New herpes simplex virus gene therapy vector

Abstract

Provided herein is a herpes simplex virus 1 (HSV-1) recombinant virus, comprising one or more therapeutic payload sequences, wherein the genome comprises at least one alteration in each of a gene encoding infected cell polypeptides (ICP)0, a gene encoding ICP4, a gene encoding ICP22, a gene encoding ICP27 and a gene encoding ICP47, wherein the genome does not encode a functional ICP0, ICP4, ICP22, ICP27 and ICP47 protein, and wherein the genome comprises internal inverted repeat (joint) regions. Methods for using the same are also provided.

Description

NEW HERPES SIMPLEX VIRUS GENE THERAPY VECTORCROSS-REFERENCE TO RELATED APPLICATION

[0001] This Application claims benefit under 35 U.S.C. § 119(e) of the U.S. Provisional Application No. 63 / 526,864 filed July 14, 2023, the contents of which is incorporated herein by reference in its entireties.GOVERNMENT SUPPORT

[0002] This invention was made with government support under AI106934 and AI044821 awarded by National Institutes of Health (NIH). The government has certain rights in this invention.TECHNICAL FIELD

[0003] The technology described herein relates to compositions and methods for gene therapy and uses thereof.BACKGROUND

[0004] HSV-1 recombinants with the immediate-early (IE) genes deleted or mutated except for ICP0 have been used as vaccine vectors (Kaur et al., 2007) or as gene therapy vectors in animals (Majima et al., 2015) and human clinical trials (Fink et al., 2011; and Guide et al., 2022 NEJM). These serve as short-term expression vectors because ICP0 is toxic to the host cell (Samaniego et al., 1997). Herpes simplex virus 1 (HSV-1) recombinants with all the immediate-early genes deleted are promising new gene therapy vectors for long-term expression of large genes from a non-cytotoxic vector (Miyagawa et al., 2015). Deletion of the ICP0 genes reduced cytotoxicity and allowed long-term expression when the transgene was located in either the ICP4 or in the latency-associated transcript (LAT) locus. Described herein are new HSV viruses that are safe and effective for gene therapy.SUMMARY

[0005] The compositions and methods provided herein, relate in part, to the discovery of a new HSV- 1 virus, that can serve as a safe and efficient vector for delivering a therapeutic payload. Accordingly, one aspect provided herein describes a herpes simplex virus 1 (HSV-1) recombinant virus, comprising within its genome: one or more therapeutic payload sequences, wherein the genome comprises at least one alteration in each of a gene encoding infected cell polypeptides (ICP) 0, a gene encoding ICP4, a gene encoding ICP22, a gene encoding ICP27 and a gene encoding ICP47, wherein the genome does not encode a functional ICP0, ICP4, ICP22, ICP27 and ICP47 protein, and wherein the genome comprises internal inverted repeat (joint) regions.

[0006] In one embodiment of any aspect herein, the one or more therapeutic payload sequences are inserted in a latency-associated transcript (LAT) gene locus, e.g., see Fig. 10.

[0007] In one embodiment of any aspect herein, the one or more therapeutic payload sequences are inserted between two insulator sequences.

[0008] In one embodiment of any aspect herein, the one or more therapeutic payload sequences are inserted in between CTRL1 and CTRL2 sequences.

[0009] In one embodiment of any aspect herein, the at least one alteration is a deletion of the gene’s open reading frame (ORF).

[0010] In one embodiment of any aspect herein, the at least one alteration is a deletion of gene’s intermediate early (IE) promoter. In one embodiment of any aspect herein, the at least one alteration is a deletion of at least a part of the gene’s intermediate early (IE) promoter. In one embodiment of any aspect herein, the at least one alteration is a deletion of the entirety of the gene’s intermediate early (IE) promoter.

[0011] In one embodiment of any aspect herein, the at least one alteration of the ICP0 gene is a deletion of the ICP0 ORF.

[0012] In one embodiment of any aspect herein, the at least one alteration of the ICP4 gene is a deletion of the ICP4 ORF.

[0013] In one embodiment of any aspect herein, the at least one alteration of the ICP27 gene is a deletion of the ICP27 ORF.

[0014] In one embodiment of any aspect herein, the at least one alteration of the ICP22 gene is a deletion of the ICP22 IE promoter.

[0015] In one embodiment of any aspect herein, the at least one alteration of the ICP47 gene is a deletion of the ICP47 IE promoter.

[0016] In one embodiment of any aspect herein, one or more therapeutic payload sequence is selected from the group consisting of a therapeutic transgene, a gene editing gene, a microRNA (miRNA), a interfering RNA, an antisense RNA, a ribozyme, and an aptamer.

[0017] In one embodiment of any aspect herein, the therapeutic transgene is a codon-optimized sequence.

[0018] In one embodiment of any aspect herein, the virus comprises at least two copies of the one or more therapeutic payload sequences within its genome.

[0019] In one embodiment of any aspect herein, one or more therapeutic payload sequence is expressed for at least 3 months, at least 6 months, at least 9 months, at least 12 months or more.

[0020] In one embodiment of any aspect herein, one or more therapeutic payload sequence is expressed at a higher level as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions.

[0021] In one embodiment of any aspect herein, the recombinant virus produces plaques having a diameter that is at least 2- fold larger as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions.

[0022] In one embodiment of any aspect herein, the recombinant virus exhibits a greater infectivity (PFU per genome copy) as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions.

[0023] In one embodiment of any aspect herein, the recombinant virus exhibits a higher viral yield as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions.

[0024] In one embodiment of any aspect herein, the viral transgene located in the LAT locus is resistant to silencing by Gamma-interferon-inducible protein 16 (IFI16).

[0025] Also provided herein is a herpes simplex virus 1 (HSV-1) recombinant virus, comprising within its genome: one or more therapeutic payload sequences, wherein the genome comprises at least one of i) a deletion of the ICP0 ORF; ii) a deletion of the ICP4 ORF; iii) a deletion of the ICP27 ORF; iv) a deletion of the ICP22 IE promoter; and v) a deletion of the ICP47 IE promoter; wherein the genome does not encode a functional ICP0, ICP4, ICP22, ICP27 and ICP47 protein, and wherein the genome comprises internal inverted repeat (joint) regions.

[0026] Also provided herein is a composition comprising any of the recombinant viruses described herein.

[0027] Also provided herein is a method of delivering a therapeutic payload to a subject, the method comprising: administering to the subject in need thereof any of the recombinant viruses or compositions described herein.

[0028] Also provided herein is a method of altering a gene in a subject, the method comprising: administering to the subject in need thereof any of the recombinant viruses or compositions described herein.

[0029] In one embodiment of any aspect herein, the gene is a disease gene.

[0030] Also provided herein is a method of treating a disease or disorder in a subject, the method comprising: administering to the subject in need thereof any of the recombinant viruses or compositions described herein.

[0031] In one embodiment of any aspect herein, the subject has been diagnosed as having or at risk of having the disease or disorder.

[0032] In one embodiment of any aspect herein, the method further comprises, prior to administering, the step of diagnosing the subject as having or at risk of having the disease or disorder.

[0033] In one embodiment of any aspect herein, the method further comprises, prior to administering, receiving the results of an assay that diagnoses the subject as having or at risk of having the disease or disorder.Some Selected De finitions

[0034] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art to which this disclosure belongs. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in immunology, virology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 20th Edition, published by Merck Sharp & Dohme Corp., 2018 (ISBN 0911910190, 978-0911910421); Fields Virology, 7thed. 2023, P. Howley and D. Knipe eds, published byWolters Kluwer; Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), W. W. Norton & Company, 2016 (ISBN 0815345054, 978-0815345053); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN- 1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the contents of which are all incorporated by reference herein in their entireties.

[0035] As used herein, the terms "treat,” "treatment," "treating,” or “amelioration” refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with a disease or disorder. The term “treating" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder. Treatment is generally “effective" if one or more symptoms or clinical markers are reduced. Alternatively, treatment is “effective" if the progression of a disease is reduced or halted. That is, “treatment" includes not just the improvement of symptoms or markers, but also a cessation of, or at least slowing of, progress or worsening of symptoms compared to what would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviationof one or more symptom(s), diminishment of extent of disease, stabilized (z.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, remission (whether partial or total), and / or decreased mortality, whether detectable or undetectable. The term "treatment" of a disease also includes providing relief from the symptoms or side-effects of the disease (including palliative treatment).

[0036] The terms “decrease”, “reduce”, “reduction”, or “inhibit” are all used herein to mean a decrease by a statistically significant amount. In some embodiments, “reduce,” “reduction", “decrease" or “inhibit” means a decrease by at least 10% as compared to a reference level (e.g. the absence of a given treatment) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more. As used herein, “reduction” or “inhibition” does not encompass complete inhibition or reduction as compared to a reference level. “Complete inhibition” is a 100% inhibition as compared to a reference level.

[0037] The terms “increased”, “increase”, “enhance”, or “activate” are all used herein to mean an increase by a statically significant amount. In some embodiments, the terms “increased”, “increase”, “enhance”, or “activate” can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3 -fold, or at least about a 4-fold, or at least about a 5 -fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level.

[0038] As used herein, a "subject" is a human or a non-human animal. Usually the non-human animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. In some embodiments, the subject is a mammal, e.g., a primate, e.g., a human. The terms, “individual,” “patient” and “subject” are used interchangeably herein.

[0039] Preferably, the subject is a mammal. The mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of diseases including diseases and disorders involving inappropriate immunosuppression. A subject can be male or female.

[0040] A subject can be one who has been previously diagnosed with or identified as suffering from or having a condition in need of treatment or one or more complications related to such a condition, and optionally, have already undergone treatment for the condition or the one or more complications related to the condition. Alternatively, a subject can also be one who has not been previously diagnosed as having the condition or one or more complications related to the condition. For example, a subject can be one who exhibits one or more risk factors for the condition or one or more complications related to the condition or a subject who does not exhibit risk factors.

[0041] As used herein, a “subject in need” of treatment for a particular condition can be a subject having that condition, diagnosed as having that condition, or at risk of developing that condition.

[0042] As used herein, the term “alteration” refers to any change in a native wild-type nucleic acid or amino acid sequence. Alterations can include, but are not limited to, insertions, deletions, mutations, substitutions, or molecular changes as compared to a reference sequence. Alterations of the native amino acid sequence can be accomplished by any of a number of techniques known to one of skill in the art. Mutations can be introduced, for example, at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites permitting ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion. Alternatively, oligonucleotide-directed sitespecific mutagenesis procedures can be employed to provide an altered nucleotide sequence having particular codons altered according to the substitution, deletion, or insertion required. Techniques for making such alterations are well established and include, for example, those disclosed by Walder et al. (Gene 42: 133, 1986); Bauer et al. (Gene 37:73, 1985); Craik (BioTechniques, January 1985, 12- 19); Smith et al. (Genetic Engineering: Principles and Methods, Plenum Press, 1981); and U.S. Pat. Nos. 4,518,584 and 4,737,462, which are herein incorporated by reference in their entireties. Any cysteine residue not involved in maintaining the proper conformation of a polypeptide also can be substituted, generally with serine, to improve the oxidative stability of the molecule and prevent aberrant crosslinking. Conversely, cysteine bond(s) can be added to a polypeptide to improve its stability or facilitate oligomerization.

[0043] In the various embodiments described herein, it is further contemplated that variants (naturally occurring or otherwise), alleles, homologs, conservatively modified variants, and / or conservative substitution variants of any of the particular polypeptides described are encompassed. As to amino acid sequences, one of ordinary skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters a single amino acid or a small percentage of amino acids in the encoded sequence is a “conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid and retains the desired activity of the polypeptide. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles consistent with the disclosure.

[0044] A given amino acid can be replaced by a residue having similar physiochemical characteristics, e.g., substituting one aliphatic residue for another (such as Ile, Vai, Leu, or Ala for one another), or substitution of one polar residue for another (such as between Lys and Arg; Glu and Asp; or Gin and Asn). Other such conservative substitutions, e.g., substitutions of entire regions having similar hydrophobicity characteristics, are well known. Polypeptides comprising conservative amino acid substitutions can be tested in any one of the assays described herein to confirm that a desired activity, e.g. ligand-mediated receptor activity and specificity of a native or reference polypeptide is retained.

