based on a DNA sequence.

[0051] In the present invention, the recombinant protein or a functional fragment thereof can act as a 1,3-PDO efflux pump in a microorganism of the genus Corynebacterium, thereby exhibiting an activity of secreting intracellular 1,3-propanediol to the outside of the cell.

[0052] Accordingly, the present invention provides a use of a recombinant protein comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a functional fragment thereof for secretion and production of 1,3-propanediol.

[0053] In addition, the present invention provides a use for secretion and production of 1,3-propanediol by a microorganism of the genus Corynebacterium sp. expressing a recombinant protein comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a functional fragment thereof.

[0054] In the present invention, the polynucleotide encoding the recombinant protein or a functional fragment thereof may comprise or consist of the nucleotide sequence of the following SEQ ID NO: 2 or a partial nucleotide sequence thereof, but any nucleotide sequence encoding the recombinant protein or a functional fragment thereof may be used without limitation. For example, the polynucleotide according to the present invention may be codon-optimized for the type of host cell used to produce the recombinant protein or a functional fragment thereof, and techniques for codon optimization according to such host cells are well known in the art (Fuglsang et al., Protein Expr. Purif. 31(2): 247-249, 2003).

[0055]

[0056]

[0057] In addition, the present invention may include a polynucleotide encoding a polypeptide that substantially exhibits 1,3-PDO secretion activity as a nucleotide sequence that exhibits at least 70%, preferably 80%, more preferably 90%, even more preferably 95%, and most preferably 98% homology with the above nucleotide sequence. It is also apparent that a polynucleotide encoding the functional equivalent, variant, or functional fragment described above is also included within the scope of the present invention.

[0058] In the present invention, a polynucleotide encoding the recombinant protein or a functional fragment thereof may be included in a recombinant expression vector in the form of a gene construct operably linked to an expression control sequence.

[0059] In the present invention, the term "vector" refers to a DNA construct comprising a nucleotide sequence of a polynucleotide encoding a target protein operably linked to a suitable expression control sequence so as to enable expression of the target protein in a suitable host. Once in a host cell, an expression vector can replicate independently of the host chromosomal DNA, producing multiple copies of the vector and its inserted DNA.

[0060] Since plasmids are the most commonly used form of vector today, the terms "plasmid" and "vector" are sometimes used interchangeably in the present specification. For the purposes of the present invention, the use of a plasmid vector is preferred. A typical plasmid vector that can be used for this purpose has a structure that includes (a) an origin of replication that allows efficient replication to include hundreds of plasmid vectors per host cell, (b) an antibiotic resistance gene that allows selection of host cells transformed with the plasmid vector, and (c) a restriction enzyme cleavage site into which a foreign DNA fragment can be inserted. Even if a suitable restriction enzyme cleavage site does not exist, the vector and the foreign DNA can be easily ligated using a synthetic oligonucleotide adapter or linker according to conventional methods.

[0061] After ligation, the vector can be transformed into a suitable host cell. In the present invention, the preferred host cell is a prokaryotic cell. Suitable prokaryotic host cells may include E. coli DH5α, E. coli JM101, E. coli K12, E. coli W3110, E. coli X1776, E. coli XL-1Blue (Stratagene), E. coli B, E. coli B21, etc. However, E. coli strains such as FMB101, NM522, NM538, and NM539, as well as other species and genera of prokaryotes, may also be used. The aforementioned E. In addition to E. coli, strains of the genus Agrobacterium such as Agrobacterium A4, Bacilli such as Bacillus subtilis, other Enterobacteriaceae such as Salmonella typhimurium or Serratia marcescens, various strains of the genus Pseudomonas, Corynebacterium and Streptomyces can be used as host cells.

[0062] Transformation of prokaryotic cells can be readily achieved using electroporation, heat-shock or calcium chloride methods.

[0063] Numerous conventional vectors that can be used in prokaryotic cells are well known to those skilled in the art, and an appropriate vector can be selected and used. Conventional vectors that can be used in the present invention include, but are not limited to, pCES208, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pUC19, λgtㆍ4λB, λ-charon, λΔz1, and M13.

