Neutrally tasting, high protein and low fat pea varieties

Abstract

Pea plants or part(s) thereof, as well as products such as commodity whole or split grains, pea protein concentrates (PPC), dairy analogues or protein-fortified beverages and meat analogues or texturized pea protein prepared therefrom, which have high protein content, low fat content and neutral taste are provided. The pea plans, part(s) and products are characterized by specific sets of genetic markers that correspond to identified quantitative trait loci (QTLs). Phenotypic and genotypic analysis of many pea varieties was performed to derive the markers for these phenotypic traits, and a breeding simulation was used to identify the most common and most stable markers. Following verification of trait stability over several generations, markers and marker cassettes were defined as being uniquely present in the developed pea lines. The resulting pea lines can be used to provide products with pea-based protein and low or no off flavors.

Description

NEUTRALLY TASTING, HIGH PROTEIN AND LOW FAT PEA VARIETIESSEQUENCE LISTING STATEMENT

[0001] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML format copy, created on July 27, 2023, is named P-628198-USP_ST26.xml, and is 41 KB in size.BACKGROUND OF THE INVENTION1. TECHNICAL FIELD

[0002] The present invention relates to the field of pea varieties for multiple uses, such as pea concentrates, dairy products and meat replacements, and more particularly, to computer-assisted classically-bred varieties with neutral taste.2. DISCUSSION OF RELATED ART

[0003] Pea (Pisum sativum) is a cool season legume grown worldwide as a source of protein both for human food and animal feed. Economically, legumes represent the second most important family of crop plants, and dry pea currently ranks second only to common bean as the most widely grown grain legume in the world. Its primary production is in temperate regions. In 2018, its global production was 34.7 M tons.

[0004] Although pea is considered to be one of the world’s oldest domesticated crops, classical breeding methodology attempts done in order to increase protein level encountered some obstacles due to inferior agronomical traits such as low yield potential. Commercial dry pea varieties, which currently grown in France and Canada, have an average protein content of about 22%. The plant protein market is constantly challenged by the growing worldwide demand for non-GMO (genetically modified organisms) plant-based protein.

[0005] Dry fractionation of pulse proteins has been used as a sustainable method of plant protein extraction due to reduced use of energy and water (see, e.g., Moeller et al. 2021, From raw material to mildly refined ingredient - Linking structure to composition to understand fractionation processes, Journal of Food Engineering 291, 110321). However, since commercial pea concentrates typically have a distinct “beany” flavor (see, e.g., Trindler et al. 2022, Aroma of peas,its constituents and reduction strategies - Effects from breeding to processing, Food Chemistry 376, 131892), their uses in the food industry are limited, and current practice often requires chemical or biological processes to mitigate the undesirable off-flavors.

[0006] Tayeh et al. 2015 (Development of two major resources for pea genomics: the GenoPea 13.2 K SNP Array and a high-density, high-resolution consensus genetic map, The Plant Journal, 84(6), pp.1257-1273) provides extensive data on a very larger set of SNP (single nucleotide polymorphism) markers identified in pea.SUMMARY OF THE INVENTION

[0007] The following is a simplified summary providing an initial understanding of the invention. The summary does not necessarily identify key elements nor limit the scope of the invention, but merely serves as an introduction to the following description.

[0008] One aspect of the present invention provides pea plants or part(s) thereof that have high protein content, low fat content (e.g., at most 2% w / w dry base) and neutral taste, the pea plant(s) comprising a plurality of loci associated with a corresponding plurality quantitative trait loci (QTLs) having a corresponding plurality of nucleic acid genetic markers that are associated with a plurality of phenotypic traits of the pea plant, the phenotypic traits including high yield, high protein, low fat and neutral taste traits, wherein: the phenotypic traits comprise a high protein content of the seeds of at least 29% w / w dry base, a low fat content of the seeds of at most 2% w / w dry base and the neutral taste characterized by moderate to very mild off flavors in a qualitative tasting test and associated with reduced level of volatile compounds associated with off flavors, the plurality of QTLs and corresponding markers comprise at least three QTLs and corresponding markers, of at least one of the following cassettes: (i) cassette 1 comprising: the QTL and marker associated with the increased yield trait comprise QTL 1 with corresponding markers set forth in Seq. IDs 1 or 2, and the pea plant or part thereof is homozygous with respect to Seq. ID 1 or heterozygous at QTL 1, the QTL and marker associated with the low fat content trait comprise QTL 2 with corresponding markers set forth in Seq. IDs 3 or 4, and the pea plant or part thereof is homozygous with respect to Seq. ID 3 or heterozygous at QTL 2, and the QTL and marker associated with the increased yield trait and with a neutral taste trait comprise QTL 3 with corresponding markers set forth in Seq. IDs 5 or 6, and the pea plant or part thereof is homozygous with respect to Seq. ID 5 or heterozygous at QTL 3; (ii) at least one of cassettes 2, 3, 4, 8, 9 or 10 comprising the QTL and marker associated with the neutral taste trait comprise QTL 4 withcorresponding markers set forth in Seq. IDs 7 or 8, and the pea plant or part thereof is homozygous with respect to Seq. ID 7 or heterozygous at QTL 4; and / or (iii) at least one of cassettes 5-10 comprising the QTL and marker associated with the neutral taste trait comprise QTL 13 with corresponding markers set forth in Seq. IDs 25 or 26, and the pea plant or part thereof is homozygous with respect to Seq. ID 25 or heterozygous at QTL 13.

[0009] One aspect of the present invention provides pea plants or part(s) thereof that include the QTLs of any one or several of cassettes 1-10, as well as various products such as commodity whole or split grains, pea protein concentrate (PPC), dairy analogues or protein-fortified beverages, and / or meat analogues or texturized pea proteins - derived therefrom. The QTLs and cassettes are described in detail herein.

[0010] These, additional, and / or other aspects and / or advantages of the present invention are set forth in the detailed description which follows; possibly inferable from the detailed description; and / or learnable by practice of the present invention.BRIEF DESCRIPTION OF THE DRAWINGS

[0011] For a better understanding of embodiments of the invention and to show how the same may be carried into effect, reference will now be made, purely by way of example, to the accompanying drawings in which like numerals designate corresponding elements or sections throughout. The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. In the accompanying drawings:

[0012] Figure 1 is a high-level schematic illustration of pea chromosomes with indications of the markers’ loci, according to some embodiments of the invention.

[0013] Figure 2 provides a comparison along the taste scale of commercial varieties with disclosed varieties, according to some embodiments of the invention.

[0014] Figure 3 is a high-level schematic illustration of the breeding method, according to some embodiments of the invention.

[0015] It will be appreciated that for simplicity and clarity of illustration, elements shown in the figures have not necessarily been drawn to scale. For example, the dimensions of some of the elements may be exaggerated relative to other elements for clarity. Further, where considered appropriate, reference numerals may be repeated among the figures to indicate corresponding or analogous elements.DETAILED DESCRIPTION OF THE INVENTION

[0016] In the following description, various aspects of the present invention are described. For purposes of explanation, specific configurations and details are set forth in order to provide a thorough understanding of the present invention. However, it will also be apparent to one skilled in the art that the present invention may be practiced without the specific details presented herein. Furthermore, well-known features may have been omitted or simplified in order not to obscure the present invention. With specific reference to the drawings, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the present invention only, and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the invention. In this regard, no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention, the description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.

[0017] Before at least one embodiment of the invention is explained in detail, it is to be understood that the invention is not limited in its application to the details of construction and the arrangement of the components set forth in the following description or illustrated in the drawings. The invention is applicable to other embodiments that may be practiced or carried out in various ways as well as to combinations of the disclosed embodiments. Also, it is to be understood that the phraseology and terminology employed herein are for the purpose of description and should not be regarded as limiting.

[0018] Embodiments of the present invention provide efficient and economical methods and mechanisms for producing neutrally tasting pea varieties for multiple uses such as producing pea concentrates and thereby provide improvements to the additional technological fields of dairy products and meat replacements, as non-limiting examples.

[0019] The following application discloses processing methods and appropriate pea varieties for producing improved and new non-GMO (genetically modified organisms) pea protein products. Pea varieties that were developed using computer-assisted breeding programs to have neutral taste (in addition to high protein content and low fat content) - open possibilities for using pea products in many fields from which they were barred due to their typical off-flavor.

[0020] Provided are pea plants and parts thereof, which are more neutrally tasting, or have less off- flavor, than current varieties, as well as their uses and corresponding pea plant cells. Phenotypicand genotypic analysis of many pea varieties was performed to derive markers for neutral taste and other phenotypic traits (e.g., high protein content and low fat content), and a breeding simulation was used to identify the most common and most stable markers. Following verification of trait stability over several generations, markers and marker cassettes were defined as being uniquely present in the developed pea lines. The resulting high-protein low-fat neutrally-tasting pea lines can be used to enhance the range of uses of pea and its products in the food industry. Uses include processing the seeds to yield any of pea protein isolate, pea concentrate, texturized products, milk / meat analogs or milk / meat replacements, commodity whole or split grains, or as animal feed.