[0045] Amino acids can be grouped according to similarities in the properties of their side chains (in A. L. Lehninger, in Biochemistry, second ed., pp. 73-75, Worth Publishers, New York (1975)): (1) non-polar: Ala (A), Vai (V), Leu (L), Ile (I), Pro (P), Phe (F), Trp (W), Met (M); (2) uncharged polar: Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gin (Q); (3) acidic: Asp (D), Glu (E); (4) basic: Lys (K), Arg (R), His (H). Alternatively, naturally occurring residues can be divided into groups based on common side-chain properties: (1) hydrophobic: Norleucine, Met, Ala, Vai, Leu, Ile; (2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gin; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; (6) aromatic: Trp, Tyr, Phe. Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Particular conservative substitutions include, for example; Ala into Gly or into Ser; Arg into Lys; Asn into Gin or into His; Asp into Glu; Cys into Ser; Gin into Asn; Glu into Asp; Gly into Ala or into Pro; His into Asn or into Gin; Ile into Leu or into Vai; Leu into Ile or into Vai; Lys into Arg, into Gin or into Glu; Met into Leu, into Tyr or into Ile; Phe into Met, into Leu or into Tyr; Ser into Thr; Thr into Ser; Trp into Tyr; Tyr into Trp; and / or Phe into Vai, into Ile or into Leu.

[0046] In some embodiments, a polypeptide described herein (or a nucleic acid encoding such a polypeptide) can be a functional fragment of one of the amino acid sequences described herein. As used herein, a “functional fragment” is a fragment or segment of a peptide which retains at least 50% of the wildtype reference polypeptide’s activity according to an assay known in the art or described below herein. A functional fragment can comprise conservative substitutions of the sequences disclosed herein.

[0047] In some embodiments, a polypeptide described herein can be a variant of a polypeptide or molecule as described herein. In some embodiments, the variant is a conservatively modified variant. Conservative substitution variants can be obtained by mutations of native nucleotide sequences, for example. A “variant," as referred to herein, is a polypeptide substantially homologous to a native or reference polypeptide, but which has an amino acid sequence different from that of the native or reference polypeptide because of one or a plurality of deletions, insertions or substitutions. Variant polypeptide -encoding DNA sequences encompass sequences that comprise one or more additions, deletions, or substitutions of nucleotides when compared to a native or reference DNA sequence, butthat encode a variant protein or fragment thereof that retains activity of the non-variant polypeptide. A wide variety of PCR-based site-specific mutagenesis approaches are known in the art and can be applied by the ordinarily skilled artisan.

[0048] A variant amino acid or DNA sequence can be at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, identical to a native or reference sequence. The degree of homology (percent identity) between a native and a mutant sequence can be determined, for example, by comparing the two sequences using freely available computer programs commonly employed for this purpose on the world wide web (e.g. BLASTp or BLASTn with default settings).

[0049] As used herein, the term "DNA" is defined as deoxyribonucleic acid. The term "polynucleotide" is used herein interchangeably with "nucleic acid" to indicate a polymer of nucleosides. Typically, a polynucleotide is composed of nucleosides that are naturally found in DNA or RNA (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxy cytidine) joined by phosphodiester bonds. However, the term encompasses molecules comprising nucleosides or nucleoside analogs containing chemically or biologically modified bases, modified backbones, etc., whether or not found in naturally occurring nucleic acids, and such molecules may be preferred for certain applications. Where this application refers to a polynucleotide it is understood that both DNA, RNA, and in each case both single- and double-stranded forms (and complements of each single-stranded molecule) are provided. "Polynucleotide sequence" as used herein can refer to the polynucleotide material itself and / or to the sequence information (i.e. the succession of letters used as abbreviations for bases) that biochemically characterizes a specific nucleic acid. A polynucleotide sequence presented herein is presented in a 5' to 3' direction unless otherwise indicated.

[0050] The term “operably linked,” as used herein, refers to the arrangement of various nucleic acid molecule elements relative to each other such that the elements are functionally connected and are able to interact with each other. Such elements may include, without limitation, a promoter, an enhancer, a polyadenylation sequence, one or more introns and / or exons, and a coding sequence of a gene of interest to be expressed. The nucleic acid sequence elements, when operably linked, can act together to modulate the activity of one another, and ultimately may affect the level of expression of the gene of interest, including any of those encoded by the sequences described above.

[0051] The term “vector,” as used herein, refers to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. A nucleic acid sequence can be “exogenous,” which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g,YACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques (see, for example, Maniatis et al., 1988 and Ausubel et al., 1994, both of which are incorporated herein by reference). Additionally, the techniques described herein and demonstrated in the referenced figures are also instructive with regard to effective vector construction.

[0052] The terms “Herpes simplex virus 1 (HSV-1) recombinant virus” or “HSV-1 vector” or refers to a genetically engineered HSV-1 virus corresponding to at least a portion of the genome of HSV-1 that is capable of infecting a target cell, replicating, and being packaged into HSV-1 virions. The genetically engineered virus comprises deletions and or mutations and or insertions of nucleic acids. The virus may be attenuated or non-attenuated. The virus may deliver a transgene-that differs from the HSV viral genome.

[0053] The term “promoter,” as used herein, refers to a nucleic acid sequence that regulates, either directly or indirectly, the transcription of a corresponding nucleic acid coding sequence to which it is operably linked. The promoter may function alone to regulate transcription, or, in some cases, may act in concert with one or more other regulatory sequences such as an enhancer or silencer to regulate transcription of the gene of interest. The promoter comprises a DNA regulatory sequence, wherein the regulatory sequence is derived from a gene, which is capable of binding RNA polymerase and initiating transcription of a downstream (3 '-direction) coding sequence. A promoter generally comprises a sequence that functions to position the start site for RNA synthesis. The best-known example of this is the TATA box, but in some promoters lacking a TATA box, such as, for example, the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation. Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have been shown to contain functional elements downstream of the start site as well. To bring a coding sequence “under the control of’ a promoter, one can position the 5' end of the transcription initiation site of the transcriptional reading frame “downstream” of (i.e., 3' of) the chosen promoter. The “upstream” promoter stimulates transcription of the DNA and promotes expression of the encoded RNA.

[0054] The spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. Depending on the promoter used, individual elements can function either cooperatively or independently to activate transcription. The promoters described herein may or may not be used in conjunction with an “enhancer,” which refers to a cis-acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence, such as those for the genes, or portions or functional equivalents thereof, listed herein.

[0055] A promoter may be one naturally associated with a nucleic acid sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and / or exon. Such apromoter can be referred to as “endogenous.” Similarly, an enhancer may be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence. Alternatively, certain advantages may be gained by positioning the coding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer refers also to an enhancer not normally associated with a nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other virus, or prokaryotic or eukaryotic cell, and promoters or enhancers not “naturally occurring,” i.e., containing different elements of different transcriptional regulatory regions, and / or mutations that alter expression. For example, promoters that are most commonly used in recombinant DNA construction include, the HCMV immediate-early promoter, the beta-lactamase (penicillinase), lactose and tryptophan (trp) promoter systems.

[0056] A “gene,” or a “sequence which encodes” a particular protein, is a nucleic acid molecule which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of one or more appropriate regulatory sequences. A gene of interest can include, but is no way limited to, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic DNA, and even synthetic DNA sequences. A transcription termination sequence will usually be located 3' to the gene sequence. Typically, a polyadenylation signal is provided to terminate transcription of genes inserted into a recombinant virus.

[0057] The term " polypeptide " as used herein refers to a polymer of amino acids. The terms "protein" and "polypeptide" are used interchangeably herein. A peptide is a relatively short polypeptide, typically between about 2 and 60 amino acids in length. Polypeptides used herein typically contain amino acids such as the 20 L-amino acids that are most commonly found in proteins. However, other amino acids and / or amino acid analogs known in the art can be used. One or more of the amino acids in a polypeptide may be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a phosphate group, a fatty acid group, a linker for conjugation, functionalization, etc. A polypeptide that has a nonpolypeptide moiety covalently or noncovalently associated therewith is still considered a "polypeptide." Exemplary modifications include glycosylation and palmitoylation. Polypeptides can be purified from natural sources, produced using recombinant DNA technology or synthesized through chemical means such as conventional solid phase peptide synthesis, etc. The term "polypeptide sequence" or "amino acid sequence" as used herein can refer to the polypeptide material itself and / or to the sequence information (i.e., the succession of letters or three letter codes used as abbreviations for amino acid names) that biochemically characterizes a polypeptide. A polypeptide sequence presented herein is presented in an N-terminal to C-terminal direction unless otherwise indicated.

[0058] The term “transgene” refers to a particular nucleic acid sequence encoding a polypeptide or a portion of a polypeptide to be expressed in a cell into which the nucleic acid sequence is inserted. The term “transgene” is meant to include (1) a nucleic acid sequence that is not naturally found in the cell (i.e., a heterologous nucleic acid sequence); (2) a nucleic acid sequence that is a mutant form of a nucleic acid sequence naturally found in the cell into which it has been inserted; (3) a nucleic acid sequence that serves to add additional copies of the same (i.e., homologous) or a similar nucleic acid sequence naturally occurring in the cell into which it has been inserted; or (4) a silent naturally occurring or homologous nucleic acid sequence whose expression is induced in the cell into which it has been inserted. A “mutant form” or “modified nucleic acid” or “modified nucleotide” sequence means a sequence that contains one or more nucleotides that are different from the wild-type or naturally occurring sequence, i.e., the mutant nucleic acid sequence contains one or more nucleotide substitutions, deletions, and / or insertions. In some cases, the gene of interest may also include a sequence encoding a leader peptide or signal sequence such that the transgene product may be secreted from the cell.

[0059] A “biologically active” portion of a molecule, as used herein, refers to a portion of a larger molecule that can perform a similar function as the larger molecule. Merely by way of non-limiting example, a biologically active portion of a promoter is any portion of a promoter that retains the ability to influence gene expression, even if only slightly. Similarly, a biologically active portion of a protein is any portion of a protein which retains the ability to perform one or more biological functions of the full-length protein (e.g. binding with another molecule, phosphorylation, etc.), even if only slightly.

[0060] As used herein, the term "administering," refers to the placement of a therapeutic or pharmaceutical composition as disclosed herein into a subject by a method or route which results in at least partial delivery of the agent at a desired site. Pharmaceutical compositions comprising agents as disclosed herein can be administered by any appropriate route which results in an effective treatment in the subject.

[0061] The term “statistically significant" or “significantly" refers to statistical significance and generally means a two standard-deviation (2SD) or greater difference.

[0062] As used herein the term "comprising" or "comprises" is used in reference to compositions, methods, and respective component(s) thereof, that are essential to the method or composition, yet open to the inclusion of unspecified elements, whether essential or not.

[0063] As used herein the term "consisting essentially of refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment.

[0064] The term "consisting of refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.

[0065] The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The abbreviation, "e.g." is derived from the Latin exempli gratia, and is used herein to indicate a nonlimiting example. Thus, the abbreviation "e.g." is synonymous with the term "for example."

[0066] It is to be understood that the foregoing description and the following examples are illustrative only and are not to be taken as limitations upon the scope of the invention. Various changes and modifications to the disclosed embodiments, which will be apparent to those of skill in the art, may be made without departing from the spirit and scope of the present invention. Further, all patents, patent applications, and publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents are based on the information available to the applicants and do not constitute any admission as to the correctness of the dates or contents of these documents.BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Fig. 1 shows schematic of genome structures of HSV-1 KTT3 and JDNI7.

[0068] Figs 2A and 2B show replication kinetics of KTT3 and JDNI7 at 37°C. U2OS4-27 cells were infected with KTT3 or JDNI7 at 0.05 genome copies / cell. Cell lysates were collected at 8 hours post-infection or 1-5 days post-infection, and viral yields were titrated by plaque assays on U2OS4-27 cells.

[0069] Figs 3A and 3B show replication kinetics of KTT3 and JDNI7 at 37°C. U2OS cells were infected with KTT3 or JDNI7 at 300 genome copies / cell. Cell lysates were collected at 8 hours postinfection or 1-5 days post-infection and viral yields were titrated as in Fig. 2A and 2B.

[0070] Figs 4A and 4B show western blots of proteins from lysates of human foreskin fibroblasts infected with 30,000 genomes of one of the two viruses. Fig. 4A) HFFs were infected at 15,000 gc / cell and harvested at 1-5 days post-infection. Fig. 4B) HFFs were infected at 15,000 gc / cell and harvested at 1-5 days post-infection.

[0071] Fig 5 shows KTT3 transgene expression is resistant to the host cell factor IFI16 which silences HSV gene expression by epigenetic mechanisms. IFI16 control (Cas9) cells or IFI16 knockout cells were infected with a viral dose containing 10,000 gene copies of HSV-1 KTT3, JDNI7 or dl09 (all IE genes deleted and GFP cassette in the ICP27 locus). dl09 expression of GFP was increased by IFI16 knockout, but KTT3 expression of GFP was unaffected.