[0064] In the present invention, the term "expression control sequence" refers to a DNA sequence essential for the expression of an operably linked coding sequence in a specific host organism. Such control sequences include a promoter for initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences that regulate the termination of transcription and translation. For example, a control sequence suitable for prokaryotes includes a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells include a promoter, a polyadenylation signal, and an enhancer. The factor that most influences the expression level of a gene in a plasmid is the promoter. Preferably, promoters for high expression include the SRα promoter and cytomegalovirus-derived promoters. Any of a wide variety of expression control sequences can be used in a vector to express the DNA sequence of the present invention. Useful expression control sequences include, for example, the H36 promoter, the early and late promoters of SV40 or adenovirus, the lac system, the trp system, the TAC or TRC system, the T3 and T7 promoters, the major operator and promoter region of phage lambda, the regulatory region of the fd encoded protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of said phosphatases, e.g., Pho5, the promoter of the yeast alpha-mating system, and any other sequence known to control gene expression in prokaryotes or eukaryotes or viruses, and various combinations thereof. The H36 promoter can be usefully used to express the recombinant protein of the invention or a functional fragment thereof in Corynebacterium glutamicum (Yim et al. (2013) Biotechnol. Bioeng. 110(11):2959-2971).

[0065] A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. This can be a gene and regulatory sequence(s) that are linked in such a way that an appropriate molecule (e.g., a transcriptional activating protein) enables gene expression when bound to the regulatory sequence(s). For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it influences the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it influences the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the linked DNA sequences are in contact, and in the case of a secretory leader, are in contact and are in reading frame. However, an enhancer need not be in contact. These sequences are joined by ligation at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adaptors or linkers are used according to conventional methods.

[0066] As is well known in the art, to increase the expression level of a transfected gene in a host cell, the gene must be operably linked to transcriptional and translational expression control sequences that function within the selected expression host. Preferably, the expression control sequences and the gene are contained within a single expression vector that also includes a bacterial selection marker and an origin of replication. If the host cell is eukaryotic, the expression vector may further include expression markers useful in the eukaryotic expression host.

[0067] A host cell transformed or transfected with the recombinant expression vector described above constitutes another aspect of the present invention. Accordingly, the second aspect of the present invention relates to a microorganism for producing 1,3-PDO, which expresses the recombinant protein or functional fragment thereof according to the first aspect described above.

[0068] In the present invention, the term "transformation" refers to the introduction of DNA into a host cell, such that the DNA becomes replicable either as an extrachromosomal element or through chromosomal integration. In the present invention, the term "transfection" refers to the reception of an expression vector by a host cell, regardless of whether any coding sequence is actually expressed.

[0069] Of course, it will be appreciated that not all vectors and expression control sequences are equally effective in expressing the nucleotide sequences of the present invention. Similarly, not all hosts will function equally well in the same expression system. However, those skilled in the art can appropriately select from among various vectors, expression control sequences, and hosts without undue experimental burden and without departing from the scope of the present invention. For example, when selecting a vector, consideration should be given to the host, as the vector must be replicated within it. The vector's copy number, its ability to control copy number, and the expression of other proteins encoded by the vector, such as antibiotic markers, should also be considered. When selecting an expression control sequence, various factors should be considered. For example, the relative strength of the sequence, its controllability, and its compatibility with the nucleotide sequences of the present invention, particularly those related to potential secondary structures, may be considered. A unicellular host may be selected by considering factors such as the selected vector, the toxicity of the product encoded by the nucleotide sequence of the present invention, secretion characteristics, the ability to accurately fold the protein, culture and fermentation requirements, and the ease of purifying the product encoded by the nucleotide sequence of the present invention from the host. Within the scope of these variables, those skilled in the art can select various vector / expression control sequence / host combinations that can express the nucleotide sequence of the present invention in fermentation or large-scale animal culture. When attempting to clone the cDNA of the recombinant protein or functional fragment thereof according to the present invention by expression cloning, a binding method, a panning method, a film emulsion method, etc. may be applied as a screening method.