[0021] Various embodiments comprise pea plants or part(s) thereof that have a neutral taste and comprise a plurality of loci associated with a corresponding plurality quantitative trait loci (QTLs) having a corresponding plurality of nucleic acid genetic markers that are associated with a plurality of phenotypic traits of the pea plant. The phenotypic traits comprise high yield, high-protein content, low-fat content, and neutral taste, and the plurality of QTLs and corresponding markers comprise at least two QTLs and corresponding markers - with details provided in Figure 1 and in Table 1 below. The methods used to develop and select the varieties are disclosed with respect to Figure 3 below.

[0022] Various uses include processing the seeds to yield pea protein isolate and / or pea concentrate which provide the pea protein at different levels of concentration and with different amounts of additional compounds. The seeds may be processed into texturized products which may have mechanical properties in addition to their nutritional properties, e.g., texturized products may make a food product more firm or more elastic. The seeds may be processed into meat analogs to provide nutritional properties, chemical characteristics and similar look and feel (e.g., texture, flavor, appearance) as various types of meat, and without off-tastes. The seeds may be processed into commodity whole or split grains, possibly by drying or otherwise modifying the seeds.

[0023] Figure 1 is a high-level schematic illustration of pea chromosomes (and linkage groups - LGs) with indications of the markers’ loci (QTL number), according to some embodiments of the invention. Figure 1 illustrates schematically the seven pea chromosomes with their banding patterns, and the approximate marker locations indicated along them (see exact data in Table 1). Tables 1-3 provide the derived genetic markers, QTLs, corresponding traits and derived marker cassettes, according to some embodiments of the invention.

[0024] Table 1 lists the identified QTLs, markers, associated traits and the significance of correlation between the marker and the trait. Concerning the traits, the numbers of pods and seeds,and seed moisture (in weight %) and weight are agronomic traits related to enhanced yield. The protein content and nutrient fat were measured in weight %, dry basis (protein level refers to weight %, protein content dry basis is calculated by division by the dry weight), and provide nutritional traits that were correlated to the markers (in the direction of higher protein and lower fat contents).

[0025] Neutrality of taste was measured by combining a qualitative (sensory) tasting test and a quantitative measurement of volatiles. Volatiles refer to the presence of volatile compounds that affect the aroma, odor and taste, which indicate specifically the off flavors of the pea products. The qualitative tests were performed by trained tasters and the quantitative measurements were carried out by an electronic nose device, as described below.

[0026] In the sensory tasting test, each sample was evaluated by multiple tasters which were trained to detect various off flavors according to low concentrate standards including: bitterness-caffeine, sour-citric acid, beany off flavor associated with canned beans, grassy aromas; and mineral water as a neutral taste. The results were analyzed as belonging to one of seven categories:1- Very neutral taste, no off flavors.2- Very mild off flavors.3- Mild off flavors.4- Moderate off flavors5- Balanced off flavors.6- Strong off flavors.7- Intense off flavors.

[0027] Prior art commercial yellow pea varieties and products thereof, such as CDC Meadow, are evaluated at category 7 of the scale above. In contrast, disclosed pea varieties and products thereof are typically rated at categories 2 to 4 of the scale above - exhibiting their superior taste neutrality.

[0028] Figure 2 provides a comparison along the taste scale of commercial varieties (average of 15 taste rankings) with disclosed varieties, according to some embodiments of the invention. The taste comparison has been carried out with milk pea protein concentrate (PPC). Milk PPC was prepared by mixing the PPC (5wt%) in water, with added taste -neutral stabilizers, emulsifiers (totaling less than 0.1 wt%) and oil (2.8wt%), according to a specific mixing, heating and cooling protocol used to reach a milk-like texture. One disclosed variety was characterized by markers of cassettes 2, 6, 9 and 10 - including QTLs 4, 6, 11, 12, 13, 14, 16, 17, 18, 20 (average of 8 taste rankings) and another disclosed variety was characterized by markers of cassettes 7 and 9 including QTLs 4, 13, 14, 15, 20 (average of 39 taste rankings). The graph indicates that while results forcommercial varieties have an average of category 6 - Strong off flavors (mean 5.9±0.4), disclosed varieties have averages around category 3 - Mild off flavors (mean 3.4±0.5 for QTLs 2, 6, 9 and 10; mean 3.0±0.2 for QTLs 2, 6, 9 and 10, both significantly different from the commercial varieties with p<0.05 in Student’s t test), which provides a large and easily noticeable improvement.

[0029] In another tasting panel, taste estimations were carried out for the following varieties, with emphasis on the presence of bitter and beany off tastes. Samples were prepared as powder, and in water solution (with a 95:5 ratio of water to concentrate) and two disclosed varieties were compared to commercial concentrates and to commercial de-flavored concentrates (physically processed to reduce off tastes). Of the two tested varieties - one disclosed variety was characterized by markers of cassettes 7 and 8 - including QTLs 4, 5, 13, 14, 15, 21 and another disclosed variety was characterized by markers of cassettes 5, 8, 9 and 10 including QTLs 4, 5, 6, 13, 14, 19, 20, 21. Both varieties were ranked three to four ranking steps above the reference de-flavored commercial variety (significantly better than the de-flavored reference in the terms of the test, with four ranking steps being the maximal difference), and five to seven ranking steps above the reference commercial variety (the regular reference commercial variety was graded one to three ranking steps below the reference de-flavored commercial variety - indicating the former being slightly to significantly worse than the latter) - in both powder and water solution format tests. Specifically, the beany and bitter off tastes were shown to be reduced in the disclosed variety compared with the reference de-flavored commercial variety and much reduced in the disclosed variety compared with the reference commercial variety.

[0030] In the quantitative tests, the presence of various volatiles was measured using an electronic nose device (e-Nose), which includes gas sensors, configured to detect and identify various volatile organic compounds (VOCs) that are related to odor and taste effects of the peas and pea products. The e-Nose device was used to yield various retention indices for various volatile compounds, following the methodology described in Kakumyan et al. 2009 (Development of a screening system for the evaluation of soybean volatiles, Bioscience, Biotechnology, and Biochemistry, 73(8): 1844- 1848). In order to obtain gas chromatography mass spectrometry (GCMS) analyses, retention indices (RI) were calculated from retention time (RT) and data from calibration with 11 hexane standards through the AlphaSoft software (Alpha MOS, Toulouse, France). The RI’s were then used to characterize various volatile compounds in the product and correlate them to the qualitative tasting results on the one hand, and to correlate them with the QTL markers listed below on the other hand.

[0031] The QTLs relate to these traits in a way that reduces the off flavors in the product. Overall ca. 30 retention indices (RI’s), which correspond to multiple volatile compounds, were found to be modified toward taste -neutrality in correlation with the presence of one or more of the disclosed QTLs. These RIs are referred to below, for simplicity, with respect to the neutral taste trait, based on the detected correlations between specific RIs and specific QTLs. It is noted however, that each QTL that is correlated with the neutral taste trait is associated with the presence of one or more volatile compound detected by the corresponding RI. Some exemplary results are provided in Table 5.

[0032] Reduction of volatile compounds that contribute to the presence of off tastes - associated with the disclosed QTLs, is considered to correspond to the improved taste neutrality that was shown in the qualitative taste tests, discussed above. Specifically, in various embodiments grassy aromas and off flavors were reduced in varieties characterized by the disclosed QTLs.Table 1: Genetic markers, QTLs and corresponding traits with corresponding phenotypic traits.

[0033] Table 2 lists the QTLs and markers with respect to their states and their combinations into marker cassettes. Concerning the state of the QTLs in the disclosed varieties, it is noted that typical crop varieties are bred to yield homozygous trait loci, so that in certain embodiments, one or more of the markers is in its homozygous state, all markers in one or more cassettes are in their homozygous state and / or all markers for the respective variety are in their homozygous state (referring to markers associated with the respective QTLs). However, in various embodiments, one or more markers may be in its heterozygous state, with the variety still providing improved agricultural, nutritional and / or taste-neutrality (qualitative test results and quantitative volatiles composition) traits. Accordingly, in varieties characterized by respective marker cassettes - one, several or all markers may be homozygous, and one, several or all markers may be heterozygous.Table 2: QTLs, their alleles and the marker cassettes.Table 2 (continued): QTLs, their alleles and the marker cassettes.

[0034] Table 3 summarizes the composition of the disclosed cassettes of QTLs and markers, and indicates two common marker to multiple disclosed cassettes (QTLs 4 and 13).Table 3: Overview of the marker cassettes.