[0072] Figs 6A and 6B show that numbers of viral genome copies (gc) present in nuclear or cytosolic fractions of human foreskin fibroblasts (HFF) were equivaent for KTT3 and JDNI7.HFFs were infected at 10,000 gc / cell and harvested at 2 hours post-infection. qPRC was used to determine gc present in in nuclear (Fig. 6A) or cytosolic fractions (Fig. 6B)

[0073] Fig 7 shows GFP expression in human foreskin fibroblasts (HFF) infected with indicated virus. HFFs were infected at 10,000 gc / cell, 20,000 gc / cell, or 30,000 gc / cell and harvested at 2 hours post-infection, 1 day post-infection or 5 days post-infection.

[0074] Fig 8 shows a map of the LAT locus in the JDNI and KTT3 viruses. The GFP transgene cassette is oriented from right to left.DETAILED DESCRIPTIONVirus compositions

[0075] Described herein are sequences and data related to a herpes simplex virus 1 (HSV-1) recombinant virus comprising within its genome: one or more therapeutic payload sequences, wherein the genome comprises at least one alteration in each of a gene encoding infected cell polypeptides (ICP) 0, a gene encoding ICP4, a gene encoding ICP22, a gene encoding ICP27 and a gene encoding ICP47, wherein the genome does not encode a functional ICP0, ICP4, ICP22, ICP27 and ICP47 protein, and wherein the genome comprises internal inverted repeat (joint) regions.

[0076] Also provided herein is a herpes simplex virus 1 (HSV-1) recombinant virus, comprising within its genome: one or more therapeutic payload sequences, wherein the genome comprises at least one of i) a deletion of the ICP0 ORF; ii) a deletion of the ICP4 ORF; iii) a deletion of the ICP27 ORF; iv) a deletion of the ICP22 IE promoter; and v) a deletion of the ICP47 IE promoter; wherein the genome does not encode a functional ICP0, ICP4, ICP22, ICP27 and ICP47 protein, and wherein the genome comprises internal inverted repeat (joint) regions.

[0077] Data shown herein conclude that the of this HSV virus, inclusion of the internal inverted repeat (joint) regions within its genome, enhance the beneficial properties of the virus. For example, the HSV virus described herein replicates to 3 to 4-fold higher titers as compared to viruses lacking internal inverted repeat (joint) regions; produces plaques that have a 2-fold larger diameter as compared to viruses lacking internal inverted repeat (joint) regions; produce viral stocks with 3 to 5-fold lower Genome:PFU ratio as compared to viruses lacking internal inverted repeat (joint) regions; show higher expression of atransgene as compared to viruses lacking internal inverted repeat (joint) regions;; and have enhanced lytic infection as compared to viruses lacking internal inverted repeat (joint) regions.

[0078] Herpesviruses are enveloped double stranded DNA-containing viruses in an icosahedral nucleocapsid. HSV double-stranded, linear DNA genome is comprised of 152 kb of nucleotide sequence, which encodes about 80 genes. At least seven herpesviruses are associated with infection in humans, including herpes simplex virus 1 (HSV-1), herpes simplex virus 2 (HSV-2), varicella zoster virus (VZV), Epstein Barr virus (EBV), cytomegalovirus (CMV), human herpesvirus-6 (HHV-6) and human herpesvirus-7 (HHV-7).

[0079] HSV-1 exhibits a pattern of gene expression during productive infection of a host cell or subject that is stringently regulated (see, e.g., Howley and Knipe, Fields Virology, 2021, Wolters Kluwer; DeLuca et al., J. Virol., 56:558 (1985); McCarthy et al., J. Virol., 63: 18 (1989); Gao et al., J. Virol. 63:5258 (1989); and Quinlan et al., Cell, 36:657 (1984) which are incorporated herein by reference in their entireties). The viral genes are transcribed by cellular RNA polymerase II and are temporally regulated, resulting in the transcription and subsequent synthesis of gene products in roughly discernible phases: immediate-early (IE, or α), early (E, or β) and late (L, or γ). Immediately following the arrival of an HSV genome into the nucleus of an infected cell, the IE genes are transcribed. The IE genes are all activated by a complex including the HSV virion particle VP 16 and the cellular factor, Oct-1, which binds to a consensus sequence (TAATGARAT) regulating IE gene expression (see, e.g., Preston et al., Cell, 52, 425-35 (1988), which is incorporated herein by reference in its entirety). The presence of this sequence, thus, confers the IE quality to HSV regulatory sequences. The efficient expression of IE genes, thus, does not require prior viral protein synthesis, while later expression depends upon the presence of IE gene products. The products of IE genes are required to activate transcription and regulate the remainder of the viral genome.

[0080] Infected cell polypeptide 4 (ICP4), ICP0, ICP27, ICP22, and ICP47 are the immediate early gene products, and these show varying degrees of essentiality to HSV function. These phosphoproteins possess regulatory activities that can prime the host cell for the efficient cascade of subsequent viral gene expression, DNA replication, and the production of progeny virions. For example, ICP0 activates most test promoters in transient assays (Quinlan and Knipe, Mol. Cell. Biol., 5, 957-63 (1985)), elevates levels of viral gene expression and growth in tissue culture and in the trigeminal ganglia (Cai and Schaffer, J Virol., 66, 2904-15 (1992)), and facilitates the reactivation of virus from latency (Leib, et al., J. Virol., 63, 759-68 (1989)). ICP27 modulates the activity of ICP4 and ICP0, and it regulates viral and cellular mRNA processing. These activities of ICP27 contribute to efficient DNA replication, hence it is necessary for viral growth; however, ICP27 also regulates the proper expression of early and late genes. ICP22 promotes efficient late gene expression in a cell-type dependent manner and is involved in the production of a novel modified form of RNA Pol II. ICP4 is a large multifunctional protein that can act as a transcription factor thateither represses or activates transcription through contacts with the general transcriptional machinery. ICP4 controls both virus infectivity and the transition from IE to later transcription.

[0081] The recombinant virus provided herein and demonstrated in the working examples has been engineered as a gene expression vector for expression of a therapeutic payload (e.g., a therapeutic transgene, a gene editing gene, a microRNA (miRNA), a interfering RNA, an antisense RNA, a ribozyme, and an aptamer).

[0082] In one embodiment, the one or more therapeutic payload sequences are inserted in a latency- associated transcript (LAT) gene locus, e.g., see Fig. 10.

[0083] In one embodiment, the one or more therapeutic payload sequences are inserted between two insulator sequences.

[0084] In one embodiment, the one or more therapeutic payload sequences are inserted in between CTRL1 and CTRL2 sequences, e.g., SEQ ID NO: 11 and 23, respectively. CTRL1 and CTRL2 are described in the art, for example, in Amelio, AL., et al. Journal of Virology, Mar. 2006, p. 3358-2368, which is incorporated herein by reference in its entirety.

[0085] In some embodiments, the genome comprises at least one alteration in a gene encoding ICP0. ICP0 plays a major role in enhancing the reactivation of HSV from latency and confers a significant growth advantage on the virus at low multiplicities of infection. Sequences for the HSV ICP0 and ICP4 promoters and for the genes whose regulation they endogenously control are well known in the art (e.g., SEQ ID NO: 1, TABLE 1). For example, see McGeoch et al., J. Gen. Virol. 72:3057-3075 (1991); McGeoch et al, Nucl. Acid Res. 77: 1727-1745 (1986); Perry, et al., J. Gen. Virol. 67:2365- 2380 (1986)) and procedures for making viral vectors containing these elements have been previously described (see, e.g., US 2005 / 0266564). These promoters are not only very active in promoting gene expression, they are also specifically induced by VP 16, a virus-associated transactivator released when HSV-1 or HSV-2 infects a cell.

[0086] In some embodiments of any of the aspects, the recombinant virus genome provided herein comprises at least one alteration in one or more genes encoding infected cell polypeptides (ICPs). In some embodiments of any of the aspects, the genome comprises at least one alteration in each of a gene encoding infected cell polypeptides (ICP)0, a gene encoding ICP4, a gene encoding ICP22, a gene encoding ICP27 and a gene encoding ICP47. In some embodiments of any of the aspects, the genome does not encode a functional ICP0, ICP4, ICP22, ICP27 and / or ICP47 proteins. Non-limiting examples of HHV-1 ICP amino acid and gene sequences are provided in TABLE 1.

[0087] In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP0. In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP4. In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP22. In some embodiments of any of the aspects, the genome comprises at least one alteration inICP27. In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP47.

[0088] In some embodiments of any of the aspects the genome comprises at least one alteration in ICP0 and ICP4. In some embodiments of any of the aspects the genome comprises at least one alteration in ICP0 and ICP22. In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP0 and ICP27. In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP0 and ICP47.

[0089] In some embodiments of any of the aspects the genome comprises at least one alteration in ICP4 and ICP22. In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP4 and ICP27. In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP4 and ICP47.

[0090] In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP22 and ICP27. In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP22 and ICP47. In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP27 and ICP47.

[0091] In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP0, ICP4, and ICP22. In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP0, ICP22, and ICP27. In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP0, ICP22, and ICP47. In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP0, ICP27, and ICP47.

[0092] In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP4, ICP22, and ICP27. In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP4, ICP22, and ICP47. In some embodiments of any of the aspects, the genome comprises at least one alteration in ICP22, ICP27, and ICP47.

[0093] In some embodiments, the genome comprises at least one, two, three, four, five, six, seven, eight, nine, ten, or more alterations in the genes encoding an ICP polypeptide of HSV-1. In some embodiments of any of the aspects, the genome comprises at least one alteration in one gene encoding infected cell polypeptides (ICP)0, a gene encoding ICP4, a gene encoding ICP22, a gene encoding ICP27, and / or a gene encoding ICP47. In some embodiments of any of the aspects, the genome comprises at least one alteration in two genes encoding infected cell polypeptides (ICP)0, a gene encoding ICP4, a gene encoding ICP22, a gene encoding ICP27, and / or a gene encoding ICP47. In some embodiments of any of the aspects, the genome comprises at least one alteration in three genes encoding infected cell polypeptides (ICP)0, a gene encoding ICP4, a gene encoding ICP22, a gene encoding ICP27, and / or a gene encoding ICP47. In some embodiments of any of the aspects, the genome comprises at least one alteration in four genes encoding infected cell polypeptides (ICP)0, a gene encoding ICP4, a gene encoding ICP22, a gene encoding ICP27, and / or a gene encoding ICP47.In some embodiments of any of the aspects, the genome comprises at least one alteration in five genes encoding infected cell polypeptides (ICP)0, a gene encoding ICP4, a gene encoding ICP22, a gene encoding ICP27, and / or a gene encoding ICP47.

[0094] In some embodiments of any of the aspects, the genome does not encode a functional ICP0 protein. In some embodiments of any of the aspects, the genome does not encode a functional ICP4 protein. In some embodiments of any of the aspects, the genome does not encode a functional ICP22 protein. In some embodiments of any of the aspects, the genome does not encode a functional ICP27 protein. In some embodiments of any of the aspects, the genome does not encode a functional ICP47 protein. In some embodiments of any of the aspects, the genome does not encode a functional ICP0 protein or an ICP22 protein. In some embodiments of any of the aspects, the genome does not encode a functional ICP0 protein or an ICP4 protein. In some embodiments of any of the aspects, the genome does not encode a functional ICP0 protein or an ICP27 protein. In some embodiments of any of the aspects, the genome does not encode a functional ICP0 protein or an ICP47 protein.

[0095] In some embodiments of any of the aspects, the genome does not encode a functional ICP4 protein or an ICP22 protein. In some embodiments of any of the aspects, the genome does not encode a functional ICP4 protein or an ICP27 protein. In some embodiments of any of the aspects, the genome does not encode a functional ICP4 protein or an ICP47 protein. In some embodiments of any of the aspects, the genome does not encode a functional ICP22 protein or an ICP27 protein. In some embodiments of any of the aspects, the genome does not encode a functional ICP22 protein or an ICP47 protein. In some embodiments of any of the aspects, the genome does not encode a functional ICP27 protein or an ICP47 protein.

[0096] TABLE 1: Exemplary Wild-type HHV-1 and HHV2 ICP gene and amino acid sequences

[0097] In one embodiment, the at least one alteration is a deletion of the gene’s open reading frame (ORF). In one embodiment, the at least one alteration is a deletion of gene’s intermediate early (IE) promoter. In one embodiment of any aspect herein, the at least one alteration is a deletion of at least a part of the gene’s intermediate early (IE) promoter. In one embodiment of any aspect herein, the at least one alteration is a deletion of the entirety of the gene’s intermediate early (IE) promoter.

