Drug-enzyme complex of curcumin derivative and protease and use thereof

Abstract

The present invention relates to: a curcumin derivative or a pharmaceutically acceptable salt thereof; a drug-enzyme complex in which the curcumin derivative and a protease are conjugated; nanoparticles for drug delivery, comprising the derivative; and a pharmaceutical composition for preventing or treating inflammatory diseases, comprising same. The drug-enzyme complex can enable a drug to penetrate a target cell and can inhibit the gene expression of an inflammatory factor by reacting with an enzyme site substrate and thus can be usefully applied to prevention or treatment of inflammatory diseases.

Description

Drug-enzyme complex of curcumin derivative and protease and use thereof

[0001] The present invention relates to a drug-enzyme complex comprising a curcumin derivative and a protease and to uses thereof.

[0002] Various diseases in the human body progress through inflammation, regardless of whether they are caused by external factors such as infection or internal factors such as autoimmunity. While inflammation is essential for the body's disease healing process, disruption of its delicate balance can lead to various adverse effects and even fatal outcomes, such as organ damage. Recent remarkable advances in molecular genetics have gone beyond simply decoding genetic information and are uncovering epigenetic regulatory mechanisms that regulate the expression of genetic information itself. Among these, various enzymes that influence the on-off switching of genes through various modifications of chromosomal histone proteins involved in gene expression within cells, as well as various chemical compounds capable of regulating these enzymes, have been discovered.

[0003] Histone proteins bind to DNA, the genetic information that constitutes chromosomes, to safely protect the genetic information, and at the same time, they play a role in appropriately regulating the spatiotemporal physical conditions of DNA during gene expression and gene replication using genetic information. At this time, the sites and mechanisms that can affect genetic DNA material by inducing chemical modifications to specific amino acid sequences in histone proteins are known. For example, lysines at positions 4, 36, and 79 of histone protein H3 are known to activate gene transcription, while lysines at positions 9 and 27 of histone H3 and 20 of histone H4 are known to inhibit transcription.

[0004] In addition, it has been revealed that various drugs have pharmacological effects such as various inflammation-regulating responses and anticancer effects through epigenetic mechanisms as reaction inhibitors that act on DNA and histone protein methylation and deacetylation. In particular, curcumin, a natural ingredient that has been consumed for a long time and is widely known for its anti-inflammatory and anticancer effects, is known to be a broad-spectrum histone deacetylase (HDAC) inhibitor and has a known mechanism of suppressing the expression of inflammatory factors (Molecules. 2014 Dec; 19(12): 21127-21153).

[0005] However, due to the almost random and wide range of actions of curcumin, which is classified as a PAINS (Pan Assay Interference) compound, including antioxidant, anti-inflammatory, and anticancer effects, there are limitations in identifying its exact mode of action as a drug.

[0006]

[0007] In order to solve the above problems, the present invention provides a complex that can be used for the treatment or prevention of inflammatory diseases by combining an enzyme protein with a curcumin derivative having an inflammatory factor inhibitory effect.

[0008]

[0009] However, the problems to be solved by the present invention are not limited to those mentioned above, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.

[0010]

[0011] The present invention provides a curcumin derivative of the following chemical formula 1 or a pharmaceutically acceptable salt thereof:

[0012] [Chemical Formula 1]

[0013]

[0014] In the above chemical formula 1, R1 and R2 are each independently hydroxy or -OC(=O)R3, and R3 is substituted or unsubstituted C 1-12 It is an alkyl group.

[0015] In one embodiment of the present invention, the curcumin derivative of the chemical formula 1 is

[0016] ((1E,6E)-3,5-dioxohepta-1,6-dien-1,7-diyl)bis(2-methoxy-5,1-phenylene) dibutyrate (1a);

[0017] 5-((1E,6E)-7-(3-hydroxy-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenylbutyrate (1b);

[0018] ((1E,6E)-3,5-dioxohepta-1,6-dien-1,7-diyl)bis(2-methoxy-5,1-phenylene)bis(2-propylpentanoate)(1c);

[0019] 5-((1E,6E)-7-(3-hydroxy-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenyl 2-propylpentanoate (1d);

[0020] 5-((1E,6E)-7-(3-(butyryloxy)-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenyl 2-propylpentanoate (1e); and

[0021] It may be at least one selected from the group consisting of 5-((1E,6E)-7-(3-(butyryloxy)-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenyl 5-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanoate (1f).

[0022]

[0023] In addition, the present invention provides a drug-enzyme complex comprising the curcumin derivative or a pharmaceutically acceptable salt thereof and a protease conjugated thereto.

[0024] In another embodiment of the present invention, the protease may be represented by the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5.

[0025] In another embodiment of the present invention, the protease comprises:

[0026] (1) Cell penetrating peptide;

[0027] (2) Flexible-linker peptide;

[0028] (3) Avidin-tagged peptide;

[0029] (4) endosomal escape domain; and

[0030] (5) It may be a fusion protease to which one or more peptides selected from the group consisting of cell targeting peptides are fused.

[0031] In another embodiment of the present invention, the cell penetrating peptide is represented by the amino acid sequence of SEQ ID NO: 7,

[0032] The above flexible-linker peptide is represented by the amino acid sequence of SEQ ID NO: 9,

[0033] The above avidin-tag peptide is represented by the amino acid sequence of SEQ ID NO: 11,

[0034] The above endosomal escape domain is represented by the amino acid sequence of SEQ ID NO: 13,

[0035] The above cell targeting peptide may be represented by the amino acid sequence of SEQ ID NO: 15.

[0036] In another embodiment of the present invention, the fusion protease may be represented by the amino acid sequence of SEQ ID NO: 17, SEQ ID NO: 19, or SEQ ID NO: 21.

[0037] In another embodiment of the present invention, the fusion protease may cleave a SNARE protein.

[0038] In another embodiment of the present invention, the SNARE protein may be SNAP25 or SNAP23.

[0039]

[0040] In addition, the present invention provides a nanoparticle for drug delivery, wherein the curcumin derivative or a pharmaceutically acceptable salt thereof is encapsulated inside a polymer nanoparticle.

[0041] In another embodiment of the present invention, the polymer nanoparticle may include at least one selected from the group consisting of poly-DL-lactide-co-glycolide (PLGA), poly-DL-lactide (PLA), hyaluronic acid, alginate, polycaprolactone, and polyethylene glycol.

[0042]

[0043] In addition, the present invention provides a pharmaceutical composition for preventing or treating an inflammatory disease, comprising the drug-enzyme complex or the drug delivery nanoparticle as an active ingredient.

[0044] In another embodiment of the present invention, the composition may inhibit one or more inflammatory factors selected from the group consisting of interleukin-1b, interleukin-6, and tumor necrosis factor-alpha.