[0035] Table 4 provides the number of disclosed pea varieties that include various combinations of the disclosed marker cassettes, which are not present in world (prior art) varieties. For each marker cassette, Table 4 presents the number of disclosed varieties that include the cassette by itself and in multiple combinations with other cassettes, compared with no world (prior art)varieties that include these combinations (out of 761 checked world varieties). Overall, 937 pea varieties are disclosed, which are distinct from world varieties by the marker cassettes.Table 4: Disclosed pea varieties with the marker cassettes.Occurrence in the varieties of cassette number:

[0036] Table 5 provides some of the retention indices (RI’s), which correspond to multiple volatile compounds, that were correlated with the presence of one or more of the disclosed QTLs, and indicate the improved taste-neutrality associated with these markers. The inventors are in the process of identifying the putative molecules and respective odors associated with each RI using e-Nose standards that related specific RI values to specific volatile molecules, initial results are presented in Table 5 with respect to some of the RI’s (others are to be determined - denoted TBD). These molecules and odors define off flavors which are reduced in varieties that include the respective QTL markers.Table 5: Taste neutrality QTLs and corresponding retention indices (RI) and odor descriptions.

[0037] Disclosed QTLs comprise one or more of QTLs 1 to 21 (see marker names in Table 1) with corresponding pairs of Seq IDs 1-42 that specify the alleles (with respective different SNP - SingleNucleotide Polymorphism - bases) of the respective markers that are linked to QTLs 1-21. It is noted that any of QTLs may be homozygous - having two identical alleles of the same Seq ID; or any of QTLs may be heterozygous having two different alleles with different Seq ID of each pair - as listed in Table 2 and below. Cassettes include groups of QTLs that contribute to the respective traits, as listed in Tables 2, 3 and below. Some of the cassettes include common markers (the main two markers indicated in Table 3) which contribute significantly to the respective traits.

[0038] QTL 1, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 363885584 on pea chromosome 2. The two alleles of the genetic marker at QTL 1 have the SNP bases “A” or “G”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 1 and 2. In cassette 1, QTL 1 is homozygous for allele A (SEQ ID NO 1).SEQ ID NO 1 (SNP base bold):GATATCTTTTCCAATGACATACTCATCAAGTCAGATGGCAGGACAAGACCTTTCAAA GAA A TCATGTGAAATTCATCAAGATTCACCAGACTAACACAAAGTAAACAATTATA CAGAAAACSEQ ID NO 2 (SNP base bold):GATATCTTTTCCAATGACATACTCATCAAGTCAGATGGCAGGACAAGACCTTTCAAA GAA G TCATGTGAAATTCATCAAGATTCACCAGACTAACACAAAGTAAACAATTATA CAGAAAAC

[0039] QTL 2, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 113590538 on pea chromosome 3. The two alleles of the genetic marker at QTL 2 have the SNP bases “C” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 3 and 4. In cassette 1, QTL 2 is homozygous for allele C (SEQ ID NO 3).SEQ ID NO 3 (SNP base bold):TACTATGGACGATTTCATGAGTTCGTTTTTACTAAACTGTGTTGCTTTTGAACAATGT TA C AGTGGTTGTTCTATGAAGTATTTCACAACCTATGTAACATTATTGGATTGTTTG ATAAATSEQ ID NO 4 (SNP base bold):TACTATGGACGATTTCATGAGTTCGTTTTTACTAAACTGTGTTGCTTTTGAACAATGT TA T AGTGGTTGTTCTATGAAGTATTTCACAACCTATGTAACATTATTGGATTGTTTG ATAAAT

[0040] QTL 3, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 3563293 on pea chromosome 3. The two alleles of the genetic marker at QTL 3 have the SNP bases “T” or “C”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 5 and 6. In cassette 1, QTL 3 is homozygous for allele T (SEQ ID NO 5).SEQ ID NO 5 (SNP base bold):CAAAAGTATTTGAGCAGTCATGACTAAAACCTACAGCACAAATAACCAATTGAGTA GTTG T GGTACAAAAATTCAAAAACACAGGTGGCCGAAGAAGTATAGCTACAAGGT CAAGAAAATCSEQ ID NO 6 (SNP base bold):CAAAAGTATTTGAGCAGTCATGACTAAAACCTACAGCACAAATAACCAATTGAGTA GTTG C GGTACAAAAATTCAAAAACACAGGTGGCCGAAGAAGTATAGCTACAAGGT CAAGAAAATC

[0041] QTL 4, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 427407003 on pea chromosome 2. The two alleles of the genetic marker at QTL 4 have the SNP bases “T” or “C”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 7 and 8. In cassettes 2-4 and 8-10, QTL 4 is homozygous for allele T (SEQ ID NO 7).SEQ ID NO 7 (SNP base bold):CATACCATAGATACATGCTTTAAGAAATGGAACACAAAGATCACCTTAGAAATGATG TGC T AGCTACAAAGATCACTTTATGATTTGAAGCAGACAGGTAGGAAATGAAACAC AAAACATASEQ ID NO 8 (SNP base bold):CATACCATAGATACATGCTTTAAGAAATGGAACACAAAGATCACCTTAGAAATGATG TGC C AGCTACAAAGATCACTTTATGATTTGAAGCAGACAGGTAGGAAATGAAACAC AAAACATA

[0042] QTL 5, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 27314266 on pea chromosome 6. The two alleles of the genetic marker at QTL 5 have the SNP bases “C” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 9 and 10. In cassette 4, QTL 5 is homozygous for allele C (SEQ ID NO 9), while in cassettes 5 and 8, QTL 5 is homozygous for allele T (SEQ ID NO 10).SEQ ID NO 9 (SNP base bold):TGTGATGTATCAGTGTGACAAACAGCAACAGCTTTAACTCTATTTCCAT C AACACCT TCCAATGGCACCGAGTAAACTTTAGTTGTGTCTGTTTTATGACAGTAGAAAACSEQ ID NO 10 (SNP base bold):TGTGATGTATCAGTGTGACAAACAGCAACAGCTTTAACTCTATTTCCAT T AACACCTTCCAATGGCACCGAGTAAACTTTAGTTGTGTCTGTTTTATGACAGTAGAAAAC

[0043] QTL 6, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 562131030 on pea chromosome 5. The two alleles of the genetic marker at QTL 6 have the SNP bases “G” or “A”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 11 and 12. In cassettes 2 and 10, QTL 6 is homozygous for allele G (SEQ ID NO 11).SEQ ID NO 11 (SNP base bold):CTTTTCTAAAACTAAGTTCACCAGATTTCCCTTACTTGAAAAATTGGATCTATGTGTT TC G GATGATTTGAAATCTATTACAATTTATAACCATTGTCTTCAGAGAATTGCTTTA AAAGGASEQ ID NO 12 (SNP base bold):CTTTTCTAAAACTAAGTTCACCAGATTTCCCTTACTTGAAAAATTGGATCTATGTGTT TC A GATGATTTGAAATCTATTACAATTTATAACCATTGTCTTCAGAGAATTGCTTTA AAAGGA

[0044] QTL 7, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 314710599 on pea chromosome 5. The two alleles of the genetic marker at QTL 7 have the SNP bases “C” or “A”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 13 and 14. In cassette 4, QTL 7 is homozygous for allele C (SEQ ID NO 13).SEQ ID NO 13 (SNP base bold):ACAAACATGCCACTTGGCAGCTAACCCTGTGATTGCTTGTGCTTTGTGTGTTATCTTT GT C GCACTTCGGAACATGATGGACAACGCAGAAAGAAGCGTCACCGAACACAACT GCAACAACSEQ ID NO 14 (SNP base bold):ACAAACATGCCACTTGGCAGCTAACCCTGTGATTGCTTGTGCTTTGTGTGTTATCTTT GT A GCACTTCGGAACATGATGGACAACGCAGAAAGAAGCGTCACCGAACACAACT GCAACAAC

[0045] QTL 8, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 25529885 on pea chromosome 2. The two alleles of the genetic marker at QTL 8 have the SNP bases “C” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 15 and 16. In cassette 4, QTL 8 is homozygous for allele C (SEQ ID NO 15).SEQ ID NO 15 (SNP base bold):CCGAAGCCATTAAAGAGCAAAATTGGGTCAATGATCATGAAGTGTTTGAGTTTGGTT GGT C TCCGTCTGCATTTGGAAGATGGGAAGAAGAATTTGGATGAAGATGAAGGTTG GGGAAGAGSEQ ID NO 16 (SNP base bold):CCGAAGCCATTAAAGAGCAAAATTGGGTCAATGATCATGAAGTGTTTGAGTTTGGTT GGT T TCCGTCTGCATTTGGAAGATGGGAAGAAGAATTTGGATGAAGATGAAGGTTG GGGAAGAG