[0070] Hosts useful for transformation are well known in the art, and examples of prokaryotic hosts that can be used include, but are not limited to, E. coliJM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX1776, E. coliW3110, Bacillus subtilis, Bacillus thuringiensis, Salmonella typhimurium, Serratia marcenses and various Pseudomonas, Corynebacterium and Streptomyces.

[0071] The microorganism according to the present invention may be a microorganism of the genus Corynebacterium (Corynebacterium sp.), and more specifically, may include, but is not limited to, Corynebacterium glutamicum, Corynebacterium ammoniagenes, or Corynebacterium thermoaminogenes. As a preferred example, the Corynebacterium microorganism may be Corynebacterium glutamicum, but other known Corynebacterium microorganisms having 1,3-PDO production ability may be included without limitation.

[0072] Transformation of host cells can be performed by numerous methods known in the art. For example, when prokaryotic cells are used as host cells, the CaCl2 method, the Hanson method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114 (1973); and Hanahan, D., J. Mol. Biol., 166:557-580 (1983)), and electroporation can be used for transformation.

[0073] The above-mentioned Corynebacterium genus microorganism may be introduced with a recombinant vector that overexpresses a recombinant protein comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a functional fragment thereof, or may be introduced with a gene encoding a recombinant protein comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a functional fragment thereof, and overexpressed by a strong promoter.

[0074] In the present invention, "overexpression" refers to a higher level of expression than the level at which the corresponding gene is expressed in a cell under normal conditions, and is a concept that includes increasing the amount of expression by replacing the promoter of a gene existing in the genome with a strong promoter or cloning the corresponding gene into a recombinant expression vector and transforming the cell.

[0075] Examples of known strong promoters include, but are not limited to, the H36 promoter, the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the T7 promoter, and the tet promoter.

[0076] In the present invention, a 1,3-PDO-producing Corynebacterium microorganism expressing a recombinant protein exhibiting 1,3-PDO secretion activity or a functional fragment thereof, comprising or consisting of the amino acid sequence of SEQ ID NO: 1, may be further transformed with a recombinant expression vector overexpressing a protein that converts glycerol into 1,3-PDO or a functional fragment thereof to provide or enhance 1,3-PDO production ability. For example, a recombinant expression vector overexpressing a protein that converts glycerol into 1,3-PDO or a functional fragment thereof and a recombinant vector overexpressing a protein that secretes 1,3-PDO outside the cell may be sequentially transformed, but is not limited thereto.

[0077] In the present invention, the recombinant expression vector overexpressing the protein or functional fragment thereof that plays a role in converting the glycerol into 1,3-PDO may be a gene encoding glycerol dehydratase, a gene encoding glycerol reactivase, and a gene encoding 1,3-PDO oxidoreductase, but may be derived from Klebsiella pneumoniae, for example, from Klebsiella pneumoniae DSMZ2026, but is not limited thereto. At this time, the gene encoding glycerol dehydratase and the gene encoding glycerol reactivase are dhaB1234gdrAB or pduCDEGH, which are gene cluster units, and the gene encoding 1,3-PDO oxidoreductase is yqhD or dhaT, or alternatively, the gene encoding 1,3-PDO oxidoreductase derived from E. coli can use yqhD.

[0078] In a specific embodiment of the present invention, a ppcoXL vector having a cleavage map as shown in (B) of FIG. 2 was used as a vector for converting glycerol into 1,3-PDO, and the ppcoXL vector may include a pduCDEGH gene derived from Klebsiella pneumoniae and a yqhD gene derived from Escherichia coli. At this time, the base sequence of each gene may be a wild-type base sequence or a base sequence codon-optimized for Corynebacterium glutamicum.

[0079] The base sequences of the pduCDEGH gene derived from Klebsiella pneumoniae and the yqhD gene derived from E. coli codon-optimized for Corynebacterium glutamicum used in the present invention are shown in the following sequence numbers 3 and 4, respectively.