[0045] In another embodiment of the present invention, the inflammatory disease may be at least one selected from the group consisting of degenerative arthritis, inflammatory bowel disease, peritonitis, osteomyelitis, cellulitis, pancreatitis, bronchial asthma, allergic rhinitis, bronchitis, osteoarthritis, spondylitis, vasculitis, lupus erythematosus, polymyalgia rheumatica, tenosynovitis, hemochromatosis, hyperlipoproteinemia, systemic lupus erythematosus, relapsing fever, multiple sclerosis, sepsis, septic shock, acute respiratory distress syndrome, multiple organ failure, chronic obstructive pulmonary disease, rheumatoid arthritis, asthma, periodontitis, stomatitis, peritonitis, gastritis, enteritis, arthritis, nephritis, hepatitis, inflammatory skin disease, breast cancer, prostate cancer, uterine cancer, lung cancer, liver cancer, stomach cancer, colon cancer, and brain tumor.

[0046]

[0047] The curcumin derivative according to the present invention has excellent inflammatory factor suppression ability as a compound alone, and is also provided in the form of a drug-enzyme complex conjugated to a physiological enzyme, a protease. The enzyme is conjugated and can easily penetrate into cells, and the curcumin derivative as a drug not only suppresses inflammatory factors, but also can interfere with the secretion of inflammatory factors by cleaving the SNARE protein that secretes inflammatory factors out of cells at the enzyme site, thereby inducing an epigenetic pharmacological response to suppress the gene expression of inflammatory factors, thereby fundamentally suppressing inflammatory factors at the transcriptional level and the post-translational level.

[0048]

[0049] The effects of the present invention are not limited to the effects described above, and should be understood to include all effects that can be inferred from the detailed description of the present invention or the composition of the invention described in the claims.

[0050]

[0051] Figure 1 is a drawing showing a method for producing a curcumin derivative according to one embodiment of the present invention.

[0052] Figure 2 is a drawing showing a curcumin derivative synthesized according to one embodiment of the present invention.

[0053] FIG. 3 is a drawing showing the NMR spectrum of Compound 0 synthesized according to one embodiment of the present invention.

[0054] Figure 4 is a drawing showing the NMR spectrum of compound 1a according to one embodiment of the present invention.

[0055] Figure 5 is a drawing showing the NMR spectrum of compound 1b according to one embodiment of the present invention.

[0056] Figure 6 is a drawing showing the NMR spectrum of compound 1c according to one embodiment of the present invention.

[0057] Figure 7 is a drawing showing the NMR spectrum of compound 1d according to one embodiment of the present invention.

[0058] Figure 8 is a drawing showing the NMR spectrum of compound 1e according to one embodiment of the present invention.

[0059] Figure 9 is a drawing showing the NMR spectrum of compound 1f according to one embodiment of the present invention.

[0060] Figure 10 is a drawing showing the results of confirming the inflammatory factor inhibitory effect of a curcumin derivative according to one embodiment of the present invention.

[0061] Figure 11a is a drawing showing the results of confirming the shape of PLGA nanoparticles containing curcumin derivatives according to one embodiment of the present invention.

[0062] Figure 11b is a drawing showing the results of confirming the shape of PLA nanoparticles containing a curcumin derivative according to one embodiment of the present invention.

[0063] Figure 12a is a drawing showing the results of confirming the size and zeta potential of PLGA nanoparticles containing a curcumin derivative according to one embodiment of the present invention.

[0064] Figure 12b is a drawing showing the results of confirming the size and zeta potential of PLA nanoparticles containing a curcumin derivative according to one embodiment of the present invention.

[0065] Figure 13 is a drawing comparing the action principles of the drug-enzyme complex and the drug-antibody complex of the present invention.

[0066] Figure 14 is a drawing showing various fusion forms of the drug-enzyme complex of the present invention.

[0067] Figure 15 shows the results of SDS-PAGE analysis of the SNAP substrate protein cleavage ability by the protease of SEQ ID NO: 3 and the fusion protease of SEQ ID NO: 17 according to one embodiment of the present invention.

[0068] Figure 16 shows the results of confirming the cleavage site and molecular weight of a SNAP substrate protein by a fusion protease of SEQ ID NO: 17 and a protease of SEQ ID NO: 3 according to one embodiment of the present invention.

[0069] Hereinafter, embodiments of the present invention will be described in detail with reference to the attached drawings. In describing the present invention, detailed descriptions of related known functions or configurations will be omitted if it is determined that such detailed descriptions may unnecessarily obscure the gist of the present invention. In addition, the terms used in this specification are terms used to appropriately express preferred embodiments of the present invention, and may vary depending on the intention of the user or operator, or the customs of the field to which the present invention belongs. Therefore, the definitions of these terms should be determined based on the contents throughout this specification. The same reference numerals presented in each drawing represent the same elements.

[0070] Throughout the specification, when a part is said to "include" a component, this does not mean that it excludes other components, but rather that it may include other components.

[0071]

[0072] The present invention provides a curcumin derivative of the following chemical formula 1 or a pharmaceutically acceptable salt thereof.

[0073] [Chemical Formula 1]

[0074]

[0075] In the above chemical formula 1, R1 and R2 are each independently hydroxy or -OC(=O)R3, and R3 is substituted or unsubstituted C 1-12 It is an alkyl group.

[0076] In the present invention, the term “substitution” refers to a reaction in which an atom or atomic group included in a molecule of a compound is replaced with another atom or atomic group.

[0077] The above R3 is substituted or unsubstituted C 1-12 As an alkyl group, the unsubstituted alkyl group may be ethyl, propyl, butyl, pentyl, hexyl, or heptyl in a straight or branched chain form, and the substituted alkyl group may be an alkyl group substituted with a heterocyclic group, such as pyridine, imidazole, pyrimidine, pyrazine, furyl, curcumin, oxazole, pyrrole, or It may be substituted with, but is not limited to, a substituted or unsubstituted alkyl group.

[0078]

[0079] More specifically, preferably, R1 and R2 are each independently hydroxy, , , or It could be.

[0080]

[0081] In Fig. 1, a method for producing the curcumin derivative is shown. Compound 1a, compound 1b, compound 1c, compound 1d, and compound 1e can be produced from Compound 0, and compound 1f can be produced from Compound 1b.

[0082]

[0083] According to one embodiment of the present invention, the curcumin derivative of the chemical formula 1,

[0084] ((1E,6E)-3,5-dioxohepta-1,6-dien-1,7-diyl)bis(2-methoxy-5,1-phenylene) dibutyrate (1a);

[0085] 5-((1E,6E)-7-(3-hydroxy-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenylbutyrate (1b);

[0086] ((1E,6E)-3,5-dioxohepta-1,6-dien-1,7-diyl)bis(2-methoxy-5,1-phenylene)bis(2-propylpentanoate)(1c);

[0087] 5-((1E,6E)-7-(3-hydroxy-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenyl 2-propylpentanoate (1d);

[0088] 5-((1E,6E)-7-(3-(butyryloxy)-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenyl 2-propylpentanoate (1e); and

[0089] 5-((1E,6E)-7-(3-(butyryloxy)-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenyl 5-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanoate (1f) may be at least one selected from the group consisting of. The forms of the compounds 1a to 1f are shown in FIG. 2.