[0046] QTL 9, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 230113430 on pea chromosome 5. The two alleles of the genetic marker at QTL 9 have the SNP bases “A” or “G”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 17 and 18. In cassette 3, QTL 9 is homozygous for allele A (SEQ ID NO 17).SEQ ID NO 17 (SNP base bold):CTTTCCTTAAACTCTCTGTCCATTCATCTGGATCAAAACTCATCAACTGTTTCACTGTC A A CTCAAATGTTATCTGCAACAAACAAATATATTCATCATTTTTACTACTATACCAT ACCTGSEQ ID NO 18 (SNP base bold):CTTTCCTTAAACTCTCTGTCCATTCATCTGGATCAAAACTCATCAACTGTTTCACTGTC A G CTCAAATGTTATCTGCAACAAACAAATATATTCATCATTTTTACTACTATACCAT ACCTG

[0047] QTL 10, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 66543611 on pea chromosome 2. The two alleles of the genetic marker at QTL 10 have the SNP bases “T” or “C”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 19 and 20. In cassette 3, QTL 10 is homozygous for allele T (SEQ ID NO 19).SEQ ID NO 19 (SNP base bold):TAGCTCAAATGACAAAGCAGCATCTTTAGTCGTGATTCCAGAAACCAATGGACACAT GTC T GAGAGTATTACAGAAAATCCTTTTTGCTGCAGAAAGGAAAATCAAAGACACA TTGTTAGASEQ ID NO 20 (SNP base bold):TAGCTCAAATGACAAAGCAGCATCTTTAGTCGTGATTCCAGAAACCAATGGACACAT GTC C GAGAGTATTACAGAAAATCCTTTTTGCTGCAGAAAGGAAAATCAAAGACACA TTGTTAGA

[0048] QTL 11, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 441796315 on pea chromosome 5. The two alleles of the genetic marker at QTL 11 have the SNP bases “A” or “G”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 21 and 22. In cassette 2, QTL 11 is homozygous for allele A (SEQ ID NO 21).SEQ ID NO 21 (SNP base bold):TATACTAGCAAGTGAATCCCCTTTGTCATCTTTTGTTTGATCACTTTCCTTTGTCATGA A A TTGAATACATTAGCTTTAGCATTGCTAGCTAACACAGAAACACTACTTTGGACA CTTTGAY1SEQ ID NO 22 (SNP base bold):TATACTAGCAAGTGAATCCCCTTTGTCATCTTTTGTTTGATCACTTTCCTTTGTCATGA A G TTGAATACATTAGCTTTAGCATTGCTAGCTAACACAGAAACACTACTTTGGACA CTTTGA

[0049] QTL 12, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 15003653 on pea chromosome 2. The two alleles of the genetic marker at QTL 12 have the SNP bases “A” or “G”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 23 and 24. In cassette 2, QTL 12 is homozygous for allele A (SEQ ID NO 23).SEQ ID NO 23 (SNP base bold):GCAGCTATTTGGCAAAGGATTCCTATGATAATACTTATTGAACGCATAAGAAGCATG ATC A TGAATAGAATTCGGATTGTAACAGCTTCCAGCAGGTTGAATTGCTGAACAAT CAGCGCCASEQ ID NO 24 (SNP base bold):GCAGCTATTTGGCAAAGGATTCCTATGATAATACTTATTGAACGCATAAGAAGCATG ATC G TGAATAGAATTCGGATTGTAACAGCTTCCAGCAGGTTGAATTGCTGAACAAT CAGCGCCA

[0050] QTL 13, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 207468014 on pea chromosome 1. The two alleles of the genetic marker at QTL 13 have the SNP bases “T” or “C”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 25 and 26. In cassettes 5-10, QTL 13 is homozygous for allele T (SEQ ID NO 25).SEQ ID NO 25 (SNP base bold):TACTTTTCTGAAGCAACTATCATTTTTGACAACATAGGATCAAGCGGGAACTCTGCC ATT T GTCTGCCTACCTTAGTTAATTTGCCACCAACGTTTAAAGCATTTTGTGCGTAT AAAAGCTSEQ ID NO 26 (SNP base bold):TACTTTTCTGAAGCAACTATCATTTTTGACAACATAGGATCAAGCGGGAACTCTGCCATT C GTCTGCCTACCTTAGTTAATTTGCCACCAACGTTTAAAGCATTTTGTGCGTAT AAAAGCT

[0051] QTL 14, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 5776307 on pea chromosome 2. The two alleles of the genetic marker at QTL 14 have the SNP bases “C” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 27 and 28. In cassettes 7 and 9, QTL 14 is homozygous for allele C (SEQ ID NO 27).SEQ ID NO 27 (SNP base bold):ATGGGCTGGTATTTTCAGAAGGTTCCTTGTGGACTCTCCCTACATGTGGTGGCCTTCA AA C CTTGTCCAGGTGTCTCTATTCAGGTATTTCTTTATTTTTTCTATCATTCTCTTTGT GTGTSEQ ID NO 28 (SNP base bold):ATGGGCTGGTATTTTCAGAAGGTTCCTTGTGGACTCTCCCTACATGTGGTGGCCTTCA AA T CTTGTCCAGGTGTCTCTATTCAGGTATTTCTTTATTTTTTCTATCATTCTCTTTGT GTGT

[0052] QTL 15, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 31990510 on pea chromosome 2. The two alleles of the genetic marker at QTL 15 have the SNP bases “T” or “C”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 29 and 30. In cassette 7, QTL 15 is homozygous for allele T (SEQ ID NO 29).SEQ ID NO 29 (SNP base bold):TTGCAGGAGACAAAAAGAAACTTTAGACCCAACCAACCCACTAAGAGATTTAGAAG TAAG T TATCTGTCTTTGAACTTAATGTTTTTAGATCCATGTAGTCAAACTCAAGGTA GTCAAACTSEQ ID NO 30 (SNP base bold):TTGCAGGAGACAAAAAGAAACTTTAGACCCAACCAACCCACTAAGAGATTTAGAAG TAAG C TATCTGTCTTTGAACTTAATGTTTTTAGATCCATGTAGTCAAACTCAAGGTA GTCAAACT

[0053] QTL 16, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 82642395 on pea chromosome 3. The two alleles of the genetic marker at QTL 16 have the SNP bases “C” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 31 and 32. In cassette 6, QTL 16 is homozygous for allele C (SEQ ID NO 31).SEQ ID NO 31 (SNP base bold):TTCAACAATATGACCCCGACGTACTACAATCTCAATGGCTCGTGAACCAGGTTCAGA AAT C TCACCAGCCATTTTGCGTGAGGCTTTATCTATCTTGATGAATTCACGAAACAT CTCCACTSEQ ID NO 32 (SNP base bold):TTCAACAATATGACCCCGACGTACTACAATCTCAATGGCTCGTGAACCAGGTTCAGA AAT T TCACCAGCCATTTTGCGTGAGGCTTTATCTATCTTGATGAATTCACGAAACAT CTCCACT

[0054] QTL 17, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 268444221 on pea chromosome 1. The two alleles of the genetic marker at QTL 17 have the SNP bases “G” or “A”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 33 and 34. In cassette 6, QTL 17 is homozygous for allele G (SEQ ID NO 33).SEQ ID NO 33 (SNP base bold):CTTAAAGGACATGTTCGGCACCCCAAACGACTGTGAACTAATATCAGCGGTTGAAAG CTC G GTTTCAATGTCTCTTGGAGCACCACCGTAATTTGACAACAAGTTTTGAAGATC TTTTTGASEQ ID NO 34 (SNP base bold):CTTAAAGGACATGTTCGGCACCCCAAACGACTGTGAACTAATATCAGCGGTTGAAAG CTC A GTTTCAATGTCTCTTGGAGCACCACCGTAATTTGACAACAAGTTTTGAAGATC TTTTTGA

[0055] QTL 18, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 5723089 on pea chromosome 2. The two alleles of the genetic marker at QTL 18 have the SNP bases “T” or “G”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 35 and 36. In cassette 6, QTL 18 is homozygous for allele T (SEQ ID NO 35).SEQ ID NO 35 (SNP base bold):AAAATAGGAAACTGCCTGTGGAGACACAGGTATATTGCTCTGTAGAGGTGGGGTTG GGCT T GGGGACACCGCCTGTGAACTTGCAGTCTGTAATGTTGAAAGAATTGCAGAG ATATTAGGGSEQ ID NO 36 (SNP base bold):AAAATAGGAAACTGCCTGTGGAGACACAGGTATATTGCTCTGTAGAGGTGGGGTTG GGCT G GGGGACACCGCCTGTGAACTTGCAGTCTGTAATGTTGAAAGAATTGCAGAG ATATTAGGG