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086] The Corynebacterium genus microorganism produced in this manner exhibits 1,3-PDO productivity that is approximately 2.6 times higher than that of the same strain without the 1,3-PDO secretion protein, and thus, it is possible to produce 1,3-PDO more efficiently by using this. Accordingly, the Corynebacterium glutamicum produced in the above manner in the present invention was named Corynebacterium glutamicum HCC1, and was deposited in the Korea Center for Bioscience and Biotechnology (KCTC) Gene Bank on June 23, 2023, and was assigned the accession number KCTC 15479BP.

[0087] Accordingly, the third aspect of the present invention relates to a method for producing 1,3-PDO, comprising a step of culturing the aforementioned Corynebacterium genus microorganism.

[0088] In the present invention, the term "cultivation" refers to growing the microorganism under appropriately controlled environmental conditions. The culturing process of the present invention can be performed using appropriate media and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain.

[0089] Specifically, the step of culturing the microorganism is not particularly limited thereto, but may be performed by a known batch culture method, continuous culture method, fed-batch culture method, etc. At this time, the culture conditions are not particularly limited thereto, but may be adjusted to an appropriate pH (e.g., pH 5 to 9, specifically pH 6 to 8, and most specifically pH 6.8 to 7.0) using a basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g., phosphoric acid or sulfuric acid). In addition, during the culture, a defoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation, and further, in order to maintain an aerobic state of the culture, oxygen or an oxygen-containing gas may be injected into the culture, or in order to maintain an anaerobic or microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without injecting gas. The culture temperature can be maintained at 20 to 35°C, specifically 25 to 30°C, and the culture period can be continued until the production amount of 1,3-PDO is obtained, for example, the culture can be performed for about 10 to 160 hours, but is not limited thereto. The 1,3-PDO produced through the culture can be secreted outside the cells and included in the medium.

[0090] In the present invention, the culture medium used in the method may be used as a carbon source, such as sugars and carbohydrates (e.g., glucose, sucrose, lactose, fructose, maltose, molasses, starch, and cellulose), fats and oils (e.g., soybean oil, sunflower seed oil, peanut oil, and coconut oil), fatty acids (e.g., palmitic acid, stearic acid, and linoleic acid), alcohols (e.g., glycerol and ethanol), and organic acids (e.g., acetic acid), which may be used individually or in combination, but are not limited thereto. The nitrogen source may be used as a nitrogen-containing organic compound (e.g., peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea), or inorganic compounds (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate), which may be used individually or in combination, but are not limited thereto. Potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and their corresponding sodium-containing salts may be used individually or in combination as phosphorus sources, but are not limited thereto. In addition, the medium may include essential growth-promoting substances such as other metal salts (e.g., magnesium sulfate or iron sulfate), amino acids, and vitamins.

[0091] The Corynebacterium genus microorganism producing 1,3-PDO according to the present invention can be further transformed with a recombinant vector in which a gene encoding glycerol dehydratase, a gene encoding glycerol reactivase, and a gene encoding 1,3-PDO oxidoreductase are operably linked to convert glycerol into 1,3-PDO, and the culture medium preferably contains glycerol.

[0092] In the present invention, the 1,3-PDO produced in the above-described culturing step can be recovered from the culture solution without cell disruption using a suitable method known in the art, depending on the culturing method. For example, centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC can be used, and the desired 1,3-PDO can be recovered from the medium or microorganism using a suitable method known in the art. In addition, the recovery step may include a purification process.

[0093] Hereinafter, the present invention will be described in more detail through examples. However, the present invention can be modified in various ways and can take various forms. Therefore, the specific examples and descriptions described below are only intended to aid in understanding the present invention and are not intended to limit the present invention to a specific disclosed form. It should be understood that the scope of the present invention includes all modifications, equivalents, and substitutes included in the spirit and technical scope of the present invention.

[0094] Hereinafter, the present invention will be described in more detail through examples. However, the present invention can be modified in various ways and can take various forms. Therefore, the specific examples and descriptions described below are only intended to aid in understanding the present invention and are not intended to limit the present invention to a specific disclosed form. It should be understood that the scope of the present invention includes all modifications, equivalents, and substitutes included in the spirit and technical scope of the present invention.