[0090]

[0091] In the present invention, the curcumin derivative itself has an anti-inflammatory effect, and thus, the curcumin derivative alone can be used for the treatment or prevention of inflammatory diseases. Accordingly, the present invention can provide a pharmaceutical composition for the prevention or treatment of inflammatory diseases, comprising the curcumin derivative or a pharmaceutically acceptable salt thereof.

[0092]

[0093] In addition, the present invention can provide a drug-enzyme complex comprising a curcumin derivative according to the present invention or a pharmaceutically acceptable salt thereof; and a protease conjugated thereto.

[0094]

[0095] According to one embodiment of the present invention, a protease is utilized as the enzyme. However, the present invention is not limited to a variant of the protease, such as zinc-endopeptidase, which is a light chain component of botulinum toxin, as described in the embodiment. In this regard, Fig. 13 shows a comparison of the drug-enzyme complex of the present invention with an antibody-drug conjugate (ADC).

[0096]

[0097] According to one embodiment of the present invention, the protease may be represented by an amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 5, and may be represented by a base sequence of SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6.

[0098] The above protease utilizes the light chain portion of botulinum toxin types A and E, and in the case of the E-type, it is designed based on two types of subtype genes P30995 and CAA43999.1 (NCBI, National Center for Biotechnology Information, USA, accession number). A protein expressed from a gene in which the amino acid sequence specified in the present invention is modified with a gene sequence in which an amino acid is substituted has improved solubility and substrate specificity. The above protease is a base sequence optimized for expression in the microorganism Escherichia coli, and may also include a sequence optimized for microorganisms or animal cells. The gene sequence disclosed in the present invention can easily mass-produce proteins in recombinant E. coli expression vectors, such as the pET system, i.e., an expression system using T7 RNA polymerase.

[0099] According to one embodiment of the present invention, the protease may be a fusion protease to which one or more peptides selected from the group consisting of (1) a cell penetrating peptide; (2) a flexible-linker peptide; (3) an avidin-tag peptide; (4) an endosomal escape domain; and (5) a cell targeting peptide are fused.

[0100] Several examples of the above fusion proteases are shown in FIG. 14. As shown in FIG. 14, the fusion proteases may include a cell penetrating peptide (PTD); a flexible linker peptide (Linker); an avidin-tag peptide (tag); an endosomal escape domain (EED); and a cell targeting peptide (LL37), and may have the form of PTD-Protease (Enzyme)-Linker-tag; PTD-Protease (Enzyme)-EED-Linker-tag; or PTD-Protease (Enzyme)-EED-LL37-Linker-tag.

[0101] In the present invention, the cell penetrating peptide (PTD, PEP1 peptide) functions as a protein transduction domain capable of penetrating and delivering a protein into a cell, the flexible linker peptide functions as a glycine flexible linker peptide that provides flexibility between an enzyme and another domain, the avidin-tag peptide functions to conjugate a curcumin derivative compound and a protein, the endosomal escape domain functions to help a protein to be captured by an endosome and released into the cytoplasm after moving into the cell by the function of the PTD, and the cell targeting peptide enables specific targeting of immune cells or macrophages.

[0102] According to one embodiment of the present invention, the cell penetrating peptide may be represented by the amino acid sequence of SEQ ID NO: 7, the flexible-linker peptide may be represented by the amino acid sequence of SEQ ID NO: 9, the avidin-tag peptide may be represented by the amino acid sequence of SEQ ID NO: 11, the endosomal escape domain may be represented by the amino acid sequence of SEQ ID NO: 13, and the cell targeting peptide may be represented by the amino acid sequence of SEQ ID NO: 15. In addition, the cell penetrating peptide may be represented by the base sequence of SEQ ID NO: 8, the flexible-linker peptide may be represented by the base sequence of SEQ ID NO: 10, the avidin-tag peptide may be represented by the base sequence of SEQ ID NO: 12, the endosomal escape domain may be represented by the base sequence of SEQ ID NO: 14, and the cell targeting peptide may be represented by the base sequence of SEQ ID NO: 16.

[0103]

[0104] According to one embodiment of the present invention, the fusion protease in which the peptide and domains are fused may be represented by the amino acid sequence of SEQ ID NO: 17 (BTXL-A type-avi-tag), SEQ ID NO: 19 (BTXL-E type-avi-tag) or SEQ ID NO: 21 (CAA43999.1 PTD-BTXLE-AVI-tag), and may be represented by the base sequence of SEQ ID NO: 18, SEQ ID NO: 20 or SEQ ID NO: 22, respectively.

[0105]

[0106] The fusion protease of the present invention cleaves a SNARE protein, and the SNARE protein may be SNAP25 or SNAP23. More specifically, the fusion protease can penetrate into cells in a form conjugated with a curcumin derivative. At this time, after penetrating into cells by the enzyme portion of the drug-enzyme complex, the enzyme portion cleaves SNAP25 or SNAP23, which is a SNARE protein (SNap Receptor) that binds the secretory vesicle and the cell membrane in the secretion pathway that controls the extracellular secretion of inflammatory factors such as interleukins already produced within the cell, thereby preventing the secretion of the substance, and the inflammatory substance that is not secreted is consumed within the cell through lysosomes, etc. At this time, the compound that is bound to the enzyme portion and enters the cell together is separated from the enzyme and induces an epigenetic pharmacological response, thereby suppressing the gene expression of the inflammatory factor, thereby fundamentally maximizing the inhibition of the inflammatory factor at the transcriptional level and post-translational level. In this way, the enzyme region corresponding to the protein in the drug-enzyme complex of the present invention can provide the effect of delivering a drug that can exhibit a therapeutic synergy effect on the targeted pharmacological action through the reaction of the enzyme region to the substrate as well as the target for the target, unlike the antibody region of the drug-antibody therapeutic agent that is simply used for the purpose of targeting and blocking the therapeutic target, by combining the individual recombinant domain regions. The SNARE protein is a cell membrane component involved in vesicle movement and can play a pivotal role in the transmission of neurotransmitters between cells.

[0107] In addition, the present invention can provide a nanoparticle for drug delivery, wherein the curcumin derivative or a pharmaceutically acceptable salt thereof is encapsulated inside a polymer nanoparticle.

[0108] According to one embodiment of the present invention, the polymer nanoparticle may be at least one selected from the group consisting of poly-DL-lactide-co-glycolide (PLGA), poly-DL-lactide (PLA), hyaluronic acid, alginate, polycaprolactone, and polyethylene glycol.

[0109] According to one embodiment of the present invention, the diameter of the polymer nanoparticles may be 5 to 300 nm, and the zeta potential may be -30 to +30 mV.

[0110]

[0111] In addition, the present invention can provide a pharmaceutical composition for preventing or treating an inflammatory disease, comprising the drug-enzyme complex or the drug delivery nanoparticle as an active ingredient.

[0112]

[0113] According to one embodiment of the present invention, the composition may suppress one or more inflammatory factors selected from the group consisting of interleukin-1b (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-alpha (TNF-α).