[0098] In one embodiment, the at least one alteration of the ICP0 gene is a deletion of the ICP0 ORF. In one embodiment, the at least one alteration of the ICP4 gene is a deletion of the ICP4 ORF. In one embodiment, the at least one alteration of the ICP27 gene is a deletion of the ICP27 ORF.

[0099] In one embodiment, the at least one alteration of the ICP22 gene is a deletion of the ICP22 IE promoter. In one embodiment, the at least one alteration of the ICP47 gene is a deletion of the ICP47 IE promoter.

[0100] In some embodiments of any of the aspects, the genome comprises a nucleotide sequence of SEQ ID NO: 2 and where there is at least one alteration in SEQ ID NO: 2.

[0101] In some embodiments of any of the aspects, the genome comprises a nucleotide sequence of SEQ ID NO: 4 and where there is at least one alteration in SEQ ID NO: 4.

[0102] In some embodiments of any of the aspects, the genome comprises a nucleotide sequence of SEQ ID NO: 6 and where there is at least one alteration in SEQ ID NO: 6.

[0103] In some embodiments of any of the aspects, the genome comprises a nucleotide sequence of SEQ ID NO: 8 and where there is at least one alteration in SEQ ID NO: 8.

[0104] In some embodiments of any of the aspects, the genome comprises a nucleotide sequence of SEQ ID NO: 10 and where there is at least one alteration in SEQ ID NO: 10.

[0105] In some embodiments of any of the aspects, the genome comprises a 270 nucleotide deletion in ICP22 promoter from 131396-131666 (NCBI Ref sequence: JQ673480.1) (SEQ ID NO: 11).

[0106] In some embodiments of any of the aspects, the genome comprises a 270 nucleotide deletion in ICP47 promoter from 146188-146458 (NCBI Reference sequence: JQ673480.1) (SEQ ID NO: 12).

[0107] HSV viruses described herein comprise in its genome internal inverted repeat (joint) regions. The joint region of the HSV comprises the IRs and IRL and is known in the art. Viruses in the art, e.g., US Patent No. 10,174,341 and US Patent Application No. 2019 / 0276845, the contents of which areincorporated herein by reference in their entireties, describe viruses that specifically delete the joint regions. As described in US Patent No. 10,174,341, the joint region is deleted in order to contribute to stability of the virus and accommodate larger transgenes. Specifically, US Patent No. 10,174,341 teaches “In addition to the foregoing, the inventive HSV vector also desirably comprises a deletion of the internal repeat (Joint) region, comprising IRs and IRL. Deleting this region can contribute to the stability of the vector genome, and deleting this sequence of HSV DNA also allows for the vector to accommodate large transgenes (at least 15 kb) and still be packaged correctly into mature virions.”

[0108] In one embodiment, the virus herein is any of the viruses described in US Patent No. 10,174,341 or US Patent Application No. 2019 / 0276845 that is modified to retain the internal repeat (Joint) region.

[0109] In one embodiment, the one or more therapeutic payload sequence is expressed for at least 3 months, at least 6 months, at least 9 months, at least 12 months or more. In one embodiment of any aspect herein, one or more therapeutic payload sequence is expressed for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, or more.

[0110] In one embodiment, the one or more therapeutic payload sequence is expressed at a higher level as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions. For example, the one or more therapeutic payload sequence is expressed at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%,34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%,51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%,68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%,85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or lx, 5x, 10x, 15x, 20x, 25x, 30x, 35x, 40x, 45x, 50x, 55x, 60x, 65x, 70x, 75x, 80x, 85x, 90x, 95x, 100x, 1000x or more higher level as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions. One skilled in the art will understand how to assess the expression level of a payload using standard assays in the art, e.g., using a western-blotting or a PCR-based assay to assess protein or mRNA levels of the payload e.g., as described herein in Example 3.

[0111] In one embodiment, the recombinant virus produces plaques having a diameter that is at least 2- fold larger as compared to an HSV-1 recombinant virus having a genome that does not compriseinternal inverted repeat (joint) regions. For example, the recombinant virus produces plaques having a diameter that is at least 2- fold, 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold, 40-fold, 45-fold, 50-fold, 55-fold, 60-fold, 65-fold, 70-fold, 75-fold, 80-fold, 85-fold, 90-fold, 95-fold, 100- fold, or more larger as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions. One skilled in the art will understand how to assess plaque diameter using standard assays in the art, e.g., as described herein in Example 3.

[0112] In one embodiment, the recombinant virus exhibits a greater infectivity (PFU per genome copy) as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions. For example, the recombinant virus exhibits an at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%,22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%.39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%,56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%.73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%.90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or lx, 5x, lOx, 15x, 20x, 25x, 30x, 35x,40x, 45x, 50x, 55x, 60x, 65x, 70x, 75x, 80x, 85x, 90x, 95x, lOOx, lOOOx or more greater infectivity (PFU per genome copy) as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions. One skilled in the art will understand how to assess infectivity of a virus using standard assays in the art, e.g., as described herein in Example 3.

[0113] In one embodiment, the recombinant virus exhibits a higher viral yield as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions. For example, the recombinant virus exhibits an least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%,27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%.44%. 45%. 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%.61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%.78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,95%, 96%, 97%, 98%, 99%, or lx, 5x, lOx, 15x, 20x, 25x, 30x, 35x, 40x, 45x, 50x, 55x, 60x, 65x,70x, 75x, 80x, 85x, 90x, 95x, lOOx, lOOOx or more higher viral yield as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions. One skilled in the art will understand how to assess viral yield of a virus using standard assays in the art, e.g., as described herein in Example 3.

[0114] Also provide herein are compositions comprising any of the viruses described herein. In one embodiment, the composition further comprises a pharmaceutically acceptable carrier.Therapeutic Payload

[0115] Viruses described herein include in its genome a therapeutic payload. Exemplary therapeutic payloads include a therapeutic transgene, a gene editing gene, a microRNA (miRNA), a interfering RNA, an antisense RNA, a ribozyme, and an aptamer.

[0116] As used herein, the term "therapeutic transgene" refers to a gene that, when expressed, confers a beneficial effect on the cell or tissue in which it is present, or on a subject, e.g., a mammal in which the gene is expressed. Examples of beneficial effects include amelioration of a sign or symptom of a condition or disease, prevention or inhibition of a condition or disease, or conferral of a desired characteristic. It is noted that the genome of the recombinant virus as described herein can comprise two, three, four, five, six, seven, eight, nine, ten or more therapeutic gene coding sequences. The therapeutic gene coding sequences can be the same or different or some same and some different.

[0117] As described herein, the therapeutic gene coding sequence can encode a non-fiision or a fusion protein. Accordingly, in some embodiments of the various aspects, the therapeutic gene coding sequence encodes a heterodimeric protein as a fusion protein. For example, the therapeutic gene coding sequence encodes a first domain of the fusion protein and a second domain of the fusion protein, where the first and second domain are different domains of the heterodimeric protein.

[0118] In one embodiment, the therapeutic transgene is a disease gene, e.g., for overexpression of the disease gene. In one embodiment, the therapeutic transgene corrects a disease gene, i.e., corrects a mutation contained in a disease gene. Exemplary disease genes include but are not limited to lp36; 18p; 6p21.3; 14q32; AAAS; FGD1; EDNRB; CP (3p26.3); LMBR1; COL2A1 (12ql3.11); 4pl6.3; HMBS; ADSL; ABCD1; JAG1; NOTCH2; TP63; TREX1; RNASEH2A; RNASEH2B; RNASEH2C; SAMHD1; ADAR; IFIH1; GFAP; HGD; 10q26.13; ATP1A3; ALMS1; ALAD; FGFR2; VPS33B; ATM; PITX2; FOXO1A; FOXCI; PAX6; 10q26; FGFR2; IGF-2; CDKN1C; H19; KCNQ1OT1; BTD; BCS1L; 15q26.1; 17 FLCN; ATP2A1; MAOA; NOTCH3; HTRA1; X 17q24.3-q25.1; ASPA; RAB23; SNAP29; FTR (7q31.2); PMP22; MFN2; CHD7; LYST; RUNX2; ERCC6; ERCC8; X RPS6KA3; COH1; COL11A1; COL11A2; COL2A1; NTRK1; PTEN; CPOX; 14q13-q21; 5p; 16q12; FGFR2; FGFR3; FGFR3; ATP2A2; Xpl l.22 CLCN5; OCRL; WT1; 18q; 22ql l.2; HSPB8; HSPB1; HSPB3; GARS; REEP1; IGHMBP2; SLC5A7; DCTN1; TRPV4; SIGMAR1; COL1A1; COL1A2; COL3A1; COL5A1; COL5A2; TNXB; ADAMTS2; PLOD1; B4GALT7; DSE; EMD; LMNA; SYNE1; SYNE2; FHL1; TMEM43; FECH; FANCA; FANCB; FANCC; FANCD1; FANCD2; FANCE; FANCF; FANCG; FANCI; FANCJ; FANCL; FANCM; FANCN; FANCP; FANCS; RAD51C; XPF; GLA (Xq22.1); APC; IKBKAP; MYCN; MED12; FXN; GALT; GALK1; GALE; GBA (1); PAX6; GCDH; ETFA; ETFB; ETFDH; BCS1L; MY05A; RAB27A; MLPH; ATP2C1 (3); ABCA12; HFE; HAMP; HFE2B; TFR2; TF; CP ; FVIII; UROD; 3ql2; ENG; ACVRL1; MADH4; GNE; MYHC2A; VCP; HNRPA2B1; HNRNPA1; EXT1; EXT2; EXT3; HPS1; HPS3; HPS4; HPS5; HPS6; HPS7; AP3B1; PMP22; NODAL; NKX2-5; ZIC3; CCDC11; CFC1; SESN1; CBS (gene); HD; IDS; IDUA; AASS; AGXT; GRHPR; DHDPSL; ABCA1; COL2A1; FGFR3 (4pl6.3); 20q11.2;IKBKG (Xq28); TBX4; 15qll-14; FGFR2; INPP5E; TMEM216; AHI1; NPHP1; CEP290; TMEM67; RPGRIP1L; ARL13B; CC2D2A; 0FD1; TMEM138; TCTN3; ZNF423; AMRC9; ALS2; COL2A1; PDGFRB; GAL; ATP13A2; LCAT; HPRT (X); TP53; MSH2; MLH1; MSH6; PMS2; PMS1; TGFBR2; MLH3; RYR1 (19ql3.2); BCKDHA; BCKDHB; DBT; DLD; ARSB; 20 ql3.2- 13.3; XK (X); AP1S1; MEFV; ATP7A (Xq21.1); MMAA; MMAB; MMACHC; MMADHC; LMBRD1; MUT; RAB3GAP (2q21.3); ASPM (lq31); GALNS; GLB1; ZEB2 (2); FGFR3; MEN1; RET; MSTN; DMPK; CNBP; HYAL1; 17ql 1.2; SMPD1; NPA; NPB; NPC1; NPC2; GLDC; AMT; GCSH; PTPN11; KRAS; S0S1; RAFI; NRAS; HRAS; BRAF; SHOC2; MAP2K1; MAP2K2; CBL; RELN; RAG1; RAG2; COL1A1; COL1A2; IFITM5; PANK2 (20pl3-pl2.3); UROD; PDS; STK11; FGFR1; FGFR2; PAH; AASDHPPT; TCF4 (18); PKD1 (16) or PKD2 (4); DNAI1; DNAH5; TXNDC3; DNAH11; DNAI2; KTU; RSPH4A; RSPH9; LRRC50; PROC; PROS1; ABCC6; RP1; RP2; RPGR; PRPH2; IMPDH1; PRPF31; CRB1; PRPF8; TULP1; CA4; HPRPF3; ABCA4; EYS; CERKL; FSCN2; TOPORS; SNRNP200; PRCD; NR2E3; MERTK; USH2A; PROMI; KLHL7; CNGB1; TTC8; ARL6; DHDDS; BEST1; LRAT; SPARA7; CRX ; MECP2; ESCO2; CREBBP; HEXB; SGSH; NAGLU; HGSNAT; GNS; HSPG2; COL2A1; FBN1; llpl5; Xpl l.22; PHF8; ABCB7; SLC25A38; GLRX5; GUSB; DHCR7; 17pl l.2; ATXN1; ATXN2; ATXN3; PLEKHG4; SPTBN2; CACNA1A; ATXN7; ATXN8OS; ATXN10; TTBK2; PPP2R2B; KCNC3; PRKCG; ITPR1; TBP; KCND3; FGF14; FGFR3; ABCA4; CNGB3; ELOVL4; PROMI; COL11A1; COL11A2; COL2A1; COL9A1; COL2A1; HEXA (15); GCH1; PCBD1; PTS; QDPR; MTHFR; DHFR; FGFR3; 5q32-q33.1 (TCOF1; POLR1C; or POLR1D); TSC1; TSC2; MYO7A; USH1C; CDH23; PCDH15; USH1G; USH2A; GPR98; DFNB31; CLRN1; PPOX; VHL; PAX3; MITF; WS2B; WS2C; SNAI2; EDNRB; EDN3; SOX10; COL11A2; ATP7B; C2ORF37 (2q22.3-q35); 4pl6.3; 15 ERCC4; CENPVL1; CENPVL2; GSPT2; MAGED1; ALAS2 (X); PEX1; PEX2; PEX3; PEX5; PEX6; PEX10; PEX12; PEX13; PEX14; PEX16; PEX19; and PEX26.