[0095] [Example 1]

[0096] Construction of a vector for overexpression of a recombinant protein exhibiting 1,3-PDO secretion activity and a vector for producing 1,3-PDO

[0097] 1-1. Construction of a vector for overexpression of a recombinant protein exhibiting 1,3-PDO secretion activity.

[0098] First, using a Corynebacterium glutamicum ATCC 13032 colony as a template, the NCgl2647 gene (SEQ ID NO: 2) was obtained through polymerase chain reaction (PCR) using primers Exp-F and Exp-R of the sequences listed in Table 1 below. Thereafter, the polymerase chain reaction product was digested with restriction enzymes BamHI and XbaI and ligated into the pCES208s-H36 vector listed in Table 2 below, thereby constructing the pCES208s-Exp vector as shown in Fig. 2 (A).

[0099] Primer Sequence SEQ ID NOExp-FGCATGGATCCATGGCTGGAATGGCGATTGG5Exp-RGCATCTAGACTACTTCATTTCTGGAATACCTTTTCG6yqhD-FGCATTTAAATTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGAATTC ATGAATAATTTCAATTTGCACACCC7yqhD-RTTTAAAATTACCGTGCTGCCTCATAAATA8pduCDEGH-FCAATTTCACACAGGAAACAGAATTCATGAGATCGAAAAGATTTGAAGCAC9pduCDEGH-RCCAAAACAGCCAAGCTTGGCTGCAGTTAAGCATGGCGATCCCGAA10

[0100] Strain-related characteristics E. coliDH5αF - endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG purB20 ϕ80dlacZΔM15Δ(lacZYA-argF)U169, hsdR17(r K - m K + ), λ -C. glutamicumHCCC. glutamicum ATCC13032Δald plasmid-related characteristics pCES208 E. coli-C. glutamicum shuttle vector, p15A ori, Km R pCES208s-H36pCES208 derivative, H36 promoter, Spc R pCES208s-ExppCES208s-H36 derivative, NCgl2647pEKEx1E. coli-C. glutamicum shuttle vector, pMB1 ori, Km R , tac promoter ppcoXLpEKEx1 derivative, Ptac-pduCDEGH from Klebsiella pneumoniae, Ptac-codon opt. yqhD from E. coli

[0101] 1-2. Production of a vector for producing 1,3-PDO

[0102] First, using the nucleotide sequence of E. coli yqhD obtained from KEGG Reference Sequence: b3011 as a template and the synthesized gene through codon optimization, the yqhD gene (SEQ ID NO: 4) was obtained through polymerase chain reaction (PCR) using the primers yqhD-F and yqhD-R described in Table 1 above. Afterwards, the polymerase chain reaction product was digested with the restriction enzyme DraI and ligated into the pEKEx1 vector described in Table 2 above, thereby constructing the pEKEx1-yqhD vector. Afterwards, the pduCDEGH gene (SEQ ID NO: 3) was obtained through PCR using the primers pduCDEGH-F and pduCDEGH-R described in Table 1 above, using the Klebsiella pneumoniae DSM 2026 (DSMZ) colony as a template. Afterwards, the ppcoXL vector was constructed by performing Gibson assembly (Gibson assembly (Gibson et al. (2009) Nat. Method. 6:343-345)) with the pEKEx1-yqhD vector cut with restriction enzymes BamHI and PstI.

[0103] [Example 2]

[0104] Production of microorganisms with overexpression systems for recombinant proteins exhibiting 1,3-PDO secretion activity

[0105] The pCES208s-Exp vector, ligated in Example 1, was transformed into E. coli strain DH5α and then finally into Corynebacterium glutamicum HCC. The Corynebacterium glutamicum HCC is obtained by removing the ald gene, which corresponds to an unnecessary reverse reaction for 1,3-PDO production, from Corynebacterium glutamicum ATCC13032 (Table 1).