[0114]

[0115] According to one embodiment of the present invention, the inflammatory disease may be at least one selected from the group consisting of degenerative arthritis, inflammatory bowel disease, peritonitis, osteomyelitis, cellulitis, pancreatitis, bronchial asthma, allergic rhinitis, bronchitis, osteoarthritis, spondylitis, vasculitis, lupus erythematosus, polymyalgia rheumatica, tenosynovitis, hemochromatosis, hyperlipoproteinemia, systemic lupus erythematosus, relapsing fever, multiple sclerosis, sepsis, septic shock, acute respiratory distress syndrome, multiple organ failure, chronic obstructive pulmonary disease, rheumatoid arthritis, asthma, periodontitis, stomatitis, peritonitis, gastritis, enteritis, arthritis, nephritis, hepatitis, inflammatory skin disease, breast cancer, prostate cancer, uterine cancer, lung cancer, liver cancer, stomach cancer, colon cancer, and brain tumor, but may be at least one selected from the group consisting of interleukin-1b, interleukin-6, and tumor necrosis factor-alpha. If the disease is mediated through inflammatory factors, it is not limited to the above types.

[0116]

[0117] In addition, the present invention can provide a method for preventing or treating an inflammatory disease, comprising a step of administering to a subject a pharmaceutical composition for preventing or treating the inflammatory disease.

[0118] In the present invention, the term "prevention" means any act of inhibiting or delaying the occurrence, spread, or recurrence of an inflammatory disease by administering the composition of the present invention, and "treatment" means any act of improving or beneficially changing the symptoms of the disease by administering the composition of the present invention.

[0119] The term "pharmaceutical composition" in the present invention refers to a composition manufactured for the purpose of preventing or treating a disease, and may be formulated and used in various forms according to conventional methods. For example, it may be formulated in oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, and syrups, and may be formulated and used in the form of topical preparations, suppositories, and sterile injectable solutions.

[0120] In the present invention, "including as an active ingredient" means that the ingredient is included in an amount necessary or sufficient to realize a desired biological effect. In actual application, the amount included as an active ingredient can be determined by considering the amount for treating the target disease and not causing other toxicity, and may vary depending on various factors such as the disease or condition being treated, the form of the composition being administered, the size of the subject, or the severity of the disease or condition. A person of ordinary skill in the art to which the present invention pertains can empirically determine the effective amount of an individual composition without undue experimentation.

[0121] In addition, the pharmaceutical composition of the present invention may, depending on each formulation, additionally include one or more pharmaceutically acceptable carriers in addition to the above-described effective ingredients.

[0122] The pharmaceutically acceptable carrier may be saline solution, sterile water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, ethanol, or a mixture of one or more of these components, and may further include other conventional additives such as antioxidants, buffers, and bacteriostatic agents, if necessary. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate the composition into an injectable formulation such as an aqueous solution, suspension, or emulsion, or into a pill, capsule, granule, or tablet. Furthermore, the composition may be preferably formulated according to each disease or component using an appropriate method in the art or a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA).

[0123] In the present invention, the term "pharmaceutically acceptable salt" means a formulation of a compound that does not cause serious irritation to an organism to which the compound is administered and does not impair the biological activity and physical properties of the compound. The pharmaceutically acceptable salt can be obtained by reacting the compound, complex or nanoparticle of the present invention with an inorganic acid such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid or phosphoric acid, a sulfonic acid such as methanesulfonic acid, ethanesulfonic acid or p-toluenesulfonic acid, an organic carboxylic acid such as tartaric acid, formic acid, citric acid, acetic acid, trichloroacetic acid, trifluoroacetic acid, capric acid, isobutanoic acid, malonic acid, succinic acid, phthalic acid, gluconic acid, benzoic acid, lactic acid, fumaric acid, maleic acid or salicylic acid. In addition, the compound, complex or nanoparticle of the present invention can be obtained by reacting it with a base to form a salt such as an alkali metal salt such as an ammonium salt, a sodium or potassium salt, an alkaline earth metal salt such as a calcium or magnesium salt, a salt of organic bases such as dicyclohexylamine, N-methyl-D-glucamine, tris(hydroxymethyl)methylamine, and a salt of an amino acid such as arginine or lysine.

[0124] The composition of the present invention can be administered orally or parenterally in a pharmaceutically effective amount depending on the intended method, and the term "pharmaceutically effective amount" of the present invention means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment and not causing side effects, and the effective dosage level can be determined based on factors including the patient's health condition, severity, activity of the drug, sensitivity to the drug, administration method, administration time, administration route and excretion rate, treatment period, drugs used in combination or simultaneously, and other factors well known in the medical field.

[0125] Therefore, the pharmaceutical composition of the present invention can be administered to a subject to prevent, treat, and / or diagnose inflammatory diseases.

[0126] In the present invention, the term "subject" is not limited to a mammal such as a livestock or a human that requires prevention, treatment, and / or diagnosis of an inflammatory disease, but may preferably be a human.

[0127] The pharmaceutical composition of the present invention can be formulated in various forms for administration to a subject, and a representative form of a parenteral administration form is an injectable form, preferably an isotonic aqueous solution or suspension. The injectable form can be prepared using a suitable dispersing or wetting agent and a suspending agent according to a technique known in the art. For example, each component can be dissolved in saline or a buffer solution to be formulated for injection. In addition, oral administration forms include, for example, ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, and wafers, and these forms may contain, in addition to the active ingredient, a diluent (e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, and / or glycine) and a lubricant (e.g., silica, talc, stearic acid and its magnesium or calcium salts, and / or polyethylene glycol). The above tablets may contain a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidine, and optionally may further contain a disintegrating agent such as starch, agar, alginic acid or its sodium salt, an absorbent, a coloring agent, a flavoring agent and / or a sweetening agent. The above formulations may be prepared by conventional mixing, granulating or coating methods.

[0128] In addition, the pharmaceutical composition of the present invention may further include auxiliary agents such as preservatives, wetting agents, emulsifying agents, salts for osmotic pressure control or buffers, and other therapeutically useful substances, and may be formulated according to conventional methods.

[0129] The pharmaceutical composition according to the present invention can be administered via various routes, including oral, transdermal, subcutaneous, intravenous, or intramuscular. The dosage of the active ingredient can be appropriately selected based on various factors, such as the route of administration, the patient's age, sex, weight, and severity of the condition. Furthermore, the composition of the present invention can be administered in combination with known compounds capable of enhancing the desired effect.

[0130] The pharmaceutical composition according to the present invention may be administered to humans or animals orally or parenterally, such as intravenously, subcutaneously, intranasally, or intraperitoneally. Oral administration also includes sublingual administration. Parenteral administration includes injection methods such as subcutaneous injection, intramuscular injection, and intravenous injection, as well as drip methods.