[0056] QTL 19, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 310787199 on pea chromosome 7. The two alleles of the genetic marker at QTL 19 have the SNP bases “C” or “T”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 37 and 38. In cassette 5, QTL 19 is homozygous for allele C (SEQ ID NO 37).SEQ ID NO 37 (SNP base bold):AAGTTGCTGCTTCAAATGTACTTCACATATACAAGCATTTAAAACGACAAGAAAACT CAA C AGATAGTAATTTTGTCTACTGAATGTTTAGGCTCTCTTCATTAGTACAACCAT TATCACCSEQ ID NO 38 (SNP base bold):AAGTTGCTGCTTCAAATGTACTTCACATATACAAGCATTTAAAACGACAAGAAAACT CAA T AGATAGTAATTTTGTCTACTGAATGTTTAGGCTCTCTTCATTAGTACAACCAT TATCACC

[0057] QTL 20, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 6738374 on pea chromosome 2. The two alleles of the genetic marker at QTL 20 have the SNP bases “A” or “G”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 39 and 40. In cassettes 9 and 10, QTL 20 is homozygous for allele A (SEQ ID NO 39).SEQ ID NO 39 (SNP base bold):TATTGTGCTTGATGTGCTGTTGATTTTTCCTGACCTTTTGGAAAGAGGGTTTAATCCA AA A GGTGGGATTGGGTTGGATTTGTTGATGAGTTTGGATAGCACTGTGTTTTTGTTC CTGTTGSEQ ID NO 40 (SNP base bold):TATTGTGCTTGATGTGCTGTTGATTTTTCCTGACCTTTTGGAAAGAGGGTTTAATCCAAA G GGTGGGATTGGGTTGGATTTGTTGATGAGTTTGGATAGCACTGTGTTTTTGTTC CTGTTG

[0058] QTL 21, as used herein, refers to a polymorphic genetic locus linked to a genetic marker at position 125331766 on pea chromosome 4. The two alleles of the genetic marker at QTL 21 have the SNP bases “A” or “G”, as set forth respectively in the nucleic acid sequences of SEQ ID NOs 41 and 42. In cassette 8, QTL 21 is homozygous for allele A (SEQ ID NO 41).SEQ ID NO 41 (SNP base bold):ACAATATTGTGATGATAATGGAGCATATGTGGTGGTGACAGACTATGGTGAGGGAGATAG A ACTGATTTCATATTGAGTCCACGTGCCTTTTCAAGATTGGGGCGCAATGCAG TTACATCASEQ ID NO 42 (SNP base bold):ACAATATTGTGATGATAATGGAGCATATGTGGTGGTGACAGACTATGGTGAGGGAG ATAG G ACTGATTTCATATTGAGTCCACGTGCCTTTTCAAGATTGGGGCGCAATGCA GTTACATCA

[0059] Pea plants or part(s) thereof, as well as products such as commodity whole or split grains, pea protein concentrates (PPC), dairy analogues or protein-fortified beverages and meat analogues or texturized pea protein prepared therefrom, which have high protein content, low fat content andneutral taste are provided. The pea plans, part(s) and products are characterized by specific sets of nucleic acid genetic markers that correspond to identified quantitative trait loci (QTLs) related to specific phenotypic traits. In various embodiments, the phenotypic traits may comprise a high protein content of the seeds of at least 29% (weight %, dry matter base - DB), a low fat content of the seeds of at most 2% (weight %), and a neutral taste characterized by moderate to very mild off flavors in a qualitative tasting test and associated with reduced level of volatile compounds associated with off flavors. Phenotypic and genotypic analysis of many pea varieties was performed to derive the markers for these phenotypic traits, and a breeding simulation was used to identify the most common and most stable markers. Following verification of trait stability over several generations, markers and marker cassettes were defined as being uniquely present in the developed pea lines. The resulting pea lines can be used to provide products with pea-based protein and low or no off flavors, possibly without requiring additional chemical or biological processing. In various embodiments, the plants may be hybrids and / or the plant parts may comprise any of: a seed, an endosperm, an ovule, pollen, cell, cell culture, tissue culture, plant organ, protoplast, meristem, embryo, or a combination thereof.

[0060] In certain embodiments, the QTLs and markers associated therewith comprise at least three QTLs and corresponding markers, of at least one of the following cassettes: (i) cassette 1 comprising: the QTL and marker associated with the increased yield trait comprise QTL 1 with corresponding markers set forth in Seq. IDs 1 or 2, and the pea plant or part thereof is homozygous with respect to Seq. ID 1 or heterozygous at QTL 1 , the QTL and marker associated with the low fat content trait comprise QTL 2 with corresponding markers set forth in Seq. IDs 3 or 4, and the pea plant or part thereof is homozygous with respect to Seq. ID 3 or heterozygous at QTL 2, and the QTL and marker associated with the increased yield trait comprise QTL 3 with corresponding markers set forth in Seq. IDs 5 or 6, and the pea plant or part thereof is homozygous with respect to Seq. ID 5 or heterozygous at QTL 3; (ii) at least one of cassettes 2, 3, 4, 8, 9 or 10 comprising the QTL and marker associated with the neutral taste trait comprise QTL 4 with corresponding markers set forth in Seq. IDs 7 or 8, and the pea plant or part thereof is homozygous with respect to Seq. ID 7 or heterozygous at QTL 4; and / or (iii) at least one of cassettes 5-10 comprising the QTL and marker associated with the neutral taste trait comprise QTL 13 with corresponding markers set forth in Seq. IDs 25 or 26, and the pea plant or part thereof is homozygous with respect to Seq. ID 25 or heterozygous at QTL 13.

[0061] For example, in certain embodiments, the pea plant(s) or part(s) thereof may comprise the QTLs and corresponding markers of cassette 1.

[0062] In certain embodiments, the pea plant(s) or part(s) thereof may comprise the QTLs and corresponding markers of at least one of cassettes 2, 3, 4, 8, 9 or 10, e.g., comprising QTL 4 as described herein.

[0063] For example, the QTLs and corresponding markers may comprise cassette 2 that further comprises: the QTL and marker associated with the neutral taste trait comprise QTL 6 with corresponding markers set forth in Seq. IDs 11 or 12, and the pea plant or part thereof is homozygous with respect to Seq. ID 11 or heterozygous at QTL 6, the QTL and marker associated with the neutral taste trait comprise QTL 11 with corresponding markers set forth in Seq. IDs 21 or 22, and the pea plant or part thereof is homozygous with respect to Seq. ID 21 or heterozygous at QTL 11, and the QTL and marker associated with the neutral taste trait comprise QTL 12 with corresponding markers set forth in Seq. IDs 23 or 23, and the pea plant or part thereof is homozygous with respect to Seq. ID 23 or heterozygous at QTL 12

[0064] For example, the QTLs and corresponding markers may comprise cassette 3 that further comprises the QTL and marker associated with the neutral taste trait comprise QTL 9 with corresponding markers set forth in Seq. IDs 17 or 18, and the pea plant or part thereof is homozygous with respect to Seq. ID 17 or heterozygous at QTL 9, and the QTL and marker associated with the neutral taste trait comprise QTL 10 with corresponding markers set forth in Seq. IDs 19 or 20, and the pea plant or part thereof is homozygous with respect to Seq. ID 19 or heterozygous at QTL 10.

[0065] For example, the QTLs and corresponding markers may comprise cassette 4 that further comprises the QTL and marker associated with the high protein trait comprise QTL 5 with corresponding markers set forth in Seq. IDs 9 or 10, and the pea plant or part thereof is homozygous with respect to Seq. ID 9 or heterozygous at QTL 5, the QTL and marker associated with the neutral taste trait comprise QTL 7 with corresponding markers set forth in Seq. IDs 13 or 14, and the pea plant or part thereof is homozygous with respect to Seq. ID 13 or heterozygous at QTL 7, and the QTL and marker associated with the neutral taste trait comprise QTL 8 with corresponding markers set forth in Seq. IDs 15 or 16, and the pea plant or part thereof is homozygous with respect to Seq. ID 15 or heterozygous at QTL 8.

[0066] For example, the QTLs and corresponding markers may comprise cassette 8 that further comprises the QTL and marker associated with the high yield trait comprise QTL 5 withcorresponding markers set forth in Seq. IDs 9 or 10, and the pea plant or part thereof is homozygous with respect to Seq. ID 10 or heterozygous at QTL 5, the QTL and marker associated with the neutral taste trait comprise QTL 13 with corresponding markers set forth in Seq. IDs 25 or 26, and the pea plant or part thereof is homozygous with respect to Seq. ID 25 or heterozygous at QTL 13, and the QTL and marker associated with the neutral taste trait comprise QTL 21 with corresponding markers set forth in Seq. IDs 41 or 42, and the pea plant or part thereof is homozygous with respect to Seq. ID 41 or heterozygous at QTL 21.