[0119] In one embodiment, the therapeutic transgene is a codon-optimized sequence. Methods for codon-optimizing a sequence are known in the art.

[0120] In one embodiment, the therapeutic payload is an antisense oligonucleotide. As used herein, an “antisense oligonucleotide” refers to a synthesized nucleic acid sequence that is complementary to a DNA or mRNA sequence, such as that of a microRNA. Antisense oligonucleotides are typically designed to block expression of a DNA or RNA target by binding to the target and halting expression at the level of transcription, translation, or splicing. Antisense oligonucleotides of the present invention are complementary nucleic acid sequences designed to hybridize under cellular conditions to a gene. Thus, oligonucleotides are chosen that are sufficiently complementary to the target, i.e., that hybridize sufficiently well and with sufficient specificity in the context of the cellular environment, to give the desired effect. For example, an antisense oligonucleotide may comprise atleast 5, at least 10, at least 15, at least 20, at least 25, at least 30, or more bases complementary to a portion of the coding sequence of the gene of interest.

[0121] In one embodiment, the therapeutic payload is a genome editing system including, but not limited to, zinc finger nucleases, TALENS, meganucleases, and CRISPR / Cas systems. In another embodiment of any of the aspects, the genomic editing system used to incorporate the nucleic acid encoding one or more guide RNAs into the cell’s genome is not a CRISPR / Cas system; this can prevent undesirable cell death in cells that retain a small amount of Cas enzyme / protein. It is also contemplated herein that either the Cas enzyme or the sgRNAs are each expressed under the control of a different inducible promoter, thereby allowing temporal expression of each to prevent such interference.

[0122] When a nucleic acid encoding one or more sgRNAs and a nucleic acid encoding an RNA- guided endonuclease each need to be administered in vivo, the use of an adenovirus associated vector (AAV) is specifically contemplated. Other vectors for simultaneously delivering nucleic acids to both components of the genome editing / fragmentation system (e.g., sgRNAs, RNA-guided endonuclease) include lentiviral vectors, such as Epstein Barr, Human immunodeficiency virus (HIV), and hepatitis B virus (HBV). Each of the components of the RNA-guided genome editing system (e.g., sgRNA and endonuclease) can be delivered in a separate vector as known in the art or as described herein.

[0123] In one embodiment, the therapeutic payload facilitates RNA inhibition. Inhibitors of the expression of a given gene can be an inhibitory nucleic acid. In some embodiments of any of the aspects, the inhibitory nucleic acid is an inhibitory RNA (iRNA or RNAi). The RNAi can be single stranded or double stranded.

[0124] The term “RNAi” as used herein refers to interfering RNA or RNA interference. RNAi refers to a means of selective post-transcriptional gene silencing by destruction of specific mRNA by molecules that bind and inhibit the processing of mRNA, for example inhibit mRNA translation or result in mRNA degradation. As used herein, the term "RNAi" refers to any type of interfering RNA, including but are not limited to, siRNA, shRNA, endogenous microRNA and artificial microRNA. For instance, it includes sequences previously identified as siRNA, regardless of the mechanism of down-stream processing of the RNA (i.e., although siRNAs are believed to have a specific method of in vivo processing resulting in the cleavage of mRNA, such sequences can be incorporated into the vectors in the context of the flanking sequences described herein).

[0125] The iRNA can be siRNA, shRNA, endogenous microRNA (miRNA), or artificial miRNA. In one embodiment of any of the aspects, an iRNA as described herein effects inhibition of the expression and / or activity of a target gene.

[0126] One skilled in the art would be able to design siRNA, shRNA, or miRNA to target a specific gene e.g., using publicly available design tools. siRNA, shRNA, or miRNA is commonly made using companies such as Dharmacon (Layfayette, CO) or Sigma Aldrich (St. Louis, MO).

[0127] In some embodiments of any of the aspects, the iRNA can be a dsRNA. A dsRNA includes two RNA strands that are sufficiently complementary to hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence. The target sequence can be derived from the sequence of an mRNA formed during the expression of the target. The other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions

[0128] The RNA of an iRNA can be chemically modified to enhance stability or other beneficial characteristics. The nucleic acids featured in the invention may be synthesized and / or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference.

[0129] In one embodiment, the therapeutic payload is miRNA. microRNAs are small non-coding RNAs with an average length of 22 nucleotides. These molecules act by binding to complementary sequences within mRNA molecules, usually in the 3' untranslated (3'UTR) region, thereby promoting target mRNA degradation or inhibited mRNA translation. The interaction between microRNA and mRNAs is mediated by what is known as the “seed sequence”, a 6-8-nucleotide region of the microRNA that directs sequence-specific binding to the mRNA through imperfect Watson-Crick base pairing. More than 900 microRNAs are known to be expressed in mammals. Many of these can be grouped into families on the basis of their seed sequence, thereby identifying a “cluster” of similar microRNAs. A miRNA can be expressed in a cell, e.g., as naked DNA. A miRNA can be encoded by a nucleic acid that is expressed in the cell, e.g., as naked DNA or can be encoded by a nucleic acid that is contained within a vector.

[0130] In one embodiment, the viral transgene located in the LAT locus is resistant to silencing byGamma-interferon-inducible protein (IfI16). In one embodiment, silencing of the transgene located in the LAT locus is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%,17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%,34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%,51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%.68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%,85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more as compared to a virus having the transgene located outside of the LAT locus.

[0131] In one embodiment, the virus comprises at least two copies of the one or more therapeutic payload sequences within its genome. In one embodiment, the virus comprises at least 2, 3, 4, 5, 6, 7, 8 or more copies of the one or more therapeutic payload sequences within its genome.Methods

[0132] Provided herein is a method of delivering a therapeutic payload to a subject, the method comprising administering to the subject in need thereof any of the recombinant viruses or compositions described herein.

[0133] Also provided herein is a method of altering a gene in a subject, the method comprising administering to the subject in need thereof any of the recombinant viruses or compositions described herein. In one embodiment, the gene is a disease gene, e.g., as described herein above.

[0134] In one embodiment, altering refers to change the DNA or RNA content of a gene. For example, a gene editing system can be used to substitute at least one nucleotide or amino acid, delete at least one nucleotide or amino acid, and or add at least one nucleotide or amino acid.

[0135] In one embodiment, altering refers to increasing the expression of the gene or the gene product. In one embodiment the expression of the gene or gene product is increased by at least at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3 -fold, or at least about a 4-fold, or at least about a 5 -fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. As used herein, a “reference level” refers to the level of the gene absent the payload.

[0136] In one embodiment, altering refers to decreasing the expression of the gene or the gene product. In one embodiment the expression of the gene or gene product is decreased by at least about10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about90%, at least about 95%, at least about 98%, at least about 99%, or more as compared to a reference level. As used herein, a “reference level” refers to the level of the gene absent the payload.

[0137] Also provided herein is a method of treating a disease or disorder in a subject, the method comprising administering to the subject in need thereof any of the recombinant viruses or compositions described herein.

[0138] In one embodiment, the disease or disorder is caused by an identified disease gene. Exemplary diseases or disorders caused by an identified disease gene include, but are not limited to, Amyotrophic Lateral Sclerosis; endotoxemia; atherosclerotic vascular disease is coronary artery disease; stent restenosis; carotid metabolic disease; stroke; acute myocardial infarction; heart failure; peripheral arterial disease; limb ischemia; vein graft failure; AV fistula failure; Crohn's disease; ulcerative colitis; ileitis and enteritis; vaginitis; psoriasis and inflammatory dermatoses such as dermatitis; eczema; atopic dermatitis; allergic contact dermatitis; urticaria; vasculitis;spondyloarthropathies; scleroderma; respiratory allergic diseases such as asthma; allergic rhinitis; hypersensitivity lung diseases; arthritis (e.g. rheumatoid and psoriatic); eczema; psoriasis; osteoarthritis; multiple sclerosis; systemic lupus erythematosus; diabetes mellitus; glomerulonephritis; graft rejection (including allograft rejection and graft-v-host disease) or rejection of an engineered tissue; infectious diseases; myositis; inflammatory CNS disorders; stroke; closed-head injuries; neurodegenerative diseases; Alzheimer's disease; encephalitis; meningitis; osteoporosis; gout; hepatitis; hepatic veno-occlusive disease (VOD); hemorrhagic cystitis; nephritis; sepsis; sarcoidosis; conjunctivitis; otitis; chronic obstructive pulmonary disease; sinusitis; Bechet's syndrome; graft- versus-tumor effect; mucositis; appendicitis; ruptured appendix; peritonitis; aortic valve disease; mitral valve disease; Rett's syndrome; tuberous sclerosis; phenylketonuria; Smith-Lemli-Opitz syndrome and fragile X syndrome; Parkinson's disease; Aicardi-Goutieres Syndrome; Alexander Disease; Allan-Hemdon-Dudley Syndrome; POLG-Related Disorders; Alpha-Mannosidosis (Type II and III); Alstrom Syndrome; Angelman Syndrome; Ataxia-Telangiectasia; Neuronal Ceroid- Lipofuscinoses; Beta-Thalassemia; Bilateral Optic Atrophy and (Infantile) Optic Atrophy Type 1; Retinoblastoma (bilateral); Canavan Disease; Cerebrooculofacioskeletal Syndrome 1 [COFS1]; Cerebrotendinous Xanthomatosis; Cornelia de Lange Syndrome; MAPT-Related Disorders; Genetic Prion Diseases; Dravet Syndrome; Early-Onset Familial Alzheimer Disease; Friedreich Ataxia [FRDA]; Fryns Syndrome; Fucosidosis; Fukuyama Congenital Muscular Dystrophy; Galactosialidosis; Gaucher Disease; Organic Acidemias; Hemophagocytic Lymphohistiocytosis; Hutchinson-Gilford Progeria Syndrome; Mucolipidosis II; Infantile Free Sialic Acid Storage Disease; PLA2G6-Associated Neurodegeneration; Jervell and Lange-Nielsen Syndrome; Junctional Epidermolysis Bullosa; Huntington Disease; Krabbe Disease (Infantile); Mitochondrial DNA- Associated Leigh Syndrome and NARP; Lesch-Nyhan Syndrome; LISI -Associated Lissencephaly; Lowe Syndrome; Maple Syrup Urine Disease; MECP2 Duplication Syndrome; ATP7A-Related Copper Transport Disorders; LAMA2-Related Muscular Dystrophy; Arylsulfatase A Deficiency; Mucopolysaccharidosis Types I; II or III; Peroxisome Biogenesis Disorders; Zellweger Syndrome Spectrum; Neurodegeneration with Brain Iron Accumulation Disorders; Acid Sphingomyelinase Deficiency; Niemann-Pick Disease Type C; Glycine Encephalopathy; ARX-Related Disorders; Urea Cycle Disorders; COL 1 A 1 / 2 -Related Osteogenesis Imperfecta; Mitochondrial DNA Deletion Syndromes; PLP1 -Related Disorders; Perry Syndrome; Phelan-McDermid Syndrome; Glycogen Storage Disease Type II (Pompe Disease) (Infantile); MAPT-Related Disorders; MECP2-Related Disorders; Rhizomelic Chondrodysplasia Punctata Type 1; Roberts Syndrome; Sandhoff Disease; Schindler Disease — Type 1; Adenosine Deaminase Deficiency; Smith-Lemli-Opitz Syndrome; Spinal Muscular Atrophy; Infantile-Onset Spinocerebellar Ataxia; Hexosaminidase A Deficiency; Thanatophoric Dysplasia Type 1; Collagen Type VI-Related Disorders; Usher Syndrome Type I;Congenital Muscular Dystrophy; Wolf-Hirschhom Syndrome; Lysosomal Acid Lipase Deficiency; and Xeroderma Pigmentosum.