[0131]

[0132] In the pharmaceutical composition of the present invention, the total effective amount of the curcumin derivative, drug-enzyme complex, or drug delivery nanoparticle according to the present invention can be administered to a patient as a single dose, or can be administered by a fractionated treatment protocol in which multiple doses are administered over a long period of time. The pharmaceutical composition of the present invention may vary the content of the active ingredient depending on the severity of the disease, but can typically be administered repeatedly several times a day at an effective dose of 100 μg to 3,000 mg per administration for an adult. However, the concentration of the curcumin derivative, drug-enzyme complex, or drug delivery nanoparticle may be determined by taking into consideration various factors such as the administration route and number of treatments as well as the patient's age, weight, health status, gender, disease severity, diet, and excretion rate.

[0133] In addition, the pharmaceutical composition according to the present invention is not particularly limited in its formulation, administration route, and administration method as long as it exhibits the effects of the present invention, and the pharmaceutical composition of the present invention may additionally include a known therapeutic agent for inflammatory diseases in addition to the curcumin derivative, drug-enzyme complex, or nanoparticle for drug delivery as an active ingredient, and may be used in combination with other known treatments for the treatment of these diseases.

[0134]

[0135] In addition, the present invention provides a use of the curcumin derivative, the drug-enzyme complex or the drug delivery nanoparticle for preventing or treating inflammatory diseases.

[0136]

[0137] Below, examples are described in more detail. However, the examples may be modified in various ways, and the scope of the patent application is not limited or restricted by these examples. It should be understood that all modifications, equivalents, or alternatives to the examples are included within the scope of the patent application.

[0138]

[0139] [Example]

[0140] Example 1. Method for synthesizing a novel compound

[0141] In order to synthesize the novel compound of the present invention, the following compound was synthesized through de novo synthesis as described in the inventor's Republic of Korea Patent No. 10-1157995.

[0142]

[0143] Example 1.1: Preparation of compound name: (1E,6E)-1,7-bis(3-hydroxy-4-methoxyphenyl)hepta-1,6-diene-3,5-dione (Compound 0)

[0144] A solution of 3-hydroxy-4-methoxybenzaldehyde (15.20 g, 99.88 mmol) and tributyl borate (45.98 g, 199.77 mmol) in ethyl acetate (50 mL) was stirred at room temperature for 30 minutes. Pentane-2,4-dione (5.00 g, 49.94 mmol) and diboron trioxide (2.43 g, 34.96 mmol) were added to the reaction mixture at room temperature, and the mixture was stirred for 30 minutes. Butyl amine (0.99 mL, 9.99 mmol) was added dropwise to the reaction mixture at room temperature, and the mixture was stirred for 24 hours. After confirming the completion of the reaction, 1N-HCl (70 mL) was added, and the mixture was stirred for 30 minutes. The solid formed in the reaction mixture was filtered under reduced pressure and washed with water. The obtained solid was added to methanol (50 mL), stirred for 30 minutes, filtered under reduced pressure, and washed sequentially with methanol and n-hexane to obtain 5.00 g (27% yield) of Compound 0. The results of NMR spectrum analysis are shown in Fig. 3.

[0145] 1 H NMR (DMSO-d6, 500 MHz): δ 9.24(s, 2H), 7.48(d, 2H, J=20.0Hz), 7.13(m, 4H), 6.97(d, 2H, J=10.0Hz), 6.64(d, 2H, J=20.0Hz), 6.12(s, 1H), 3.82(s, 6H)

[0146]

[0147] Example 1.2: Synthesis of compound name: ((1E,6E)-3,5-dioxohepta-1,6-diene-1,7-diyl)bis(2-methoxy-5,1-phenylene) dibutyrate (compound 1a)

[0148] At room temperature, (1E,6E)-1,7-bis(3-hydroxy-4-methoxyphenyl)hepta-1,6-diene-3,5-dione (200 mg, 542.92 μmol), butanoic acid (143.5 mg, 1.63 mmol), N-ethyl-N′-(3-dimethylaminopropyl)carbodiimide hydrochloride (249.8 mg, 1.30 mmol), and 4-(dimethylamino)pyridine (33.2 mg, 271.46 μmol) in DMF (5 mL) were stirred for 24 h. The reaction mixture was poured into ice water (10 mL), separated into layers with ethyl acetate (10 mL), and the organic layer was dried over anhydrous Na2SO4 and filtered. The filtrate was concentrated under reduced pressure and recrystallized from diethyl ether to obtain 80 mg (yield 28%) of compound 1a. The NMR spectrum analysis results are shown in Fig. 4.

[0149] 1 H NMR (CDCl3, 500 MHz): δ 7.56(d, 2H, J=15.0Hz), 7.37(dd, 2H, J=5.0Hz and 100Hz), 7.27(d, 2H, J=5.0Hz), 6.96(d, 2H, J=10.0Hz), 6.45(d, 2H, J=15.0Hz), 5.75(s, 1H), 3.86(s, 6H), 2.57(t, 4H, J=15.0Hz), 1.79(m, 4H), 1.05(t, 6H, J=15.0Hz)

[0150]

[0151] Example 1.3: Synthesis of compound name: 5-((1E,6E)-7-(3-hydroxy-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenyl butyrate (Compound 1b)

[0152] At room temperature, (1E,6E)-1,7-bis(3-hydroxy-4-methoxyphenyl)hepta-1,6-diene-3,5-dione (1.0 g, 2.71 mmol), butanoic acid (358.8 mg, 4.07 mmol), N-ethyl-N′-(3-dimethylaminopropyl)carbodiimide hydrochloride (780.6 mg, 4.07 mmol), and 4-(dimethylamino)pyridine (82.9 mg, 678.65 μmol) in DMF (25 mL) were stirred for 24 h. The reaction mixture was poured into ice water (30 mL), separated with ethylacetate (30 mL), and the organic layer was dried over anhydrous Na2SO4 and filtered. The filtrate was concentrated under reduced pressure and purified by column chromatography to obtain 350 mg (yield 29%) of compound 1b. The NMR spectrum analysis results are shown in Figure 5.

[0153] 1 H NMR (DMSO-d6, 500 MHz): δ 9.24 (s, 1H), 7.50 (m, 4H), 7.14 (m, 3H), 6.97 (d, 1H, J=10.0Hz), 6.81 (d, 1H, J=15.0Hz), 6.66 (d, 1H, J=20.0Hz), 6.09(s, 1H), 3.82(s, 6H), 2.55(t, 2H, J=15.0Hz), 1.67(m, 2H), 0.98(s, 3H)

[0154]

[0155] Examples 1.4, 1.5: Synthesis of compound names: ((1E,6E)-3,5-dioxohepta-1,6-diene-1,7-diyl)bis(2-methoxy-5,1-phenylene) bis(2-propylpentanoate) (compound 1c) and 5-((1E,6E)-7-(3-hydroxy-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenyl 2-propylpentanoate (compound 1d)

[0156] At room temperature, (1E,6E)-1,7-bis(3-hydroxy-4-methoxyphenyl)hepta-1,6-diene-3,5-dione (1.5 g, 4.07 mmol), valporic acid (880.8 mg, 6.11 mmol), N-ethyl-N′-(3-dimethylaminopropyl)carbodiimide hydrochloride (1.17 g, 6.11 mmol), and 4-(dimethylamino)pyridine (149.2 mg, 1.22 mmol) in DMF (40 mL) were stirred for 24 h. The reaction mixture was poured into ice water (50 mL), separated with ethyl acetate (50 mL), and the organic layer was dried over anhydrous Na2SO4 and filtered. The filtrate was concentrated under reduced pressure and purified by column chromatography to obtain 750 mg of compound 1c and 650 mg of compound 1d. The NMR spectrum analysis results are shown in Figures 6 and 7.