[0067] For example, the QTLs and corresponding markers may comprise cassette 9 that further comprises the QTL and marker associated with the neutral taste trait comprise QTL 13 with corresponding markers set forth in Seq. IDs 25 or 26, and the pea plant or part thereof is homozygous with respect to Seq. ID 25 or heterozygous at QTL 13, the QTL and marker associated with the high protein trait comprise QTL 14 with corresponding markers set forth in Seq. IDs 27 or 28, and the pea plant or part thereof is homozygous with respect to Seq. ID 27 or heterozygous at QTL 14, and the QTL and marker associated with the high protein and the high yield traits comprise QTL 20 with corresponding markers set forth in Seq. IDs 39 or 40, and the pea plant or part thereof is homozygous with respect to Seq. ID 39 or heterozygous at QTL 20.

[0068] For example, the QTLs and corresponding markers may comprise cassette 10 that further comprises the QTL and marker associated with the neutral taste trait comprise QTL 6 with corresponding markers set forth in Seq. IDs 11 or 12, and the pea plant or part thereof is homozygous with respect to Seq. ID 11 or heterozygous at QTL 6, the QTL and marker associated with the neutral taste trait comprise QTL 13 with corresponding markers set forth in Seq. IDs 25 or 26, and the pea plant or part thereof is homozygous with respect to Seq. ID 25 or heterozygous at QTL 13, and the QTL and marker associated with the high protein and the high yield traits comprise QTL 20 with corresponding markers set forth in Seq. IDs 39 or 40, and the pea plant or part thereof is homozygous with respect to Seq. ID 39 or heterozygous at QTL 20.

[0069] In certain embodiments, the pea plant(s) or part(s) thereof may comprise the QTLs and corresponding markers of at least one of cassettes 5-10, e.g., comprising QTL 13 as described herein.

[0070] For example, the QTLs and corresponding markers may comprise cassette 5 that further comprises the QTL and marker associated with the high yield trait comprise QTL 5 with corresponding markers set forth in Seq. IDs 9 or 10, and the pea plant or part thereof is homozygous with respect to Seq. ID 10 or heterozygous at QTL 5, and the QTL and marker associated with thehigh protein trait comprise QTL 19 with corresponding markers set forth in Seq. IDs 37 or 38, and the pea plant or part thereof is homozygous with respect to Seq. ID 37 or heterozygous at QTL 19.

[0071] For example, the QTLs and corresponding markers may comprise cassette 6 that further comprises the QTL and marker associated with the neutral taste trait comprise QTL 16 with corresponding markers set forth in Seq. IDs 31 or 32, and the pea plant or part thereof is homozygous with respect to Seq. ID 31 or heterozygous at QTL 16, the QTL and marker associated with the high yield trait comprise QTL 17 with corresponding markers set forth in Seq. IDs 33 or 34, and the pea plant or part thereof is homozygous with respect to Seq. ID 33 or heterozygous at QTL 17, and the QTL and marker associated with the neutral taste trait comprise QTL 18 with corresponding markers set forth in Seq. IDs 35 or 36, and the pea plant or part thereof is homozygous with respect to Seq. ID 35 or heterozygous at QTL 18.

[0072] For example, the QTLs and corresponding markers may comprise cassette 7 that further comprises the QTL and marker associated with the high protein trait comprise QTL 14 with corresponding markers set forth in Seq. IDs 27 or 28, and the pea plant or part thereof is homozygous with respect to Seq. ID 27 or heterozygous at QTL 14, and the QTL and marker associated with the neutral taste trait comprise QTL 15 with corresponding markers set forth in Seq. IDs 29 or 30, and the pea plant or part thereof is homozygous with respect to Seq. ID 29 or heterozygous at QTL 15.

[0073] In various embodiments, commodity whole or split grains of the pea plants, pea protein concentrate (PPC) prepared from seeds of the pea plants, as well as dairy analogues, protein- fortified beverages, meat analogues or texturized pea protein comprising the PPC may comprise 29% w / w DB or more protein (dry base) and 2% w / w DB or less fat and have a neutral taste characterized by moderate to very mild off flavors in a qualitative tasting test and associated with reduced level of volatile compounds associated with off flavors.

[0074] Figure 3 is a high-level schematic illustration of a computationally supported breeding method 200, according to some embodiments of the invention. Method 200 may be at least partially implemented by at least one computer processor; computationally supported breeding method 200 is used to detect and combine QTLs from a plurality of pea varieties to develop the disclosed pea plants which are different than any of the parent varieties by virtue of the achieved phenotypical characteristics.

[0075] Computationally supported breeding method 200 comprises stages of trait discovery by growing and phenotyping a broad spectrum of varieties (stage 210), trait blending by developinghybridized lines through crossing the selected lines to mix and combine traits (stage 220) and selfing of the progeny in subsequent generations (stage 225), Target Product Genomic Code (TPGC) discovery by associating phenotypes and genotypes using derived linkage maps (stage 230), in silico selection (and validation) to suggest candidate varieties (stage 240), breeding candidate varieties (stage 250) and selecting varieties based on the best TPGC potential (stage 260), as explained in detail below. TPGC discovery (stage 230) and in silico selection and validation (stage 240) are based on computational algorithms that cannot be performed manually and provide the computational support for the judicious selection of the varieties that are generated and further crossed during the development process to yield disclosed pea plants. It is noted that during the discovery phase, the QTLs are derived in order to combine them (by hybridization) to create unique combinations of QTLs which do not exist in known world lines.

[0076] In certain embodiments, pea lines were bred to reach neutral taste (in addition to high protein content and low-fat content) by collecting various pea lines worldwide, creating F2 breeding populations, applying intensive phenotyping and genotyping of thousands of pea plants, predicting of QTLs that affect the taste and other phenotypical traits, and establishing unique QTL marker combinations, termed “marker cassettes” herein, to characterize novel lines provided by the methods described herein and not existing in commercial or natural lines.

[0077] The breeding methodology was based on algorithms for deriving the Target Product Genomic Code (TPGC) to associate (i) the Target Product (TP) being defined in advance based on market requirements and including a set of desired attributes (traits) that are available in natural genetic variations; and (ii) the Genomic Code (GC) comprising set(s) of genomic regions that include quantitative trait loci (QTLs) that affect and are linked to the TP traits. The algorithms may be configured to calculate multiple genomic interactions and to maximize the genomic potential of specific pea plants for the development of new pea varieties. The breeding program was constructed to derive the TPGC, and then by selfing, and optionally crossing, to achieve a pea product which contains the specific GC that corresponds to the required TPs.

[0078] Certain embodiments of the breeding process of developing lines, through crossing and successive generations of selfing comprise stages such as: (i) Trait Discovery, in which a broad spectrum of pea varieties from different geographies and worldwide sources are grown and phenotyped in order to identify new traits that can potentially be combined to create new pea varieties; (ii) Trait Blend, in which a crossing cycle is carried out based on phenotypic assumption(s), in which the different traits are mixed and combined. Initial trait cycle(s) arefollowed by additional cycle(s) to create F2 (and possibly higher generations) breeding population(s) that provide the basis for algorithmic analysis for constructing the TPGC; (iii) TPGC Discovery, in which the breeding populations of pea plant(s) are phenotyped and genotyped to produce linkage map(s), discover relevant QTLs and derive the TPGC; (iv) Trait TPGC Blend, in which accurate crossings are performed in order to calculate the most efficient way to reach the best TPGC. The crossings are performed after in silico selection and are based, at least in part, on phenotype assumptions, and (v) Consecutive algorithm-based GC discovery stage(s) applied to F2 (or higher generation) population(s) grown in additional cycle(s).

[0079] Defining the TP for high (or modified) protein and / or low fat pea varieties with neutral taste includes the development of high throughput methods for identifying high (or modified) protein and / or low fat level as well as neutral taste traits.

[0080] In the following non-limiting example of the breeding process, Trait Discovery (i) was based on proprietary germplasm including hundreds of elite varieties and 761 different pea lines that were obtained from the Germplasm Resources Information Network (GRIN) and the Israel Gene Bank (IGB). These lines were used for the Trait Blend stage (ii), with crosses executed based on the potential for enrichment of genomic diversity to create new complex(es) of traits for the high (or modified) protein and / or low fat level, as well as neutral taste - as the initial step for the TP-directed breeding program for high (or modified) protein and / or low fat neutrally -tasting pea lines. The resulting Fl hybrids were later self-crossed to create F2 breeding populations that showed phenotypic segregation. The F2 populations were then planted in two different environments for discovering the TPGC (iii) that includes high (or modified) protein, low fat and / or neutral taste traits. After screening and deep phenotyping of 3318 individuals from 11 populations, a set of ca. 400 representatives was selected. The selected individuals from the F2 populations were further massively phenotyped for traits associated with high (or modified) protein, low fat and / or neutral taste, as detailed in the following description. The measurement results were summarized into the representative high (or modified) protein, low fat and / or neutral taste traits.