[0139] In one embodiment, the subject has been diagnosed as having or at risk of having the disease or disorder prior to administering. Assays for diagnosing a subject has having a given disease or disorder are specific to the given disease or disorder, and are known to the skilled practitioner. Such assays can include, but are not limited to, analysis of biological samples from the subject (e.g., blood, sputum, tissue, urine, or cerebral fluid samples) for a given marker, mutation, or composition; biopsy; CT scan; MRI scan; etc.

[0140] In one embodiment, the method further comprises, prior to administering, the step of diagnosing the subject as having or at risk of having the disease or disorder.

[0141] In one embodiment, the method further comprises, prior to administering, receiving the results of an assay that diagnoses the subject as having or at risk of having the disease or disorder. In some embodiments of any of the aspects, the virus provided herein is administered in combination with one or more additional therapeutic, e.g., used in the treatment of a given disease or disorder.Dosage, Administration, EfficacyDosage

[0142] Effective amounts, toxicity, and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dosage can vary depending upon the dosage form employed and the route of administration utilized. The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio LD50 / ED50. Compositions, methods, and uses that exhibit large therapeutic indices are preferred. A therapeutically effective dose can be estimated initially from cell culture assays. Also, a dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50, which achieves a half-maximal inhibition of measured function or activity as determined in cell culture, or in an appropriate animal model. The effects of any particular dosage can be monitored by a suitable bioassay. The dosage can be determined by a physician and adjusted, as necessary, to suit observed effects of the treatment.Administration

[0143] Although certain routes of administration are provided in the foregoing description, according to the invention, any suitable route of administration of the vectors may be adapted, and therefore the routes of administration described above are not intended to be limiting. Routes of administration may include, but are not limited to, intravenous, regional artery infusion, oral, buccal, intranasal, inhalation, topical application to a mucosal membrane or injection, including intratumoral,intradermal, intrathecal, intracistemal, intralesional or any other type of injection. Administration can be effected continuously or intermittently and will vary with the subject and the condition to be treated. One of skill in the art would readily appreciate that the various routes of administration described herein would allow for the inventive vectors or compositions to be delivered on, in, or near a target site (e.g., heart tissue if treating a cardiac disease or disorder). One of skill in the art would also readily appreciate that various routes of administration described herein will allow for the vectors and compositions described herein to be delivered to a region in the vicinity of the desired site or individual cells to be treated. “In the vicinity” can include any tissue or bodily fluid in the subject that is in sufficiently close proximity to a target site such that at least a portion of the vectors or compositions administered to the subject reach their intended targets and exert their therapeutic effects.

[0144] Prior to administration, the viruses can be suspended in any pharmaceutically acceptable solution including sterile isotonic saline, water, phosphate buffered saline, 1,2-propylene glycol, polyglycols mixed with water, Ringer's solution, etc. The exact number of viruses to be administered is not crucial to the invention but should be an "effective amount," i.e., to obtain an anti-disease or disorder for the disease or disorder to be treated. Since virus is replicated in the cells after infection, the number initially administered will increase rapidly with time. Thus, widely different amounts of initially administered virus can give the same result by varying the time that they are allowed to replicate. In general, it is expected that the number of viruses (PFU) initially administered will be between 1 x 106and 1 x 1010.Efficacy

[0145] The effectiveness of a dosage, as well as the effectiveness of the overall treatment can be assessed by using standard imaging techniques over a period of days, weeks and / or months. If this does not occur or continue, then the treatment can be repeated as many times as desired. In addition, treatment with virus can be combined with any other therapy typically used to treat a given disease or disorder.

[0146] Viral infection assays can also be used to determine the effect of the Recombinant virus compositions provided herein. For example, the level of cell death in a population of cells after infection with a virus can be compared relative to a control population of cells. See, e.g., Barber et al. Host defense, viruses and apoptosis. Cell Death Differ 8, 113-126, (2001); and Liu, S. et al. Science 347, (2015), and which are incorporated herein by reference in its entirety.

[0147] In addition, relevant animal models and human in vitro cell models can also be used to detect therapeutic payloads directly or indirectly and to assess the therapeutic benefit of the payload.

[0148] As used herein, the term “therapeutically effective amount” is intended to mean the amount of vector which exerts a desired effect, e.g., delivering a therapeutic transgene for treating a disease ordisorder. An effective amount will vary, depending upon the pathology or condition to be treated, by the patient and his or her status, and other factors well known to those of skill in the art. Effective amounts are easily determined by those of skill in the art. In some embodiments a therapeutic range is from 103to 1012plaque forming units introduced once. In some embodiments a therapeutic dose in the aforementioned therapeutic range is administered at an interval from every day to every month via the intrathecal, convection-enhanced, intravenous or intra-arterial route.

[0149] In vitro and animal model assays are provided herein which allow the assessment of a given dose of a recombinant virus composition.

[0150] All patents and other publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that could be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

[0151] The present invention as described herein can be further described in the following numbered paragraphs:1. A herpes simplex virus 1 (HSV-1) recombinant virus, comprising within its genome: one or more therapeutic payload sequences, wherein the genome comprises at least one alteration in each of a gene encoding infected cell polypeptides (ICP) 0, a gene encoding ICP4, a gene encoding ICP22, a gene encoding ICP27 and a gene encoding ICP47, wherein the genome does not encode a functional ICP0, ICP4, ICP22, ICP27 and ICP47 protein, and wherein the genome comprises internal inverted repeat (joint) regions.2. The recombinant virus of paragraph 1, wherein the one or more therapeutic payload sequences are inserted in a latency-associated transcript (LAT) gene locus.3. The recombinant virus of any of the preceding paragraphs, wherein the one or more therapeutic payload sequences are inserted between two insulator sequences.4. The recombinant virus of any of the preceding paragraphs, wherein the one or more therapeutic payload sequences are inserted in between CTRL1 and CTRL2 sequences.5. The recombinant virus of any of the preceding paragraphs, wherein the at least one alteration is a deletion of the gene’s open reading frame (ORF).6. The recombinant virus of any of the preceding paragraphs, wherein the at least one alteration is a deletion of gene’s intermediate early (IE) promoter. 7. The recombinant virus of any of the preceding paragraphs, wherein the at least one alteration of the ICP0 gene is a deletion of the ICP0 ORF. 8. The recombinant virus of any of the preceding paragraphs, wherein the at least one alteration of the ICP4 gene is a deletion of the ICP4 ORF. 9. The recombinant virus of any of the preceding paragraphs, wherein the at least one alteration of the ICP27 gene is a deletion of the ICP27 ORF. 10. The recombinant virus of any of the preceding paragraphs, wherein the at least one alteration of the ICP22 gene is a deletion of the ICP22 IE promoter. 11. The recombinant virus of any of the preceding paragraphs, wherein the at least one alteration of the ICP47 gene is a deletion of the ICP47 IE promoter. 12. The recombinant virus of any of the preceding paragraphs, wherein one or more therapeutic payload sequence is selected from the group consisting of a therapeutic transgene, a gene editing gene, a microRNA (miRNA), a interfering RNA, an antisense RNA, a ribozyme, and an aptamer. 13. The recombinant virus of any of the preceding paragraphs, wherein the therapeutic transgene is a codon-optimized sequence. 14. The recombinant virus of any of the preceding paragraphs, wherein the virus comprises at least two copies of the one or more therapeutic payload sequences within its genome. 15. The recombinant virus of any of the preceding paragraphs, wherein one or more therapeutic payload sequence is expressed for at least 3 months, at least 6 months, at least 9 months, at least 12 months or more. 16. The recombinant virus of any of the preceding paragraphs, wherein one or more therapeutic payload sequence is expressed at a higher level as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions. 17. The recombinant virus of any of the preceding paragraphs, wherein recombinant virus produces plaques having a diameter that is at least 2- fold larger as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions. 18. The recombinant virus of any of the preceding paragraphs, wherein recombinant virus exhibits a greater infectivity (PFU per genome copy) as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions. 19. The recombinant virus of any of the preceding paragraphs, wherein recombinant virus exhibits a higher viral yield as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions.20. The recombinant virus of any of the preceding paragraphs, wherein the viral transgene located in the LAT locus is resistant to silencing by Gamma-interferon-inducible protein (IfI16).21. A herpes simplex virus 1 (HSV-1) recombinant virus, comprising within its genome: one or more therapeutic payload sequences, wherein the genome comprises at least one of i) a deletion of the ICP0 ORF; ii) a deletion of the ICP4 ORF; iii) a deletion of the ICP27 ORF; iv) a deletion of the ICP22 IE promoter; and v) a deletion of the ICP47 IE promoter; wherein the genome does not encode a functional ICP0, ICP4, ICP22, ICP27 and ICP47 protein, and wherein the genome comprises internal inverted repeat (joint) regions.22. A composition comprising any of the recombinant viruses of any of the preceding paragraphs.23. A method of delivering a therapeutic payload to a subject, the method comprising: administering to the subject in need thereof any of the recombinant viruses of any of any of the preceding paragraphs or composition of any of the preceding paragraphs.24. A method of altering a gene in a subject, the method comprising: administering to the subject in need thereof any of the recombinant viruses of any of any of the preceding paragraphs or composition of any of the preceding paragraphs.25. The method of paragraph 24, wherein the gene is a disease gene.26. A method of treating a disease or disorder in a subject, the method comprising: administering to the subject in need thereof any of the recombinant viruses of any of the preceding paragraphs or composition of any of the preceding paragraphs.27. The method of any of the preceding paragraphs, wherein the subject has been diagnosed as having or at risk of having the disease or disorder.28. The method of any of the preceding paragraphs, further comprising, prior to administering, the step of diagnosing the subject as having or at risk of having the disease or disorder.29. The method of any of the preceding paragraphs, further comprising, prior to administering, receiving the results of an assay that diagnoses the subject as having or at risk of having the disease or disorder.EXAMPLES

[0152] The following examples are provided by way of illustration not limitation.EXAMPLE 1

[0153] HSV-1 recombinants with the immediate-early (IE) genes deleted or mutated except for ICP0 have been used as vaccine vectors (Kaur et al., 2007) or as gene therapy vectors in animals (Majima et al., 2015) and human clinical trials (Fink et al., 2011). These serve as short-term expression vectors because ICP0 is toxic to the host cell (Samaniego et al., 1997; Hobbs, DeLuca et al., 2001). Herpes simplex virus 1 (HSV-1) recombinants with all the immediate-early genes deleted are promising new gene therapy vectors for long-term expression of large genes from a non-cytotoxic vector (Miyagawa et al., 2015). Deletion of the ICP0 genes reduced cytotoxicity and allowed long-term expression when the transgene was located in either the ICP4 or in the latency-associated transcript (LAT) locus. Trans-gene expression varied depending on the cell lines implemented in the study (Miyagawa et al., 2015). Safe expression lasting up to six months was observed in vivo after delivery to the central nervous system (CNS) (Verlengia et al., 2018).

[0154] The HSV-1 gene deleted vectors JDNI7 and JDN8, as described in US Patent No. 10,174,341 and US Patent Application No. 2019 / 0276845, the contents of which are incorporated herein by reference in their entireties, contain deletions of the internal repeated sequences at the junction of the long (E) and short (S) components of the viral genome, also called the “joint” region of the genome. Deletion of the joint provides stability of the virus and a large capacity for insertion of transgenes.

[0155] However, the JDNI viruses show high genome :PFU ratios, indicative of a lot of defective viral particles. Described herein is an IE gene-deleted vector with intact joint sequences. Data herein show that having intact joint sequences grow at a better rate and are more easily produced.

[0156] The HSV-1 KTT3 virus was constructed with the genome shown in Fig 1. KTT3 was constructed by co-infecting U2OS4-27 cells with HSV-1 dl05 (ICP0 as only IE gene, no GFP) and HSV- 1 JDNI7 (all IE genes deleted, GFP and mCherry) and screening for plaques that were green only. One plaque, KTT3, showed the presence of the joint sequences and formed plaques that had diameters at least 2- fold larger than JDNI7 (not shown).

[0157] The KTT3 virus shows higher specific infectivity with a 4-5 fold lower genome :plaque-forming unit ratio. KTT3 shows a higher yield of progeny virus than JDNI7 when infections of the complementing U2OS4 / 27 cells are based on multiplicity of infection or on numbers of input genome copies (Figs 2A-3B).