[0157] Compound 1c

[0158] 1 H NMR (CDCl3, 500 MHz): δ 7.56(d, 2H, J=15.0Hz), 7.37(dd, 2H, J=5.0Hz and 10.0Hz), 7.22(d, 2H, J=5.0Hz), 6.95(d, 2H, J=10.0Hz), 6.46(d, 2H, J=15.0Hz), 5.79(s, 1H), 3.85(s, 6H), 2.63(m, 2H), 1.75(m, 4H), 1.56(m, 6H), 1.48(m, 6H), 0.97(t, 12H, J=15.0Hz)

[0159] Compound 1d

[0160] 1H NMR (CDCl3, 500 MHz): δ 7.55(dd, 2H, J=5.0Hz and 20.0Hz), 7.37(dd, 1H, J=5.0Hz and 10.0Hz), 7.22(d, 1H, J=5.0Hz), 7.17(d, 1H, J=5.0Hz), 7.04(dd, 1H, J=5.0Hz and 10.0Hz), 6.95(d, 1H, J=5.0Hz), 6.84(d, 1H, J=10.0Hz), 6.46(dd, 2H, J=5.0Hz and 15.0Hz), 5.78(s, 1H), 5.67(br s, 1H), 3.93(s, 3H), 3.84(s, 3H), 2.64(m, 1H), 1.75(m, 2H), 1.48(m, 6H), 0.97(tm 6H, J=15.0Hz);

[0161]

[0162] Application 1.6. Solvents : 5-((1E,6E)-7-(3-(butyryloxy)-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenyl 2-propylpentanoate (soluble 1e) was used

[0163] 5-((1E,6E)-7-(3-hydroxy-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenyl butyrate (200 mg, 456.13 μmol), valporic acid (78.9 mg, 547.36 μmol), N-ethyl-N′-(3-dimethylaminopropyl)carbodiimide hydrochloride (104.9 mg, 547.36 μmol), and 4-(dimethylamino)pyridine (13.9 mg, 114.03 μmol) in DMF (4 mL) were stirred at room temperature for 24 h. The reaction mixture was poured into ice-cold water (5 mL), separated with ethylacetate (5 mL), and the organic layer was dried over anhydrous Na2SO4 and filtered. The filtrate was concentrated under reduced pressure and purified by column chromatography to obtain 120 mg (46% yield) of compound 1e. The results of NMR spectrum analysis are shown in Figure 8.

[0164] 1 H NMR (CDCl3, 500 MHz): δ 7.56(d, 2H, J=15.0Hz), 7.37(dd, 2H, J=5.0Hz and 10.0Hz), 7.27(d, 1H, J=5.0Hz), 7.22(d, 1H, J=5.0Hz), 6.95(dd, 2H, J=5.0Hz and 10.0Hz), 6.45(dd, 2H, J=5.0Hz and 15.0Hz), 5.77(s, 1H), 3.84(d, 6H, J=10.0Hz), 2.65(m, 1H), 2.57(t, 2H, J=15.0Hz), 1.75(m, 4H), 1.48(m, 6H), 1.05(t, 3H, J=15.0Hz), 0.97(t, 6H, J=15.0Hz)

[0165]

[0166] Example 1.7. Synthesis of compound 5-((1E,6E)-7-(3-(butyryloxy)-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenyl 5-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanoate (1f)

[0167] Compound 1b (120 mg, 273.68 μmol) and 5-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanoic acid (80.24 mg, 328.41 μmol), N-ethyl-N′-(3-dimethylaminopropyl)carbodiimide hydrochloride (62.96 mg, 328.41 μmol), and 4-(dimethylamino)pyridine (3.34 mg, 27.37 μmol) in DMF (3 mL) were stirred at room temperature for 24 h. The reaction mixture was poured into ice-water (10 mL), separated into layers with ethylacetate (10 mL), and the organic layer was dried over anhydrous Na2SO4 and filtered. The filtrate was concentrated under reduced pressure and recrystallized from diethyl ether to obtain 50 mg (42% yield) of compound 1f. The results of NMR spectrum analysis are shown in Figure 9.

[0168] 1 H NMR (CDCl3, 500 MHz): δ 7.56(m, 6H), 7.18(d, 2H, J=10.0Hz), 6.83(dd, 2H, J=5.0Hz and 10.0Hz), 6.48(s, 1H), 6.38(s, 1H), 6.06(s, 1H), 4.31(m, 1H), 4.15(m, 1H), 3.82(d, 6H, J=5.0Hz), 3.15(m, 1H), 2.84(m, 1H), 2.55(m, 5H), 1.64(m, 5H), 1.54(m, 1H), 1.45(m, 2H), 0.98(s, 3H)

[0169]

[0170] Example 2. Inhibition of inflammatory factor expression in various cell lines by compounds

[0171] To confirm the inhibition of inflammatory factor expression in various cells by the derivatives of the present invention, gene expression of interleukins and TNF was analyzed via qRT-PCR. The cell lines used were the macrophage cell line RAW264.7, the neural cell line PC12, and the colon epithelial cell line CACO-2. The increased inflammatory factor mRNA levels before and after treatment with LPS, an inflammatory condition, were analyzed. The relative expression levels were analyzed using curcumin as a positive control.

[0172] In addition, we confirmed that lipopolysaccharide (LPS), an experimental substance that induces an inflammatory response, increases the transcription level of the inflammatory factor tested in various cell lines, and compared it with the inflammatory factor suppressed by natural curcumin as a comparative substance.

[0173] The qRT-PCR primer sequences used are shown in Table 1 below.