[0106] Specifically, the ppcoXL vector for producing 1,3-PDO, as shown in (B) of Fig. 2, and the pCES208s-Exp vector for secreting 1,3-PDO outside the cell, as shown in (A) of Fig. 2, were sequentially transformed using electroporation. The electroporation conditions were OD 600 =0.7, the vector was electroporated into the Corynebacterium glutamicum HCC strain prepared with 10% (w / v) glycerol using a 2 mm electroporation cuvette at 2.5 kV and 25 μF capacity (200-600 ohms), and then heat shock culture was performed at 46°C for 6 minutes with medium. Afterwards, the transformed strain was collected at 30°C and 200 rpm for 1 hour and plated on a plate to secure the transformed strain (van der Rest et al. (1999) Appl. Microbiol. Biotechnol. 52(4):541-545).

[0107] [Example 3]

[0108] Confirmation of 1,3-PDO production ability

[0109] Corynebacterium glutamicum transformed with the above two vectors and Corynebacterium glutamicum transformed only with the ppcoXL vector were inoculated into BHIS (37 g / L brain heart infusion (BHI) and 91 g / L sorbitol) medium containing 25 μg / mL kanamycin and 200 μg / mL spectinomycin. After culturing for 24 hours under conditions of 30 ℃ and 200 rpm, fresh CGXII medium containing the antibiotics (10 g / L yeast extract, 20 g / L (NH4)2SO4, 2 g / L urea, 1 g / L KH2PO4, 1 g / L K2HPO4, 40 g / L glucose, 30 mg / L PCA (3,4-dihydroxybenzoic acid), 1 g / L MgSO4·7H2O, 0.2 mg / L biotin, 0.5 mg / L thiamine, 5 mL / L TMS (TMS: 2.6 g / L CaCl2·2H2O, 2 g / L FeSO4·7H2O, 2.8 g / L MnSO4·5H2O, 0.2 g / L ZnSO4·7H2O, 0.06 g / L CuSO4·5H2O, 4 mg / L NiCl2·6H2O, 10 mL / L HCl)) OD in 200 mL 600 After moving to =0.1, it was cultured for 18 hours under the same conditions.

[0110] Afterwards, the two strains were each subjected to fed-batch cultivation for the production of 1,3-PDO. Here, CGXII medium with 40 g / L corn steep liquor was used, excluding yeast extract, and 13.4 g / L cyanocobalamin (vitamin B) was added at 12-hour intervals from 0 h. 12) was added. The culture was started by adding 200 mL of the seed culture to 1.8 L of the fermentation medium prepared in advance, and the temperature was 30 ℃, the pH was 7.0 using 28% (v / v) ammonia solution and feeding solution (700 g / L glucose, 1 g / L MgSO4·7H2O, 5 mL / L TMS), and DO (dissolved oxygen) was increased to 1000 rpm and maintained at 10% (v / v) by adding oxygen thereafter.

[0111] The analysis of the culture medium sample was conducted as follows. After centrifugation at 13,000 rpm and 4 °C for 10 min, the remaining insoluble fraction was removed using a 0.45 μm PVDF syringe filter. After diluting 1 / 100, the sample was analyzed using HPLC (high performance liquid chromatography; 1260 Infinity, Agilent Technologies). The mobile phase (5 mM H2SO4) was used at a flow rate of 0.5 mL / min, and the analysis was performed using an Agilent MetaCarb 87H, 300 X 7.8 mm organic acid column at 35 °C. In addition, cell growth was measured by OD at 600 nm (OD 600 ) was confirmed by measuring.

[0112] The left side of Fig. 3 shows the results for Corynebacterium glutamicum transformed only with the ppcoXL vector, and the right side shows the results for Corynebacterium glutamicum transformed with the ppcoXL vector and the pCES208s-Exp vector. As confirmed in Fig. 3, the culture medium of the Corynebacterium glutamicum strain transformed with the ppcoXL vector and the pCES208s-Exp vector showed a significantly increased content of 1,3-PDO compared to the Corynebacterium glutamicum strain transformed only with the ppcoXL vector, and the content of 1,3-PDO increased as the culture time increased, and at the end of the culture, the content of 1,3-PDO was increased by about 2.6 times compared to the culture medium of the Corynebacterium glutamicum strain transformed only with the ppcoXL vector.