[0081] TPGC Discovery (iii) included genotyping ca. 2900 selected individual pea plants from 8 populations. The analysis was performed with a panel of 600 markers based on single nucleotide polymorphisms (SNP) and directly designed based on the polymorphism found in the parental lines of the populations which were analyzed in depth using high throughput DNA sequencing technologies. The panel was designed to maximize the chance to have the largest number of common segregating SNPs in order to create highly similar linkage maps for all observedpopulations. The computation of linkage maps was executed on each linkage F2 population based on the genotyping results. Linkage maps were computed with ASMap package (Julian Taylor, David Butler (2017). R Package ASMap: Efficient Genetic Linkage Map Construction and Diagnosis. Journal of Statistical Software, 79(6), 1-29. doi: 10.18637 / jss.v079.i06), which runs in the R statistical environment (R Core Team (2023). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. URL https: / / www.R- project.org / .). Discovery of QTLs that are related to high (or modified) protein, low fat and / or neutral taste traits was carried out with the R / qtl package (Broman et al. (2003) R / qtl: QTL mapping in experimental crosses. Bioinformatics 19:889-890 doi: 10.1093 / bioinformatics / btgl l2), based on the linkage maps and the F2 population phenotype data, and using the interval mapping algorithm (IM). The significance and co-occurrences of the markers for high protein level and protein content, low fat content and neutral taste traits were evaluated using an algorithm that related the genotypephase of each marker to respective QTLs and phenotypic traits in linkage maps of the eight F2 populations (also called “linkage F2 populations” herein) in each population, for populations in different environments. QTL significance was computed with permutation, bootstrap tools and FDR (false discovery rate) for total analysis. The linkage maps of all eight F2 populations and the information of the high (or modified) protein, low fat and / or neutral taste traits over all genotyped plants belonging to those populations were analyzed and used to predict the QTLs in a “one trait to one marker” model, in which for all markers that constructed the linkage maps, each trait was tested independently against each one of the markers. In the provided examples, altogether 21 markers were found to be related to traits associated with high (or modified) protein, low fat and / or neutral taste components (see Table 1 above). The occurrence of some high (or modified) protein, low fat and / or neutral taste traits in two or more linkage maps of the F2 population (repetitive markers) strengthened its significance as representative for QTLs for these traits.

[0082] In general, the eight linkage F2 populations presented different markers that related to high (or modified) protein, low fat and / or seed color. However, subsets of common markers were found to be shared by multiple populations and are referred to herein as marker cassettes.

[0083] It is emphasized that the breeding process is explained using non-limiting examples from a specific part of the breeding program, and is not limited to the specific populations and varieties derived by this specific part of the breeding program. For example, different F2 population may be bred and used to derive additional varieties that are characterized by one or more of the disclosed QTLs.

[0084] Following TPGC Discovery (iii), an in-silico breeding program (iv) was established to process the TPGC blend (including combinations of QTLs for different plants) to simulate and predict the genotypic states of self, cross-self and hybrid plant with respect to the QTLs and their predicted effects on each phase of the markers for the high (or modified) protein, low fat and / or neutral taste traits. The in-silico breeding program was constructed to yield millions of in silico selfing combinations which were bred and evaluated in-silico up to F4 to measure the potential for each of the genotyped plants to acquire the high (or modified) protein and / or low fat level in the right combination at the right phase. The analysis resulted in identifying ca. 393 F2 plants having the highest score for high (or modified) protein, low fat and / or seed color, which were then chosen for the actual selfing and cross-selfing procedures. The F3 seeds from these selected F2 plants were sown in plots in the subsequent growing season. Under this procedure, QTLs from different populations were combined to yield F3 plants containing new and unique cassettes of QTLs and resulting in high (or modified) protein, low fat and / or neutral taste.

[0085] The high (or modified) protein, low fat and / or neutral tasting pea lines were then validated as retaining the traits in the following generations by genotyping the F3 and some subsequent generation offspring to verify they maintained the identified marker cassettes. Specifically, the parental lines of linkage F2 populations together with 3108 different pea cultivars (landraces and old commercial varieties) were genotyped based on markers for the high (or modified) protein, low fat and / or neutral taste traits of all populations. The cassettes detailed in Table 1 were found to wholly differentiate the developed high (or modified) protein, low fat and / or neutral taste lines from the rest of the pea cultivars screened.

[0086] The inventors note that none of high (or modified) protein, low fat and / or neutral taste plants that were bred according to the methods described herein is naturally occurring; indeed, they were derived by highly complicated computationally-supported breeding methods 200 described above, in which the genotypes of multiple pea varieties were judiciously combined and analyzed, to discover and accumulate the recited QTL markers and corresponding phenotypic traits. Although the recited pea plants are not genetically modified by sequences originating from other species, they cannot be reached merely by natural processes, as is evident by the detailed and intentional breeding program that was applied to specifically measure required characteristics, detect corresponding markers using bioinformatics methods and combine the detected QTLs in the selected varieties by classic breeding approaches. The inventors note that due to the huge complexity of the breeding program, involving growing, selecting and breeding of hundreds ofvarieties over many generations in the field, and based on genetic analysis of the varieties and of the relations of QTL markers to phenotypic characteristics, this breeding process cannot happen merely by natural means and therefore cannot be considered a natural phenomenon. It is further noted that while the disclosed QTL markers are not heterologous to pea as a species, the identified QTLs are not present in the recited combinations in any of over 3108 landraces and old commercial varieties which were used as initial breeding stock, and that the QTL genomics of the pea plants has been significantly and judiciously modified by the breeding program. Therefore, at the taxonomic level of the pea varieties, the high (or modified) protein, low fat and / or neutrally tasting plants may be considered hybridized in that the QTL markers are mixed and introduced from other pea varieties.

[0087] In the above description, an embodiment is an example or implementation of the invention. The various appearances of "one embodiment”, "an embodiment", "certain embodiments" or "some embodiments" do not necessarily all refer to the same embodiments. Although various features of the invention may be described in the context of a single embodiment, the features may also be provided separately or in any suitable combination. Conversely, although the invention may be described herein in the context of separate embodiments for clarity, the invention may also be implemented in a single embodiment. Certain embodiments of the invention may include features from different embodiments disclosed above, and certain embodiments may incorporate elements from other embodiments disclosed above. The disclosure of elements of the invention in the context of a specific embodiment is not to be taken as limiting their use in the specific embodiment alone. Furthermore, it is to be understood that the invention can be carried out or practiced in various ways and that the invention can be implemented in certain embodiments other than the ones outlined in the description above.

[0088] The invention is not limited to those diagrams or to the corresponding descriptions. For example, flow need not move through each illustrated box or state, or in exactly the same order as illustrated and described. Meanings of technical and scientific terms used herein are to be commonly understood as by one of ordinary skill in the art to which the invention belongs, unless otherwise defined. While the invention has been described with respect to a limited number of embodiments, these should not be construed as limitations on the scope of the invention, but rather as exemplifications of some of the preferred embodiments. Other possible variations, modifications, and applications are also within the scope of the invention. Accordingly, the scopeof the invention should not be limited by what has thus far been described, but by the appended claims and their legal equivalents.

Claims

CLAIMSWhat is claimed is:

1. A pea plant or a part thereof that has high protein content, low fat content and neutral taste, the pea plant comprising: a plurality of loci associated with a corresponding plurality quantitative trait loci (QTLs) having a corresponding plurality of nucleic acid genetic markers that are associated with a plurality of phenotypic traits of the pea plant, the phenotypic traits including high yield, high protein, low fat and neutral taste traits, wherein: the phenotypic traits comprise a high protein content of the seeds of at least 29% w / w dry base, a low fat content of the seeds of at most 2% w / w dry base, and the neutral taste characterized by moderate to very mild off flavors in a qualitative tasting test and associated with reduced level of volatile compounds associated with off flavors, the plurality of QTLs and corresponding markers comprise at least three QTLs and corresponding markers, of at least one of the following cassettes: cassette 1 comprising: the QTL and marker associated with the increased yield trait comprise QTL 1 with corresponding markers set forth in Seq. IDs 1 or 2, and the pea plant or part thereof is homozygous with respect to Seq. ID 1 or heterozygous at QTL 1 , the QTL and marker associated with the low fat content trait comprise QTL 2 with corresponding markers set forth in Seq. IDs 3 or 4, and the pea plant or part thereof is homozygous with respect to Seq. ID 3 or heterozygous at QTL 2, and the QTL and marker associated with the increased yield trait and with a neutral taste trait comprise QTL 3 with corresponding markers set forth in Seq. IDs 5 or 6, and the pea plant or part thereof is homozygous with respect to Seq. ID 5 or heterozygous at QTL 3; at least one of cassettes 2, 3, 4, 8, 9 or 10 comprising the QTL and marker associated with the neutral taste trait comprise QTL 4 with corresponding markers set forth in Seq. IDs 7 or 8, and the pea plant or part thereof is homozygous with respect to Seq. ID 7 or heterozygous at QTL 4; and / or at least one of cassettes 5-10 comprising the QTL and marker associated with the neutral taste trait comprise QTL 13 with corresponding markers set forth in Seq. IDs 25 or 26, and the pea plant or part thereof is homozygous with respect to Seq. ID 25 or heterozygous at QTL 13.