[0174]

[0175] Cell line identification sequence Raw264.7 cell line (mouse) GAPDH, - XM_029476871F (forward, SEQ ID NO: 23): 5'-AACGACCCCTTCATTGAC-3'R (backward, SEQ ID NO: 24): 5'-TCCACGACATACTCAGCAC-3'TNF-α, - XM_021149735F (SEQ ID NO: 25): 5'-ATGAGCACAGAAAGCATGAT-3'R (SEQ ID NO: 26): 5'-TACAGGCTTGTCACTCGAAT-3'IL-1β, - NM_008361F (SEQ ID NO: 27): 5'-ATGGCAACTGTTCCTGAACT-3'R (SEQ ID NO: 28): 5'-CAGGACAGGTATAGATTCTT-3'IL-6, - NM_001314054F (SEQ ID NO: 29): 5'-TTCCATCCAGTTGCCTTCTT-3'R (SEQ ID NO: 30): 5'-ATTTCCACGATTTCCCAGAG-3'PC12 cell line (rat)GAPDH, - NM_017008F (SEQ ID NO: 31): GGCACAGTCAAGGCTGAGAATGR (SEQ ID NO: 32): ATGGTGGTGAAGACGCCAGTAGAPDH, - XM_032888689F (SEQ ID NO: 33): TCAGTTCCATGGCCCAGACR (SEQ ID NO: 34): GTTGTCTTTGAGATCCATGCCATTGAPDH, - NM_012589F (SEQ ID NO: 35): ATTGTATGAACAGCGATGATGCACR (SEQ ID NO: 36): CCAGGTAGAAACGGAACTCCAGACACO-2 cell line (human)GAPDH, - NM_001357943F (SEQ ID NO: 37): GGAGCGAGATCCCTCCAAAATR (SEQ ID NO: 38): GGCTGTTGTCATACTTCTCATGGIL-6, - NM_000600.5F (SEQ ID NO: 39): AGGTATACCTAGAGTACCTCR (SEQ ID NO: 40): AGCCACTGGTTCTGTGCCTG

[0176]

[0177]

[0178] As a result, as shown in Fig. 10, in the macrophage cell line RAW264.7, which is an important inflammatory factor producing cell, interleukin 1, 6 and TNF-a showed inhibitory effects superior to or similar to curcumin, and in the neural cell line PC-12, it was confirmed that it inhibited the gene expression of TNF-a and IL-6, and in the colonic epithelial cell CACO-2, it inhibited the gene expression of IL-6. The inhibition of inflammatory factors by these compounds is not limited to the mentioned inflammatory factors and is expected to contribute to the inhibition of other inflammatory substances as well. In the above Fig. 10, Sample 1 is compound 1a, Sample 2 is compound 1b, Sample 3 is compound 1c, Sample 4 is compound 1d, Sample 5 is compound 1e, and Sample 6 is compound 1f.

[0179]

[0180] Example 3. Method for manufacturing nanoparticles using compounds

[0181] In this Example 3, drug delivery nanoparticles are manufactured using the synthesized derivative and a biocompatible polymer.

[0182] Using PLGA (Poly-DL-Lactide-co-Glycolide) and PLA (Poly-DL-Lactide), which are polymers proven to be biocompatible by FDA approval, as main materials and curcumin as a model drug, nanoparticles can be manufactured by changing factors that have an important influence on the size of nanoparticles and drug release control, such as the concentration of the polymer, the type and concentration of the stabilizer, and the sonication output, using the novel compounds (1a-1f) of the present invention.

[0183] To manufacture nanoparticles using emulsification-solvent evaporation, first, the main ingredient, the polymer, is dissolved in 500 μL of acetone at various concentrations, and then mixed with the polymer solution. The mixture is mixed with a stabilizer solution dissolved in distilled water according to type and concentration, and stabilized for approximately 2 minutes to maintain the thermodynamic equilibrium of the aqueous phase and the organic phase. This mixture is emulsified using a sonicator with different outputs and reaction times, stirred at room temperature to remove the organic solvent, and then dialyzed for 10 hours to remove the residual organic solvent, stabilizer, and unloaded drug. The dialyzed emulsified solution is centrifuged at 35,000 rpm using an ultracentrifuge, and after suspension in PBS and ultracentrifugation, it is freeze-dried to manufacture drug-loaded PLGA nanoparticles.

[0184] To analyze the manufactured nanoparticles, the average particle diameter and dispersion stability are compared through zeta potential measurement using a light scattering method (Electrophoretic Light Scattering Spectrophotometer), and the actual particle size and surface morphology are confirmed using a SEM (Scanning Electron Microscope) and TEM (Transmission Electron Microscope).

[0185] The results confirmed by SEM are shown in Figs. 11a and 11b. It was confirmed that PLGA nanoparticles (Fig. 11a) and PLA nanoparticles (Fig. 11b) containing curcumin derivatives were formed in a spherical shape and were well dispersed by the above-described method for manufacturing nanoparticles.

[0186] In addition, the results confirmed by TEM are shown in Fig. 12a and Fig. 12b (scale bar = 500 nm). For PLGA nanoparticles, the diameter was 84.0 nm ± 0.167, and the Zeta-potential was -5.62 mV (Fig. 12a). For PLA nanoparticles, the diameter was 96.2 nm ± 0.278, and the Zeta-potential was -0.41 mV (Fig. 12b).

[0187]

[0188] Example 4. Recombinant proteins for protein-enzyme-drug conjugation

[0189] In order to suppress inflammatory factor proteins that work in various inflammatory diseases, an enzyme that can cleave SNARE family proteins involved in the cell material secretion pathway can be delivered into the cell to block the pathway that secretes substances from inside the cell to the outside of the cell. By blocking the secretion pathway, the secretion of inflammatory substances such as interleukin or TNF-alpha can be blocked. For this purpose, a recombinant protein in which a transport domain known as PTD (protein transduction domain) or CPP (cell penetrating peptide) is combined with the light chain protease of botulinum toxin is expected to be able to suppress the secretion of inflammatory substances in various cells. The working principle of this drug-enzyme complex is shown in Figure 13 in comparison with a drug-antibody complex.

[0190] Accordingly, in addition to the temporary secretion inhibition effect, a drug-enzyme complex is manufactured that exhibits a synergistic effect in treating inflammation by combining an epigenetic regulatory drug capable of transcriptional inhibition at the gene expression stage in cells that secrete substances, thereby suppressing the inflammatory response from the gene expression stage to the post-transcriptional modification stage.

[0191]

[0192] First, recombinant proteins for protein-enzyme-drug conjugation of sequence numbers 7 to 16 are designed in combination according to Figure 14 and genes are synthesized. The accessory domains that can be applied at this time include a protein transduction domain that can penetrate and deliver proteins into cells, a PEP1 peptide (SEQ ID NO: 7), a Glycine flexible linker peptide (SEQ ID NO: 9) that provides flexibility between protein domains, an avidin-tag peptide (biotin compound) (SEQ ID NO: 11) required for conjugating synthetic compounds and proteins, an endosomal escaping domain (SEQ ID NO: 13) that helps proteins to be captured by endosomes and released into the cytoplasm after moving into cells by the function of PTD, and an LL37 domain (SEQ ID NO: 15) that can specifically target immune cells and macrophages. By combining these domains with the protease domain, various recombinant targeted secretion inhibitors can be designed.

[0193] In addition, the structure of the protease used here is designed in a way that the light chain portion of botulinum toxin, which is a protease applied to the inventor's Republic of Korea registered patent "No. 10-2174197", is expressed in an active form. The light chain portions of botulinum toxin types A and E are used as the types of protease utilized in the present invention. In the case of E-type, it is designed based on two types of subtype genes P30995 and CAA43999.1 (NCBI, National Center for Biotechnology Information, USA, search number). The designed proteases are as shown in sequence numbers 1, 3, and 5, respectively. The proteins expressed with genes modified with gene sequences in which the specified amino acid sequences are substituted with amino acids as shown in sequence numbers 1, 3, and 5 have improved water solubility and substrate specificity.