[0158] The vector potential of the KTT3 virus was analyzed by infecting normal human fibroblasts with equal numbers of genomes of KTT3 and JDNI7 and analyzed expression of the GFP transgene by western blotting (Figs. 4A, 4B, 7 and 8). KTT3 showed higher peak levels of GFP than JDNI7, and this expression continued for at least 5 days. These data show thatKTT3 replicates better than JDNI7 and will be easier to prepare high titer stocks for gene therapy. Second, KTT3 expresses higher and levels of transgene than JDNI7, so it is a more effective vector when comparing the same number of genomes.

[0159] In summary, the KTT3 virus is a new HSV-1 IE gene-deleted gene therapy vector that shows higher levels of replication than JDNI7 and shows higher expression of a transgene than JDNI7 virus (Figs 6-9).

[0160] Exemplary finds with KTT3 virus — KTT3 replicates to 3-4-fold higher titers as compared to JDNI7-GFP; Plaques of KTT3 show 2-fold increased diameter; Genome:PFU ratio of KTT3 viral stocks is 3-5-fold lower than JDNI7-GFP; KTT3 shows higher expression of the GFP transgene when similar numbers of genomes are used; GFP expression persists at higher levels with KTT3; Lytic infection and expression of transgene are enhanced by the presence of the internal repeats.EXAMPLE 2

[0161] KTT3 transgene expression is resistant to the host cell factor IFI16, which silences HSV gene expression by epigenetic mechanisms. IFI16 control (Cas9) cells or IFI16 knockout cells were transfected with a viral dose containing 10,000 gene copies of HSV-1 KTT3, JDNI7 or dl09 (all IE genes deleted and GFP cassette in the ICP27 locus). Expression of GFP was measured by western blotting at various times post infection. dl09 expression of GFP was increased by IFI16 knockout, but KTT3 expression of GFP was unaffected (Fig. 5). These data account for the high levels of GFP expression by KTT3 — the virus is resistant to at least one host cell epigenetic silencing mechanism, likely by placement of the transgene between the insulators.EXAMPLE 3INFECTIONS

[0162] MATERIALS USED IN EXPERIMENTS• Versene - used to wash cells before trypsinization• Trypsin• DMEM 10% FBS / BCS• Trypan Blue• PBS-ABC-BCS-Glu - used to make viral inoculum• DMEV 1% BCS - used to maintain cells post-infection

[0163] CELLS AND FORMAT USED IN INFECTION EXPERIMENTS• Cells - HFF• Timepoints - 8 HPI, 1-5 DPI• Input (virus) - 20,000 genome copies / cell• Plate format - 12-well plate, 300 ul inoculum / well

[0164] THE FOLLOWING PROTOCOL WAS FOLLOWED FOR INFECTIONS.1. Trypsinize a well to count cells (cells / mL / well). Calculate input virus (gc / cell).2. To make viral inoculum, add calculated amount of virus in PBS-ABC-BCS-Glu. Mix by vortexing gently.3. Remove culture medium from a well.4. Wash lx with PBS.5. Remove PBS from the well and add viral inoculum. ** 300 uL / well in 12-well-plate format.6. Incubate newly infected cells in a 37oC-shaker for 1 hour.7. Remove viral inoculum from the well.8. Wash lx-2x with PBS.9. Add fresh DMEV to the well. ** 1 mL / well in a 12-well-plate format.10. Incubate plate at 37oC in 5%-CO2 incubator until harvesting.WESTERN BLOTTING

[0165] WESTERN BLOT MATERIALS USED IN EXPERIMENTS• NuPAGE LDS Sample Buffer 4X (Thermo) o To make 10 mL of IX Sample buffer• HALT Protease Inhibitor (Thermo) o Dissolve one tablet in 500 uL sterile water o Add to freshly made IX Sample buffer o Store stock in small aliquots at -20oC• NuPAGE 4-12% Bis-Tris 1.0 mm Midi protein gel (Thermo) o 20 wells

[0166] THE FOLLOWING PROTOCOLS WERE FOLLOWED FOR WESTERN BLOTTING.

[0167] HARVEST PROTEIN LYSATES1. Using cell scraper, collect all cells in culture medium into an Eppendorf tube.2. Centrifuge at 1500 rpm for 5 min.3. Remove supernatant and wash lx with cold PBS.4. Add 50 uL of IX Sample Buffer and resuspend well cell pellet. ** resuspension volume can be adjusted.5. Boil at 95oC for 5-10 min.6. Store protein lysate at -80oC until use.

[0168] LOAD SDS-PAGE GEL1. Load 5 ul of protein marker2. Load 14 uL of:• 7 ul sample protein lysate• 7 uL IX Sample bufferPLAQUE ASSA YS (TITRATION OF VIRUS STOCK)

[0169] MATERIALS FOR PLAQUE ASSAYS (TITRATION OF VIRUS STOCK) USED IN EXPERIMENTS• PBS-ABC-BCS-Glu - used to make viral inoculum• DMEM-01 (1% bovine calf serum+ human IgG) - used as overlay• Methanol - used to fix cells• IX Giemsa - used to stain cells

[0170] CELLS AND FORMAT USED IN EXPERIMENTS• Cells - U2OS 4 / 27• Format - T25 flask (2 flasks per dilution)

[0171] THE FOLLOWING PROTOCOLS WERE FOLLOWED FOR INFECTION FOR PLAQUE ASSAYS.

[0172] Prepare 9 tall glass tubes and place them on ice (1 small + 8 big).1. Thaw virus stock on ice.2. Prepare serial dilutions of viral inoculum as follow: a. Tube 1 0.9 mL PBS 0. 1 mL virus stock b. Tube 2 4.5 mL PBS 0.5 mL tube 1 c. Tube 3 4.5 mL PBS 0.5 mL tube 2 d. Tube 4 4.5 mL PBS 0.5 mL tube 3 e. Tube 5 4.5 mL PBS 0.5 mL tube 4 f. Tube 6 4.5 mL PBS 0.5 mL tube 5 g. Tube 7 4.5 mL PBS 0.5 mL tube 6 h. Tube 8 4.5 mL PBS 0.5 mL tube 73. Completely remove medium from a T25 flask4. Add 1 mL of viral inoculum5. Incubate newly-infected cells in a 37 oC shaker for 1 hour.6. Replace viral inoculum with 5 mL of DMEM-01.7. Incubate flasks at 37 oC until plaques are big enough to count. ** Usually, it takes 5 days for KTT3.

[0173] THE FOLLOWING PROTOCOLS WERE FOLLOWED TO STOP TITRATION.1. Remove medium from T25 flask.2. Fix cells with 3 mL Methanol for 20 min.3. Remove Methanol from the flask.4. Stain cells with 3-4 mL of IX Giemsa for a few hours or overnight.VIRAL GENOME COPIES

[0174] VIRAL GENOME COPIES (qPCR) USED IN EXPERIMENTS• ICP8 is targeted to detect viral DNA.• Full-length HSV-1 KOS viral DNA is used for standard curve. o Viral DNA is double-banded on Nal gradients.

[0175] QPCR MACHINES AND CALCULATIONS USED IN EXPERIMENTS• qPCR machine - QuantStudio3, Realtime PCR system (AB I) corresponding software• Standard curve - Excel• DNA concentration - Excel• Genome copies - as taught on the world wide web at https: / / cels.uri.edu / gsc / cndna.html

[0176] STANDARD CURVE USED IN EXPERIMENTS• Viral DNA - Full-length HSV-1 KOS, Double-banded on Nal gradients• 10-fold serial dilution - E-01 to E-08

[0177] PRIMERS USED IN EXPERIMENTS• ICP8 o TT 73F: GTCGTTACCGAGGGCTTCAA (SEQ ID NO: 24) o TT 74R: GTTACCTTGTCCGAGCCTCC (SEQ ID NO: 25)• GAPDH o TT 79F: TTCGACAGTCAGCCGCATCTTCTT (SEQ ID NO: 26) o TT 80R: CAGGCGCCCAATACGACCAAATC (SEQ ID NO: 27)

[0178] qPCR MIX

[0179] CALCULATION OF GENOME COPIES USED IN EXPERIMENTS 1. Use standard curve to extrapolate viral DNA concentration. 2. Calculate total genome copies • As found on the world wide web at https: / / cels.uri.edu / gsc / cndna.html • Using this formula: number of copies = (amount * 6.022x1023) / (length * 1x109 * 650) EXAMPLE 4

[0180] Sequences of SEQ ID NOs 11-23 describe the LAT locus to the virus described herein, e.g., KTT3 virus. SEQ ID NOs 11-23 are read continuously from top to bottom to describe the entire viral sequence. For example, SEQ ID NO: 12 immediately follows SEQ ID NO: 11, SEQ ID NO: 13 immediately follows SEQ ID NO: 12, and so on.

[0181] (CTRL2) (SEQ ID NO: 11) TGTATCGCGGGGGTGCGTGGGAGTGGGGGTGCGTGGGAGTGGGGGTGCGTGGGAGTGGGGGTGCGTGG GAGTGGGGGTGCGTGGGAGTGGGGGTGCGTGGGAGTGGGGGTGCGTGGGAGTGGGGGTGCGTGGGAGT GGGGGTGCGTGGGAGTGGGGGTGCCATG

[0182] (unannotated plasmid sequence) (SEQ ID NO: 12) TTGGGCAGGCTCTGGTGTTAACCACAGAGCCGCGGCCCGGGCTGCCTGACCACCGATCCCCGAAAGCA TCCTGCCACTGGCAATTGAGATCTCCACTTTGTACAAGAAAGCTGGGTCTAGATTAAGCTGCAATAAA CAAGTTAGCTT

[0183] (SV40 promoter) (SEQ ID NO: 13) GCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCA GTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCG GCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAA

[0184] (unannotated plasmid sequence) (SEQ ID NO: 14) GGATCCGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGT TAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGT GAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTGGGCTGCAGGTCG AGGGATCTCCATAAGAGAAGAGGGACAGCTATGACTGGGAGTAGTCAGGAGAGGAGGAAAAATCTGGC TAGTAAAACATGTAAGGAAAATTTTAGGGATGTTAAAGAAAAAAATAACACAAAACAAAATATAAAAA AAATCTAACCTCAAGTCAAGGCTTTTCTATGGAATAAGGAATGGACAGCAGGGGGCTGTTTCATATACTGATGACCTCTTTATAGCCAACCTTTGTTCATGGCAGCCAGCATATGGGCATATGTTGCCAAACTCTA AACCAAATACTCATTCTGATGTTTTAAATGATTTGCCCTCCCATATGTCCTTCCGAG

[0185] (β-globin poly A signal) (SEQ ID NO: 15) AATAAAGGAAATTTATTTTCATTGCAATAGTGTGTTGGAATTTTTTGTGTCTCTCA

[0186] (plasmid sequence) (SEQ ID NO: 16) AGCCAGAAGTCAGATGCTCAAGGGGCTTCATGATGTCCCCATAATTTTTGGCAGAGGGAAAAAGATCT GAGTCCGGA

[0187] (EGFP) (SEQ ID NO: 17) ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGT AAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGA AGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGC GTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGA AGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGA AGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAAC ATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAA GAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACC ACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACC CAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGC CGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG

[0188] (CAG promoter = chicken beta-actin promoter + CMV enhancer) (SEQ ID NO: 18) GACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATG GAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATT GACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGG AGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATT GACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTAC TTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCA CTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCA GCGATGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGCGCGCCRGGSGGGGSGGGGSGGGGSG RGGGGSGGGGSGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTT CCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGC TGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGA CCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTT TAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGGGCCCTTTGTG CGGGGGGAGCGGCTCGGGGGGTGCGTGCGTGTGTGTGTGCGTGGGGAGCGCCGCGTGCGGCTCCGCGC TGCCCGGCGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCAGTGTGCGCGAGGGG AGCGCGGCCGGGGGCGGTGCCCCGCGGTGCGGGGGGGGGCTGCGAGGGGAACAAAGGCTGCGTGCGGG GTGTGTGCGTGGGGGGGTGAGCAGGGGGTGTGGGCGCGTCGGTCGGGCTGCAACCCCCCCCTGCACCC CCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTGCGGGGCTCCGTACGGGGCGTGGCGCGGGGC TCGCCGTGCCGGGCGGGGGGTGGCGGCAGGTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGG GAGGGCTCGGGGGAGGGGCGCGGCGGCCCCCGGAGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCGCAG CCATTGCCTTTTATGGTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGTCCCAAATCTGTGCGGAGC CGAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCGGGCGCGGGGCGAAGCGGTGCGGCGCCGGCAGG AAGGAAATGGGCGGGGAGGGCCTTCGTGCGTCGCCGCGCCGCCGTCCCCTTCTCCCTCTCCAGCCTCG GGGCTGTCCGCGGGGGGACGGCTGCCTTCGGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTG TGACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGC AACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCAA

[0189] (part of LAT stable 2-kb) (SEQ ID NO: 19)AAAGCCTGCTTTTTTGTACAAACTTGTATAACTAGTTATAGGCCTAGGGTTTTATAACCATGGCCACA GACGTGGGTGTTGGGGGGTGGGGCGGAGGGGTGGGGGGGGAGACAGAAACAGGAACATAGTTAGAAAA CAAGAATGCGGTGCAGCCAGAGAATCACAGGAGACGAGGGGATGGGCGTGTTGGTTACCAACCCACAC CCAGGCATGCTCGGTGGTATGAAGGAGGGGGGGCGGTGTTTCTTAGAGACCGCCGGGGGACGTGGGGT TGGTGTGCAAAGGCACGCGCACCCGCGCCGGCCAGGTGGGCCGGTACCCCATCCCCCCCTCCCCCGAC CCTTCCCACCCCCGCGTGCCAGAGATCACCCCGGTCCCCCGGCACCCGCCACTCCTCCATATCCTCGC TTTAGGAACAACTTTAGGGGGGGGTACACACGCGCCGTGCATTTCCTTCCACACCCCCCCCCTCCCCC GCACTCCCCCCCCCCAGGCAGTAAGACCCAAGCATAGAGAGCCAGGCACAAAAACACAGGCGGGGTGG GACACATGCCTTCTTGGAGTACGTGGGTCATTGGCGTGGGGGGTTACAGCGACACCGGCCGACCCCCT GGCGGTCTTCCAGCCGGCCCTTAGATAAGGGGGCAGTTGGTGGTCGGACGGGTAAGTAACAGAGTCTA ACTAAGGGTGGGAGGGGGGGAAAATAACGGGCTGGTGTGCTGTAACACGAGCCCACCCGCGAGTGGCG TGGCCGACCTTAGCCTCTGGGGCGCCCCCTGTCGTTTGGGTCCCCCCCCCTCTATTGGGGAGAAGCAG GTGTCTAACCTACCT

[0190] (LATP2) (SEQ ID NO: 20) CTGCAGCCGGGGCGGCCAAGGGGCGTCGGCGACATCCTCCCCCTAAGCGCCGGCCGGCCGCTGGTCTG TTTTTTCGTTTTCCCCGTTTCGGGGGTGGTGGGGGTTGCGGTTTCTGTTTCTTTAACCCGTCTGGGGT GTTTTTCGTTCCGTCGCCGGAATGTTTCGTTCGTCTGTCCCCTCACGGGGCGAAGGCCGCGTACGGCC CGGGACGAGGGGCCCCCGACCGCGGCGGTCCGGGCCCCGTCCGGACCCGCTCGCCGGCACGCGACGCG AAAAAGGCCCCCCGGAGGCTTTTCCGGGTTCCCGGCCCGGGGCCTGAGATGAACACTCGGGGTTACCG CCAACGGCCGGCCCCCGTGGCGGCCCGGCCCGGGGCCCCGGCGGACCCAAGGGGCCCCGGCCCGGGGC CCCACAACGGCCCGGCGCATGCGCTGTGGTTTTTTTTTCCTCGGTGTTCTGCCGGGCTCCGTCGCCTT TCCTGTTCTCGCTTCTCCCCCCCCCCCTTCACCCCCAGTACCCTCCTCCCTCCCTTCCTCCCCCGTTA TCCCACTCGTCGAGGGCGCCCCGGTGTCGTTCAACAAAGACGCCGCGTTTCC

[0191] (LAP1) (SEQ ID NO: 21) CTGCAGACAGGGGCACCGCGCCCGGAAATCCATTAGGCCGCAGACGAGGAAAATAAAATTACATCACC TACCCATGTGGTGCTGTGGCCTGTTTTTGCTGCGTCATCTGAGCCTTTATAAAAGCGGGGGCGCGGCC GTGCCGATCGCCGGTGGTGCGAAAGACTTTCCGGGCGCGTCCGGGTGCCGCGGCTCTCCGGGCCCC

[0192] (unannotated HSV-1 sequence) (SEQ ID NO: 22) AGCACTTAACGGATTGATATCTCGCGGGCACGCGCGCCCTTAATGGACCGGCGCGGGGCGGGGGGCCG GATACCCACACGGGCGGGGGGGGGTGTCGCGGGCCGTCTGCTGGCCCGCGGCCACATAAACAATGACT CGGGGCCTTTCTGCCTCTGCCGCTTGTGTGTGCGCGCGCCGGCTCTGCGGTGTCGGCGGCGGCGGCGG CGGTGGCCGCCGTGTTCGGTCTCGGTAGCCGGCCGGCGGGTGGACTCGCGGGGGGCCGGAGGGTGGAA GGCAGGGGGGTGTAGGATGGGTATCAGGACTTCCACTTCCCGTCCTTCCATCCCCCGTTCCCCTCGGT TGTTCCTCGCCTCCCCCAACACCCCGCCGCTTTCCGTTGGGGTTGTTATTGTTGTCGGGATCGTGCGG GCCGGGGGTCGCCGGGGCAGGGGCGGGGGCGTGGGCGGGGGTGCTCGTCGATCGACCGGGCTCAGTGG GGGCGTGGGGTGGGTGGGAGAAGGCGAGGAGACTGGGGTGGGGGTGTCGGTGGGTGGTTGTTTTTTGT GGTTGTTTTTTGTGTCTGTTTCCGTCCCCCGTCACCCCCCTCCCTCCGTCCCCTCCGTCCCCCCGTCG CGGGTGTTTGTGTTTGTTTATTCCGACATCGGTTTATTTAAAATAAACACAGCCGTTCTGCGTGTCTG TTCTTGCGTGTGGCTGGGGGCTTATATGTGGGGTCCCGGGGGCGGGATGGGGTTTAGCGGCGGGGGGC GGCGCGCCGGACGGGGCGCTGGAGATAACGGCCCCCGGGGAACGGGGGACCGGGGCTGGGTATCCCGA GGTGGGTGGGTGGGCGGCGGTGGCCGGGCCGGGCCGGGCCGGGCCGGGTGGGCGGGGTTTGGAAAAAC GAGGAGGAGGAGGAGAAGGCGGGGGGGGAGACGGGGGGAAAGCAAGGACACGGCCCGGGGGGTGGGAG CGCGGGCCGGGCCGCTCGTAAGAGCCGCGACCCGGCCGCCGGGGAGCGTTGTCGCCGTCGGTCTGCCG GCCCCCGTCCCTCCCTTTTTTGACCAACCAGCGCCCTCCCCCCCACCACCATTCCTACTACCACCACC ACCACCACCCCCACCACCGACACCTCCCGCGCACCCCCGCCCACATCCCCCCACCCCGCACCACGAGC ACGGGGTGGGGGTAGCAGGGGATCAAAGGGGGGCAAAGCCGGCGGGGCGGTTCGGGGGGGCGGGAGAC CGAGTAGGCCCGCCCATACGCGGCCCCTCCCGGCAGCCACGCCCCCCAGCGTCGGGTGTCACGG

[0193] (CTRL1) (SEQ ID NO: 23)GGAAAGAGCAGGGGAGAGGGGGGGAGAGGGGAGAGGGGGGGAGAGGGGAGAGGGGGGGAGAGGGGAGA GGGGGGGAGAGGGGAGAGGGGGGGAGAGGGGAGAGGGGGGGAGAGGGGAGAGGGGGGGAGAGGGGAGA GGGGGGGAGAGGGGAGAGGGGGGGAGAGGGGAGAGGGGGGGAGAGGGG

Claims

CLAIMS1. A herpes simplex virus 1 (HSV-1) recombinant virus, comprising within its genome: one or more therapeutic payload sequences, wherein the genome comprises at least one alteration in each of a gene encoding infected cell polypeptides (ICP) 0, a gene encoding ICP4, a gene encoding ICP22, a gene encoding ICP27 and a gene encoding ICP47, wherein the genome does not encode a functional ICP0, ICP4, ICP22, ICP27 and ICP47 protein, and wherein the genome comprises internal inverted repeat (joint) regions.

2. The recombinant virus of claim 1, wherein the one or more therapeutic payload sequences are inserted in a latency-associated transcript (LAT) gene locus.

3. The recombinant virus of claim 1, wherein the one or more therapeutic payload sequences are inserted between two insulator sequences.

4. The recombinant virus of claim 1, wherein the one or more therapeutic payload sequences are inserted in between CTRL1 and CTRL2 sequences.

5. The recombinant virus of claim 1, wherein the at least one alteration is a deletion of the gene’s open reading frame (ORF).

6. The recombinant virus of claim 1, wherein the at least one alteration is a deletion of gene’s intermediate early (IE) promoter.

7. The recombinant virus of claim 1, wherein the at least one alteration of the ICP0 gene is a deletion of the ICP0 ORF.

8. The recombinant virus of claim 1, wherein the at least one alteration of the ICP4 gene is a deletion of the ICP4 ORF.

9. The recombinant virus of claim 1, wherein the at least one alteration of the ICP27 gene is a deletion of the ICP27 ORF.

10. The recombinant virus of claim 1, wherein the at least one alteration of the ICP22 gene is a deletion of the ICP22 IE promoter.

11. The recombinant virus of claim 1, wherein the at least one alteration of the ICP47 gene is a deletion of the ICP47 IE promoter.

12. The recombinant virus of claim 1, wherein one or more therapeutic payload sequence is selected from the group consisting of a therapeutic transgene, a gene editing gene, a microRNA (miRNA), a interfering RNA, an antisense RNA, a ribozyme, and an aptamer.

13. The recombinant virus of claim 1, wherein the therapeutic transgene is a codon-optimized sequence.

14. The recombinant virus of claim 1, wherein the virus comprises at least two copies of the one or more therapeutic payload sequences within its genome.

15. The recombinant virus of claim 1, wherein one or more therapeutic payload sequence is expressed for at least 3 months, at least 6 months, at least 9 months, at least 12 months or more.

16. The recombinant virus of claim 1, wherein one or more therapeutic payload sequence is expressed at a higher level as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions.

17. The recombinant virus of claim 1, wherein recombinant virus produces plaques having a diameter that is at least 2- fold larger as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions.

18. The recombinant virus of claim 1, wherein recombinant virus exhibits a greater infectivity (PFU per genome copy) as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions.

19. The recombinant virus of claim 1, wherein recombinant virus exhibits a higher viral yield as compared to an HSV-1 recombinant virus having a genome that does not comprise internal inverted repeat (joint) regions.

20. The recombinant virus of any of claims 1-19, wherein the viral transgene located in the LAT locus is resistant to silencing by Gamma-interferon-inducible protein (IfI16).

21. A herpes simplex virus 1 (HSV-1) recombinant virus, comprising within its genome: one or more therapeutic payload sequences, wherein the genome comprises at least one of vi) a deletion of the ICP0 ORF; vii) a deletion of the ICP4 ORF; viii) a deletion of the ICP27 ORF;ix) a deletion of the ICP22 IE promoter; and x) a deletion of the ICP47 IE promoter; wherein the genome does not encode a functional ICP0, ICP4, ICP22, ICP27 and ICP47 protein, and wherein the genome comprises internal inverted repeat (joint) regions.

22. A composition comprising any of the recombinant viruses of any of claims 1-21.

23. A method of delivering a therapeutic payload to a subject, the method comprising: administering to the subject in need thereof any of the recombinant viruses of any of claims 1- 21 or composition of claim 22.

24. A method of altering a gene in a subject, the method comprising: administering to the subject in need thereof any of the recombinant viruses of any of claims 1-21 or composition of claim 22.

25. The method of claim 24, wherein the gene is a disease gene.

26. A method of treating a disease or disorder in a subject, the method comprising: administering to the subject in need thereof any of the recombinant viruses of any of claims 1-21 or composition of claim 22.

27. The method of claim 26, wherein the subject has been diagnosed as having or at risk of having the disease or disorder.

28. The method of claim 26, further comprising, prior to administering, the step of diagnosing the subject as having or at risk of having the disease or disorder.

29. The method of claim 26, further comprising, prior to administering, receiving the results of an assay that diagnoses the subject as having or at risk of having the disease or disorder.

Images