2. The pea plant or a part thereof of claim 1, comprising the plurality of QTLs and corresponding markers of cassette 1.

3. The pea plant or a part thereof of claim 1 or 2, comprising the plurality of QTLs and corresponding markers of at least one of cassettes 2, 3, 4, 8, 9 or 10.

4. The pea plant or a part thereof of claim 3, comprising the plurality of QTLs and corresponding markers of cassette 2, further comprising: the QTL and marker associated with the neutral taste trait comprise QTL 6 with corresponding markers set forth in Seq. IDs 11 or 12, and the pea plant or part thereof is homozygous with respect to Seq. ID 11 or heterozygous at QTL 6, the QTL and marker associated with the neutral taste trait comprise QTL 11 with corresponding markers set forth in Seq. IDs 21 or 22, and the pea plant or part thereof is homozygous with respect to Seq. ID 21 or heterozygous at QTL 11 , and the QTL and marker associated with the neutral taste trait comprise QTL 12 with corresponding markers set forth in Seq. IDs 23 or 23, and the pea plant or part thereof is homozygous with respect to Seq. ID 23 or heterozygous at QTL 12.

5. The pea plant or a part thereof of claim 3 or 4, comprising the plurality of QTLs and corresponding markers of cassette 3, further comprising: the QTL and marker associated with the neutral taste trait comprise QTL 9 with corresponding markers set forth in Seq. IDs 17 or 18, and the pea plant or part thereof is homozygous with respect to Seq. ID 17 or heterozygous at QTL 9, and the QTL and marker associated with the neutral taste trait comprise QTL 10 with corresponding markers set forth in Seq. IDs 19 or 20, and the pea plant or part thereof is homozygous with respect to Seq. ID 19 or heterozygous at QTL 10.

6. The pea plant or a part thereof of any one of claims 3-5, comprising the plurality of QTLs and corresponding markers of cassette 4, further comprising: the QTL and marker associated with the high protein trait comprise QTL 5 with corresponding markers set forth in Seq. IDs 9 or 10, and the pea plant or part thereof is homozygous with respect to Seq. ID 9 or heterozygous at QTL 5, the QTL and marker associated with the neutral taste trait comprise QTL 7 with corresponding markers set forth in Seq. IDs 13 or 14, and the pea plant or part thereof is homozygous with respect to Seq. ID 13 or heterozygous at QTL 7, andthe QTL and marker associated with the neutral taste trait comprise QTL 8 with corresponding markers set forth in Seq. IDs 15 or 16, and the pea plant or part thereof is homozygous with respect to Seq. ID 15 or heterozygous at QTL 8.

7. The pea plant or a part thereof of any one of claims 3-5, comprising the plurality of QTLs and corresponding markers of cassette 8, further comprising: the QTL and marker associated with the high yield trait comprise QTL 5 with corresponding markers set forth in Seq. IDs 9 or 10, and the pea plant or part thereof is homozygous with respect to Seq. ID 10 or heterozygous at QTL 5, the QTL and marker associated with the neutral taste trait comprise QTL 13 with corresponding markers set forth in Seq. IDs 25 or 26, and the pea plant or part thereof is homozygous with respect to Seq. ID 25 or heterozygous at QTL 13, and the QTL and marker associated with the neutral taste trait comprise QTL 21 with corresponding markers set forth in Seq. IDs 41 or 42, and the pea plant or part thereof is homozygous with respect to Seq. ID 41 or heterozygous at QTL 21.

8. The pea plant or a part thereof of any one of claims 3-7, comprising the plurality of QTLs and corresponding markers of cassette 9, further comprising: the QTL and marker associated with the neutral taste trait comprise QTL 13 with corresponding markers set forth in Seq. IDs 25 or 26, and the pea plant or part thereof is homozygous with respect to Seq. ID 25 or heterozygous at QTL 13, the QTL and marker associated with the high protein trait comprise QTL 14 with corresponding markers set forth in Seq. IDs 27 or 28, and the pea plant or part thereof is homozygous with respect to Seq. ID 27 or heterozygous at QTL 14, and the QTL and marker associated with the high protein and the high yield traits comprise QTL 20 with corresponding markers set forth in Seq. IDs 39 or 40, and the pea plant or part thereof is homozygous with respect to Seq. ID 39 or heterozygous at QTL 20.

9. The pea plant or a part thereof of any one of claims 3-8, comprising the plurality of QTLs and corresponding markers of cassette 10, further comprising: the QTL and marker associated with the neutral taste trait comprise QTL 6 with corresponding markers set forth in Seq. IDs 11 or 12, and the pea plant or part thereof is homozygous with respect to Seq. ID 11 or heterozygous at QTL 6,the QTL and marker associated with the neutral taste trait comprise QTL 13 with corresponding markers set forth in Seq. IDs 25 or 26, and the pea plant or part thereof is homozygous with respect to Seq. ID 25 or heterozygous at QTL 13, and the QTL and marker associated with the high protein and the high yield traits comprise QTL 20 with corresponding markers set forth in Seq. IDs 39 or 40, and the pea plant or part thereof is homozygous with respect to Seq. ID 39 or heterozygous at QTL 20.

10. The pea plant or a part thereof of claim 1 or 2, comprising the plurality of QTLs and corresponding markers of at least one of cassettes 5-10.

11. The pea plant or a part thereof of claim 10, comprising the plurality of QTLs and corresponding markers of cassette 5, further comprising: the QTL and marker associated with the high yield trait comprise QTL 5 with corresponding markers set forth in Seq. IDs 9 or 10, and the pea plant or part thereof is homozygous with respect to Seq. ID 10 or heterozygous at QTL 5, and the QTL and marker associated with the high protein trait comprise QTL 19 with corresponding markers set forth in Seq. IDs 37 or 38, and the pea plant or part thereof is homozygous with respect to Seq. ID 37 or heterozygous at QTL 19.

12. The pea plant or a part thereof of claim 10 or 11, comprising the plurality of QTLs and corresponding markers of cassette 6, further comprising: the QTL and marker associated with the neutral taste trait comprise QTL 16 with corresponding markers set forth in Seq. IDs 31 or 32, and the pea plant or part thereof is homozygous with respect to Seq. ID 31 or heterozygous at QTL 16, the QTL and marker associated with the high yield trait comprise QTL 17 with corresponding markers set forth in Seq. IDs 33 or 34, and the pea plant or part thereof is homozygous with respect to Seq. ID 33 or heterozygous at QTL 17, and the QTL and marker associated with the neutral taste trait comprise QTL 18 with corresponding markers set forth in Seq. IDs 35 or 36, and the pea plant or part thereof is homozygous with respect to Seq. ID 35 or heterozygous at QTL 18.

13. The pea plant or a part thereof of any one of claims 10-12, comprising the plurality of QTLs and corresponding markers of cassette 7, further comprising: the QTL and marker associated with the high protein trait comprise QTL 14 with corresponding markers set forth in Seq. IDs 27 or 28, and the pea plant or part thereof is homozygous with respect to Seq. ID 27 or heterozygous at QTL 14, andthe QTL and marker associated with the neutral taste trait comprise QTL 15 with corresponding markers set forth in Seq. IDs 29 or 30, and the pea plant or part thereof is homozygous with respect to Seq. ID 29 or heterozygous at QTL 15.

14. Commodity whole or split grains of the pea plants of any one of claims 1-13, comprising 29% w / w or more protein (dry base) and 2% w / w or less fat (dry base) and neutral taste characterized by moderate to very mild off flavors in a qualitative tasting test and associated with reduced level of volatile compounds associated with off flavors.

15. Pea protein concentrate (PPC) prepared from seeds of the pea plants of any one of claims 1-13, comprising 29% w / w or more protein (dry base) and 2% w / w or less fat (dry base) and neutral taste characterized by moderate to very mild off flavors in a qualitative tasting test and associated with reduced level of volatile compounds associated with off flavors.

16. A dairy analogue or protein-fortified beverage comprising the PPC of claim 15 and being taste neutral characterized by moderate to very mild off flavors in a qualitative tasting test and associated with reduced level of volatile compounds associated with off flavors.

17. A meat analogue or texturized pea protein comprising the PPC of claim 15 and being taste neutral characterized by moderate to very mild off flavors in a qualitative tasting test and associated with reduced level of volatile compounds associated with off flavors.

Images