[0194] The above protease includes a base sequence optimized for expression in the microorganism Escherichia coli, and also includes sequences optimized for microorganisms or animal cells. The gene sequence specified in the present invention can be easily mass-produced as a protein using recombinant E. coli expression vectors, such as the pET system, i.e., an expression system using T7 RNA polymerase.

[0195]

[0196] Example 5. Expression, purification, and activity measurement of recombinant proteins for protein-enzyme-drug conjugation.

[0197] Using the base sequence of the protease and peptide used in the present invention, the protein expressed in various expression vectors of the synthetic E. coli is harvested, and then purified from the soluble or insoluble fraction or recovered as a soluble protein through a purification and protein refolding process.

[0198] To analyze the protein activity of this, a SNARE protein (including SNAP25 and SNAP23) with ANNEXIN V protein fused to the C-terminus as a substrate for measuring enzyme activity and a protease are mixed in a substrate-to-enzyme ratio of 20 to 1:1 (w / w) to perform an enzyme reaction, and then the cleavage of the substrate is confirmed by SDS-PAGE.

[0199] The SDS-PAGE results are shown in Figure 15, and it was confirmed that the SNAP substrate protein was effectively cleaved using the fusion protease of sequence number 17 and the protease of sequence number 3 manufactured in the present invention.

[0200] Figure 16 shows the cleavage sites and molecular weights of SNAP substrate proteins by recombinant BTXL enzymes. The protease of sequence number 3 was confirmed to cleave 50 kDa SNAP-ANNEXiN V, forming protein bands of 38 kDa and 12 kDa, and the fusion protease of sequence number 17 was confirmed to cleave 50 kDa SNAP-ANNEXiN V, forming protein bands of 36 kDa and 14 kDa.

[0201]

[0202] Although the embodiments described above have been described with limited drawings, those skilled in the art will appreciate that various technical modifications and variations can be applied based on the above. For example, appropriate results can still be achieved even if the described techniques are performed in a different order than described, and / or components of the described systems, structures, devices, circuits, etc. are combined or combined in a different manner than described, or are replaced or substituted with other components or equivalents.

[0203]

[0204] Therefore, other implementations, other embodiments, and equivalents to the claims also fall within the scope of the claims described below.

[0205]

[0206]

Claims

1. A curcumin derivative of the following chemical formula 1 or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] In the above chemical formula 1, R1 and R2 are each independently hydroxy or -OC(=O)R3, and R3 is substituted or unsubstituted C 1-12 It is an alkyl group.

2. In paragraph 1, The curcumin derivative of the above chemical formula 1 is ((1E,6E)-3,5-dioxohepta-1,6-dien-1,7-diyl)bis(2-methoxy-5,1-phenylene) dibutyrate (1a); 5-((1E,6E)-7-(3-hydroxy-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenylbutyrate (1b); ((1E,6E)-3,5-dioxohepta-1,6-dien-1,7-diyl)bis(2-methoxy-5,1-phenylene)bis(2-propylpentanoate)(1c); 5-((1E,6E)-7-(3-hydroxy-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenyl 2-propylpentanoate (1d); 5-((1E,6E)-7-(3-(butyryloxy)-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenyl 2-propylpentanoate (1e); and At least one selected from the group consisting of 5-((1E,6E)-7-(3-(butyryloxy)-4-methoxyphenyl)-3,5-dioxohepta-1,6-dien-1-yl)-2-methoxyphenyl 5-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanoate (1f), A curcumin derivative or a pharmaceutically acceptable salt thereof.

3. A curcumin derivative of paragraph 1 or a pharmaceutically acceptable salt thereof; and a drug-enzyme complex conjugated with a protease.

4. In paragraph 3, The above protease is represented by the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO:

5. Drug-enzyme complex.

5. In paragraph 3, The above protease, (1) Cell penetrating peptide; (2) Flexible-linker peptide; (3) Avidin-tagged peptide; (4) endosomal escape domain; and (5) A fusion protease to which one or more peptides selected from the group consisting of cell targeting peptides are fused, Drug enzyme complex.

6. In paragraph 5, The above cell penetrating peptide is represented by the amino acid sequence of sequence number 7, The above flexible-linker peptide is represented by the amino acid sequence of SEQ ID NO: 9, The above avidin-tag peptide is represented by the amino acid sequence of SEQ ID NO: 11, The above endosomal escape domain is represented by the amino acid sequence of SEQ ID NO: 13, The above cell targeting peptide is represented by the amino acid sequence of SEQ ID NO:

15. Drug enzyme complex.

7. In paragraph 5, The above fusion protease is represented by the amino acid sequence of SEQ ID NO: 17, SEQ ID NO: 19 or SEQ ID NO:

21. Drug-enzyme complex.

8. In paragraph 5, The above fusion protease cleaves the SNARE protein. Drug-enzyme complex.

9. In paragraph 8, The above SNARE protein is SNAP25 or SNAP23. Drug-enzyme complex.

10. A nanoparticle for drug delivery, wherein the curcumin derivative of paragraph 1 or a pharmaceutically acceptable salt thereof is encapsulated inside the polymer nanoparticle.

11. In paragraph 10, A drug delivery nanoparticle, wherein the polymer nanoparticle comprises at least one selected from the group consisting of poly-DL-lactide-co-glycolide (PLGA), poly-DL-lactide (PLA), hyaluronic acid, alginate, polycaprolactone, and polyethylene glycol.

12. A drug-enzyme complex according to any one of claims 3 to 9 or a drug delivery nanoparticle according to any one of claims 10 to 11, comprising as an active ingredient, A pharmaceutical composition for the prevention or treatment of inflammatory diseases.

13. In paragraph 12, The composition inhibits one or more inflammatory factors selected from the group consisting of interleukin-1b, interleukin-6, and tumor necrosis factor-alpha. A pharmaceutical composition for the prevention or treatment of inflammatory diseases.

14. In paragraph 12, The inflammatory disease is characterized in that at least one selected from the group consisting of degenerative arthritis, inflammatory bowel disease, peritonitis, osteomyelitis, cellulitis, pancreatitis, bronchial asthma, allergic rhinitis, bronchitis, osteoarthritis, spondylitis, vasculitis, Lougenic granulomatosis, polymyalgia rheumatica, tenosynovitis, hemochromatosis, hyperlipoproteinemia, systemic lupus erythematosus, relapsing fever, multiple sclerosis, sepsis, septic shock, acute respiratory distress syndrome, multiple organ failure, chronic obstructive pulmonary disease, rheumatoid arthritis, asthma, periodontitis, stomatitis, peritonitis, gastritis, enteritis, arthritis, nephritis, hepatitis, inflammatory skin disease, breast cancer, prostate cancer, uterine cancer, lung cancer, liver cancer, stomach cancer, colon cancer, and brain tumor. A pharmaceutical composition for the prevention or treatment of inflammatory diseases.

Images