[0113] OD 600 In this case, no significant difference was observed between the Corynebacterium glutamicum strain transformed with only the ppcoXL vector and the Corynebacterium glutamicum strain transformed with the ppcoXL vector and the pCES208s-Exp vector, confirming that the Corynebacterium glutamicum strain transformed with the ppcoXL vector and the pCES208s-Exp vector effectively secretes and produces 1,3-PDO outside the cell without inhibition of cell growth.

[0114] As described above, Corynebacterium glutamicum overexpressing the NCgl2647 protein, which induces the secretion and production of 1,3-PDO, secretes 1,3-PDO produced and accumulated inside the cell to the outside of the cell, thereby exhibiting the effects of alleviating cytotoxicity and increasing the secretion production of 1,3-PDO. The strain was named Corynebacterium glutamicum (C. glutamicum) HCC1 and deposited with the Korea Center for Bioscience and Biotechnology (KCTC) Gene Bank on June 23, 2023, and was assigned the accession number KCTC 15479BP.

[0115] While specific aspects of the present invention have been described in detail above, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

[0116] [Accession number]

[0117] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0118] Accession number: KCTC15479BP

[0119] Date of acceptance: 20230623

[0120]

Claims

1. A recombinant protein or a functional fragment thereof exhibiting 1,3-propanediol secretion activity, comprising the amino acid sequence of sequence number 1.

2. In the first paragraph, the recombinant protein is a recombinant protein or a functional fragment thereof that exhibits an activity of secreting intracellular 1,3-propanediol to the outside of the cell.

3. A polynucleotide encoding the recombinant protein of paragraph 1 or a functional fragment thereof.

4. A polynucleotide comprising the nucleotide sequence of sequence number 2 in the third paragraph.

5. A recombinant expression vector comprising the polynucleotide of clause 3.

6. A microorganism of the genus Corynebacterium sp. that produces 1,3-propanediol and expresses the recombinant protein of paragraph 1 or a functional fragment thereof.

7. In the 6th paragraph, the microorganism of the genus Corynebacterium is a microorganism of the genus Corynebacterium, into which a recombinant expression vector that overexpresses a recombinant protein comprising the amino acid sequence of sequence number 1 or a functional fragment thereof has been introduced.

8. In paragraph 6, the microorganism of the genus Corynebacterium is a microorganism in which a gene encoding a recombinant protein or a functional fragment thereof comprising the amino acid sequence of sequence number 1 is introduced and overexpressed by a strong promoter.

9. In the sixth paragraph, the microorganism of the genus Corynebacterium is a microorganism of the genus Corynebacterium, wherein a recombinant vector is additionally introduced that includes a gene encoding glycerol dehydratase, a gene encoding glycerol reactivase, and a gene encoding 1,3-propanediol oxidoreducductase to convert glycerol into 1,3-propanediol.

10. In the sixth paragraph, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

11. In the 10th paragraph, the Corynebacterium glutamicum is a microorganism of the genus Corynebacterium, which is Corynebacterium glutamicum HCC1 (accession number KCTC 15479BP).

12. A method for producing 1,3-propanediol, comprising a step of culturing a microorganism of the genus Corynebacterium according to any one of claims 6 to 11.

13. A method for producing 1,3-propanediol, further comprising a step of isolating and purifying 1,3-propanediol from a medium in which the Corynebacterium genus microorganism is cultured without cell disruption, in accordance with paragraph 12.

14. Use of a recombinant protein comprising the amino acid sequence of sequence number 1 or a functional fragment thereof for secretion and production of 1,3-propanediol.

15. Use of a microorganism of the genus Corynebacterium sp. expressing a recombinant protein comprising the amino acid sequence of sequence number 1 or a functional fragment thereof for secretion and production of 1,3-propanediol.

Images